Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

Science.gov (United States)

Dimitrov, Valentin V.

2009-01-01

This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

Charge transport in polyguanine-polycytosine DNA molecules

International Nuclear Information System (INIS)

Wei, J H; Chan, K S

2007-01-01

A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

DNA-Based Single-Molecule Electronics: From Concept to Function

Science.gov (United States)

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

DNA-Based Single-Molecule Electronics: From Concept to Function.

Science.gov (United States)

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

International Nuclear Information System (INIS)

Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

2009-01-01

We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

Science.gov (United States)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Single Molecule Screening of Disease DNA Without Amplification

Energy Technology Data Exchange (ETDEWEB)

Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

2006-01-01

The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

DNA analysis by single molecule stretching in nanofluidic biochips

DEFF Research Database (Denmark)

Abad, E.; Juarros, A.; Retolaza, A.

2011-01-01

Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

DEFF Research Database (Denmark)

Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

2017-01-01

Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

Electron microscope autoradiography of isolated DNA molecules

International Nuclear Information System (INIS)

Delain, Etienne; Bouteille, Michel

1980-01-01

Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

Science.gov (United States)

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Thermophoretic forces on DNA measured with a single-molecule spring balance

DEFF Research Database (Denmark)

Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

2014-01-01

We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

Science.gov (United States)

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

A study of planar anchor groups for graphene-based single-molecule electronics.

Science.gov (United States)

Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

2014-02-07

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

Energy Technology Data Exchange (ETDEWEB)

Bailey, Steven; Visontai, David; Lambert, Colin J., E-mail: c.lambert@lancaster.ac.uk [Department of Physics, Lancaster University, Lancaster LA1 4YB (United Kingdom); Bryce, Martin R. [Department of Chemistry, Durham University, Durham DH1 3LE (United Kingdom); Frampton, Harry; Chappell, David [BP Exploration Operating Company Limited, Chertsey Road, Sunbury on Thames, Middlesex TW16 7BP (United Kingdom)

2014-02-07

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for –OH and –CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

Science.gov (United States)

Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

2014-02-01

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

International Nuclear Information System (INIS)

Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

2014-01-01

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for –OH and –CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

Science.gov (United States)

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Highly parallel translation of DNA sequences into small molecules.

Directory of Open Access Journals (Sweden)

Rebecca M Weisinger

Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

Developing DNA nanotechnology using single-molecule fluorescence.

Science.gov (United States)

Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

2014-06-17

CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

Science.gov (United States)

Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

2015-07-13

We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

Science.gov (United States)

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Single-molecule mechanics of protein-labelled DNA handles

Directory of Open Access Journals (Sweden)

Vivek S. Jadhav

2016-01-01

Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

International Nuclear Information System (INIS)

Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

2003-01-01

DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

International Nuclear Information System (INIS)

Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

2007-01-01

Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

How to read and write mechanical information in DNA molecules

Science.gov (United States)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

Immobilization and stretching of 5'-pyrene-terminated DNA on carbon film deposited on electron microscope grid.

Science.gov (United States)

Loukanov, Alexandre; Filipov, Chavdar; Lecheva, Marta; Emin, Saim

2015-11-01

The immobilization and stretching of randomly coiled DNA molecules on hydrophobic carbon film is a challenging microscopic technique, which possess various applications, especially for genome sequencing. In this report the pyrenyl nucleus is used as an anchor moiety to acquire higher affinity of double stranded DNA to the graphite surface. DNA and pyrene are joined through a linker composed of four aliphatic methylene groups. For the preparation of pyrene-terminated DNA a multifunctional phosphoramidite monomer compound was designed. It contains pyrenylbutoxy group as an anchor moiety for π-stacking attachment to the carbon film, 2-cyanoethyloxy, and diisopropylamino as coupling groups for conjugation to activated oligonucleotide chain or DNA molecule. This monomer derivative was suitable for incorporation into automated solid-phase DNA synthesis and was attached to the 5' terminus of the DNA chain through a phosphodiester linkage. The successful immobilization and stretching of pyrene-terminated DNA was demonstrated by conventional 100 kV transmission electron microscope. The microscopic analysis confirmed the stretched shape of the negatively charged nucleic acid pieces on the hydrophobic carbon film. © 2015 Wiley Periodicals, Inc.

Dual-Specificity Anti-HER-2/neu Antisense DNA Agents for Breast Cancer Therapy

National Research Council Canada - National Science Library

Stein, Stanley

2001-01-01

.... To achieve high avidity and specificity, we designed chimeric antisense molecules consisting of a short active DNA fused to a short "anchor" 2'-0-methyl RNA complementary to non-contiguous single...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

NARCIS (Netherlands)

Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

2009-01-01

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

DNA molecules and human therapeutics | Danquah | African Journal ...

African Journals Online (AJOL)

Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

Science.gov (United States)

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Automation of a single-DNA molecule stretching device

DEFF Research Database (Denmark)

Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

2015-01-01

We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

Science.gov (United States)

Abdalla, S; Obaid, A; Al-Marzouki, F M

2017-12-01

Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

Studying DNA looping by single-molecule FRET.

Science.gov (United States)

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

[The effect of spermine on acid-base equilibrium in DNA molecule].

Science.gov (United States)

Slonitskiĭ, S V; Kuptsov, V Iu

1990-01-01

The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

OpenAIRE

Buyukdagli, Sahin

2016-01-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

Quantifying DNA melting transitions using single-molecule force spectroscopy

International Nuclear Information System (INIS)

Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

2009-01-01

We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

Quantifying DNA melting transitions using single-molecule force spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

2009-01-21

We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

A 3D-DNA Molecule Made of PlayMais

Science.gov (United States)

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

DEFF Research Database (Denmark)

Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

2017-01-01

Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

Science.gov (United States)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

A single molecule DNA flow stretching microscope for undergraduates

NARCIS (Netherlands)

Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

2011-01-01

The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

Functionalized Nanostructures: Redox-Active Porphyrin Anchors for Supramolecular DNA Assemblies

KAUST Repository

Börjesson, Karl; Wiberg, Joanna; El-Sagheer, Afaf H.; Ljungdahl, Thomas; Må rtensson, Jerker; Brown, Tom; Nordén, Bengt; Albinsson, Bo

2010-01-01

, such as orientation, strength, homogeneity, and binding site size, was determined, suggesting that the porphyrin is well suited as a photophysical and redox-active lipid anchor, in comparison to the inert cholesterol anchor commonly used today. Furthermore

Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

Science.gov (United States)

Friedrich, Sarah; Wang, Tza-Huei

Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

Directory of Open Access Journals (Sweden)

Marijn T J van Loenhout

Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

Science.gov (United States)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

Science.gov (United States)

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

DNA replication at the single-molecule level

NARCIS (Netherlands)

Stratmann, S.A.; Oijen, A.M. van

2014-01-01

A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

International Nuclear Information System (INIS)

Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

2008-01-01

Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

Single-molecule analysis of DNA replication in Xenopus egg extracts

NARCIS (Netherlands)

Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

International Nuclear Information System (INIS)

Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

2007-01-01

We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

Science.gov (United States)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Inhibition of DNA glycosylases via small molecule purine analogs.

Directory of Open Access Journals (Sweden)

Aaron C Jacobs

Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

Real-time single-molecule observation of rolling-circle DNA replication

NARCIS (Netherlands)

Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

2009-01-01

We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

Single-strand DNA molecule translocation through nanoelectrode gaps

International Nuclear Information System (INIS)

Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

2007-01-01

Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

Spin selection at organic spinterface by anchoring group

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zhao; Qiu, Shuai; Miao, Yuan-yuan; Ren, Jun-feng; Wang, Chuan-kui [School of Physics and Electronics, Shandong Normal University, Jinan 250014 (China); Hu, Gui-chao, E-mail: hgc@sdnu.edu.cn [School of Physics and Electronics, Shandong Normal University, Jinan 250014 (China); Institute of Theoretical Physics, Technische Universität Dresden, 01062 Dresden (Germany)

2017-07-01

Highlights: • The sign of interfacial spin polarization can be selected by using different anchoring groups. • A sp{sup 3}-d or sp-d hybridization may occur and induce spin polarization when the anchoring group changes. • Interfacial spin polarization depends on both the type of the outer orbital of the anchoring atom as well as its energy. - Abstract: Control of organic interfacial spin polarization is crucial in organic spintronics. Based on ab initio theory, here we proposed a spin selection at organic interface via anchoring group by adsorbing an organic molecule onto Ni(111) surface. The results demonstrate that either a positive or negative interfacial spin polarization may be obtained by choosing different anchoring groups. The orbital analysis via the projected density of states shows that the interfacial spin polarization is sensitive to the hybridization of the outer orbital of the anchoring atom as well as its energy relative to the d orbital of the ferromagnetic atom. The work indicates a feasible way to realize spin selection at the organic spinterface by anchoring group.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

Science.gov (United States)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

Science.gov (United States)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

Directory of Open Access Journals (Sweden)

Scott S Walker

Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

Science.gov (United States)

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Direct immobilization and hybridization of DNA on group III nitride semiconductors

Energy Technology Data Exchange (ETDEWEB)

Xu Xiaobin; Jindal, Vibhu; Shahedipour-Sandvik, Fatemeh; Bergkvist, Magnus [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States); Cady, Nathaniel C. [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States)], E-mail: ncady@uamail.albany.edu

2009-03-15

A key concern for group III-nitride high electron mobility transistor (HEMT) biosensors is the anchoring of specific capture molecules onto the gate surface. To this end, a direct immobilization strategy was developed to attach single-stranded DNA (ssDNA) to AlGaN surfaces using simple printing techniques without the need for cross-linking agents or complex surface pre-functionalization procedures. Immobilized DNA molecules were stably attached to the AlGaN surfaces and were able to withstand a range of pH and ionic strength conditions. The biological activity of surface-immobilized probe DNA was also retained, as demonstrated by sequence-specific hybridization experiments. Probe hybridization with target ssDNA could be detected by PicoGreen fluorescent dye labeling with a minimum detection limit of 2 nM. These experiments demonstrate a simple and effective immobilization approach for attaching nucleic acids to AlGaN surfaces which can further be used for the development of HEMT-based DNA biosensors.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

Science.gov (United States)

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

PCR-based detection of a rare linear DNA in cell culture

Directory of Open Access Journals (Sweden)

Saveliev Sergei V.

2002-01-01

Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

PCR-based detection of a rare linear DNA in cell culture.

Science.gov (United States)

Saveliev, Sergei V.

2002-11-11

The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

Science.gov (United States)

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

Science.gov (United States)

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

Science.gov (United States)

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

OpenAIRE

Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

2018-01-01

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

Proteomic analysis of GPI-anchored membrane proteins

DEFF Research Database (Denmark)

Jung, Hye Ryung; Jensen, Ole Nørregaard

2006-01-01

Glycosyl-phosphatidyl-inositol-anchored proteins (GPI-APs) represent a subset of post-translationally modified proteins that are tethered to the outer leaflet of the plasma membrane via a C-terminal GPI anchor. GPI-APs are found in a variety of eukaryote species, from pathogenic microorganisms...... to humans. GPI-APs confer important cellular functions as receptors, enzymes and scaffolding molecules. Specific enzymes and detergent extraction methods combined with separation technologies and mass spectrometry permit proteomic analysis of GPI-APs from plasma membrane preparations to reveal cell...

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

Science.gov (United States)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

Directory of Open Access Journals (Sweden)

Eduardo JM Nascimento

2007-02-01

Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

Zwitterionic peptide anchored to conducting polymer PEDOT for the development of antifouling and ultrasensitive electrochemical DNA sensor.

Science.gov (United States)

Wang, Guixiang; Han, Rui; Su, Xiaoli; Li, Yinan; Xu, Guiyun; Luo, Xiliang

2017-06-15

Zwitterionic peptides were anchored to a conducting polymer of citrate doped poly(3,4-ethylenedioxythiophene) (PEDOT) via the nickel cation coordination, and the obtained peptide modified PEDOT, with excellent antifouling ability and good conductivity, was further used for the immobilization of a DNA probe to construct an electrochemical biosensor for the breast cancer marker BRCA1. The DNA biosensor was highly sensitive (with detection limit of 0.03fM) and selective, and it was able to detect BRCA1 in 5% (v/v) human plasma with satisfying accuracy and low fouling. The marriage of antifouling and biocompatible peptides with conducting polymers opened a new avenue to construct electrochemical biosensors capable of assaying targets in complex biological media with high sensitivity and without biofouling. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of DNA interactions using single-molecule force spectroscopy.

Science.gov (United States)

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

Cavity-Type DNA Origami-Based Plasmonic Nanostructures for Raman Enhancement.

Science.gov (United States)

Zhao, Mengzhen; Wang, Xu; Ren, Shaokang; Xing, Yikang; Wang, Jun; Teng, Nan; Zhao, Dongxia; Liu, Wei; Zhu, Dan; Su, Shao; Shi, Jiye; Song, Shiping; Wang, Lihua; Chao, Jie; Wang, Lianhui

2017-07-05

DNA origami has been established as addressable templates for site-specific anchoring of gold nanoparticles (AuNPs). Given that AuNPs are assembled by charged DNA oligonucleotides, it is important to reduce the charge repulsion between AuNPs-DNA and the template to realize high yields. Herein, we developed a cavity-type DNA origami as templates to organize 30 nm AuNPs, which formed dimer and tetramer plasmonic nanostructures. Transmission electron microscopy images showed that high yields of dimer and tetramer plasmonic nanostructures were obtained by using the cavity-type DNA origami as the template. More importantly, we observed significant Raman signal enhancement from molecules covalently attached to the plasmonic nanostructures, which provides a new way to high-sensitivity Raman sensing.

Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

Directory of Open Access Journals (Sweden)

Jonghyun Park

2010-11-01

Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

DEFF Research Database (Denmark)

Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

2011-01-01

We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

Ultraweak azimuthal anchoring of a nematic liquid crystal on a planar orienting photopolymer

International Nuclear Information System (INIS)

Nespoulous, Mathieu; Blanc, Christophe; Nobili, Maurizio

2007-01-01

The search of weak anchoring is an important issue for a whole class of liquid crystal displays. In this paper we present an orienting layer showing unreached weak planar azimuthal anchoring for 4-n-pentyl-4 ' -cyanobiphenyl nematic liquid crystal (5CB). Azimuthal extrapolation lengths as large as 80 μm are easily obtained. Our layers are made with the commercial photocurable polymer Norland optical adhesive 60. The anisotropy of the film is induced by the adsorption of oriented liquid crystal molecules under a 2 T magnetic field applied parallel to the surfaces. We use the width of surface π-walls and a high-field electro-optical method to measure, respectively, the azimuthal and the zenithal anchorings. The azimuthal anchoring is extremely sensitive to the ultraviolet (UV) dose and it also depends on the magnetic field application duration. On the opposite, the zenithal anchoring is only slightly sensitive to the preparation parameters. All these results are discussed in terms of the adsorption/desorption mechanisms of the liquid crystal molecules on the polymer layer and of the flexibility of the polymer network

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

Science.gov (United States)

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

DEFF Research Database (Denmark)

Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

2010-01-01

DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules

International Nuclear Information System (INIS)

Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei

2015-01-01

Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH 3 molecule, the adsorbed NO, SO 2 , CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO 2 . The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device

Fullerene-based Anchoring Groups for Molecular Electronics

DEFF Research Database (Denmark)

Martin, Christian A.; Ding, Dapeng; Sørensen, Jakob Kryger

2008-01-01

We present results on a new fullerene-based anchoring group for molecular electronics. Using lithographic mechanically controllable break junctions in vacuum we have determined the conductance and stability of single-molecule junctions of 1,4-bis(fullero[c]pyrrolidin-1-yl)benzene. The compound can...

Single-molecule denaturation mapping of DNA in nanofluidic channels

DEFF Research Database (Denmark)

Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

2010-01-01

Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

Science.gov (United States)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

Science.gov (United States)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

Directory of Open Access Journals (Sweden)

Greta Zubaite

2017-02-01

Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

NARCIS (Netherlands)

Moayed, F.; Mashaghi, A.; Tans, S.J.

2013-01-01

Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

Single molecule DNA detection with an atomic vapor notch filter

Energy Technology Data Exchange (ETDEWEB)

Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

2015-12-01

The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

Single-molecule studies of DNA transcription using atomic force microscopy

International Nuclear Information System (INIS)

Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

2012-01-01

Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

CERN Document Server

Williams, Mark C

2011-01-01

This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

Cell wall-anchored nuclease of Streptococcus sanguinis contributes to escape from neutrophil extracellular trap-mediated bacteriocidal activity.

Directory of Open Access Journals (Sweden)

Chisato Morita

Full Text Available Streptococcus sanguinis, a member of the commensal mitis group of streptococci, is a primary colonizer of the tooth surface, and has been implicated in infectious complications including bacteremia and infective endocarditis. During disease progression, S. sanguinis may utilize various cell surface molecules to evade the host immune system to survive in blood. In the present study, we discovered a novel cell surface nuclease with a cell-wall anchor domain, termed SWAN (streptococcal wall-anchored nuclease, and investigated its contribution to bacterial resistance against the bacteriocidal activity of neutrophil extracellular traps (NETs. Recombinant SWAN protein (rSWAN digested multiple forms of DNA including NET DNA and human RNA, which required both Mg(2+ and Ca(2+ for optimum activity. Furthermore, DNase activity of S. sanguinis was detected around growing colonies on agar plates containing DNA. In-frame deletion of the swan gene mostly reduced that activity. These findings indicated that SWAN is a major nuclease displayed on the surface, which was further confirmed by immuno-detection of SWAN in the cell wall fraction. The sensitivity of S. sanguinis to NET killing was reduced by swan gene deletion. Moreover, heterologous expression of the swan gene rendered a Lactococcus lactis strain more resistant to NET killing. Our results suggest that the SWAN nuclease on the bacterial surface contributes to survival in the potential situation of S. sanguinis encountering NETs during the course of disease progression.

Cell wall-anchored nuclease of Streptococcus sanguinis contributes to escape from neutrophil extracellular trap-mediated bacteriocidal activity.

Science.gov (United States)

Morita, Chisato; Sumioka, Ryuichi; Nakata, Masanobu; Okahashi, Nobuo; Wada, Satoshi; Yamashiro, Takashi; Hayashi, Mikako; Hamada, Shigeyuki; Sumitomo, Tomoko; Kawabata, Shigetada

2014-01-01

Streptococcus sanguinis, a member of the commensal mitis group of streptococci, is a primary colonizer of the tooth surface, and has been implicated in infectious complications including bacteremia and infective endocarditis. During disease progression, S. sanguinis may utilize various cell surface molecules to evade the host immune system to survive in blood. In the present study, we discovered a novel cell surface nuclease with a cell-wall anchor domain, termed SWAN (streptococcal wall-anchored nuclease), and investigated its contribution to bacterial resistance against the bacteriocidal activity of neutrophil extracellular traps (NETs). Recombinant SWAN protein (rSWAN) digested multiple forms of DNA including NET DNA and human RNA, which required both Mg(2+) and Ca(2+) for optimum activity. Furthermore, DNase activity of S. sanguinis was detected around growing colonies on agar plates containing DNA. In-frame deletion of the swan gene mostly reduced that activity. These findings indicated that SWAN is a major nuclease displayed on the surface, which was further confirmed by immuno-detection of SWAN in the cell wall fraction. The sensitivity of S. sanguinis to NET killing was reduced by swan gene deletion. Moreover, heterologous expression of the swan gene rendered a Lactococcus lactis strain more resistant to NET killing. Our results suggest that the SWAN nuclease on the bacterial surface contributes to survival in the potential situation of S. sanguinis encountering NETs during the course of disease progression.

Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

NARCIS (Netherlands)

Hohlbein, J.; Kapanidis, A.N.

2016-01-01

Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

Single Molecule Study of DNA Organization and Recombination

Science.gov (United States)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

Science.gov (United States)

Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

2016-01-01

Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

Directory of Open Access Journals (Sweden)

Mária Džunková

Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

OpenAIRE

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

Directory of Open Access Journals (Sweden)

Toshitsugu Fujita

2015-09-01

Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

Anchoring group effects in molecular devices: An ab initio study on the electronic transport of a carbon-dimer

International Nuclear Information System (INIS)

Wang, R.N.; Zheng, X.H.; Dai, Z.X.; Hao, H.; Song, L.L.; Zeng, Z.

2011-01-01

The conductance of a molecular device is sensitive to the contact geometry between the molecules and the probing electrodes. Taking a carbon-dimer C 2 as an example and connecting it to the electrodes by different linking atoms H, Cu and S, we investigate the anchoring group effect in molecular devices by the first-principles approaches. The results exhibit that, depending on the anchoring groups and the subsequent different metal-molecule chemical bonds, the current varies over more than two orders of magnitude under the same bias. This emphasizes the great importance of the anchoring groups in molecular devices.

Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

Science.gov (United States)

Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

2017-11-01

Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

Czech Academy of Sciences Publication Activity Database

Hanzálek, Petr; Kypr, Jaroslav

2001-01-01

Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

Adsorption behavior of Co anchored on graphene sheets toward NO, SO{sub 2}, NH{sub 3}, CO and HCN molecules

Energy Technology Data Exchange (ETDEWEB)

Tang, Yanan, E-mail: yntang2010@hotmail.com [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Chen, Weiguang; Li, Chenggang; Pan, Lijun [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Dai, Xianqi, E-mail: xqdai@henannu.edu.cn [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Ma, Dongwei [College of Physics and Electrical Engineering, Anyang Normal University, Anyang, Henan 455000 (China)

2015-07-01

Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH{sub 3} molecule, the adsorbed NO, SO{sub 2}, CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO{sub 2}. The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

Science.gov (United States)

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

NARCIS (Netherlands)

Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

1999-01-01

By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

DEFF Research Database (Denmark)

Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

2012-01-01

Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

How to determine local stretching and tension in a flow-stretched DNA molecule

DEFF Research Database (Denmark)

Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

2016-01-01

We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

On the identification techniques for ionizing radiation structure breaks in the DNA molecule

International Nuclear Information System (INIS)

Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

2012-01-01

In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

International Nuclear Information System (INIS)

Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

1979-01-01

The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

Science.gov (United States)

Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

1993-01-01

Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

Science.gov (United States)

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

Science.gov (United States)

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

Science.gov (United States)

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

Science.gov (United States)

Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

2017-01-01

During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

Directory of Open Access Journals (Sweden)

Fatemeh Moayed

Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

DNA expressions - A formal notation for DNA

NARCIS (Netherlands)

Vliet, Rudy van

2015-01-01

We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

AnchorDock: Blind and Flexible Anchor-Driven Peptide Docking.

Science.gov (United States)

Ben-Shimon, Avraham; Niv, Masha Y

2015-05-05

The huge conformational space stemming from the inherent flexibility of peptides is among the main obstacles to successful and efficient computational modeling of protein-peptide interactions. Current peptide docking methods typically overcome this challenge using prior knowledge from the structure of the complex. Here we introduce AnchorDock, a peptide docking approach, which automatically targets the docking search to the most relevant parts of the conformational space. This is done by precomputing the free peptide's structure and by computationally identifying anchoring spots on the protein surface. Next, a free peptide conformation undergoes anchor-driven simulated annealing molecular dynamics simulations around the predicted anchoring spots. In the challenging task of a completely blind docking test, AnchorDock produced exceptionally good results (backbone root-mean-square deviation ≤ 2.2Å, rank ≤15) for 10 of 13 unbound cases tested. The impressive performance of AnchorDock supports a molecular recognition pathway that is driven via pre-existing local structural elements. Copyright © 2015 Elsevier Ltd. All rights reserved.

Intracellular responsive dual delivery by endosomolytic polyplexes carrying DNA anchored porous silicon nanoparticles.

Science.gov (United States)

Shahbazi, Mohammad-Ali; Almeida, Patrick Vingadas; Correia, Alexandra; Herranz-Blanco, Barbara; Shrestha, Neha; Mäkilä, Ermei; Salonen, Jarno; Hirvonen, Jouni; Santos, Hélder A

2017-03-10

Bioresponsive cytosolic nanobased multidelivery has been emerging as an enormously challenging novel concept due to the intrinsic protective barriers of the cells and hardly controllable performances of nanomaterials. Here, we present a new paradigm to advance nano-in-nano integration technology amenable to create multifunctional nanovehicles showing considerable promise to overcome restrictions of intracellular delivery, solve impediments of endosomal localization and aid effectual tracking of nanoparticles. A redox responsive intercalator chemistry comprised of cystine and 9-aminoacridine is designed as a cross-linker to cap carboxylated porous silicon nanoparticles with DNA. These intelligent nanocarriers are then encapsulated within novel one-pot electrostatically complexed nano-networks made of a zwitterionic amino acid (cysteine), an anionic bioadhesive polymer (poly(methyl vinyl ether-alt-maleic acid)) and a cationic endosomolytic polymer (polyethyleneimine). This combined nanocomposite is successfully tested for the co-delivery of hydrophobic (sorafenib) or hydrophilic (calcein) molecules loaded within the porous core, and an imaging agent covalently integrated into the polyplex shell by click chemistry. High loading capacity, low cyto- and hemo-toxicity, glutathione responsive on-command drug release, and superior cytosolic delivery are shown as achievable key features of the proposed formulation. Overall, formulating drug molecules, DNA and imaging agents, without any interference, in a physico-chemically optimized carrier may open a path towards broad applicability of these cost-effective multivalent nanocomposites for treating different diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

Science.gov (United States)

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

Science.gov (United States)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

International Nuclear Information System (INIS)

Pham, Quang Trung

2014-01-01

The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

Science.gov (United States)

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

The Ogden Anchor.

Science.gov (United States)

Knudson, W E; Cerniglia, M W; Carro, A

1998-06-01

Many procedures performed by podiatric surgeons today require the use of a soft-tissue anchoring device. In recent years, many new anchoring devices have become available for use in the foot and ankle. The authors introduce a new soft-tissue anchoring device that has yet to be described in the podiatric literature and present two cases in which the new anchor was used.

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

Science.gov (United States)

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

First-principles investigation on the electronic efficiency and binding energy of the contacts formed by graphene and poly-aromatic hydrocarbon anchoring groups

Energy Technology Data Exchange (ETDEWEB)

Li, Yang; Tu, Xingchen; Wang, Hao; Hou, Shimin, E-mail: smhou@pku.edu.cn [Centre for Nanoscale Science and Technology, Key Laboratory for the Physics and Chemistry of Nanodevices, Department of Electronics, Peking University, Beijing 100871 (China); Sanvito, Stefano [School of Physics, AMBER and CRANN Institute, Trinity College, Dublin 2 (Ireland)

2015-04-28

The electronic efficiency and binding energy of contacts formed between graphene electrodes and poly-aromatic hydrocarbon (PAH) anchoring groups have been investigated by the non-equilibrium Green’s function formalism combined with density functional theory. Our calculations show that PAH molecules always bind in the interior and at the edge of graphene in the AB stacking manner, and that the binding energy increases following the increase of the number of carbon and hydrogen atoms constituting the PAH molecule. When we move to analyzing the electronic transport properties of molecular junctions with a six-carbon alkyne chain as the central molecule, the electronic efficiency of the graphene-PAH contacts is found to depend on the energy gap between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of the corresponding PAH anchoring group, rather than its size. To be specific, the smaller is the HOMO-LUMO gap of the PAH anchoring group, the higher is the electronic efficiency of the graphene-PAH contact. Although the HOMO-LUMO gap of a PAH molecule depends on its specific configuration, PAH molecules with similar atomic structures show a decreasing trend for their HOMO-LUMO gap as the number of fused benzene rings increases. Therefore, graphene-conjugated molecule-graphene junctions with high-binding and high-conducting graphene-PAH contacts can be realized by choosing appropriate PAH anchor groups with a large area and a small HOMO-LUMO gap.

First-principles investigation on the electronic efficiency and binding energy of the contacts formed by graphene and poly-aromatic hydrocarbon anchoring groups

KAUST Repository

Li, Yang

2015-04-28

© 2015 AIP Publishing LLC. The electronic efficiency and binding energy of contacts formed between graphene electrodes and poly-aromatic hydrocarbon (PAH) anchoring groups have been investigated by the non-equilibrium Green\\'s function formalism combined with density functional theory. Our calculations show that PAH molecules always bind in the interior and at the edge of graphene in the AB stacking manner, and that the binding energy increases following the increase of the number of carbon and hydrogen atoms constituting the PAH molecule. When we move to analyzing the electronic transport properties of molecular junctions with a six-carbon alkyne chain as the central molecule, the electronic efficiency of the graphene-PAH contacts is found to depend on the energy gap between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of the corresponding PAH anchoring group, rather than its size. To be specific, the smaller is the HOMO-LUMO gap of the PAH anchoring group, the higher is the electronic efficiency of the graphene-PAH contact. Although the HOMO-LUMO gap of a PAH molecule depends on its specific configuration, PAH molecules with similar atomic structures show a decreasing trend for their HOMO-LUMO gap as the number of fused benzene rings increases. Therefore, graphene-conjugated molecule-graphene junctions with high-binding and high-conducting graphene-PAH contacts can be realized by choosing appropriate PAH anchor groups with a large area and a small HOMO-LUMO gap.

First-principles investigation on the electronic efficiency and binding energy of the contacts formed by graphene and poly-aromatic hydrocarbon anchoring groups

KAUST Repository

Li, Yang; Tu, Xingchen; Wang, Hao; Sanvito, Stefano; Hou, Shimin

2015-01-01

© 2015 AIP Publishing LLC. The electronic efficiency and binding energy of contacts formed between graphene electrodes and poly-aromatic hydrocarbon (PAH) anchoring groups have been investigated by the non-equilibrium Green's function formalism combined with density functional theory. Our calculations show that PAH molecules always bind in the interior and at the edge of graphene in the AB stacking manner, and that the binding energy increases following the increase of the number of carbon and hydrogen atoms constituting the PAH molecule. When we move to analyzing the electronic transport properties of molecular junctions with a six-carbon alkyne chain as the central molecule, the electronic efficiency of the graphene-PAH contacts is found to depend on the energy gap between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of the corresponding PAH anchoring group, rather than its size. To be specific, the smaller is the HOMO-LUMO gap of the PAH anchoring group, the higher is the electronic efficiency of the graphene-PAH contact. Although the HOMO-LUMO gap of a PAH molecule depends on its specific configuration, PAH molecules with similar atomic structures show a decreasing trend for their HOMO-LUMO gap as the number of fused benzene rings increases. Therefore, graphene-conjugated molecule-graphene junctions with high-binding and high-conducting graphene-PAH contacts can be realized by choosing appropriate PAH anchor groups with a large area and a small HOMO-LUMO gap.

ANTS-anchored Zn-Al-CO3-LDH particles as fluorescent probe for sensing of folic acid

International Nuclear Information System (INIS)

Liu, Pengfei; Liu, Dan; Liu, Yanhuan; Li, Lei

2016-01-01

A novel fluorescent nanosensor for detecting folic acid (FA) in aqueous media has been developed based on 8-aminonaphthalene-1,3,6-trisulfonate (ANTS) anchored to the surface of Zn-Al-CO 3 -layered double hydroxides (LDH) particles. The nanosensor showed high fluorescence intensity and good photostability due to a strong coordination interaction between surface Zn 2+ ions of Zn-Al-CO 3 -LDH and N atoms of ANTS, which were verified by result of X-ray photoelectron spectroscopy (XPS). ANTS-anchored on the surface of Zn-Al-CO 3 -LDH restricted the intra-molecular rotation leading to ANTS-anchored J-type aggregation emission enhancement. ANTS-anchored Zn-Al-CO 3 -LDH particles exhibited highly sensitive and selective response to FA over other common metal ions and saccharides present in biological fluids. The proposed mechanism was that oxygen atoms of -SO 3 groups in ANTS-anchored on the surface of Zn-Al-CO 3 -LDH were easily collided by FA molecules to form potential hydrogen bonds between ANTS-anchored and FA molecules, which could effectively quench the ANTS-anchored fluorescence. Under the simulated physiological conditions (pH of 7.4), the fluorescence quenching was fitted to Stern-Volmer equation with a linear response in the concentration range of 1 μM to 200 μM with a limit of detection of 0.1 μM. The results indicate that ANTS-anchored Zn-Al-CO 3 -LDH particles can afford a very sensitive system for the sensing FA in aqueous solution. - Highlights: • A novel fluorescent nanosensor has been developed. • The sensor exhibited highly sensitive and selective response to FA. • The fluorescence quenching was fitted to Stern–Volmer equation. • The linear response range was 1–200 μM with a limit of detection of 0.1 μM.

Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

Science.gov (United States)

Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

2014-10-21

Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

Robust conductance of dumbbell molecular junctions with fullerene anchoring groups

DEFF Research Database (Denmark)

Markussen, Troels; Settnes, Mikkel; Thygesen, Kristian Sommer

2011-01-01

The conductance of a molecular wire connected to metallic electrodes is known to be sensitive to the atomic structure of the molecule-metal contact. This contact is to a large extent determined by the anchoring group linking the molecular wire to the metal. It has been found experimentally that a...

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

Science.gov (United States)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

International Nuclear Information System (INIS)

Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

1976-01-01

Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

NARCIS (Netherlands)

van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

2008-01-01

Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

Science.gov (United States)

Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

2017-12-14

Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

Science.gov (United States)

Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

2007-12-15

The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

International Nuclear Information System (INIS)

Waters, R.

1980-01-01

The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

Spontaneous insertion of GPI anchors into cholesterol-rich membrane domains

Directory of Open Access Journals (Sweden)

Jing Li

2018-05-01

Full Text Available GPI-Anchored proteins (GPI-APs can be exogenously transferred onto bilayer membranes both in vivo and in vitro, while the mechanism by which this transfer process occurs is unknown. In this work, we used atomistic molecular dynamics simulations and free energy calculations to characterize the essential influence of cholesterol on insertion of the GPI anchors into plasma membranes. We demonstrate, both dynamically and energetically, that in the presence of cholesterol, the tails of GPI anchors are able to penetrate inside the core of the lipid membrane spontaneously with a three-step mechanism, while in the absence of cholesterol no spontaneous insertion was observed. We ascribe the failure of insertion to the strong thermal fluctuation of lipid molecules in cholesterol-free bilayer, which generates a repulsive force in entropic origin. In the presence of cholesterol, however, the fluctuation of lipids is strongly reduced, thus decreasing the barrier for the anchor insertion. Based on this observation, we propose a hypothesis that addition of cholesterol creates vertical creases in membranes for the insertion of acyl chains. Moreover, we find that the GPI anchor could also spontaneously inserted into the boundary between cholesterol-rich and cholesterol-depleted domains. Our results shed light on the mechanism of cholesterol-mediated interaction between membrane proteins with acyl chain and plasma membranes in living cells.

Spontaneous insertion of GPI anchors into cholesterol-rich membrane domains

Science.gov (United States)

Li, Jing; Liu, Xiuhua; Tian, Falin; Yue, Tongtao; Zhang, Xianren; Cao, Dapeng

2018-05-01

GPI-Anchored proteins (GPI-APs) can be exogenously transferred onto bilayer membranes both in vivo and in vitro, while the mechanism by which this transfer process occurs is unknown. In this work, we used atomistic molecular dynamics simulations and free energy calculations to characterize the essential influence of cholesterol on insertion of the GPI anchors into plasma membranes. We demonstrate, both dynamically and energetically, that in the presence of cholesterol, the tails of GPI anchors are able to penetrate inside the core of the lipid membrane spontaneously with a three-step mechanism, while in the absence of cholesterol no spontaneous insertion was observed. We ascribe the failure of insertion to the strong thermal fluctuation of lipid molecules in cholesterol-free bilayer, which generates a repulsive force in entropic origin. In the presence of cholesterol, however, the fluctuation of lipids is strongly reduced, thus decreasing the barrier for the anchor insertion. Based on this observation, we propose a hypothesis that addition of cholesterol creates vertical creases in membranes for the insertion of acyl chains. Moreover, we find that the GPI anchor could also spontaneously inserted into the boundary between cholesterol-rich and cholesterol-depleted domains. Our results shed light on the mechanism of cholesterol-mediated interaction between membrane proteins with acyl chain and plasma membranes in living cells.

Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

NARCIS (Netherlands)

Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

2016-01-01

We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

Oligo-dT anchored cDNA-SCoT: a novel differential display method for analyzing differential gene expression in response to several stress treatments in mango (Mangifera indica L.).

Science.gov (United States)

Luo, Cong; He, Xin-Hua; Hu, Ying; Yu, Hai-xia; Ou, Shi-Jin; Fang, Zhong-Bin

2014-09-15

Differential display is a powerful technique for analyzing differences in gene expression. Oligo-dT cDNAstart codon targeted marker (cDNA-SCoT) technique is a novel, simple, cheap, rapid, and efficient method for differential gene expression research. In the present study, the oligo-dT anchored cDNA-SCoT technique was exploited to identify differentially expressed genes during several stress treatments in mango. A total of 37 primers combined with oligo-dT anchor primers 3side amplified approximately 150 fragments of 150 bp to 1500 bp in length. Up to 100 fragments were differentially expressed among the stress treatments and control samples, among which 92 were obtained and sequenced. Out of the 92 transcript derived fragments (TDFs), 70% were highly homologous to known genes, and 30% encoded unclassified proteins with unknown functions. The expression pattern of nine genes with known functions involved in several abiotic stresses in other species was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) under cold (4 °C), salinity (NaCl), polyethylene glycol (PEG, MW 6000), and heavy metal treatments in leaves and stems at different time points (0, 24, 48, and 72 h). The expression patterns of the genes (TDF4, TDF7, TDF23, TDF45, TDF49, TDF50, TDF57, TDF91 and TDF92) that had direct or indirect relationships with cold, salinity, drought and heavy metal stress response were analyzed through qRT-PCR. The possible roles of these genes are discussed. This study suggests that the oligo-dT anchored cDNA-SCoT differential display method is a useful tool to serve as an initial step for characterizing transcriptional changes induced by abiotic stresses and provide gene information for further study and application in genetic improvement and breeding in mango. Copyright © 2014 Elsevier B.V. All rights reserved.

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

Science.gov (United States)

Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

2003-10-01

Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

Science.gov (United States)

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

Directory of Open Access Journals (Sweden)

Mengyi Yang

2018-01-01

Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

ANTS-anchored Zn-Al-CO{sub 3}-LDH particles as fluorescent probe for sensing of folic acid

Energy Technology Data Exchange (ETDEWEB)

Liu, Pengfei; Liu, Dan; Liu, Yanhuan [State Key Laboratory of Chemical Resource Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Beijing Key Laboratory of Environmentally Harmful Chemical Analysis, Beijing University of Chemical Technology, Beijing 100029 (China); Li, Lei, E-mail: lilei@mail.buct.edu.cn [State Key Laboratory of Chemical Resource Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Beijing Key Laboratory of Environmentally Harmful Chemical Analysis, Beijing University of Chemical Technology, Beijing 100029 (China)

2016-09-15

A novel fluorescent nanosensor for detecting folic acid (FA) in aqueous media has been developed based on 8-aminonaphthalene-1,3,6-trisulfonate (ANTS) anchored to the surface of Zn-Al-CO{sub 3}-layered double hydroxides (LDH) particles. The nanosensor showed high fluorescence intensity and good photostability due to a strong coordination interaction between surface Zn{sup 2+} ions of Zn-Al-CO{sub 3}-LDH and N atoms of ANTS, which were verified by result of X-ray photoelectron spectroscopy (XPS). ANTS-anchored on the surface of Zn-Al-CO{sub 3}-LDH restricted the intra-molecular rotation leading to ANTS-anchored J-type aggregation emission enhancement. ANTS-anchored Zn-Al-CO{sub 3}-LDH particles exhibited highly sensitive and selective response to FA over other common metal ions and saccharides present in biological fluids. The proposed mechanism was that oxygen atoms of -SO{sub 3} groups in ANTS-anchored on the surface of Zn-Al-CO{sub 3}-LDH were easily collided by FA molecules to form potential hydrogen bonds between ANTS-anchored and FA molecules, which could effectively quench the ANTS-anchored fluorescence. Under the simulated physiological conditions (pH of 7.4), the fluorescence quenching was fitted to Stern-Volmer equation with a linear response in the concentration range of 1 μM to 200 μM with a limit of detection of 0.1 μM. The results indicate that ANTS-anchored Zn-Al-CO{sub 3}-LDH particles can afford a very sensitive system for the sensing FA in aqueous solution. - Highlights: • A novel fluorescent nanosensor has been developed. • The sensor exhibited highly sensitive and selective response to FA. • The fluorescence quenching was fitted to Stern–Volmer equation. • The linear response range was 1–200 μM with a limit of detection of 0.1 μM.

Comparative study of anchoring groups for molecular electronics: structure and conductance of Au-S-Au and Au-NH2-Au junctions

DEFF Research Database (Denmark)

Kristensen, Iben Sig; Mowbray, Duncan; Thygesen, Kristian Sommer

2008-01-01

The electrical properties of single-molecule junctions, consisting of an organic molecule coupled to metal electrodes, are sensitive to the detailed atomic structure of the molecule-metal contact. This, in turn, is determined by the anchoring group linking the molecule to the metal. With the aim ...

Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

Science.gov (United States)

Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

2017-11-01

The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

KAUST Repository

Hussain, Tanveer

2017-09-14

Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

Multiplex single-molecule interaction profiling of DNA barcoded proteins

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

Science.gov (United States)

Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

2017-08-04

Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Anchor Bolt Position in Base Plate In Terms Of T and J Anchor Bolt

Directory of Open Access Journals (Sweden)

b Osman Mohamad Hairi

2017-01-01

Full Text Available Generally, L anchor bolt system has been used for a long period of time in construction industry as one of the distributing load structures. However, there are some weaknesses in L anchor bolt which may straighten and pullup when charged with tensile load. Current practices prefer to use other types of anchor bolt systems, such as headed studs anchor bolt system to replace the L anchor bolt design. There has been lack of studies to prove that it is more effective in terms of performance. A new T anchor bolt which was basically modified from headed studs anchor bolt was proposed in this study to compare its performance of tensile loading in concrete failure to typical L design. This study aims to determine whether the T anchor bolt system gives better performance as compared to an L anchor bolt system. The performance was rated based on tensile loading on concrete failure pattern. A pullout test was conducted on two different anchor bolt systems, namely L and T. The anchor bolt embedded depth, h in concrete were varied according to their hook or bend radius. Each sample was repeated twice. There were totally eight samples. The hook or bend radius used were 50 mm and 57.5 mm for sample L1 and L2, respectively. 90-degree bend were used on sample T1 and T2. Based on test results, it can be seen that the performance of concrete failure pattern under tensile load on both L and T anchor bolt design samples with 200 mm embedment depth was better than deeper embedment depth of 230 mm. But the L anchor bolt design gives the best results as compared to T design. Although T anchor bolt design shows higher resistance before first bond failure to the concrete sample. T anchor bolt was analysed and needed deeper embedment depth to allow formation of cone pull-out shape to acquire better performance.

Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

Directory of Open Access Journals (Sweden)

Hsiu-Fang Fan

2018-05-01

Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

Spectroscopic and first principles investigation on 4-[(4-pyridinylmethylene)amino]-benzoic acid bearing pyridyl and carboxyl anchoring groups

Science.gov (United States)

Zhang, Lei; Wang, Qiaoyi

2018-03-01

We report a combined experimental and computational investigation on the structure and photophysics of 4-[(4-pyridinylmethylene)amino]-benzoic acid, a functional molecule bearing two anchoring groups for attachment onto a TiO2 surface and perovskite surface, for potential solar cell application. This molecule possesses interesting adsorption properties in perovskite solar cell because the pyridyl group serves as the Lewis base and targets Lewis acidic sites in the perovskite surface, while the carboxyl group targets TiO2 surface, improving the coupling between the perovskite surface and the TiO2 surface. The electronic structures of the molecule and its photochemistry are revealed by the UV-vis absorption spectra and the fluorescence spectra under visible light irradiation, which are combined with density functional theory (DFT) and time-dependent density functional theory (TDDFT) analysis. Considering the bi-anchoring groups and the conjugated π system embedded in the molecule, we anticipate it can molecular engineer the TiO2/perovskite interface in perovskite solar cell.

Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

Directory of Open Access Journals (Sweden)

Ilko Bald

2014-09-01

Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

DEFF Research Database (Denmark)

Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

2016-01-01

A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

Molecular beacon anchored onto a graphene oxide substrate

Science.gov (United States)

Darbandi, Arash; Datta, Debopam; Patel, Krunal; Lin, Gary; Stroscio, Michael A.; Dutta, Mitra

2017-09-01

In this article, we report a graphene oxide-based nanosensor incorporating semiconductor quantum dots linked to DNA-aptamers that functions as a ‘turn-off’ fluorescent nanosensor for detection of low concentrations of analytes. A specific demonstration of this turn-off aptasensor is presented for the case of the detection of mercury (II) ions. In this system, ensembles of aptamer-based quantum-dot sensors are anchored onto graphene oxide (GO) flakes which provide a platform for analyte detection in the vicinity of GO. Herein, the operation of this ensemble-based nanosensor is demonstrated for mercury ions, which upon addition of mercury, quenching of the emission intensity from the quantum dots is observed due to resonance energy transfer between quantum dots and the gold nanoparticle connected via a mercury target aptamer. A key result is that the usually dominant effect of quenching of the quantum dot due to close proximity to the GO can be reduced to negligible levels by using a linker molecule in conjunctions with the aptamer-based nanosensor. The effect of ionic concentration of the background matrix on the emission intensity was also investigated. The sensor system is found to be highly selective towards mercury and exhibits a linear behavior (r 2 > 0.99) in the nanomolar concentration range. The detection limit of the sensor towards mercury with no GO present was found to be 16.5 nM. With GO attached to molecular beacon via 14 base, 35 base, and 51 base long linker DNA, the detection limit was found to be 38.4 nM, 9.45 nM, and 11.38 nM; respectively.

Analysis of Anchoring Mechanism of Fully Grouted Prestressed Anchor

Directory of Open Access Journals (Sweden)

WEN Zhi-jie

2014-01-01

Full Text Available Some researchers have been carried out on analysis of the influence of the full grouted prestressed anchor shape of borehole wall on its carrying capacity. Based on the self-affine fractal feature of anchor borehole wall structural plane, the relation equation among structural plane shear strength, liquid injection pressure, tensile load and structural plane fractal dimension D was built, the instability judgment criterion of anchoring bearing strata and rock structural plane was determined, the solving equations of disintegrated rock support density were derived. Based on the experimental results, the theoretical basis of support design under the disintegrated rock condition was offered.

Anchors as Semantic Primes in Value Construction: An EEG Study of the Anchoring Effect.

Directory of Open Access Journals (Sweden)

Qingguo Ma

Full Text Available Previous research regarding anchoring effects has demonstrated that human judgments are often assimilated to irrelevant information. Studies have demonstrated that anchors influence the economic valuation of various products and experiences; however, the cognitive explanations of this effect remain controversial, and its neural mechanisms have rarely been explored. In the current study, we conducted an electroencephalography (EEG experiment to investigate the anchoring effect on willingness to accept (WTA for an aversive hedonic experience and the role of anchors in this judgment heuristic. The behavioral results demonstrated that random numbers affect participants' WTA for listening to pieces of noise. The participants asked for higher pay after comparing their WTA with higher numbers. The EEG results indicated that anchors also influenced the neural underpinnings of the valuation process. Specifically, when a higher anchor number was drawn, larger P2 and late positive potential amplitudes were elicited, reflecting the anticipation of more intensive pain from the subsequent noise. Moreover, higher anchors induced a stronger theta band power increase compared with lower anchors when subjects listened to the noises, indicating that the participants felt more unpleasant during the actual experience of the noise. The levels of unpleasantness during both anticipation and experience were consistent with the semantic information implied by the anchors. Therefore, these data suggest that a semantic priming process underlies the anchoring effect in WTA. This study provides proof for the robustness of the anchoring effect and neural evidence of the semantic priming model. Our findings indicate that activated contextual information, even seemingly irrelevant, can be embedded in the construction of economic value in the brain.

Three-Dimensional Graphene Supported Bimetallic Nanocomposites with DNA Regulated-Flexibly Switchable Peroxidase-Like Activity.

Science.gov (United States)

Yuan, Fang; Zhao, Huimin; Zang, Hongmei; Ye, Fei; Quan, Xie

2016-04-20

A synergistic bimetallic enzyme mimetic catalyst, three-dimensional (3D) graphene/Fe3O4-AuNPs, was successfully fabricated which exhibited flexibly switchable peroxidase-like activity. Compared to the traditional 2D graphene-based monometallic composite, the introduced 3D structure, which was induced by the addition of glutamic acid, and bimetallic anchoring approach dramatically improved the catalytic activity, as well as the catalysis velocity and its affinity for substrate. Herein, Fe3O4NPs acted as supporters for AuNPs, which contributed to enhance the efficiency of electron transfer. On the basis of the measurement of Mott-Schottky plots of graphene and metal anchored hybrids, the catalysis mechanism was elucidated by the decrease of Fermi level resulted from the chemical doping behavior. Notably, the catalytic activity was able to be regulated by the adsorption and desorption of single-stranded DNA molecules, which laid a basis for its utilization in the construction of single-stranded DNA-based colorimetric biosensors. This strategy not only simplified the operation process including labeling, modification, and imprinting, but also protected the intrinsic affinity between the target and biological probe. Accordingly, based on the peroxidase-like activity and its controllability, our prepared nanohybrids was successfully adopted in the visualized and label-free sensing detections of glucose, sequence-specific DNA, mismatched nucleotides, and oxytetracycline.

Susceptibility to anchoring effects

Directory of Open Access Journals (Sweden)

Todd McElroy

2007-02-01

Full Text Available Previous research on anchoring has shown this heuristic to be a very robust psychological phenomenon ubiquitous across many domains of human judgment and decision-making. Despite the prevalence of anchoring effects, researchers have only recently begun to investigate the underlying factors responsible for how and in what ways a person is susceptible to them. This paper examines how one such factor, the Big-Five personality trait of openness-to-experience, influences the effect of previously presented anchors on participants' judgments. Our findings indicate that participants high in openness-to-experience were significantly more influenced by anchoring cues relative to participants low in this trait. These findings were consistent across two different types of anchoring tasks providing convergent evidence for our hypothesis.

Anchor-dependent lipofection with non-glycerol based cytofectins containing single 2-hydroxyethyl head groups.

Science.gov (United States)

Venkata Srilakshmi, Gollapudi; Sen, Joyeeta; Chaudhuri, Arabinda; Ramadas, Yerramsetti; Madhusudhana Rao, Nalam

2002-02-15

Detailed structure-activity investigations aimed at probing the anchor chain length dependency for glycerol-based lipofectins have been reported previously. Herein, we report on the first detailed investigation on the anchor-dependent transfection biology of non-glycerol based simple monocationic cytofectins containing single 2-hydroxyethyl head group functionality using 11 new structural analogs of our previously published first generation of non-glycerol based transfection lipids (lipids 1-11). The C-14 and C-16 analogs of DOMHAC (lipids 4 and 5, respectively) were found to be remarkably efficient in transfecting COS-1 cells. In addition, the present anchor-dependency investigation also revealed that the C-14 analog of DOHEMAB (lipid 10) is significantly efficient in transfecting both COS-1 and NIH3T3 cells. Our results also indicate that too strong lipid-DNA interactions might result in weaker transfection for non-glycerol based cationic lipids. In summary, the anchor-dependence investigations presented here convincingly demonstrate that non-glycerol based cationic lipids containing a single hydroxyethyl head group and hydrophobic C-14 or C-16 anchors are promising non-toxic cationic transfection lipids for future use in liposomal gene delivery.

Comparison of Suture-Based Anchors and Traditional Bioabsorbable Anchors in Foot and Ankle Surgery.

Science.gov (United States)

Hembree, W Chad; Tsai, Michael A; Parks, Brent G; Miller, Stuart D

We compared the pullout strength of a suture-based anchor versus a bioabsorbable anchor in the distal fibula and calcaneus and evaluated the relationship between bone mineral density and peak load to failure. Eight paired cadaveric specimens underwent a modified Broström procedure and Achilles tendon reattachment. The fibula and calcaneus in the paired specimens received either a suture-based anchor or a bioabsorbable suture anchor. The fibular and calcaneal specimens were loaded to failure, defined as a substantial decrease in the applied load or pullout from the bone. In the fibula, the peak load to failure was significantly greater with the suture-based versus the bioabsorbable anchors (133.3 ± 41.8 N versus 76.8 ± 35.3 N; p = .002). No significant difference in load with 5 mm of displacement was found between the 2 groups. In the calcaneus, no difference in the peak load to failure was found between the 2 groups, and the peak load to failure with 5 mm of displacement was significantly lower with the suture-based than with the bioabsorbable anchors (52.2 ± 9.8 N versus 75.9 ± 12.4 N; p = .003). Bone mineral density and peak load to failure were significantly correlated in the fibula with the suture-based anchor. An innovative suture-based anchor had a greater peak load to failure compared with a bioabsorbable anchor in the fibula. In the calcaneus, the load at 5 mm of displacement was significantly lower in the suture-based than in the bioabsorbable group. The correlation findings might indicate the need for a cortical bone shelf with the suture-based anchor. Suture-based anchors could be a viable alternative to bioabsorbable anchors for certain foot and ankle procedures. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Electronic properties and assambly of DNA-based molecules on gold surfaces

DEFF Research Database (Denmark)

Salvatore, Princia

, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

KAUST Repository

Shirbini, Afnan

2017-05-01

Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

Science.gov (United States)

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

KAUST Repository

Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

2017-01-01

Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

Anchored LH2 complexes in 2D polarization imaging.

Science.gov (United States)

Tubasum, Sumera; Sakai, Shunsuke; Dewa, Takehisa; Sundström, Villy; Scheblykin, Ivan G; Nango, Mamoru; Pullerits, Tõnu

2013-09-26

Protein is a soft material with inherently large structural disorder. Consequently, the bulk spectroscopies of photosynthetic pigment protein complexes provide averaged information where many details are lost. Here we report spectroscopy of single light-harvesting complexes where fluorescence excitation and detection polarizations are both independently rotated. Two samples of peripheral antenna (LH2) complexes from Rhodopseudomonas acidophila were studied. In one, the complexes were embedded in polyvinyl alcohol (PVA) film; in the other, they were anchored on the glass surface and covered by the PVA film. LH2 contains two rings of pigment molecules-B800 and B850. The B800 excitation polarization properties of the two samples were found to be very similar, indicating that orientation statistics of LH2s are the same in these two very different preparations. At the same time, we found a significant difference in B850 emission polarization statistics. We conclude that the B850 band of the anchored sample is substantially more disordered. We argue that both B800 excitation and B850 emission polarization properties can be explained by the tilt of the anchored LH2s due to the spin-casting of the PVA film on top of the complexes and related shear forces. Due to the tilt, the orientation statistics of two samples become similar. Anchoring is expected to orient the LH2s so that B850 is closer to the substrate. Consequently, the tilt-related strain leads to larger deformation and disorder in B850 than in B800.

A structural basis for the regulatory inactivation of DnaA.

Science.gov (United States)

Xu, Qingping; McMullan, Daniel; Abdubek, Polat; Astakhova, Tamara; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C; Duan, Lian; Elsliger, Marc-Andre; Feuerhelm, Julie; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Johnson, Hope A; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Sri Krishna, S; Kumar, Abhinav; Marciano, David; Miller, Mitchell D; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L; Sefcovic, Natasha; Trame, Christine; van den Bedem, Henry; Weekes, Dana; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2009-01-16

Regulatory inactivation of DnaA is dependent on Hda (homologous to DnaA), a protein homologous to the AAA+ (ATPases associated with diverse cellular activities) ATPase region of the replication initiator DnaA. When bound to the sliding clamp loaded onto duplex DNA, Hda can stimulate the transformation of active DnaA-ATP into inactive DnaA-ADP. The crystal structure of Hda from Shewanella amazonensis SB2B at 1.75 A resolution reveals that Hda resembles typical AAA+ ATPases. The arrangement of the two subdomains in Hda (residues 1-174 and 175-241) differs dramatically from that of DnaA. A CDP molecule anchors the Hda domains in a conformation that promotes dimer formation. The Hda dimer adopts a novel oligomeric assembly for AAA+ proteins in which the arginine finger, crucial for ATP hydrolysis, is fully exposed and available to hydrolyze DnaA-ATP through a typical AAA+ type of mechanism. The sliding clamp binding motifs at the N-terminus of each Hda monomer are partially buried and combine to form an antiparallel beta-sheet at the dimer interface. The inaccessibility of the clamp binding motifs in the CDP-bound structure of Hda suggests that conformational changes are required for Hda to form a functional complex with the clamp. Thus, the CDP-bound Hda dimer likely represents an inactive form of Hda.

Experimental Research on Destruction Mode and Anchoring Performance of Carbon Fiber Phyllostachys pubescens Anchor Rod with Different Forms

Directory of Open Access Journals (Sweden)

Wang Yulan

2018-01-01

Full Text Available The anchoring technology is extensively applied in reinforcing protection of the earth relics. Now that no specification is available for different new anchor rods in earth relics protection due to diversified destruction modes of earth relics and complexity of engineering technology conditions, it is urgent to guide reinforcing design and construction with a complete detailed anchor rod research document. With the new carbon fiber Phyllostachys pubescens anchor rod as the research object, six lots of in situ tests are designed to, respectively, study the destruction mode and anchoring performance of the carbon fiber Phyllostachys pubescens anchor rod under different anchor length L, anchor rod diameter D, bore diameter H, grouting material S, rib spacing R, and inclination angle A in this paper. By studying load shift curve experiment in drawing of the anchor rod, the destruction mode and ultimate bearing capacity of the carbon fiber Phyllostachys pubescens anchor rod in different experiment lots are obtained, and the concept of permitted application value N in anchor rod design is proposed. By studying strain distribution characteristics of anchor rods in experimental lots along the length direction under action of the permitted application value N and combining the existing destruction mode and ultimate bearing capacity, this paper analyzes influences of L, D, H, S, R, and A on anchoring effect of the carbon fiber Phyllostachys pubescens anchor rod; gives the reasonable value range of L, D, H, and R when the carbon fiber Phyllostachys pubescens anchor rod is used for reinforcing design of the earth relics; and provides favorable experiment basis for reinforcing design of the earth relics based on the carbon fiber Phyllostachys pubescens anchor rod.

The P9 pocket of HLA-DQ2 (non-Aspbeta57) has no particular preference for negatively charged anchor residues found in other type 1 diabetes-predisposing non-Aspbeta57 MHC class II molecules

DEFF Research Database (Denmark)

Quarsten, H; Paulsen, G; Johansen, B H

1998-01-01

Susceptibility and resistance to type 1 diabetes are associated with MHC class II alleles that carry non-Asp and Asp at residue 57 of their beta chain respectively. The effect of Asp or non-Aspbeta57 may relate to a differential ability of distinct class II molecules to bind specific immuno......-pathogenic peptides. Recent studies in man and mouse have revealed that some type 1 diabetes-predisposing non-Aspbeta57 class II molecules (i.e. DQ8, DR4Dw15 and I-Ag7) preferentially bind peptides with a negatively charged anchor residue at P9. It has been suggested that this is a common feature of type 1 diabetes......-predisposing class II molecules. The molecular explanation for such a phenomenon could be that class II beta chains with Aspbeta57 form a salt bridge between Aspbeta57 and a conserved Arg of the a chain, whereas in non-Aspbeta57 molecules the Arg is unopposed and free to interact with negatively charged P9 peptide...

Charge transport properties of a twisted DNA molecule: A renormalization approach

Energy Technology Data Exchange (ETDEWEB)

Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2016-10-20

In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

Science.gov (United States)

Kühnemund, M; Nilsson, M

2015-05-15

Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

Anchored PKA as a gatekeeper for gap junctions.

Science.gov (United States)

Pidoux, Guillaume; Taskén, Kjetil

2015-01-01

Anchored protein kinase A (PKA) bound to A Kinase Anchoring Protein (AKAP) mediates effects of localized increases in cAMP in defined subcellular microdomains and retains the specificity in cAMP-PKA signaling to distinct extracellular stimuli. Gap junctions are pores between adjacent cells constituted by connexin proteins that provide means of communication and transfer of small molecules. While the PKA signaling is known to promote human trophoblast cell fusion, the gap junction communication through connexin 43 (Cx43) is a prerequisite for this process. We recently demonstrated that trophoblast fusion is regulated by ezrin, a known AKAP, which binds to Cx43 and delivers PKA in the vicinity gap junctions. We found that disruption of the ezrin-Cx43 interaction abolished PKA-dependent phosphorylation of Cx43 as well as gap junction communication and subsequently cell fusion. We propose that the PKA-ezrin-Cx43 macromolecular complex regulating gap junction communication constitutes a general mechanism to control opening of Cx43 gap junctions by phosphorylation in response to cAMP signaling in various cell types.

Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

Directory of Open Access Journals (Sweden)

Haowei Wang

Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

Science.gov (United States)

Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

2018-01-01

Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

Science.gov (United States)

Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

2018-01-10

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

Experimental testing of anchoring devices for bottom rails in partially anchored timber frame shear walls

OpenAIRE

Caprolu, Giuseppe

2011-01-01

Källsner and Girhammar have presented a new plastic design method of wood-framed shear walls at ultimate limit state. This method allows the designer to calculate the load-carrying capacity of shear walls partially anchored, where the leading stud is not anchored against the uplift.The anchorage system of shear walls is provided from anchor bolts and hold downs. Anchor bolts provide horizontal shear continuity between the bottom rail and the foundation. Hold downs are directly connected from ...

The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

International Nuclear Information System (INIS)

Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

2008-01-01

We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease

Energy Technology Data Exchange (ETDEWEB)

Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki

1980-09-19

Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

Energy Technology Data Exchange (ETDEWEB)

Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

2009-07-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

International Nuclear Information System (INIS)

Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

2009-01-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells

Directory of Open Access Journals (Sweden)

Sharma Shikhar

2012-01-01

Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.

Studying DNA Looping by Single-Molecule FRET

OpenAIRE

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

KAUST Repository

Raducanu, Vlad-Stefan

2016-05-01

Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

Science.gov (United States)

Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

2015-04-01

DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

Linker-dependent Junction Formation Probability in Single-Molecule Junctions

Energy Technology Data Exchange (ETDEWEB)

Yoo, Pil Sun; Kim, Taekyeong [HankukUniversity of Foreign Studies, Yongin (Korea, Republic of)

2015-01-15

We compare the junction formation probabilities of single-molecule junctions with different linker molecules by using a scanning tunneling microscope-based break-junction technique. We found that the junction formation probability varies as SH > SMe > NH2 for the benzene backbone molecule with different types of anchoring groups, through quantitative statistical analysis. These results are attributed to different bonding forces according to the linker groups formed with Au atoms in the electrodes, which is consistent with previous works. Our work allows a better understanding of the contact chemistry in the metal.molecule junction for future molecular electronic devices.

Thermal stability and molecular ordering of organic semiconductor monolayers: effect of an anchor group.

Science.gov (United States)

Jones, Andrew O F; Knauer, Philipp; Resel, Roland; Ringk, Andreas; Strohriegl, Peter; Werzer, Oliver; Sferrazza, Michele

2015-06-08

The thermal stability and molecular order in monolayers of two organic semiconductors, PBI-PA and PBI-alkyl, based on perylene derivatives with an identical molecular structure except for an anchor group for attachment to the substrate in PBI-PA, are reported. In situ X-ray reflectivity measurements are used to follow the stability of these monolayers in terms of order and thickness as temperature is increased. Films have thicknesses corresponding approximately to the length of one molecule; molecules stand upright on the substrate with a defined structure. PBI-PA monolayers have a high degree of order at room temperature and a stable film exists up to 250 °C, but decomposes rapidly above 300 °C. In contrast, stable physisorbed PBI-alkyl monolayers only exist up to 100 °C. Above the bulk melting point at 200 °C no more order exists. The results encourage using anchor groups in monolayers for various applications as it allows enhanced stability at the interface with the substrate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation.

