WorldWideScience

Sample records for anastrepha

  1. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  2. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2016-07-01

    Full Text Available ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae is recorded for the first time parasitizing Anastrepha obliqua (Macquart (Diptera: Tephritidae in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae in Brazil.

  3. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    OpenAIRE

    Almerinda Amélia Rodrigues Araújo; Paulo Roberto Ramalho Silva; Ranyse Barbosa Querino Silva; Elizangela Pereira da Silva Sousa

    2016-01-01

    ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae) is recorded for the first time parasitizing Anastrepha obliqua (Macquart) (Diptera: Tephritidae ) in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae) in Brazil.

  4. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  5. Distribution of Anastrepha spp. in carambola orchards: Evidence for migration

    Science.gov (United States)

    Carambola orchards in Juana Diaz, Corozal, and Isabela, PR, were monitored for Anastrepha spp. fruit flies using Multi-lure traps baited with putrescine and ammonium acetate. The number of flies at various locations within the orchards were statistically compared with the expected distribution if fl...

  6. Ammonia Formulations and Capture of Anastrepha Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted in numbers to protein baits. Synthetic lures based on the principle components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important ...

  7. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  8. Ammonium Acetate and Ammonium Bicarbonate in Traps for Anastrepha Fruit Flies

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Anastrepha s...

  9. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae).

    Science.gov (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A

    2016-09-15

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  10. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae)

    Science.gov (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  11. Morphological characterization of the reproductive system of irradiated Anastrepha fraterculus

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Andrea, E-mail: andreabartolucci@iscamen.com.a [Instituto de Sanidad y Calidad Agropecuaria de Mendoza (ISCAMEN), Mendoza (Argentina); Vera, M. Teresa [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), (Argentina); Yusef, Veronica [Comision Nacional de Energia Atomica (Argentina). Centro Atomico Ezeiza; Oviedo, Andrea [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Field identification of released sterile insects is a major issue for eradication and suppression programs. Irradiated flies are normally identified by the presence of a fluorescent dye. When a fly lacks fluorescent dye, determination of gonadal state is necessary to identified between sterile or fertile flies. This is particularly relevant when population levels have decreased. Animal and identification is required to be as unequivocal as possible. Here we describe the reproductive system of irradiated Anastrepha fraterculus of different ages and we compare it with that of fertile flies in order to provide a diagnosis tool. Fertile and irradiated A. fraterculus were dissected from the day of emergence and until 15 days of age. Gross morphology was described and the gonads were measured. Germ cells were visualized in the testis. The reproductive systems of both males and females contained the same structures as other Anastrepha species. From day 1 to day 3, there were no detectable differences between irradiated and fertile males. The growing region encompassed half the testis total length and there was no free sperm in the seminal vesicle. On day 4 the presence of free sperm was seen in the seminal vesicle. At this stage irradiated males started differentiating from fertile ones: the growing region reduced in size and totally disappeared by day 11; sperm bundle zones occupied most of the testis; spermatids lost their triangular shape and sperm remained in the seminal vesicle without moving into the apical region. Testis length and width of irradiated males did not differ from fertile males. In females, the maturation of the ovaries involved a change in size that was more pronounced in the length of the ovary. This became noticeable at day 3. At this stage, the formation of yolk and the basal follicle began in fertile females and the oocyte had the same size as the trophocytes. From this point, the oocyte started growing. After day 8, the maturing oocyte reached

  12. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  13. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  14. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  15. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  16. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae)

    Science.gov (United States)

    Mascarenhas, Rodrigo O; Prezotto, Leandro F; Perondini, André Luiz P; Marino, Celso Luiz; Selivon, Denise

    2016-01-01

    Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids. PMID:27648768

  17. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae)

    Science.gov (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  18. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae and parasitoid wasps (Braconidae

    Directory of Open Access Journals (Sweden)

    Rodrigo O Mascarenhas

    Full Text Available Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

  19. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  20. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-01-10

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack.

  1. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha

    2010-06-01

    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study

  2. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  3. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  4. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  5. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults

    Science.gov (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  6. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua

    Science.gov (United States)

    Different lures based on hydrolyzed protein products were assayed in the field for their ability to attract Anastrepha suspensa and A. obliqua (Diptera: Tephritidae). Typically, ammonium acetate with putrescine and freeze-dried NuLure with ammonium acetate and putrescine attracted more flies than ot...

  7. Electroantennogram response and attraction of Anastrepha suspensa to volatiles of various sugar sources and aged sugar sollutions

    Science.gov (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  8. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  9. Male sexual behavior and pheromone emission is enhanced by exposure to guava fruit volatiles in Anastrepha fraterculus

    Science.gov (United States)

    Host plant chemicals can influence sex pheromone communication of tephritid fruit flies, and affect strategies optimizing mating and reproduction. Previous studies suggest that females of the South American fruit fly, Anastrepha fraterculus, prefer to mate with laboratory males previously exposed to...