Science.gov (United States)

Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria

2013-08-01

The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 bound to yeast TBP, together with mutational data. We find that yeast TAF1-TAND1, which in itself acts as a transcriptional activator, binds TBP's concave DNA-binding surface by presenting similar anchor residues to TBP as does Mot1 but from a distinct structural scaffold. Furthermore, we show how TAF1-TAND2 uses an aromatic and acidic anchoring pattern to bind a conserved TBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides insight into the competitive multiprotein TBP interplay critical to transcriptional regulation.

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

Energy Technology Data Exchange (ETDEWEB)

Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

Not all Anchors Weigh Equally.

Science.gov (United States)

Greenstein, Michael; Velazquez, Alexandra

2017-11-01

The anchoring bias is a reliable effect wherein a person's judgments are affected by initially presented information, but it is unknown specifically why this effect occurs. Research examining this bias suggests that elements of both numeric and semantic priming may be involved. To examine this, the present research used a phenomenon wherein people treat numeric information presented differently in Arabic numeral or verbal formats. We presented participants with one of many forms of an anchor that represented the same value (e.g., twelve hundred or 1,200). Thus, we could examine how a concept's meaning and its absolute numeric value affect anchoring. Experiments 1 and 2 showed that people respond to Arabic and verbal anchors differently. Experiment 3 showed that these differences occurred largely because people tend to think of numbers in digit format. This suggests that one's conceptual understanding of the anchored information matters more than its strict numeric value.

Measurement and understanding of single-molecule break junction rectification caused by asymmetric contacts

International Nuclear Information System (INIS)

Wang, Kun; Zhou, Jianfeng; Hamill, Joseph M.; Xu, Bingqian

2014-01-01

The contact effects of single-molecule break junctions on rectification behaviors were experimentally explored by a systematic control of anchoring groups of 1,4-disubstituted benzene molecular junctions. Single-molecule conductance and I-V characteristic measurements reveal a strong correlation between rectifying effects and the asymmetry in contacts. Analysis using energy band models and I-V calculations suggested that the rectification behavior is mainly caused by asymmetric coupling strengths at the two contact interfaces. Fitting of the rectification ratio by a modified Simmons model we developed suggests asymmetry in potential drop across the asymmetric anchoring groups as the mechanism of rectifying I-V behavior. This study provides direct experimental evidence and sheds light on the mechanisms of rectification behavior induced simply by contact asymmetry, which serves as an aid to interpret future single-molecule electronic behavior involved with asymmetric contact conformation

SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat map and reveal synteny with model species.

Directory of Open Access Journals (Sweden)

Rebekah E Oliver

Full Text Available A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42 has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources.

Radiation-induced DNA damage as a function of DNA hydration

International Nuclear Information System (INIS)

Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.

1995-01-01

Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage

Nonlinear and Nonsymmetric Single-Molecule Electronic Properties Towards Molecular Information Processing.

Science.gov (United States)

Tamaki, Takashi; Ogawa, Takuji

2017-09-05

This review highlights molecular design for nonlinear and nonsymmetric single-molecule electronic properties such as rectification, negative differential resistance, and switching, which are important components of future single-molecule information processing devices. Perspectives on integrated "molecular circuits" are also provided. Nonlinear and nonsymmetric single-molecule electronics can be designed by utilizing (1) asymmetric molecular cores, (2) asymmetric anchoring groups, (3) an asymmetric junction environment, and (4) asymmetric electrode materials. This review mainly focuses on the design of molecular cores.

Quantitative evaluation of Candia antarctica lipase B displayed on the cell surface of a Pichia pastoris based on an FS anchor system.

Science.gov (United States)

Liang, Xing-xiang; Wang, Bei-bei; Sun, Yu-fei; Lin, Ying; Han, Shuang-yan; Zheng, Sui-ping; Cui, Tang-bing

2013-03-01

A new approach is described to quantify the number of enzyme molecules, such as Candia antarctica lipase B, that are displayed on the cell surface of Pichia pastoris. Enhanced green fluorescent protein (EGFP) and Candida antarctica lipase B (CALB) were fused and displayed on the surface of P. pastoris by linking to the anchor flocculation functional domain of FLO1p from Saccharomyces cerevisiae. Confocal laser scanning microscopy, flow cytometry, and fluorescence spectrophotometry were used to monitor the fluorescence intensity of fused EGFP. Combined with the corresponding protein concentration detected in the medium, a standard curve describing the relationship between the fusion protein concentration and fluorescence intensity were obtained and could be used to number CALB displayed on the cell surface. The results showed that approx. 10(4) molecules of CALB molecules were immobilized on the single P. pastoris cell wall based on FS anchor system.

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

Detection of gas molecules on single Mn adatom adsorbed graphyne: a DFT-D study

Science.gov (United States)

Lu, Zhansheng; Lv, Peng; Ma, Dongwei; Yang, Xinwei; Li, Shuo; Yang, Zongxian

2018-02-01

As one of the prominent applications in intelligent systems, gas sensing technology has attracted great interest in both industry and academia. In the current study, the pristine graphyne (GY) without and with a single Mn atom is investigated to detect the gas molecules (CO, CH4, CO2, NH3, NO and O2). The pristine GY is promising to detect O2 molecules because of its chemical adsorption on GY with large electron transfer. The great stability of the Mn/GY is found, and the Mn atom prefers to anchor at the alkyne ring as a single atom. Upon single Mn atom anchoring, the sensitivity and selectivity of GY based gas sensors is significantly improved for various molecules, except CH4. The recovery time of the Mn/GY after detecting the gas molecules may help to appraise the detection efficiency for the Mn/GY. The current study will help to understand the mechanism of detecting the gas molecules, and extend the potentially fascinating applications of GY-based materials.

Photoactive curcumin-derived dyes with surface anchoring moieties used in ZnO nanoparticle-based dye-sensitized solar cells

International Nuclear Information System (INIS)

Ganesh, T.; Kim, Jong Hoon; Yoon, Seog Joon; Kil, Byung-Ho; Maldar, N.N.; Han, Jin Wook; Han, Sung-Hwan

2010-01-01

Photoactive, eco-friendly and high molar extinction coefficient, curcumin-derived dyes (BCMoxo and BCtCM) have been explored in ZnO nanoparticles (NPs)-based dye-sensitized solar cells (DSSCs). The boron complex curcumin dyes modified with di-carboxylic anchor groups (BCtCM) provided surface attachment with a strong UV-vis region absorption than the dye molecule without anchor groups (BCMoxo). Photoanodes primed with poly-dispersive ZnO NPs (∼80-50 nm) specifically devised for these dyes and optimized for the critical thickness, sensitization time and concentration using a solvent-free ionic electrolyte so as to get current density as high as 1.66 mA/cm 2 under 80 mW/cm 2 irradiation. Therefore, a successful conversion of visible light into electricity by using these curcumin-derived dyes (natural derived photoactive molecules) as photosensitizer in DSSCs would be a great interest in future studies for enhancing further conversion efficiencies.

Surface effects on magnetic Freedericksz transition in ferronematics with soft particle anchoring

International Nuclear Information System (INIS)

Bena, R.-E.; Petrescu, Emil

2003-01-01

The magnetic field-induced Freedericksz transition in a homeotropically aligned ferronematic (FN) in the case of weak anchoring molecules to the walls is studied. A correction to the Burylov-Raikher expression for the second-order transition threshold field is found. The possibility of a first-order transition is discussed in connection with the similar results for nematic liquid crystals. The saturation magnetic field is also obtained in terms of FN, surface and device parameters

A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

International Nuclear Information System (INIS)

Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

2011-01-01

To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

Binding constants of membrane-anchored receptors and ligands: A general theory corroborated by Monte Carlo simulations.

Science.gov (United States)

Xu, Guang-Kui; Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

2015-12-28

Adhesion processes of biological membranes that enclose cells and cellular organelles are essential for immune responses, tissue formation, and signaling. These processes depend sensitively on the binding constant K2D of the membrane-anchored receptor and ligand proteins that mediate adhesion, which is difficult to measure in the "two-dimensional" (2D) membrane environment of the proteins. An important problem therefore is to relate K2D to the binding constant K3D of soluble variants of the receptors and ligands that lack the membrane anchors and are free to diffuse in three dimensions (3D). In this article, we present a general theory for the binding constants K2D and K3D of rather stiff proteins whose main degrees of freedom are translation and rotation, along membranes and around anchor points "in 2D," or unconstrained "in 3D." The theory generalizes previous results by describing how K2D depends both on the average separation and thermal nanoscale roughness of the apposing membranes, and on the length and anchoring flexibility of the receptors and ligands. Our theoretical results for the ratio K2D/K3D of the binding constants agree with detailed results from Monte Carlo simulations without any data fitting, which indicates that the theory captures the essential features of the "dimensionality reduction" due to membrane anchoring. In our Monte Carlo simulations, we consider a novel coarse-grained model of biomembrane adhesion in which the membranes are represented as discretized elastic surfaces, and the receptors and ligands as anchored molecules that diffuse continuously along the membranes and rotate at their anchor points.

Controlling single-molecule junction conductance by molecular interactions

Science.gov (United States)

Kitaguchi, Y.; Habuka, S.; Okuyama, H.; Hatta, S.; Aruga, T.; Frederiksen, T.; Paulsson, M.; Ueba, H.

2015-01-01

For the rational design of single-molecular electronic devices, it is essential to understand environmental effects on the electronic properties of a working molecule. Here we investigate the impact of molecular interactions on the single-molecule conductance by accurately positioning individual molecules on the electrode. To achieve reproducible and precise conductivity measurements, we utilize relatively weak π-bonding between a phenoxy molecule and a STM-tip to form and cleave one contact to the molecule. The anchoring to the other electrode is kept stable using a chalcogen atom with strong bonding to a Cu(110) substrate. These non-destructive measurements permit us to investigate the variation in single-molecule conductance under different but controlled environmental conditions. Combined with density functional theory calculations, we clarify the role of the electrostatic field in the environmental effect that influences the molecular level alignment. PMID:26135251

In silico single-molecule manipulation of DNA with rigid body dynamics.

Directory of Open Access Journals (Sweden)

Pascal Carrivain

2014-02-01

Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

PDB4DNA: Implementation of DNA geometry from the Protein Data Bank (PDB) description for Geant4-DNA Monte-Carlo simulations

Science.gov (United States)

Delage, E.; Pham, Q. T.; Karamitros, M.; Payno, H.; Stepan, V.; Incerti, S.; Maigne, L.; Perrot, Y.

2015-07-01

This paper describes PDB4DNA, a new Geant4 user application, based on an independent, cross-platform, free and open source C++ library, so-called PDBlib, which enables use of atomic level description of DNA molecule in Geant4 Monte Carlo particle transport simulations. For the evaluation of direct damage induced on the DNA molecule by ionizing particles, the application makes use of an algorithm able to determine the closest atom in the DNA molecule to energy depositions. Both the PDB4DNA application and the PDBlib library are available as free and open source under the Geant4 license.

Biomechanical comparison of traditional anchors to all-suture anchors in a double-row rotator cuff repair cadaver model.

Science.gov (United States)

Goschka, Andrew M; Hafer, Jason S; Reynolds, Kirk A; Aberle, Nicholas S; Baldini, Todd H; Hawkins, Monica J; McCarty, Eric C

2015-10-01

To further reduce the invasiveness of arthroscopic rotator cuff repair surgery the all-suture anchor has been developed. The all-suture anchor requires less bone removal and reduces the potential of loose body complications. The all-suture anchor must also have adequate biomechanical strength for the repair to heal. The hypothesis is there is no significant difference in the biomechanical performance of supraspinatus repairs using an all-suture anchor when compared to traditional solid-body suture anchors. Using nine shoulders per group, the supraspinatus tendon was dissected from the greater tuberosity. The four different double row repairs tested were (medial row/lateral row): A: ICONIX2/ICONIX2; B: ICONIX2/Stryker ReelX 3.9mm; C: ICONIX2/Stryker ReelX 4.5mm; D: Arthrex BioComposite CorkScrew FT 4.5mm/Arthrex BioComposite SwiveLock 4.75mm. The ICONIX2 was the only all-suture anchor tested. Tendons underwent cyclic loading from 10 to 100N for 500 cycles, followed by load-to-failure. Data was collected at cycles 5, 100, 200, 300, 400, and 500. One-way ANOVA analysis was used to assess significance (P≤0.05). The anchor combinations tested did not differ significantly in anterior (P>0.4) or posterior (P>0.3) gap formation, construct stiffness (P>0.7), ultimate load (P=0.06), or load to 5mm gap formation (P=0.84). The all-suture anchor demonstrated comparable biomechanical performance in multiple double-row anchor combinations to a combination of traditional solid-body anchors. Thus it may be an attractive option to further reduce the invasiveness of rotator cuff repairs. Copyright © 2015 Elsevier Ltd. All rights reserved.

Photoactive curcumin-derived dyes with surface anchoring moieties used in ZnO nanoparticle-based dye-sensitized solar cells

Energy Technology Data Exchange (ETDEWEB)

Ganesh, T.; Kim, Jong Hoon; Yoon, Seog Joon; Kil, Byung-Ho; Maldar, N.N. [Inorganic Nano-Materials Laboratory, Department of Chemistry, Hanyang University, Sung-Dong-Ku, Haengdang-dong 17, Seoul (Korea, Republic of); Han, Jin Wook, E-mail: jwhan@hanyang.ac.kr [Inorganic Nano-Materials Laboratory, Department of Chemistry, Hanyang University, Sung-Dong-Ku, Haengdang-dong 17, Seoul (Korea, Republic of); Han, Sung-Hwan, E-mail: shhan@hanyang.ac.kr [Inorganic Nano-Materials Laboratory, Department of Chemistry, Hanyang University, Sung-Dong-Ku, Haengdang-dong 17, Seoul (Korea, Republic of)

2010-09-01

Photoactive, eco-friendly and high molar extinction coefficient, curcumin-derived dyes (BCMoxo and BCtCM) have been explored in ZnO nanoparticles (NPs)-based dye-sensitized solar cells (DSSCs). The boron complex curcumin dyes modified with di-carboxylic anchor groups (BCtCM) provided surface attachment with a strong UV-vis region absorption than the dye molecule without anchor groups (BCMoxo). Photoanodes primed with poly-dispersive ZnO NPs ({approx}80-50 nm) specifically devised for these dyes and optimized for the critical thickness, sensitization time and concentration using a solvent-free ionic electrolyte so as to get current density as high as 1.66 mA/cm{sup 2} under 80 mW/cm{sup 2} irradiation. Therefore, a successful conversion of visible light into electricity by using these curcumin-derived dyes (natural derived photoactive molecules) as photosensitizer in DSSCs would be a great interest in future studies for enhancing further conversion efficiencies.

Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

Energy Technology Data Exchange (ETDEWEB)

Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2015-01-07

Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

Convenient synthesis and application of versatile nucleic acid lipid membrane anchors in the assembly and fusion of liposomes

DEFF Research Database (Denmark)

Ries, Oliver; Löffler, Philipp M. G.; Vogel, Stefan

2015-01-01

or the construction of DNA origami structures. We herein present the synthesis and applications of versatile lipid membrane anchor building blocks suitable for solid phase oligonucleotide synthesis. These are readily synthesized in bulk in five to seven steps from commercially available precursors and can...

Microgravity Drill and Anchor System

Science.gov (United States)

Parness, Aaron; Frost, Matthew A.; King, Jonathan P.

2013-01-01

This work is a method to drill into a rock surface regardless of the gravitational field or orientation. The required weight-on-bit (WOB) is supplied by a self-contained anchoring mechanism. The system includes a rotary percussive coring drill, forming a complete sampling instrument usable by robot or human. This method of in situ sample acquisition using micro - spine anchoring technology enables several NASA mission concepts not currently possible with existing technology, including sampling from consolidated rock on asteroids, providing a bolt network for astronauts visiting a near-Earth asteroid, and sampling from the ceilings or vertical walls of lava tubes and cliff faces on Mars. One of the most fundamental parameters of drilling is the WOB; essentially, the load applied to the bit that allows it to cut, creating a reaction force normal to the surface. In every drilling application, there is a minimum WOB that must be maintained for the system to function properly. In microgravity (asteroids and comets), even a small WOB could not be supported conventionally by the weight of the robot or astronaut. An anchoring mechanism would be needed to resist the reactions, or the robot or astronaut would push themselves off the surface and into space. The ability of the system to anchor itself to a surface creates potential applications that reach beyond use in low gravity. The use of these anchoring mechanisms as end effectors on climbing robots has the potential of vastly expanding the scope of what is considered accessible terrain. Further, because the drill is supported by its own anchor rather than by a robotic arm, the workspace is not constrained by the reach of such an arm. Yet, if the drill is on a robotic arm, it has the benefit of not reflecting the forces of drilling back to the arm s joints. Combining the drill with the anchoring feet will create a highly mobile, highly stable, and highly reliable system. The drilling system s anchor uses hundreds of

Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution

Science.gov (United States)

Soo, Oi Yoon Michelle; Tan, Wooi Boon; Lim, Lee Hong Susan

2016-01-01

Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae) species infecting two marine mugilid (Teleostei: Mugilidae) fish hosts: Moolgarda buchanani (Bleeker) and Liza subviridis (Valenciennes) from Malaysia. Anchor shape and size data (n = 530) were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams’s Kmult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogenean anchor geometric morphometric data with morphological and phylogenetic data. Results. We discriminated 12 of the 13 Ligophorus species using anchor shape data. Significant phylogenetic signal was detected in anchor shape. Thus, we discovered new morphological characters based on anchor shaft shape, the length between the inner root point and the outer root

Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

DEFF Research Database (Denmark)

Olsen, Eva Maria

2012-01-01

Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

Anchoring of organic molecules to a metal surface: HtBDC on Cu(110)

DEFF Research Database (Denmark)

Schunack, M.; Petersen, L.; Kuhnle, A.

2001-01-01

The interaction of largish molecules with metal surfaces has been studied by combining the imaging and manipulation capabilities of the scanning tunneling microscope (STM). At the atomic scale, the STM results directly reveal that the adsorption of a largish organic molecule can induce...

The Holding Power of Anchors

Indian Academy of Sciences (India)

The efficiency of an anchor may be expressed as the ratio (holding force + weight of anchor). In dry sand .... the market at the beginning of the coming season in three sizes, namely 20, 35 and. 60 lb. These are ... Taylor frozen-flow hypothesis.

Anchoring effects on early autobiographical memories.

Science.gov (United States)

Greenberg, Daniel L; Bishara, Anthony J; Mugayar-Baldocchi, Marino A

2017-10-01

Studies of childhood memory typically show that our earliest memories come from between three and four years of age. This finding is not universal, however. The age estimate varies across cultures and is affected by social influences. Research from the judgments and decision-making literature suggests that these estimates might also involve a judgment under uncertainty. Therefore, they might be susceptible to less social influences such as heuristics and biases. To investigate this possibility, we conducted two experiments that used anchoring paradigms to influence participants' estimates of their age during early autobiographical memories. In Experiment 1, participants answered either a high-anchor or a low-anchor question, and were warned that the anchor was uninformative; they went on to estimate their age during their earliest autobiographical memory. In Experiment 2, we replicated Experiment 1 and extended the design to examine additional early autobiographical memories. In both experiments, participants in the low-anchor condition gave earlier age estimates than those in the high-anchor condition. These results provide new insights into the methods used to investigate autobiographical memory. Moreover, they show that reports of early autobiographical memories can be influenced by a relatively light touch - a change to a single digit in a single question.

An earth anchor system: installation and design guide.

Science.gov (United States)

R.L. Copstead; D.D. Studier

1990-01-01

A system for anchoring the guylines and skylines of cable yarding equipment is presented. A description of three types of tipping plate anchors is given. Descriptions of the installation equipment and methods specific to each type are given. Procedures for determining the correct number of anchors to install are included, as are guidelines for installing the anchors so...

DNA nanotechnology-enabled biosensors.

Science.gov (United States)

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

Science.gov (United States)

Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

2015-03-01

Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

DNA Open states and DNA hydratation

International Nuclear Information System (INIS)

Lema-Larre, B. de; Martin-Landrove, M

1995-01-01

It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

Improving performance by anchoring movement and "nerves".

Science.gov (United States)

Iso-Ahola, Seppo E; Dotson, Charles O; Jagodinsky, Adam E; Clark, Lily C; Smallwood, Lorraine L; Wilburn, Christopher; Weimar, Wendi H; Miller, Matthew W

2016-10-01

Golf's governing bodies' recent decision to ban all putting styles "anchoring one end of the club against the body" bridges an important practical problem with psychological theory. We report the first experiment testing whether anchoring provides technical and/or psychological advantage in competitive performance. Many "greats" of professional golf from Arnold Palmer and Jack Nicklaus to Tiger Woods have argued against anchoring, believing that it takes "nerves" out of competitive performance and therefore artificially levels the playing field. To shed more light on the issue, we tested participants' performance with anchored and unanchored putters under low and high pressure when controlling for the putter length. We found no statistically significant evidence for a technical advantage due to anchoring but a clear psychological advantage: participants who anchored their putters significantly outperformed unanchored counterparts under high, but not low, pressure. Results provide tentative evidence for the ban's justification from a competitive standpoint. However, before any definite conclusions can be made, more research is needed when using high-level golfers. Copyright © 2016 Elsevier B.V. All rights reserved.

Testing and modeling of cyclically loaded rock anchors

Directory of Open Access Journals (Sweden)

Joar Tistel

2017-12-01

Full Text Available The Norwegian Public Roads Administration (NPRA is planning for an upgrade of the E39 highway route at the westcoast of Norway. Fixed links shall replace ferries at seven fjord crossings. Wide spans and large depths at the crossings combined with challenging subsea topography and environmental loads call for an extension of existing practice. A variety of bridge concepts are evaluated in the feasibility study. The structures will experience significant loads from deadweight, traffic and environment. Anchoring of these forces is thus one of the challenges met in the project. Large-size subsea rock anchors are considered a viable alternative. These can be used for anchoring of floating structures but also with the purpose of increasing capacity of fixed structures. This paper presents first a thorough study of factors affecting rock anchor bond capacity. Laboratory testing of rock anchors subjected to cyclic loading is thereafter presented. Finally, the paper presents a model predicting the capacity of a rock anchor segment, in terms of a ribbed bar, subjected to a cyclic load history. The research assumes a failure mode occurring in the interface between the rock anchor and the surrounding grout. The constitutive behavior of the bonding interface is investigated for anchors subjected to cyclic one-way tensile loads. The model utilizes the static bond capacity curve as a basis, defining the ultimate bond τbu and the slip s1 at τbu. A limited number of input parameters are required to apply the model. The model defines the bond-slip behavior with the belonging rock anchor capacity depending on the cyclic load level (τmax cy/τbu, the cyclic load ratio (R = τmin cy/τmax cy, and the number of load cycles (N. The constitutive model is intended to model short anchor lengths representing an incremental length of a complete rock anchor.

The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

Science.gov (United States)

Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

2018-01-09

Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

A prominent anchoring effect on the kinetic control of drug release from mesoporous silica nanoparticles (MSNs).

Science.gov (United States)

Tran, Vy Anh; Lee, Sang-Wha

2018-01-15

This work demonstrated kinetically controlled release of model drugs (ibuprofen, FITC) from well-tailored mesoporous silica nanoparticles (MSNs) depending on the surface charges and molecular sizes of the drugs. The molecular interactions between entrapped drugs and the pore walls of MSNs controlled the release of the drugs through the pore channels of MSNs. Also, polydopamine (PDA) layer-coated MSNs (MSNs@PDA) was quite effective to retard the release of large FITC, in contrast to a slight retardation effect on relatively small Ibuprofen. Of all things, FITC (Fluorescein isothiocyanate)-labeled APTMS (3-aminopropyltrimethoxysilane) (APTMS-FITC conjugates) grafted onto the MSNs generate a pinch-effect on the pore channel (so-called a prominent anchoring effect), which was highly effective in trapping (or blocking) drug molecules at the pore mouth of the MSNs. The anchored APTMS-FITC conjugates provided not only tortuous pathways to the diffusing molecules, but also sustained release of the ibuprofen over a long period of time (∼7days). The fast release kinetics was predicted by an exponential equation based on Fick's law, while the slow release kinetics was predicted by Higuchi model. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

Science.gov (United States)

Eernisse, D J

1992-04-01

DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

Influence of Anchoring on Burial Depth of Submarine Pipelines.

Science.gov (United States)

Zhuang, Yuan; Li, Yang; Su, Wei

2016-01-01

Since the beginning of the twenty-first century, there has been widespread construction of submarine oil-gas transmission pipelines due to an increase in offshore oil exploration. Vessel anchoring operations are causing more damage to submarine pipelines due to shipping transportation also increasing. Therefore, it is essential that the influence of anchoring on the required burial depth of submarine pipelines is determined. In this paper, mathematical models for ordinary anchoring and emergency anchoring have been established to derive an anchor impact energy equation for each condition. The required effective burial depth for submarine pipelines has then been calculated via an energy absorption equation for the protection layer covering the submarine pipelines. Finally, the results of the model calculation have been verified by accident case analysis, and the impact of the anchoring height, anchoring water depth and the anchor weight on the required burial depth of submarine pipelines has been further analyzed.

Fluorescence Microscopy of Nanochannel-Confined DNA.

Science.gov (United States)

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

International Nuclear Information System (INIS)

Yamamoto, Takatoki; Fujii, Teruo

2010-01-01

Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

Ringstone anchors from Gujarat, west coast of India

Digital Repository Service at National Institute of Oceanography (India)

Gaur, A.S.; Sundaresh; Tripati, S.; Bandodkar, S.N.

of Dwarka and Somanath have yielded several ringstone anchors along with other stone anchors such as triangular and grapnel types. The raw material used for these ring stones comprises basalt, sandstone and limestone. Earlier, these anchors were identified...

Estimating single molecule conductance from spontaneous evolution of a molecular contact

Science.gov (United States)

Gil, M.; Malinowski, T.; Iazykov, M.; Klein, H. R.

2018-03-01

We present an original method to estimate the conductivity of a single molecule anchored to nanometric-sized metallic electrodes, using a Mechanically Controlled Break Junction operated at room temperature in the liquid. We record the conductance through the metal/molecules/metal nanocontact while keeping the metallic electrodes at a fixed distance. Taking advantage of thermal diffusion and electromigration, we let the contact naturally explore the more stable configurations around a chosen conductance value. The conductance of a single molecule is estimated from a statistical analysis of raw conductance and conductance standard deviation data for molecular contacts containing up to 14 molecules. The single molecule conductance values are interpreted as time-averaged conductance of an ensemble of conformers at thermal equilibrium.

Influence of Anchoring on Burial Depth of Submarine Pipelines.

Directory of Open Access Journals (Sweden)

Yuan Zhuang

Full Text Available Since the beginning of the twenty-first century, there has been widespread construction of submarine oil-gas transmission pipelines due to an increase in offshore oil exploration. Vessel anchoring operations are causing more damage to submarine pipelines due to shipping transportation also increasing. Therefore, it is essential that the influence of anchoring on the required burial depth of submarine pipelines is determined. In this paper, mathematical models for ordinary anchoring and emergency anchoring have been established to derive an anchor impact energy equation for each condition. The required effective burial depth for submarine pipelines has then been calculated via an energy absorption equation for the protection layer covering the submarine pipelines. Finally, the results of the model calculation have been verified by accident case analysis, and the impact of the anchoring height, anchoring water depth and the anchor weight on the required burial depth of submarine pipelines has been further analyzed.

Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

Science.gov (United States)

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

KAUST Repository

Shirbini, Afnan

2017-01-01

and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

Membrane-assisted growth of DNA origami nanostructure arrays.

Science.gov (United States)

Kocabey, Samet; Kempter, Susanne; List, Jonathan; Xing, Yongzheng; Bae, Wooli; Schiffels, Daniel; Shih, William M; Simmel, Friedrich C; Liedl, Tim

2015-01-01

Biological membranes fulfill many important tasks within living organisms. In addition to separating cellular volumes, membranes confine the space available to membrane-associated proteins to two dimensions (2D), which greatly increases their probability to interact with each other and assemble into multiprotein complexes. We here employed two DNA origami structures functionalized with cholesterol moieties as membrane anchors--a three-layered rectangular block and a Y-shaped DNA structure--to mimic membrane-assisted assembly into hierarchical superstructures on supported lipid bilayers and small unilamellar vesicles. As designed, the DNA constructs adhered to the lipid bilayers mediated by the cholesterol anchors and diffused freely in 2D with diffusion coefficients depending on their size and number of cholesterol modifications. Different sets of multimerization oligonucleotides added to bilayer-bound origami block structures induced the growth of either linear polymers or two-dimensional lattices on the membrane. Y-shaped DNA origami structures associated into triskelion homotrimers and further assembled into weakly ordered arrays of hexagons and pentagons, which resembled the geometry of clathrin-coated pits. Our results demonstrate the potential to realize artificial self-assembling systems that mimic the hierarchical formation of polyhedral lattices on cytoplasmic membranes.

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

Science.gov (United States)

Nayak, Alpana; Suresh, K. A.

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

Science.gov (United States)

Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

2017-01-01

The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

Energy Technology Data Exchange (ETDEWEB)

Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

2015-06-01

Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

The Use of Comics-Based Cases in Anchored Instruction

Science.gov (United States)

Kneller, Matthew F.

2009-01-01

The primary purpose of this research was to understand how comics fulfill the role of anchor in an anchored instruction learning environment. Anchored instruction addresses the inert knowledge problem through the use of realistic multimedia stories, or "anchors," that embed a problem and the necessary data to solve it within the narrative. In the…

Effects of accuracy motivation and anchoring on metacomprehension judgment and accuracy.

Science.gov (United States)

Zhao, Qin

2012-01-01

The current research investigates how accuracy motivation impacts anchoring and adjustment in metacomprehension judgment and how accuracy motivation and anchoring affect metacomprehension accuracy. Participants were randomly assigned to one of six conditions produced by the between-subjects factorial design involving accuracy motivation (incentive or no) and peer performance anchor (95%, 55%, or no). Two studies showed that accuracy motivation did not impact anchoring bias, but the adjustment-from-anchor process occurred. Accuracy incentive increased anchor-judgment gap for the 95% anchor but not for the 55% anchor, which induced less certainty about the direction of adjustment. The findings offer support to the integrative theory of anchoring. Additionally, the two studies revealed a "power struggle" between accuracy motivation and anchoring in influencing metacomprehension accuracy. Accuracy motivation could improve metacomprehension accuracy in spite of anchoring effect, but if anchoring effect is too strong, it could overpower the motivation effect. The implications of the findings were discussed.

Dynamic performance of concrete undercut anchors for Nuclear Power Plants

Energy Technology Data Exchange (ETDEWEB)

Mahrenholtz, Christoph, E-mail: christoph@mahrenholtz.net; Eligehausen, Rolf

2013-12-15

Graphical abstract: - Highlights: • Behavior of undercut anchors under dynamic actions simulating earthquakes. • First high frequency load and crack cycling tests on installed concrete anchors ever. • Comprehensive review of anchor qualification for Nuclear Power Plants. - Abstract: Post-installed anchors are widely used for structural and nonstructural connections to concrete. In many countries, concrete anchors used for Nuclear Power Plants have to be qualified to ensure reliable behavior even under extreme conditions. The tests required for qualification of concrete anchors are carried out at quasi-static loading rates well below the rates to be expected for dynamic actions deriving from earthquakes, airplane impacts or explosions. To investigate potentially beneficial effects of high loading rates and cycling frequencies, performance tests on installed undercut anchors were conducted. After introductory notes on anchor technology and a comprehensive literature review, this paper discusses the qualification of anchors for Nuclear Power Plants and the testing carried out to quantify experimentally the effects of dynamic actions on the load–displacement behavior of undercut anchors.

A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

Science.gov (United States)

Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

2017-11-17

The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

International Nuclear Information System (INIS)

Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

1999-01-01

The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

DNA damage, homology-directed repair, and DNA methylation.

Directory of Open Access Journals (Sweden)

Concetta Cuozzo

2007-07-01

Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

End-anchored polymers in good solvents from the single chain limit to high anchoring densities.

Science.gov (United States)

Whitmore, Mark D; Grest, Gary S; Douglas, Jack F; Kent, Michael S; Suo, Tongchuan

2016-11-07

An increasing number of applications utilize grafted polymer layers to alter the interfacial properties of solid substrates, motivating refinement in our theoretical understanding of such layers. To assess existing theoretical models of them, we have investigated end-anchored polymer layers over a wide range of grafting densities, σ, ranging from a single chain to high anchoring density limits, chain lengths ranging over two orders of magnitude, for very good and marginally good solvent conditions. We compare Monte Carlo and molecular dynamics simulations, numerical self-consistent field calculations, and experimental measurements of the average layer thickness, h, with renormalization group theory, the Alexander-de Gennes mushroom theory, and the classical brush theory. Our simulations clearly indicate that appreciable inter-chain interactions exist at all simulated areal anchoring densities so that there is no mushroom regime in which the layer thickness is independent of σ. Moreover, we find that there is no high coverage regime in which h follows the predicted scaling, h ∼ Nσ 1/3 , for classical polymer brushes either. Given that no completely adequate analytic theory seems to exist that spans wide ranges of N and σ, we applied scaling arguments for h as a function of a suitably defined reduced anchoring density, defined in terms of the solution radius of gyration of the polymer chains and N. We find that such a scaling approach enables a smooth, unified description of h in very good solvents over the full range of anchoring density and chain lengths, although this type of data reduction does not apply to marginal solvent quality conditions.

Studies on the mechanical behavior of rock anchors. ; Results of in-situ pull-out tests. Rock anchor no rikigaku kyodo ni kansuru kenkyu. ; Gen prime ichi shiken ni okeru anchor no kyodo

Energy Technology Data Exchange (ETDEWEB)

Arimoto, K.; Ebisu, S.; Nakagawa, M.; Usui, M.; Someya, T.; Machida, N. (Okumura Corp., Tokyo (Japan))

1991-10-31

The rock anchor method is planned to apply to some permanent structures but since this method was developed for temporary structures, the clarification of the transferring mechanism of force from an anchor to a rockmass, the fracture mechanism and the development of the dynamic model have not been established. This paper arranged the data obtained by a full-scale, in-situ pulling out test of a rock anchor as the first step to understand the dynamic behavior and analyzed by paying attetion to the modulus of deformation of the rockmass where the anchor was embedded to elucidate the affecting degree of rockmass modulus of deformation, the embedded length and the tendon diameter on the dynamic behavior of the anchor. The rock anchor behavior could be expressed accurately by applying a theoretical solution derived by the balancing condition of forces at the boundary face. Especially, when the rockmass is uniform and the fracture occurrs at the interface between the tendon and grout, this approach can express the fracture with the accuracy similar to that made by the finite element method. 6 refs., 11 figs.,1 tab.

Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

Directory of Open Access Journals (Sweden)

Zach Hensel

Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

Uncovering the Peptide-Binding Specificities of HLA-C: A General Strategy To Determine the Specificity of Any MHC Class I Molecule

DEFF Research Database (Denmark)

Rasmussen, Michael; Harndahl, Mikkel; Stryhn, Anette

2014-01-01

MHC class I molecules (HLA-I in humans) present peptides derived from endogenous proteins to CTLs. Whereas the peptide-binding specificities of HLA-A and -B molecules have been studied extensively, little is known about HLA-C specificities. Combining a positional scanning combinatorial peptide...... library approach with a peptide-HLA-I dissociation assay, in this study we present a general strategy to determine the peptide-binding specificity of any MHC class I molecule. We applied this novel strategy to 17 of the most common HLA-C molecules, and for 16 of these we successfully generated matrices...... representing their peptide-binding motifs. The motifs prominently shared a conserved C-terminal primary anchor with hydrophobic amino acid residues, as well as one or more diverse primary and auxiliary anchors at P1, P2, P3, and/or P7. Matrices were used to generate a large panel of HLA-C-specific peptide...

Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

International Nuclear Information System (INIS)

Gareev, F.A.; Gareeva, G.F.

2001-01-01

Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

Containment liner plate anchors and steel embedments test results

International Nuclear Information System (INIS)

Chang-Lo, P.L.; Johnson, T.E.; Pfeifer, B.W.

1977-01-01

This paper summarizes test data on shear load and deformation capabilities for liner plate line anchors and structural steel embedments in reinforced and prestressed concrete nuclear containments. Reinforced and prestressed nuclear containments designed and constructed in the United States are lined with a minimum of 0.64 cm steel plate. The liner plates are anchored by the use of either studs or structural members (line anchors) which usually run in the vertical direction. This paper will only address line anchors. Static load versus displacement test data is necessary to assure that the design is adequate for the maximum loads. The test program for the liner anchors had the following major objectives: determine load versus displacement data for a variety of anchors considering structural tees and small beams with different weld configurations, from the preceding tests, determine which anchors would lead to an economical and extremely safe design and test these anchors for cyclic loads resulting from thermal fluctuations. Various concrete embeds in the containment and other structures are subjected to loads such as pipe rupture which results in shear. Since many of the loads are transient by nature, it is necessary to know the load-displacement relationship so that the energy absorption can be determined. The test program for the embeds had the following objectives: determine load-displacement relationship for various size anchors from 6.5 cm 2 to 26 cm 2 with maximum capacities of approximately 650 kN; determine the effect of various anchor width-to-thickness ratios for the same shear area

Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

International Nuclear Information System (INIS)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

2017-01-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

Science.gov (United States)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

2017-03-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

Science.gov (United States)

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

Quantitive DNA Fiber Mapping

Energy Technology Data Exchange (ETDEWEB)

Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

2008-01-28

Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

Modified Kidner procedure utilizing a Mitek bone anchor.

Science.gov (United States)

Dawson, D M; Julsrud, M E; Erdmann, B B; Jacobs, P M; Ringstrom, J B

1998-01-01

The recent development of small bone suture anchors has created several potential applications in reconstructive surgery of the foot. Mitek bone anchors are simple to insert, require less aggressive dissection and surgical time than reefing of the redundant posterior tibial tendon, and are a reliable method of tendon-to-bone fixation. Mitek bone anchors are an excellent technique for the treatment of redundant tibialis posterior tendon following a modified Kidner procedure. In modified Kidner procedures involving an excessively large os tibiale externum, Mitek anchoring of the redundant tibialis posterior tendon to the navicular bone is an excellent means for secure plication of the posterior tibial tendon in cases involving intraoperative tendon laxity. A description of the Mitek Anchor System and technique of application in a modified Kinder procedure is presented. The purpose of this study was to describe patient satisfaction and long-term clinical outcomes of the modified Kinder procedure with and without the Mitek bone anchoring system. A retrospective study of the modified Kinder procedure was performed with 13 patients being evaluated, seven with Mitek anchoring and six without. The University of Maryland 100-point Painful Foot Center Scoring System was modified to be more specific to the modified Kinder procedure for assessment of subjective long-term results. Patient overall satisfaction was rated good to excellent by 85.6% of patients in the Mitek group and by 100% of patients in the non-Mitek group. Use of the Mitek anchor allowed for quicker postoperative recovery to resumption of ambulation without assistive devices (average of 3 weeks vs. 4.42 weeks) and a quicker return to pain-free ambulation in normal shoegear (average of 4 weeks vs. 6 weeks). Mitek anchoring of the tibialis posterior tendon, theoretically, increases medial arch support as evidenced by 14% of the Mitek group and 67% of the non-Mitek group requiring postoperative orthotics.

Editorial Commentary: All-Suture Anchors, Foam Blocks, and Biomechanical Testing.

Science.gov (United States)

Brand, Jefferson C

2017-06-01

Barber's biomechanical work is well known to Arthroscopy's readers as thorough, comprehensive, and inclusive of new designs as they become available. In "All-Suture Anchors: Biomechanical Analysis of Pullout Strength, Displacement, and Failure Mode," the latest iteration, Barber and Herbert test all-suture anchors in both porcine femurs and biphasic foam. While we await in vivo clinical trials that compare all-suture anchors to currently used anchors, Barber and Herbert have provided data to inform anchor choice, and using their biomechanical data at time zero from all-suture anchor trials in an animal model, we can determine the anchors' feasibility for human clinical investigations. Copyright © 2017 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

DNA nanotechnology

Science.gov (United States)

Seeman, Nadrian C.; Sleiman, Hanadi F.

2018-01-01

DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

Science.gov (United States)

Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

2018-06-27

Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

DNA maintenance in plastids and mitochondria of plants

Directory of Open Access Journals (Sweden)

Delene J Oldenburg

2015-10-01

Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.

Adsorption phenomena and anchoring energy in nematic liquid crystals

CERN Document Server

Barbero, Giovanni

2005-01-01

Despite the large quantity of phenomenological information concerning the bulk properties of nematic phase liquid crystals, little is understood about the origin of the surface energy, particularly the surface, interfacial, and anchoring properties of liquid crystals that affect the performance of liquid crystal devices. Self-contained and unique, Adsorption Phenomena and Anchoring Energy in Nematic Liquid Crystals provides an account of new and established results spanning three decades of research into the problems of anchoring energy and adsorption phenomena in liquid crystals.The book contains a detailed discussion of the origin and possible sources of anchoring energy in nematic liquid crystals, emphasizing the dielectric contribution to the anchoring energy in particular. Beginning with fundamental surface and anchoring properties of liquid crystals and the definition of the nematic phase, the authors explain how selective ion adsorption, dielectric energy density, thickness dependence, and bias voltage...

Outcomes of the modified Brostrom procedure using suture anchors for chronic lateral ankle instability--a prospective, randomized comparison between single and double suture anchors.