  10. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures.

    Science.gov (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R

    2009-08-01

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  11. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  12. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate

  13. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  14. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  15. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  16. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  17. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  18. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  19. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain

  20. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato

    2015-10-01

    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  1. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L

    2015-08-01

    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus.

  2. Viability of Cabralea canjerana extracts to control the South American fruit fly, Anastrepha fraterculus.

    Science.gov (United States)

    Magrini, Flaviane Eva; Specht, Alexandre; Gaio, Juliano; Girelli, Cristiane Priscila; Migues, Ignacio; Heinzen, Horacio; Sartori, Valdirene Camatti; Cesio, Veronica

    2014-04-10

    Several representatives of Meliaceae contain biologically active compounds that are toxic to insects with few negative effects on the environment and humans. Our study evaluated the activity of ethyl acetate and ethanol extracts from the fruit and seeds of Cabralea canjerana (Vellozo) Mart (Sapindales: Meliaceae) on Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae). Limonoids and triterpenes were detected in fruit and seed extracts. Each extract was added to an artificial diet at three concentrations and tested after 24, 48, and 72 hr of extract application. Ethyl acetate extracts were the most active ones and showed the effect of both dose and time elapses after application on the insects. The highest toxic effect on A. fraterculus adults was from ethyl acetate extracts from fruit, followed by extracts from seeds. These extracts showed antifeedant activities. Extract solutions sprinkled on fruits of Carica papaya (L.) (Brassicales: Caricaceae) caused oviposition repellency and negatively affected the biological development of A. fraterculus. Ethyl acetate extracts highly hampered oviposition, but seed extracts showed lesser oviposition deterrence. The fruit and seed extracts diminished pupal viability. Particularly, the ethyl acetate fruit extract caused malformed adults. The sex ratio was also affected, resulting in female predominance for the fruit extract, while the seed extract showed a dose-dependent effect. Low doses caused male abundance, but at higher concentrations the effect was reversed. These encouraging results showed that the C. canjerana extracts have great potential as new tools to be used in integrated pest management programs to protect fruits against A. fraterculus.

  3. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M

    2015-12-01

    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  4. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses.

    Science.gov (United States)

    Orozco-Dávila, Dina; Adriano-Anaya, Maria de Lourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel

    2015-01-01

    A genetic sexing strain of Anastrepha ludens (Loew), Tapachula-7, was developed by the Mexican Program Against Fruit Flies to produce and release only males in programs where the sterile insect technique (SIT) is applied. Currently, breeding are found at a massive scale, and it is necessary to determine the optimum irradiation dose that releases sterile males with minimum damage to their sexual competitiveness. Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild females and offspring survivorship. The results of the study indicate that irradiation doses have a significant effect on the sexual behavior of males. A reduction of mating capacity was inversely proportional to the irradiation dose of males. It is estimated that a dose of 60 Gy can induce more than 99% sterility in wild females. In all treatments, the degree of offspring fertility was correlated with the irradiation dose of the parents. In conclusion, the results of the study indicate that a dose of 60 Gy can be applied in sterile insect technique release programs. The application of this dose in the new genetic sexing strain of A. ludens is discussed.

  5. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  6. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    Full Text Available 1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponderante. 3. Las moscas Anastrephas constituyen la plaga más importante de la fruticultura nacional, y por esta razón, un estudio sobre estos insectos es un tema de importancia. 4. Las principales "moscas de las frutas" pertenecen dentro de la familia Trypetidae, a los géneros: Dacus, Rhaglethis, Ceratitis, Dactrocera y Anastrepha. 5. Los nombres comunes con que se conocen las moscas Anastrephas varían de un país a otro y se relacionan particularmente con el lugar de origen de las distintas especies o la fruta determinada como preterida por la mosca en una localidad. En Colombia la denominación vernácula más difundida es la de "gusano de las frutas". También se nombra el insecto como "mosca o gusano del mango" o "gusano de la guayaba". 6. Los nombres científicos de las moscas distinguen a una, gran cantidad de especies. En Colombia, varios autores han reportado la existencia de las especies A.fraterculus, A. ludens, A. mombinpracoptans, A. pikeli y A. serpentina. Todas estas especies inciden en las regiones colombianas comprendidas entre 0 y 2000 metros de altura, es decir, en casi todas las regiones agrícolas importantes (frutales, café, cacao de temperaturas entre 14° y 30° C. 7. Las moscas Anastrephas están confinadas casi exclusivamente al continente americano entre las latitudes 27° N. y 35° S. Particularmente, la especie A. fraterculus, una de las más difundidas en Colombia, fué determinada por Wiedemann (1830

  7. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (Diptera;Tephritidae)

    Science.gov (United States)

    Lures based on odors released by hydrolyzed protein were assessed for their attractiveness to Anastrepha obliqua and A. suspensa at three locations in Puerto Rico in August through October 2009. Lures compared included ammonium acetate combined with putrescine, hydrolyzed corn protein (Nulure) with ...