Science.gov (United States)

Cho, Byung-Ki; Kim, Yong-Min; Kim, Dong-Soo; Choi, Eui-Sung; Shon, Hyun-Chul; Park, Kyoung-Jin

2013-01-01

The present prospective, randomized study was conducted to compare the clinical outcomes of the modified Brostrom procedure using single and double suture anchors for chronic lateral ankle instability. A total of 50 patients were followed up for more than 2 years after undergoing the modified Brostrom procedure. Of the 50 procedures, 25 each were performed using single and double suture anchors by 1 surgeon. The Karlsson scale had improved significantly to 89.8 points and 90.6 points in the single and double anchor groups, respectively. Using the Sefton grading system, 23 cases (92%) in the single anchor group and 22 (88%) in the double anchor group achieved satisfactory results. The talar tilt angle and anterior talar translation on stress radiographs using the Telos device had improved significantly to an average of 5.7° and 4.6 mm in the single anchor group and 4.5° and 4.3 mm in the double anchor group, respectively. The double anchor technique was superior with respect to the postoperative talar tilt. The single and double suture anchor techniques produced similar clinical and functional outcomes, with the exception of talar tilt as a reference of mechanical stability. The modified Brostrom procedure using both single and double suture anchors appears to be an effective treatment method for chronic lateral ankle instability. Copyright © 2013 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Single Molecule Nano-Metronome

Science.gov (United States)

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

DNA Repair Systems

Indian Academy of Sciences (India)

DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

Understanding the low uptake of bone-anchored hearing aids: a review.

Science.gov (United States)

Powell, R; Wearden, A; Pardesi, S M; Green, K

2017-03-01

Bone-anchored hearing aids improve hearing for patients for whom conventional behind-the-ear aids are problematic. However, uptake of bone-anchored hearing aids is low and it is important to understand why this is the case. A narrative review was conducted. Studies examining why people accept or decline bone-anchored hearing aids and satisfaction levels of people with bone-anchored hearing aids were reviewed. Reasons for declining bone-anchored hearing aids included limited perceived benefits, concerns about surgery, aesthetic concerns and treatment cost. No studies providing in-depth analysis of the reasons for declining or accepting bone-anchored hearing aids were identified. Studies of patient satisfaction showed that most participants reported benefits with bone-anchored hearing aids. However, most studies used cross-sectional and/or retrospective designs and only included people with bone-anchored hearing aids. Important avenues for further research are in-depth qualitative research designed to fully understand the decision-making process for bone-anchored hearing aids and rigorous quantitative research comparing satisfaction of people who receive bone-anchored hearing aids with those who receive alternative (or no) treatments.

Career anchors and learning plan (part one

Directory of Open Access Journals (Sweden)

Daniela Brečko

2006-12-01

Full Text Available The article is divided into three parts. The first part concentrates on how important career is for an individual, organization and society. The author establishes that understanding of career has changed dramatically and does not only refer to climbing up the career ladder, but also moving off or even down the career ladder. The notion of career, as a lifelong and professional path, encompasses all aspects of human personality and their roles acquired through one's life. On basis of vast and longitudinal research, where the author has studied career anchors of individuals, it is the objective of the author to find out on basis of what grounds do the individuals decide to take certain directions in their careers and how learning contributes to such decisions. As a source the author has used Shein's theory of career anchors. Part one describes in greater detail 8 different career anchors and introduces their main features with the findings of the research, which refer to the analysis of professions (work positions and established career anchors. The author thus verifies the hypothesis that career anchors do exist in our area.

Self-tapping ability of carbon fibre reinforced polyetheretherketone suture anchors.

Science.gov (United States)

Feerick, Emer M; Wilson, Joanne; Jarman-Smith, Marcus; Ó'Brádaigh, Conchur M; McGarry, J Patrick

2014-10-01

An experimental and computational investigation of the self-tapping ability of carbon fibre reinforced polyetheretherketone (CFR-PEEK) has been conducted. Six CFR-PEEK suture anchor designs were investigated using PEEK-OPTIMA® Reinforced, a medical grade of CFR-PEEK. Experimental tests were conducted to investigate the maximum axial force and torque required for self-taping insertion of each anchor design. Additional experimental tests were conducted for some anchor designs using pilot holes. Computational simulations were conducted to determine the maximum stress in each anchor design at various stages of insertion. Simulations also were performed to investigate the effect of wall thickness in the anchor head. The maximum axial force required to insert a self-tapping CFR-PEEK suture anchor did not exceed 150 N for any anchor design. The maximum torque required to insert a self-tapping CFR-PEEK suture anchor did not exceed 0.8 Nm. Computational simulations reveal significant stress concentrations in the region of the anchor tip, demonstrating that a re-design of the tip geometry should be performed to avoid fracture during self-tapping, as observed in the experimental component of this study. This study demonstrates the ability of PEEK-OPTIMA Reinforced suture anchors to self-tap polyurethane foam bone analogue. This provides motivation to further investigate the self-tapping ability of CFR-PEEK suture anchors in animal/cadaveric bone. An optimised design for CFR-PEEK suture anchors offers the advantages of radiolucency, and mechanical properties similar to bone with the ability to self-tap. This may have positive implications for reducing surgery times and the associated costs with the procedure. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Career anchors and values from different career management perspectives

Directory of Open Access Journals (Sweden)

Rodrigo Cunha da Silva

2016-06-01

Full Text Available Purpose – To analyze the relationships between career anchors and young Generation Y professionals’ values, from the career concept perspective. Design/methodology/approach – Research concerning the proposed objective was carried out through quantitative research involving 189 Business Administration majors from a Catholic university in São Paulo, Brazil. We used two instruments to identify the career anchors and values of respondents: Schein (1990 and Schwartz (1994, respectively. We used statistical techniques to explore the relationships between career anchors and values. Findings – Among the results, mention should be made to the statistical relationships found between analyzed career anchors and values. It is also important to stress that, although the Lifestyle career anchor was predominantly present in the conglomerate division, this anchor was the predominant characteristic in the differentiation of the smaller group of respondents, the new career group. The General Management Career Anchor, which presents a lower incidence, is the predominant characteristic of the larger group, referring to organizational careers. As well as the Lifestyle career anchor, the Hedonism value was predominant among respondents. Originality/value – The need to consider the following was found: Generation Y presents generational characteristics that drive people management to propose work structures that offer activities to generate learning, pleasure, self-fulfillment and conciliation between work and personal life.

Test Score Equating Using Discrete Anchor Items versus Passage-Based Anchor Items: A Case Study Using "SAT"® Data. Research Report. ETS RR-14-14

Science.gov (United States)

Liu, Jinghua; Zu, Jiyun; Curley, Edward; Carey, Jill

2014-01-01

The purpose of this study is to investigate the impact of discrete anchor items versus passage-based anchor items on observed score equating using empirical data.This study compares an "SAT"® critical reading anchor that contains more discrete items proportionally, compared to the total tests to be equated, to another anchor that…

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

Science.gov (United States)

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

Science.gov (United States)

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Activation of the CXCR3 chemokine receptor through anchoring of a small molecule chelator ligand between TM-III, -IV, and -VI

DEFF Research Database (Denmark)

Rosenkilde, Mette M; Andersen, Michael B; Nygaard, Rie

2006-01-01

modeling and molecular simulations combined with mutational analysis indicated that the metal ion site-anchored chelators act as agonists by establishing an aromatic-aromatic, second-site interaction with TyrVI:16 on the inner face of TM-VI. It is noteworthy that this interaction required......Seven transmembrane segment (7TM) receptors are activated through a common, still rather unclear molecular mechanism by a variety of chemical messengers ranging from monoamines to large proteins. By introducing a His residue at position III:05 in the CXCR3 receptor a metal ion site was built...... between the extracellular ends of transmembrane (TM) III and TM-IV to anchor aromatic chelators at a location corresponding to the presumed binding pocket for adrenergic receptor agonists. In this construct, free metal ions had no agonistic effect in accordance with the optimal geometry of the metal ion...

On Moderator Detection in Anchoring Research: Implications of Ignoring Estimate Direction

Directory of Open Access Journals (Sweden)

Nathan N. Cheek

2018-05-01

Full Text Available Anchoring, whereby judgments assimilate to previously considered standards, is one of the most reliable effects in psychology. In the last decade, researchers have become increasingly interested in identifying moderators of anchoring effects. We argue that a drawback of traditional moderator analyses in the standard anchoring paradigm is that they ignore estimate direction—whether participants’ estimates are higher or lower than the anchor value. We suggest that failing to consider estimate direction can sometimes obscure moderation in anchoring tasks, and discuss three potential analytic solutions that take estimate direction into account. Understanding moderators of anchoring effects is essential for a basic understanding of anchoring and for applied research on reducing the influence of anchoring in real-world judgments. Considering estimate direction reduces the risk of failing to detect moderation.

Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

International Nuclear Information System (INIS)

Gareev, F.A.; Gareeva, G.F.

2001-01-01

Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

Comparative Study on Different Slot Forms of Prestressed Anchor Blocks

Science.gov (United States)

Fan, Rong; Si, Jianhui; Jian, Zheng

2018-03-01

In this paper, two models of prestressed pier, rectangular cavity anchor block and arch hollow anchor block are established. The ABAQUS software was used to calculate the stress of the surface of the neck of the pier and the cavity of the anchor block, through comparative analysis. The results show that compared with the rectangular cavity anchor block, the stress of the pier and the cavity can be effectively reduced when the arch hole is used, and the amount of prestressed anchor can be reduced, so as to obtain obvious economic benefits.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

Science.gov (United States)

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

Biased calculations: Numeric anchors influence answers to math equations

Directory of Open Access Journals (Sweden)

Andrew R. Smith

2011-02-01

Full Text Available People must often perform calculations in order to produce a numeric estimate (e.g., a grocery-store shopper estimating the total price of his or her shopping cart contents. The current studies were designed to test whether estimates based on calculations are influenced by comparisons with irrelevant anchors. Previous research has demonstrated that estimates across a wide range of contexts assimilate toward anchors, but none has examined estimates based on calculations. In two studies, we had participants compare the answers to math problems with anchors. In both studies, participants' estimates assimilated toward the anchor values. This effect was moderated by time limit such that the anchoring effects were larger when the participants' ability to engage in calculations was limited by a restrictive time limit.

Structural Transitions in Supercoiled Stretched DNA

Science.gov (United States)

v, Croquette

1998-03-01

Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

Fabrication of Chitosan-gold Nanocomposites Combined with Optical Fiber as SERS Substrates to Detect Dopamine Molecules

Energy Technology Data Exchange (ETDEWEB)

Lim, Jaewook; Kang, Ikjoong [Gachon Univ., Seongnam (Korea, Republic of)

2014-01-15

This research was aimed to fabricate an optical fiber-based SERS substrate which can detect dopamine neurotransmitters. Chitosan nanoparticles (NPs) were firstly anchored on the surface of optical fiber, and then gold layer was subseque N{sub T}ly deposited on the anchored chitosan NPs via electroless plating method. Finally, chitosan-gold nanocomposites combined with optical fiber reacted with dopamine molecules of 100-1500 mg/ day which is a standard daily dose for Parkinson's disease patientss. The amplified Raman signal at 1348 cm{sup -1} obtained from optical fiber-based SERS substrate was plotted versus dopamine concentrations (1-10 mM), demonstrating an approximate linearity of Y = 303.03X + 2385.8 (R{sup 2} = 0.97) with narrow margin errors. The optical fiber-based Raman system can be potentially applicable to in-vitro (or in-vivo) detection of probe molecules.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

Science.gov (United States)

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Single Molecule Nano-Metronome

OpenAIRE

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2006-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

Modeling DNA

Science.gov (United States)

Robertson, Carol

2016-01-01

Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

The elastic theory of a single DNA molecule

Indian Academy of Sciences (India)

methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

Science.gov (United States)

Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

2018-02-27

In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

Biofunctionalization of zinc oxide nanowires for DNA sensory applications

Directory of Open Access Journals (Sweden)

Rudolph Bettina

2011-01-01

Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

Computational design of molecules for dye sensitized solar cells and nano electronics

DEFF Research Database (Denmark)

Ørnsø, Kristian Baruël

sensitized solar cell (DSSC) in terms of a loss-less level alignment quality. This scoring only takes into account a simplified absorption spectrum of the dye in combination with the alignment between the molecular levels, the semi-conductor conduction band edge and the redox mediator. To improve on this...... a molecular junction, is by controlling the junction geometry. This is achieved by designing a molecule with two sets of anchor groups, which bind to gold with significantly different strengths. Hence, it is proposed that the geometry can be controlled by chemical passivisation of one type of anchor group....... Using a simple computational model, this experimental hypothesis is verified and the change in conductance upon changing junction geometry is reproduced....

Concentrating and labeling genomic DNA in a nanofluidic array

DEFF Research Database (Denmark)

Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

2018-01-01

, however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

76 FR 30301 - Commercial Acquisition; Anchor Tenancy

Science.gov (United States)

2011-05-25

... NATIONAL AERONAUTICS AND SPACE ADMINISTRATION 48 CFR Part 1812 RIN 2700-AD64 Commercial... consistent with NASA's authority under Section 401 of the Commercial Space Competitiveness Act (CSCA) of 1992. NASA may enter into multi-year anchor tenancy contracts for commercial space goods or services. Anchor...

A comparison of lateral ankle ligament suture anchor strength.

Science.gov (United States)

Barber, F Alan; Herbert, Morley A; Crates, John M

2013-06-01

Lateral ankle ligament repairs increasingly use suture anchors instead of bone tunnels. Our purpose was to compare the biomechanical properties of a knotted and knotless suture anchor appropriate for a lateral ankle ligament reconstruction. In porcine distal fibulae, 10 samples of 2 different PEEK anchors were inserted. The attached sutures were cyclically loaded between 10N and 60N for 200 cycles. A destructive pull was performed and failure loads, cyclic displacement, stiffness, and failure mode recorded. PushLock 2.5 anchors failed before 200 cycles. PushLock 100 cycle displacement was less than Morphix 2.5 displacement (panchors completing 200 cycles was 86.5N (PushLock) and 252.1N (Morphix) (panchor breaking and suture breakage. The knotted Morphix demonstrated more displacement and greater failure strength than the knotless PushLock. The PushLock failed consistently with suture breaking. The Morphix anchor failed both by anchor breaking and by suture breaking. Copyright © 2012 European Foot and Ankle Society. Published by Elsevier Ltd. All rights reserved.

Detection of DNA hybridizations using solid-state nanopores

International Nuclear Information System (INIS)

Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng

2010-01-01

We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

Detection of DNA hybridizations using solid-state nanopores

Energy Technology Data Exchange (ETDEWEB)

Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)

2010-08-20

We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

Directory of Open Access Journals (Sweden)

Francesco Gentile

2018-04-01

Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

International Nuclear Information System (INIS)

Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

2014-01-01

The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

Directory of Open Access Journals (Sweden)

Lindy L. Esterhuizen

2012-09-01

Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

Post-installed concrete anchors in nuclear power plants: Performance and qualification

International Nuclear Information System (INIS)

Mahrenholtz, Philipp; Eligehausen, Rolf

2015-01-01

Graphical abstract: - Highlights: • Review of qualification and design regulations for anchors in nuclear power plants. • First complete set of nuclear anchor load–displacement data and its evaluation ever. • Demonstration of robust test behavior of a qualified post-installed anchor product. - Abstract: In nuclear power plants (NPPs), post-installed anchors are widely used for structural and non-structural connections to concrete. In many countries, anchor products employed for safety relevant applications have to be approved by the authorities. For the high safety standards in force for NPPs, special requirements have to be met to allow for extreme design situations. This paper presents an experimental test program conducted to evaluate the performance of anchors according to the German Guideline for Anchorages in Nuclear Power Plants and Nuclear Technology Installations (DIBt KKW Leitfaden, 2010). After a brief introduction to anchor behavior and the regulative context, the results of tension and shear tests carried out on undercut anchors are discussed. Robust load capacities and relatively small displacements determined for demanding load and crack cycling tests demonstrated the suitability of anchors qualified according to a state-of-the-art qualification guideline

3D DNA Crystals and Nanotechnology

Directory of Open Access Journals (Sweden)

Paul J. Paukstelis

2016-08-01

Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

Agarose gel electrophoresis for the separation of DNA fragments.

Science.gov (United States)

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

International Nuclear Information System (INIS)

An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

2007-01-01

We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

Anchorage Behaviors of Frictional Tieback Anchors in Silty Sand

Science.gov (United States)

Hsu, Shih-Tsung; Hsiao, Wen-Ta; Chen, Ke-Ting; Hu, Wen-Chi; Wu, Ssu-Yi

2017-06-01

Soil anchors are extensively used in geotechnical applications, most commonly serve as tieback walls in deep excavations. To investigate the anchorage mechanisms of this tieback anchor, a constitutive model that considers both strain hardening and softening and volume dilatancy entitled SHASOVOD model, and FLAC3D software are used to perform 3-D numerical analyses. The results from field anchor tests are compared with those calculated by numerical analyses to enhance the applicability of the numerical method. After the calibration, this research carried out the parameter studies by numerical analyses. The numerical results reveal that whether the yield of soil around an anchor develops to ground surface and/or touches the diaphragm wall depending on the overburden depth H and the embedded depth Z of an anchor, this study suggests the minimum overburden and embedded depths to avoid the yield of soils develop to ground surface and/or touch the diaphragm wall. When the embedded depth, overburden depth or fixed length of an anchor increases, the anchorage capacity also increases. Increasing fixed length should be the optimum method to increase the anchorage capacity for fixed length less than 20m. However, when the fixed length of an anchor exceeds 30 m, the increasing rate of anchorage capacity per fixed length decreases, and progressive yield occurs obviously between the fixed length and surrounding soil.

Constrained Active Learning for Anchor Link Prediction Across Multiple Heterogeneous Social Networks.

Science.gov (United States)

Zhu, Junxing; Zhang, Jiawei; Wu, Quanyuan; Jia, Yan; Zhou, Bin; Wei, Xiaokai; Yu, Philip S

2017-08-03

Nowadays, people are usually involved in multiple heterogeneous social networks simultaneously. Discovering the anchor links between the accounts owned by the same users across different social networks is crucial for many important inter-network applications, e.g., cross-network link transfer and cross-network recommendation. Many different supervised models have been proposed to predict anchor links so far, but they are effective only when the labeled anchor links are abundant. However, in real scenarios, such a requirement can hardly be met and most anchor links are unlabeled, since manually labeling the inter-network anchor links is quite costly and tedious. To overcome such a problem and utilize the numerous unlabeled anchor links in model building, in this paper, we introduce the active learning based anchor link prediction problem. Different from the traditional active learning problems, due to the one-to-one constraint on anchor links, if an unlabeled anchor link a = ( u , v ) is identified as positive (i.e., existing), all the other unlabeled anchor links incident to account u or account v will be negative (i.e., non-existing) automatically. Viewed in such a perspective, asking for the labels of potential positive anchor links in the unlabeled set will be rewarding in the active anchor link prediction problem. Various novel anchor link information gain measures are defined in this paper, based on which several constraint active anchor link prediction methods are introduced. Extensive experiments have been done on real-world social network datasets to compare the performance of these methods with state-of-art anchor link prediction methods. The experimental results show that the proposed Mean-entropy-based Constrained Active Learning (MC) method can outperform other methods with significant advantages.

The structure of DNA by direct imaging

KAUST Repository

Marini, Monica

2015-08-28

The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

The structure of DNA by direct imaging

KAUST Repository

Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo M.

2015-01-01

The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

Design and Assembly of DNA Nano-Objects and 2D DNA Origami Arrays

Science.gov (United States)

Liu, Wenyan

DNA, which plays a central role in biology as the carrier of genetic information, is also an excellent candidate for structural nanotechnology. Researches have proven that a variety of complicated DNA assemblies, such as objects, 2D & 3D crystals, and nanomechanical devices, can be fabricated through the combination of robust branched DNA motifs and sticky ends. This dissertation focuses on the design and construction of DNA nano--objects and 2D DNA origami arrays. In this dissertation, we first describe the formation of a triangular species that has four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can combine a partial triangle with other strands to form a robust four--stranded molecule. By combining them with a novel three--domain molecule, we also demonstrate by AFM that these triangles can be self--assembled into a linear array. Second, we demonstrate our attempts to design and self--assemble 2D DNA origami arrays using several different strategies. Specifically, we introduce the self--assembly of 2D DNA origami lattices using a symmetric cross--like design. This design strategy resulted in a well--ordered woven latticework array with edge dimensions of 2--3 mum. This size is likely to be large enough to connect bottom-up methods of patterning with top--down approaches. Third, we illustrate the design and construction of DNA nano--objects for exploring the substrate preferences of topoisomerase (topo) II. We designed and fabricated four double rhombus--like DNA molecules, each of which contains a different conformation of crossover in the middle, as possible substrates to establish the structural preferences for topo II. We characterized the formation of each substrate molecule by gel electrophoresis. Finally, we study the effect of M13 DNA knotting on the formation of the DNA origami tiles. We demonstrate by atomic force microscopy (AFM) that knotted M13

Link Anchors in Images: Is there Truth?

NARCIS (Netherlands)

Aly, Robin; McGuinness, Kevin; Kleppe, Martijn; Ordelman, Roeland J.F.; O'Connor, Noel; de Jong, Franciska M.G.

2012-01-01

While automatic linking in text collections is well understood, little is known about links in images. In this work, we investigate two aspects of anchors, the origin of a link, in images: 1) the requirements of users for such anchors, e.g. the things users would like more information on, and 2)

An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

Science.gov (United States)

Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

2006-10-01

In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

The Effect of Mini and Midi Anchor Tests on Test Equating

Science.gov (United States)

Arikan, Çigdem Akin

2018-01-01

The main purpose of this study is to compare the test forms to the midi anchor test and the mini anchor test performance based on item response theory. The research was conducted with using simulated data which were generated based on Rasch model. In order to equate two test forms the anchor item nonequivalent groups (internal anchor test) was…

Hydrophilicity and Microsolvation of an Organic Molecule Resolved on the Sub-molecular Level by Scanning Tunneling Microscopy.

Science.gov (United States)

Lucht, Karsten; Loose, Dirk; Ruschmeier, Maximilian; Strotkötter, Valerie; Dyker, Gerald; Morgenstern, Karina

2018-01-26

Low-temperature scanning tunneling microscopy was used to follow the formation of a solvation shell around an adsorbed functionalized azo dye from the attachment of the first water molecule to a fully solvated molecule. Specific functional groups bind initially one water molecule each, which act as anchor points for additional water molecules. Further water attachment occurs in areas close to these functional groups even when the functional groups themselves are already saturated. In contrast, water molecules surround the hydrophobic parts of the molecule only when the two-dimensional solvation shell closes around them. This study thus traces hydrophilic and hydrophobic properties of an organic molecule down to a sub-molecular length scale. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Spin interactions in Graphene-Single Molecule Magnets Hybrids

Science.gov (United States)

Cervetti, Christian; Rettori, Angelo; Pini, Maria Gloria; Cornia, Andrea; Repollés, Aña; Luis, Fernando; Rauschenbach, Stephan; Dressel, Martin; Kern, Klaus; Burghard, Marko; Bogani, Lapo

2014-03-01

Graphene is a potential component of novel spintronics devices owing to its long spin diffusion length. Besides its use as spin-transport channel, graphene can be employed for the detection and manipulation of molecular spins. This requires an appropriate coupling between the sheets and the single molecular magnets (SMM). Here, we present a comprehensive characterization of graphene-Fe4 SMM hybrids. The Fe4 clusters are anchored non-covalently to the graphene following a diffusion-limited assembly and can reorganize into random networks when subjected to slightly elevated temperature. Molecules anchored on graphene sheets show unaltered static magnetic properties, whilst the quantum dynamics is profoundly modulated. Interaction with Dirac fermions becomes the dominant spin-relaxation channel, with observable effects produced by graphene phonons and reduced dipolar interactions. Coupling to graphene drives the spins over Villain's threshold, allowing the first observation of strongly-perturbative tunneling processes. Preliminary spin-transport experiments at low-temperature are further presented.

Use of the ROC anchor in foot and ankle surgery. A retrospective study.

Science.gov (United States)

Kuwada, G T

1999-05-01

A retrospective study was conducted on the use of the ROC (Radial Osteo Compression) soft-tissue anchor in foot and ankle surgery. This article describes how the anchor is deployed, problematic aspects of using the anchor, and complications and success rates associated with the anchor in ankle stabilizations, posterior tibial tendon reconstruction, peroneus brevis tendon reconstruction after fracture of the base of the fifth metatarsal, and detachment and reattachment of the Achilles tendon. The ROC anchor consists of the anchor with nonabsorbable suture attached to the shaft, the deployment handle, and drill bits. The anchor and shaft are snapped into the deployment handle and inserted into the drill hole. Compression of the trigger deploys the anchor into the hole. The ROC anchor was found to be reliable, useful, and relatively easy to deploy, with outcomes similar to those of other soft-tissue anchors.

COP9 signalosome: a provider of DNA building blocks

DEFF Research Database (Denmark)

Nielsen, Olaf

2003-01-01

In fission yeast, the COP9 signalosome is required to activate ribonucleotide reductase for DNA synthesis. This is mediated via the ubiquitin ligase Pcu4, activation of which leads to degradation of the scaffold protein Spd1, which anchors the small ribonucleotide reductase subunit in the nucleus...

DNA-Based Applications in Nanobiotechnology

Directory of Open Access Journals (Sweden)

Khalid M. Abu-Salah

2010-01-01

Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

Anchoring Proteins as Regulators of Signaling Pathways

Science.gov (United States)

Perino, Alessia; Ghigo, Alessandra; Scott, John D.; Hirsch, Emilio

2012-01-01

Spatial and temporal organization of signal transduction is coordinated through the segregation of signaling enzymes in selected cellular compartments. This highly evolved regulatory mechanism ensures the activation of selected enzymes only in the vicinity of their target proteins. In this context, cAMP-responsive triggering of protein kinase A is modulated by a family of scaffold proteins referred to as A-kinase anchoring proteins. A-kinase anchoring proteins form the core of multiprotein complexes and enable simultaneous but segregated cAMP signaling events to occur in defined cellular compartments. In this review we will focus on the description of A-kinase anchoring protein function in the regulation of cardiac physiopathology. PMID:22859670

Bacterial natural transformation by highly fragmented and damaged DNA

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

2013-01-01

for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

NARCIS (Netherlands)

Geertsema, Hylkje

2014-01-01

De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

The re-entrant cholesteric phase of DNA

Science.gov (United States)

Yevdokimov, Yu. M.; Skuridin, S. G.; Salyanov, V. I.; Semenov, S. V.; Shtykova, E. V.; Dadinova, L. A.; Kompanets, O. N.; Kats, E. I.

2017-07-01

The character of packing of double-stranded DNA molecules in particles of liquid-crystal dispersions formed as a result of the phase exclusion of DNA molecules from aqueous salt polyethylene glycol solutions has been estimated by comparing the circular dichroism (CD) spectra of these dispersions recorded at different osmotic pressures and temperatures. It is shown that the first cycle of heating of dispersion particles with hexagonally packed double-stranded DNA molecules leads to the occurrence of abnormal optical activity of these particles, which manifests itself in the form of a strong negative CD band, characteristic of DNA cholesterics. Moreover, subsequent cooling is accompanied by a further increase in the abnormal optical activity, which indicates the existence of the "hexagonal → cholesteric packing" phase transition, controlled by both the osmotic pressure of the solution and its temperature. The result obtained can be described in terms of "quasi-nematic" layers composed of orientationally ordered DNA molecules in the structure of dispersion particles. There are two possible ways of packing for these layers, which determine their hexagonal or cholesteric spatial structure. The second heating → cooling cycle confirms these results and is indicative of possible differences in the packing of double-stranded DNA molecules in the hexagonal phase, which depend on the osmotic pressure of the solution.

On the Robustness of Anchoring Effects in WTP and WTA Experiments

OpenAIRE

Drew Fudenberg; David K Levine; Zacharias Maniadis

2010-01-01

We reexamine the effects of the anchoring manipulation of Ariely, Loewenstein, and Prelec (2003) on the evaluation of common market goods and find very weak anchoring effects. We perform the same manipulation on the evaluation of binary lotteries, and find no anchoring effects at all. This suggests limits on the robustness of anchoring effects. (JEL C91, D12, D44)

Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

Energy Technology Data Exchange (ETDEWEB)

Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

2003-01-01

Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

The Neural Cell Adhesion Molecule NCAM2/OCAM/RNCAM, a Close Relative to NCAM

DEFF Research Database (Denmark)

Kulahin, Nikolaj; Walmod, Peter

2008-01-01

molecule (NCAM) is a well characterized, ubiquitously expressed CAM that is highly expressed in the nervous system. In addition to mediating cell adhesion, NCAM participates in a multitude of cellular events, including survival, migration, and differentiation of cells, outgrowth of neurites, and formation......Cell adhesion molecules (CAMs) constitute a large class of plasma membrane-anchored proteins that mediate attachment between neighboring cells and between cells and the surrounding extracellular matrix (ECM). However, CAMs are more than simple mediators of cell adhesion. The neural cell adhesion...... and plasticity of synapses. NCAM shares an overall sequence identity of approximately 44% with the neural cell adhesion molecule 2 (NCAM2), a protein also known as olfactory cell adhesion molecule (OCAM) and Rb-8 neural cell adhesion molecule (RNCAM), and the region-for-region sequence homology between the two...

Career Paths, Images and Anchors: A Study with Brazilian Professionals

Science.gov (United States)

Kilimnik, Zelia Miranda; de Oliveira, Luiz Claudio Vieira; Sant'anna, Anderson De Souza; Barros, Delba Teixeira Rodrigues

2011-01-01

This article analyses career anchors changes associated to images and professionals trajectories. Its main question: Do anchors careers change through time? We conducted twelve interviews involving professionals from the Administration Area, applying Schein's Career Anchors Inventory (1993). We did the same two years later. In both of them, the…

Mismatch discrimination of lipidated DNA and LNA-probes (LiNAs) in hybridization-controlled liposome assembly

DEFF Research Database (Denmark)

Jakobsen, Ulla; Vogel, Stefan

2016-01-01

Assays for mismatch discrimination and detection of single nucleotide variations by hybridization-controlled assembly of liposomes, which do not require tedious surface chemistry, are versatile for both DNA and RNA targets. We report herein a comprehensive study on different DNA and LNA (locked...... assay in the context of mismatch discrimination and SNP detection are presented. The advantages of membrane-anchored LiNA-probes compared to chemically attached probes on solid nanoparticles (e.g. gold nanoparticles) are described. Key functionalities such as non-covalent attachment of LiNA probes...... without the need for long spacers and the inherent mobility of membrane-anchored probes in lipid-bilayer membranes will be described for several different probe designs....

DNA binding and aggregation by carbon nanoparticles

International Nuclear Information System (INIS)

An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo

2010-01-01

Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.

Stone anchors of India: Findings, classification and significance.

Digital Repository Service at National Institute of Oceanography (India)

Tripati, S.

Various types of stone anchors have been observed during inshore and offshore explorations along the east and west coasts of India. The earliest stone anchors of India have been recorded from the Harappan sites (3rd millennium BC), but their shape...

Conformation-dependent DNA attraction

Science.gov (United States)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

Investigation of suction anchor pullout capacity under undrained conditions

OpenAIRE

Jarand, Pollestad

2015-01-01

Master's thesis in Offshore technology Floating units are dependent on reliable mooring systems to ensure safety during marine operations. Suction anchors have proved to be a technologically viable and cost-effective concept. They are capable of precision installation, re-use, and provide large resistive capacity. This thesis investigates load capacity and failure modes of suction anchors subjected to vertical, horizontal (lateral), and incline loading. Suction anchor design co...

DNA moves sequentially towards the nuclear matrix during DNA replication in vivo

Directory of Open Access Journals (Sweden)

Aranda-Anzaldo Armando

2011-01-01

Full Text Available Abstract Background In the interphase nucleus of metazoan cells DNA is organized in supercoiled loops anchored to a nuclear matrix (NM. There is varied evidence indicating that DNA replication occurs in replication factories organized upon the NM and that DNA loops may correspond to the actual replicons in vivo. In normal rat liver the hepatocytes are arrested in G0 but they synchronously re-enter the cell cycle after partial-hepatectomy leading to liver regeneration in vivo. We have previously determined in quiescent rat hepatocytes that a 162 kbp genomic region containing members of the albumin gene family is organized into five structural DNA loops. Results In the present work we tracked down the movement relative to the NM of DNA sequences located at different points within such five structural DNA loops during the S phase and after the return to cellular quiescence during liver regeneration. Our results indicate that looped DNA moves sequentially towards the NM during replication and then returns to its original position in newly quiescent cells, once the liver regeneration has been achieved. Conclusions Looped DNA moves in a sequential fashion, as if reeled in, towards the NM during DNA replication in vivo thus supporting the notion that the DNA template is pulled progressively towards the replication factories on the NM so as to be replicated. These results provide further evidence that the structural DNA loops correspond to the actual replicons in vivo.

Pyramidal anchor stone from Baga waters of Goa, west coast of India

Digital Repository Service at National Institute of Oceanography (India)

Tripati, S.

. Pyramidal anchor stones have an apex hole which goes up to the round hole, however Goa anchor stone has no such perforation, but, instead has a rectangular cutting on the apex. The anchor stone is compared with Greek pyramidal anchor stones, and probably...

Mutational analysis of the glycosylphosphatidylinositol (GPI) anchor pathway demonstrates that GPI-anchored proteins are required for cell wall biogenesis and normal hyphal growth in Neurospora crassa.

Science.gov (United States)

Bowman, Shaun M; Piwowar, Amy; Al Dabbous, Mash'el; Vierula, John; Free, Stephen J

2006-03-01

Using mutational and proteomic approaches, we have demonstrated the importance of the glycosylphosphatidylinositol (GPI) anchor pathway for cell wall synthesis and integrity and for the overall morphology of the filamentous fungus Neurospora crassa. Mutants affected in the gpig-1, gpip-1, gpip-2, gpip-3, and gpit-1 genes, which encode components of the N. crassa GPI anchor biosynthetic pathway, have been characterized. GPI anchor mutants exhibit colonial morphologies, significantly reduced rates of growth, altered hyphal growth patterns, considerable cellular lysis, and an abnormal "cell-within-a-cell" phenotype. The mutants are deficient in the production of GPI-anchored proteins, verifying the requirement of each altered gene for the process of GPI-anchoring. The mutant cell walls are abnormally weak, contain reduced amounts of protein, and have an altered carbohydrate composition. The mutant cell walls lack a number of GPI-anchored proteins, putatively involved in cell wall biogenesis and remodeling. From these studies, we conclude that the GPI anchor pathway is critical for proper cell wall structure and function in N. crassa.

Radioprotection of DNA molecule by oxido-reduction's coenzymes

International Nuclear Information System (INIS)

Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

1978-01-01

The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

Peptide-Mediated Liposome Fusion: The Effect of Anchor Positioning

Directory of Open Access Journals (Sweden)

Niek S. A. Crone

2018-01-01

Full Text Available A minimal model system for membrane fusion, comprising two complementary peptides dubbed “E” and “K” joined to a cholesterol anchor via a polyethyleneglycol spacer, has previously been developed in our group. This system promotes the fusion of large unilamellar vesicles and facilitates liposome-cell fusion both in vitro and in vivo. Whilst several aspects of the system have previously been investigated to provide an insight as to how fusion is facilitated, anchor positioning has not yet been considered. In this study, the effects of placing the anchor at either the N-terminus or in the center of the peptide are investigated using a combination of circular dichroism spectroscopy, dynamic light scattering, and fluorescence assays. It was discovered that anchoring the “K” peptide in the center of the sequence had no effect on its structure, its ability to interact with membranes, or its ability to promote fusion, whereas anchoring the ‘E’ peptide in the middle of the sequence dramatically decreases fusion efficiency. We postulate that anchoring the ‘E’ peptide in the middle of the sequence disrupts its ability to form homodimers with peptides on the same membrane, leading to aggregation and content leakage.

Testing methods of steel wi re ropes at the anchor

Directory of Open Access Journals (Sweden)

Stanislav Kropuch

2012-12-01

Full Text Available The present paper introduces an application of the acoustic andthermographic method in the defectoscopic testing of immobilesteel wire ropes at the most critical point, the anchor. Firstmeasurements and their results by these new defectoscopic methodsare shown. In defectoscopic tests at the anchor, the widelyused magnetic method gives unreliable results, and therefore presentsa problem for steel wire defectoscopy. Application of the two new methods in the steel wire defectoscopy at the anchor point will enableincreased safety measures at the anchor of steel wire ropes in bridge, roof, tower and aerial cable lift constructions.

DNA adsorption and desorption on mica surface studied by atomic force microscopy

Energy Technology Data Exchange (ETDEWEB)

Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)

2011-05-15

The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

DNA adsorption and desorption on mica surface studied by atomic force microscopy

International Nuclear Information System (INIS)

Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang

2011-01-01

The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

Adsorbed states of chlorophenol on Cu(110) and controlled switching of single-molecule junctions

Energy Technology Data Exchange (ETDEWEB)

Okuyama, H., E-mail: hokuyama@kuchem.kyoto-u.ac.jp; Kitaguchi, Y.; Hattori, T.; Ueda, Y.; Ferrer, N. G.; Hatta, S.; Aruga, T. [Department of Chemistry, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)

2016-06-28

A molecular junction of substituted benzene (chlorophenol) is fabricated and controlled by using a scanning tunneling microscope (STM). Prior to the junction formation, the bonding geometry of the molecule on the surface is characterized by STM and electron energy loss spectroscopy (EELS). EELS shows that the OH group of chlorophenol is dissociated on Cu(110) and that the molecule is bonded nearly flat to the surface via an O atom, with the Cl group intact. We demonstrate controlled contact of an STM tip to the “available” Cl group and lift-up of the molecule while it is anchored to the surface via an O atom. The asymmetric bonding motifs of the molecule to the electrodes allow for reversible control of the junction.

Controlling formation of single-molecule junctions by electrochemical reduction of diazonium terminal groups.

Science.gov (United States)

Hines, Thomas; Díez-Pérez, Ismael; Nakamura, Hisao; Shimazaki, Tomomi; Asai, Yoshihiro; Tao, Nongjian

2013-03-06

We report controlling the formation of single-molecule junctions by means of electrochemically reducing two axialdiazonium terminal groups on a molecule, thereby producing direct Au-C covalent bonds in situ between the molecule and gold electrodes. We report a yield enhancement in molecular junction formation as the electrochemical potential of both junction electrodes approach the reduction potential of the diazonium terminal groups. Step length analysis shows that the molecular junction is significantly more stable, and can be pulled over a longer distance than a comparable junction created with amine anchoring bonds. The stability of the junction is explained by the calculated lower binding energy associated with the direct Au-C bond compared with the Au-N bond.

Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

Science.gov (United States)

Ares, Manuel

2014-01-01

This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

A tailored biocatalyst achieved by the rational anchoring of imidazole groups on a natural polymer: furnishing a potential artificial nuclease by sustainable materials engineering.

Science.gov (United States)

Ferreira, José G L; Grein-Iankovski, Aline; Oliveira, Marco A S; Simas-Tosin, Fernanda F; Riegel-Vidotti, Izabel C; Orth, Elisa S

2015-04-11

Foreseeing the development of artificial enzymes by sustainable materials engineering, we rationally anchored reactive imidazole groups on gum arabic, a natural biocompatible polymer. The tailored biocatalyst GAIMZ demonstrated catalytic activity (>10(5)-fold) in dephosphorylation reactions with recyclable features and was effective in cleaving plasmid DNA, comprising a potential artificial nuclease.

Preparation and self-folding of amphiphilic DNA origami.

Science.gov (United States)

Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

2015-03-01

Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA under Force: Mechanics, Electrostatics, and Hydration

Directory of Open Access Journals (Sweden)

Jingqiang Li

2015-02-01

Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

Natural HLA-B*2705 Protein Ligands with Glutamine as Anchor Motif

Science.gov (United States)

Infantes, Susana; Lorente, Elena; Barnea, Eilon; Beer, Ilan; Barriga, Alejandro; Lasala, Fátima; Jiménez, Mercedes; Admon, Arie; López, Daniel

2013-01-01

The presentation of short viral peptide antigens by human leukocyte antigen (HLA) class I molecules on cell surfaces is a key step in the activation of cytotoxic T lymphocytes, which mediate the killing of pathogen-infected cells or initiate autoimmune tissue damage. HLA-B27 is a well known class I molecule that is used to study both facets of the cellular immune response. Using mass spectrometry analysis of complex HLA-bound peptide pools isolated from large amounts of HLA-B*2705+ cells, we identified 200 naturally processed HLA-B*2705 ligands. Our analyses revealed that a change in the position (P) 2 anchor motif was detected in the 3% of HLA-B*2705 ligands identified. B*2705 class I molecules were able to bind these six GlnP2 peptides, which showed significant homology to pathogenic bacterial sequences, with a broad range of affinities. One of these ligands was able to bind with distinct conformations to HLA-B27 subtypes differentially associated with ankylosing spondylitis. These conformational differences could be sufficient to initiate autoimmune damage in patients with ankylosing spondylitis-associated subtypes. Therefore, these kinds of peptides (short, with GlnP2, and similar low affinity to all HLA-B27 subtypes tested but with unlike conformations in differentially ankylosing spondylitis-associated subtypes) must not be excluded from future researches involving potential arthritogenic peptides. PMID:23430249

Assessing tether anchor labeling and usability in pickup trucks.

Science.gov (United States)

Klinich, Kathleen D; Manary, Miriam A; Malik, Laura A; Flannagan, Carol A; Jermakian, Jessica S

2018-04-03

The objective of this study was to investigate vehicle factors associated with child restraint tether use and misuse in pickup trucks and evaluate 4 labeling interventions designed to educate consumers on proper tether use. Volunteer testing was performed with 24 subjects and 4 different pickup trucks. Each subject performed 8 child restraint installations among the 4 pickups using 2 forward-facing restraints: a Britax Marathon G4.1 and an Evenflo Triumph. Vehicles were selected to represent 4 different implementations of tether anchors among pickups: plastic loop routers (Chevrolet Silverado), webbing routers (Ram), back wall anchors (Nissan Frontier), and webbing routers plus metal anchors (Toyota Tundra). Interventions included a diagram label, Quick Response (QR) Code linked to video instruction, coordinating text label, and contrasting text tag. Subjects used the child restraint tether in 93% of trials. However, tether use was completely correct in only 9% of trials. An installation was considered functional if the subject attached the tether to a tether anchor and had a tight installation (ignoring routing and head restraint position); 28% of subjects achieved a functional installation. The most common installation error was attaching the tether hook to the anchor/router directly behind the child restraint (near the top of the seatback) rather than placing the tether through the router and attaching it to the anchor in the adjacent seating position. The Nissan Frontier, with the anchor located on the back wall of the cab, had the highest rate of correct installations but also had the highest rate of attaching the tether to components other than the tether anchor (seat adjustor, child restraint storage hook, around head restraint). None of the labeling interventions had a significant effect on correct installation; not a single subject scanned the QR Code to access the video instruction. Subjects with the most successful installations spent extensive time

The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

NARCIS (Netherlands)

van den Berg, A.A.

2017-01-01

During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

Rapid purification of circular DNA by triplex-mediated affinity capture

Science.gov (United States)

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Real-time monitoring and manipulation of single bio-molecules in free solution

Energy Technology Data Exchange (ETDEWEB)

Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)

2005-01-01

The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored

Graphene oxide and DNA aptamer based sub-nanomolar potassium detecting optical nanosensor

Science.gov (United States)

Datta, Debopam; Sarkar, Ketaki; Mukherjee, Souvik; Meshik, Xenia; Stroscio, Michael A.; Dutta, Mitra

2017-08-01

Quantum-dot (QD) based nanosensors are frequently used by researchers to detect small molecules, ions and different biomolecules. In this article, we present a sensor complex/system comprised of deoxyribonucleic acid (DNA) aptamer, gold nanoparticle and semiconductor QD, attached to a graphene oxide (GO) flake for detection of potassium. As reported herein, it is demonstrated that QD-aptamer-quencher nanosensor functions even when tethered to GO, opening the way to future applications where sensing can be accomplished simultaneously with other previously demonstrated applications of GO such as serving as a nanocarrier for drug delivery. Herein, it is demonstrated that the DNA based thrombin binding aptamer used in this study undergoes the conformational change needed for sensing even when the nanosensor complex is anchored to the GO. Analysis with the Hill equation indicates the interaction between aptamer and potassium follows sigmoidal Hill kinetics. It is found that the quenching efficiency of the optical sensor is linear with the logarithm of concentration from 1 pM to 100 nM and decreases for higher concentration due to unavailability of aptamer binding sites. Such a simple and sensitive optical aptasensor with minimum detection capability of 1.96 pM for potassium ion can also be employed in-vitro detection of different physiological ions, pathogens and disease detection methods.

Controlling Electrical Conductance through a π‐Conjugated Cruciform Molecule by Selective Anchoring to Gold Electrodes

DEFF Research Database (Denmark)

Huang, Cancan; Chen, Songjie; Ørnsø, Kristian Baruël

2015-01-01

Tuning charge transport at the single‐molecule level plays a crucial role in the construction of molecular electronic devices. Introduced herein is a promising and operationally simple approach to tune two distinct charge‐transport pathways through a cruciform molecule. Upon in situ cleavage of t...

Mitochondrial DNA copy number threshold in mtDNA depletion myopathy.

Science.gov (United States)

Durham, S E; Bonilla, E; Samuels, D C; DiMauro, S; Chinnery, P F

2005-08-09

The authors measured the absolute amount of mitochondrial DNA (mtDNA) within single muscle fibers from two patients with thymidine kinase 2 (TK2) deficiency and two healthy controls. TK2 deficient fibers containing more than 0.01 mtDNA/microm3 had residual cytochrome c oxidase (COX) activity. This defines the minimum amount of wild-type mtDNA molecules required to maintain COX activity in skeletal muscle and provides an explanation for the mosaic histochemical pattern seen in patients with mtDNA depletion syndrome.

DNA-FET using carbon nanotube electrodes

International Nuclear Information System (INIS)

Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y

2006-01-01

We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages

Anchoring submersible ultrasonic receivers in river channels with stable substrate

Science.gov (United States)

Bettoli, Phillip William; Scholten, G.D.; Hubbs, D.

2010-01-01

We developed an anchoring system for submersible ultrasonic receivers (SURs) that we placed on the bottom of the riverine reaches of three main-stem reservoirs in the upper Tennessee River. Each anchor consisted of a steel tube (8.9 x 35.6 cm) welded vertically to a round plate of steel (5.1 x 40.6 cm). All seven SURs and their 57-kg anchors were successfully deployed and retrieved three times over 547 d by a dive team employing surface air-breathing equipment and a davit-equipped boat. All of the anchors and their SURs remained stationary over two consecutive winters on the hard-bottom, thalweg sites where they were deployed. The SUR and its anchor at the most downriver site experienced flows that exceeded 2,100 m(3)/s and mean water column velocities of about 0.9 m/s.

Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

Energy Technology Data Exchange (ETDEWEB)

Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

2005-01-01

Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

Small-angle light scattering symmetry breaking in polymer-dispersed liquid crystal films with inhomogeneous electrically controlled interface anchoring

Energy Technology Data Exchange (ETDEWEB)

Loiko, V. A., E-mail: loiko@ifanbel.bas-net.by; Konkolovich, A. V. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus); Zyryanov, V. Ya. [Russian Academy of Sciences, Kirensky Institute of Physics, Federal Research Center “Krasnoyarsk Scientific Center,” Siberian Branch (Russian Federation); Miskevich, A. A. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)

2017-03-15

We have described the method of analyzing and reporting on the results of calculation of the small-angle structure of radiation scattered by a polymer-dispersed liquid crystal film with electrically controlled interfacial anchoring. The method is based on the interference approximation of the wave scattering theory and the hard disk model. Scattering from an individual liquid crystal droplet has been described using the anomalous diffraction approximation extended to the case of droplets with uniform and nonuniform interface anchoring at the droplet–polymer boundary. The director field structure in an individual droplet is determined from the solution of the problem of minimizing the volume density of the free energy. The electrooptical effect of symmetry breaking in the angular distribution of scattered radiation has been analyzed. This effect means that the intensities of radiation scattered within angles +θ{sub s} and–θ{sub s} relative to the direction of illumination in the scattering plane can be different. The effect is of the interference origin and is associated with asymmetry of the phase shift of the wavefront of an incident wave from individual parts of the droplet, which appears due to asymmetry of the director field structure in the droplet, caused by nonuniform anchoring of liquid crystal molecules with the polymer on its surface. This effect is analyzed in the case of normal illumination of the film depending on the interfacial anchoring at the liquid crystal–polymer interface, the orientation of the optical axes of droplets, their concentration, sizes, anisometry, and polydispersity.

Large branched self-assembled DNA complexes

International Nuclear Information System (INIS)

Tosch, Paul; Waelti, Christoph; Middelberg, Anton P J; Davies, A Giles

2007-01-01

Many biological molecules have been demonstrated to self-assemble into complex structures and networks by using their very efficient and selective molecular recognition processes. The use of biological molecules as scaffolds for the construction of functional devices by self-assembling nanoscale complexes onto the scaffolds has recently attracted significant attention and many different applications in this field have emerged. In particular DNA, owing to its inherent sophisticated self-organization and molecular recognition properties, has served widely as a scaffold for various nanotechnological self-assembly applications, with metallic and semiconducting nanoparticles, proteins, macromolecular complexes, inter alia, being assembled onto designed DNA scaffolds. Such scaffolds may typically contain multiple branch-points and comprise a number of DNA molecules selfassembled into the desired configuration. Previously, several studies have used synthetic methods to produce the constituent DNA of the scaffolds, but this typically constrains the size of the complexes. For applications that require larger self-assembling DNA complexes, several tens of nanometers or more, other techniques need to be employed. In this article, we discuss a generic technique to generate large branched DNA macromolecular complexes

Solvated protein–DNA docking using HADDOCK

International Nuclear Information System (INIS)

Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J.

2013-01-01

Interfacial water molecules play an important role in many aspects of protein–DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein–DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein–DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein–DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein–DNA complexes.

Solvated protein-DNA docking using HADDOCK

Energy Technology Data Exchange (ETDEWEB)

Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J., E-mail: a.m.j.j.bonvin@uu.nl [Utrecht University, Bijvoet Center for Biomolecular Research, Faculty of Science-Chemistry (Netherlands)

2013-05-15

Interfacial water molecules play an important role in many aspects of protein-DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein-DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein-DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein-DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein-DNA complexes.

Archaeometallurgical investigation of the iron anchor from the Tantura F shipwreck

Energy Technology Data Exchange (ETDEWEB)

Aronson, A. [Faculty of Engineering, Tel Aviv University, Ramat Aviv 69978 (Israel); Ashkenazi, D., E-mail: dana@eng.tau.ac.il [Faculty of Engineering, Tel Aviv University, Ramat Aviv 69978 (Israel); Barkai, O.; Kahanov, Y. [Leon Recanati Institute for Maritime Studies, University of Haifa, Haifa 31905 (Israel)

2013-04-15

The Tantura F shipwreck was a coaster or a fishing vessel about 15.7 m long, discovered in the Dor/Tantura lagoon, Israel in 1995. It was dated to between the mid-7th and the end of the 8th centuries CE. Among the finds excavated were two T-shaped type iron anchors. Of the two anchors, one (anchor A) was thoroughly studied by archaeometallurgical methods in order to identify forge-welding lines, to determine the welding quality and to understand the manufacturing technology. The examinations included X-ray radiography, XRF analysis, optical microscopy, SEM/EDS observation and analysis, OES analysis and microhardness tests. The investigation included characterization of the composition, microstructure, thermal treatments, forge-welding junctions and slag analysis. The results revealed a heterogeneous microstructure, rich in glassy, fayalite and wüstite slag. Iron based phases included ferrite, pearlite, cementite and Widmanstätten plates, all typical to wrought iron. The forge-welds of Anchor A were located. Each arm was made of one piece, weighing about 2.5–3 kg and the shank was made of a few 1.5–2 kg pieces. The second anchor (anchor B) was only briefly examined visually and with a few radiographs, which support the results from anchor A. The research results revealed significant information about T-shaped anchors and their manufacturing process, including hot-working processes without any additional heat treatments, and folding techniques. The microstructure was similar to other ancient simple tools such as saws, sickles, axes and mortise chisels, and though the technology to make complicated structures and objects, such as swords, existed at that time, the anchors did not require this sophistication; thus simpler techniques were used, presumably because they were more cost-effective. - Highlights: ► Tantura F was a coaster dated to mid-7th–end-8th centuries. ► Two iron anchors were discovered at the Tantura F shipwreck-site. ► Anchor A was

Do budget balance rules anchor budget balance expectations? -- Some international evidence

OpenAIRE

Rülke, Jan-Christoph; Frenkel, Michael; Lis, Eliza

2013-01-01

This is the first study that analyzes whether budget balance expectations are anchored and whether budget balance rules effectively anchor expectations. To this end, we use a unique data set which covers budget balance expectations in 17 countries that implemented a budget balance rules. While our results are mixed concerning the general impact of budget balance rules on anchoring expectations, we do find that specific features of budget balance rules are important to successfully anchor budg...

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

International Nuclear Information System (INIS)

Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

2011-01-01

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Ultimate load capacities of expansion anchor bolts

International Nuclear Information System (INIS)

Czarnecki, R.M.; Manrique, M.A.; Samaddar, S.K.

1993-01-01

A summary of available experimental expansion anchor bolt test data is presented. These data were collected as part of programs by the nuclear industry to address generic issues related to verification of seismic adequacy of equipment in nuclear power plants. Some of the data presented are suitable for use in seismic probabilistic risk assessments. For example, mean values of ultimate strength, along with their standard deviation and coefficients of variation, for a range of most typical expansion anchor bolt sizes are presented. Effects of interaction between shear and tension, edge distance, spacing, and cracking of the concrete are presented in a manner that is more suitable for use in deterministic evaluations. Related industry programs to derive anchor bolt capacities are briefly discussed. Recommendations for areas of further investigation are also presented

Label-free, electrochemical detection of methicillin-resistant staphylococcus aureus DNA with reduced graphene oxide-modified electrodes

KAUST Repository

Wang, Zhijuan

2011-05-01

Reduced graphene oxide (rGO)-modified glassy carbon electrode is used to detect the methicillin-resistant Staphylococcus aureus (MRSA) DNA by using electrochemical impedance spectroscopy. Our experiments confirm that ssDNA, before and after hybridization with target DNA, are successfully anchored on the rGO surface. After the probe DNA, pre-adsorbed on rGO electrode, hybridizes with target DNA, the measured impedance increases dramatically. It provides a new method to detect DNA with high sensitivity (10-13M, i.e., 100 fM) and selectivity. © 2011 Elsevier B.V.

Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

Science.gov (United States)

Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

2018-01-01

Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

Novel applications for glycosylphosphatidylinositol-anchored proteins in pharmaceutical and industrial biotechnology.

Science.gov (United States)

Müller, Günter

2011-04-01

Glycosylphosphatidylinositol (GPI)-anchored proteins have been regarded as typical cell surface proteins found in most eukaryotic cells from yeast to man. They are embedded in the outer plasma membrane leaflet via a carboxy-terminally linked complex glycolipid GPI structure. The amphiphilic nature of the GPI anchor, its compatibility with the function of the attached protein moiety and the capability of GPI-anchored proteins for spontaneous insertion into and transfer between artificial and cellular membranes initially suggested their potential for biotechnological applications. However, these expectations have been hardly fulfilled so far. Recent developments fuel novel hopes with regard to: (i) Automated online expression, extraction and purification of therapeutic proteins as GPI-anchored proteins based on their preferred accumulation in plasma membrane lipid rafts, (ii) multiplex custom-made protein chips based on GPI-anchored cell wall proteins in yeast, (iii) biomaterials and biosensors with films consisting of sets of distinct GPI-anchored binding-proteins or enzymes for sequential or combinatorial catalysis, and (iv) transport of therapeutic proteins across or into relevant tissue cells, e.g., enterocytes or adipocytes. Latter expectations are based on the demonstrated translocation of GPI-anchored proteins from plasma membrane lipid rafts to cytoplasmic lipid droplets and eventually further into microvesicles which upon release from donor cells transfer their GPI-anchored proteins to acceptor cells. The value of these technologies, which are all based on the interaction of GPI-anchored proteins with membranes and surfaces, for the engineering, production and targeted delivery of biomolecules for a huge variety of therapeutic and biotechnological purposes should become apparent in the near future.

Do anchor investors create value for initial public offerings? An empirical investigation

Directory of Open Access Journals (Sweden)

Seshadev Sahoo

2017-12-01

Full Text Available The concept of anchor investors was introduced by the market regulator, Securities Exchange Board of India (SEBI, to bring transparency in the book building mechanism. We examine anchor investors' investment in initial public offerings (IPOs to determine how they create value for issuing firms and participating investors. Using a database of 135 IPOs issued in the Indian market through book building mechanism during 2009–2014, we find that anchor investors' investment in IPOs reduces underpricing. Larger subscription from retail investors for anchor-supported IPOs indicates that anchor investors' participation is viewed as a credible attestation of quality of the issue. We document that anchor-supported IPOs are more liquid and less volatile in the short run. We also find that by controlling for other factors such as offer size, subscription rate and age of the firm, a part of the underpricing is reduced by anchor investors.

Considerations on the design of through-wall anchors

International Nuclear Information System (INIS)

Ricklefs, Ulf

2012-01-01

Connections to existing buildings are often the most difficult planning challenge for the realization of construction measures in case of piping system replacements in nuclear power plants. This is due to restricted space or limited load reserves of the building structure. Usually the realization of support connections to the existing buildings is achieved by anchor bolts. But in critical cases the preferred alternative solution uses through-wall anchors. Up to now uniform assessment thresholds are not available, no technical guidelines or regulations for construction variants exist. Through-wall anchors allow significantly higher load capacities for tensile and shear loads but require enhanced planning and realization efforts.

DNA: Structure and function

DEFF Research Database (Denmark)

Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

1998-01-01

This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

Anchor enhanced capsulorraphy in bunionectomies using an L-shaped capsulotomy.

Science.gov (United States)

Gould, John S; Ali, Sheriff; Fowler, Rachel; Fleisig, Glenn S

2003-01-01

The objective of this study was to investigate potential benefit of a suture anchor-enhanced capsulorraphy in the early maintenance of correction in bunionectomies. We compared, retrospectively, in successive series, the loss of correction of the Hallux Valgus (HV) and intermetatarsal (IM) angle, in those repaired with an L-shaped capsulorraphy enhanced with anchors to those without. Intraoperative and second week postoperative simulated weightbearing anterior posterior (AP) X-rays were used to evaluate results. By using only intraoperative and early postoperative X-rays, we should have effectively eliminated extraneous factors that might have influenced our results. A Total of 106 cases were investigated, 65 of which were repaired using anchors, the remaining 41 without. In the anchor group, 38 underwent a proximal metatarsal concentric shelf osteotomy (CSO)/modified McBride procedure, while the remaining 27 had a distal Chevron correction. In the without-anchor group, 21 had a CSO/modified McBride procedure while 20 underwent the Chevron procedure. In the without-anchor group, the average HV and IM loss of correction was 4.60 degrees (range, -2 to 21 degrees) and 0.6 degrees (range, -1 to 9 degrees) respectively. In the anchor group, the corresponding loss was 2.8 degrees (range, -3 to 17 degrees) and 0.6 degrees (range, -2 to 14 degrees) respectively. These results, when statistically analyzed, demonstrated that while the IM angle change was not statistically significant, the HV angle change was statistically significant, implying that the anchor plays a significant role in maintaining the surgical correction in both the distal Chevron and CSO/ modified McBride bunionectomies.

Stone anchors from the Okhamandal region, Gujarat Coast, India

Digital Repository Service at National Institute of Oceanography (India)

Sundaresh; Gaur, A.S.; Gudigar, P.; Tripati, S.; Vora, K.H.; Bandodkar, S.N.

During marine archaeological explorations since 1983, off Dwarka, a large number of stone anchors were discovered and dated to 1400 BC, comparing with anchors found in Mediterranean waters. In recent archaeological explorations off Dwarka, Bet...

New Antifouling Platform Characterized by Single-Molecule Imaging

Science.gov (United States)

2015-01-01

Antifouling surfaces have been widely studied for their importance in medical devices and industry. Antifouling surfaces mostly achieved by methoxy-poly(ethylene glycol) (mPEG) have shown biomolecular adsorption less than 1 ng/cm2 which was measured by surface analytical tools such as surface plasmon resonance (SPR) spectroscopy, quartz crystal microbalance (QCM), or optical waveguide lightmode (OWL) spectroscopy. Herein, we utilize a single-molecule imaging technique (i.e., an ultimate resolution) to study antifouling properties of functionalized surfaces. We found that about 600 immunoglobulin G (IgG) molecules are adsorbed. This result corresponds to ∼5 pg/cm2 adsorption, which is far below amount for the detection limit of the conventional tools. Furthermore, we developed a new antifouling platform that exhibits improved antifouling performance that shows only 78 IgG molecules adsorbed (∼0.5 pg/cm2). The antifouling platform consists of forming 1 nm TiO2 thin layer, on which peptidomimetic antifouling polymer (PMAP) is robustly anchored. The unprecedented antifouling performance can potentially revolutionize a variety of research fields such as single-molecule imaging, medical devices, biosensors, and others. PMID:24503420

New antifouling platform characterized by single-molecule imaging.

Science.gov (United States)

Ryu, Ji Young; Song, In Taek; Lau, K H Aaron; Messersmith, Phillip B; Yoon, Tae-Young; Lee, Haeshin

2014-03-12

Antifouling surfaces have been widely studied for their importance in medical devices and industry. Antifouling surfaces mostly achieved by methoxy-poly(ethylene glycol) (mPEG) have shown biomolecular adsorption less than 1 ng/cm(2) which was measured by surface analytical tools such as surface plasmon resonance (SPR) spectroscopy, quartz crystal microbalance (QCM), or optical waveguide lightmode (OWL) spectroscopy. Herein, we utilize a single-molecule imaging technique (i.e., an ultimate resolution) to study antifouling properties of functionalized surfaces. We found that about 600 immunoglobulin G (IgG) molecules are adsorbed. This result corresponds to ∼5 pg/cm(2) adsorption, which is far below amount for the detection limit of the conventional tools. Furthermore, we developed a new antifouling platform that exhibits improved antifouling performance that shows only 78 IgG molecules adsorbed (∼0.5 pg/cm(2)). The antifouling platform consists of forming 1 nm TiO2 thin layer, on which peptidomimetic antifouling polymer (PMAP) is robustly anchored. The unprecedented antifouling performance can potentially revolutionize a variety of research fields such as single-molecule imaging, medical devices, biosensors, and others.

Conserved linear dynamics of single-molecule Brownian motion

KAUST Repository

Serag, Maged F.

2017-06-06

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

Science.gov (United States)

Serag, Maged F.; Habuchi, Satoshi

2017-06-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

KAUST Repository

Serag, Maged F.; Habuchi, Satoshi

2017-01-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Diffusion of lipids and GPI-anchored proteins in actin-free plasma membrane vesicles measured by STED-FCS

DEFF Research Database (Denmark)

Schneider, Falk; Waithe, Dominic; Clausen, Mathias P

2017-01-01

(STED-FCS) to access and compare the diffusion characteristics of fluorescent lipid analogues and GPI-anchored proteins (GPI-APs) in the live cell plasma membrane and in actin cytoskeleton-free cell-derived giant plasma membrane vesicles (GPMVs). Hindered diffusion of phospholipids and sphingolipids......Diffusion and interaction dynamics of molecules at the plasma membrane play an important role in cellular signalling, and they are suggested to be strongly associated with the actin cytoskeleton. Here, we utilise super-resolution STED microscopy combined with fluorescence correlation spectroscopy...... forming immobile clusters, both of which disappear in GPMVs. Our data underline the crucial role of the actin cortex in maintaining hindered diffusion modes of many but not all of the membrane molecules, and highlight a powerful experimental approach to decipher specific influences on molecular plasma...

The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

Science.gov (United States)

Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

2011-01-25

DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.