  8. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico

    Science.gov (United States)

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua and A. suspensa at four sites in Guánica, Puerto Rico; one forest fragment in Ponce, Puerto Rico; in a commercial mango orchard in Guayanilla, PR; and an experimental carambola orcha...

  9. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    Science.gov (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  10. Response of Anastrepha suspensa (Diptera: Tepritidae) to white and brown cane, coconut, date, date jaggery and panela sugar solutions with varying degrees of fermentation

    Science.gov (United States)

    We measured the EAG response of Anastrepha suspensa (Loew), the Caribbean fruit fly to six different sugars (white and brown cane, coconut, date, date jaggery and panela sugars). Wild and lab female flies of different physiological states (immature and mature) were tested in dry crystals and 10% su...

  11. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  12. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    Science.gov (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  13. The temporal pattern of mating behavior of the fruit fly, Anastrepha zenildae in the laboratory.

    Science.gov (United States)

    Almeida, Lucia M de; Araújo, Arrilton; Mendes, Norma H D; Souza, João M G A de; Menezes, Alexandre A L

    2011-01-01

    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00-19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5-6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5-7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5-163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation.

  14. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  15. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards.

    Science.gov (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco

    2014-06-01

    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  16. Evaluating the quality of the Mexican fruit-fly, Anastrepha ludens, as host for the parasitoid Melittobia digitata

    Directory of Open Access Journals (Sweden)

    J.M. González

    2013-08-01

    Full Text Available We investigated the presence of Melittobia digitata (Hymenoptera: Eulophidae and its associations with its natural hosts in Veracruz, Mexico. The parasitoid was confirmed to be present and found to attack prepupae of Trypoxylon and Sceliphron (Hymenoptera: Crabronidae and Sphecidae, respectively mud daubers as well as pupae of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae. Since A. ludens is a very important pest of citrus and mango in Mexico and Central America, we evaluated, in laboratory experiments, the quality of A. ludens as host of M. digitata comparing the development of the parasitoid in another unrelated fly species (Sarcophaga [Neobellieria] bullata (Diptera: Sarcophagidae and in mud dauber wasps (Trypoxylon sp. and Sceliphron sp.. The Mexican fruit fly appears to be a good-quality host for M. digitata, and the results are discussed in the context of their possible interest as a natural enemy of A. ludens.

  17. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  18. Selection by mating competitiveness improves the performance of Anastrepha ludens males of the genetic sexing strain Tapachula-7.

    Science.gov (United States)

    Quintero-Fong, L; Toledo, J; Ruiz, L; Rendón, P; Orozco-Dávila, D; Cruz, L; Liedo, P

    2016-10-01

    The sexual performance of Anastrepha ludens males of the Tapachula-7 genetic sexing strain, produced via selection based on mating success, was compared with that of males produced without selection in competition with wild males. Mating competition, development time, survival, mass-rearing quality parameters and pheromone production were compared. The results showed that selection based on mating competitiveness significantly improved the sexual performance of offspring. Development time, survival of larvae, pupae and adults, and weights of larvae and pupae increased with each selection cycle. Differences in the relative quantity of the pheromone compounds (Z)-3-nonenol and anastrephin were observed when comparing the parental males with the F4 and wild males. The implications of this colony management method on the sterile insect technique are discussed.

  19. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-03-16

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap.

  20. MONITORAMENTO POPULACIONAL DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE MANGA (Mangifera indica L. NO MUNICÍPIO DE JABOTICABAL – SP

    Directory of Open Access Journals (Sweden)

    Wilson Carlos Pazini

    2013-05-01

    Full Text Available The population monitoring of agricultural pests is an important tool to select the best control methodto be employed in a determined culture. Thus, the objective of this research was analyze the population fluctuation of Anastrepha spp. correlated with the mango tree phenology and the meteorological elements, temperature, relative humidity and pluviometric precipitation. The study was conducted between Mach 2009 to August 2010 in Jaboticabal, SP. For Anastrepha spp. monitoring, we randomly installed five yellow stick traps in an experimental orchard composed by a collection of mango varieties. These traps were replaced every fifteen days and carried to the Laboratory of Ecological Selectivity of the Department of Plant Protection (FCAV/UNESP to evaluate the sampled specimens. The meteorological data were recorded at the FCAV/UNESP Meteorological Station, located approximately 200 m from the study area. The results showed that the greater and more consistent Anastrepha spp. population density is between the spring and summer seasons, particularly related to the mature fruits. A weak positive correlation is observed between maximum temperature (°C and relative humitidy (% when compared with the Anastrepha spp. population density. There is moderate positive correlation between minimum and medium temperatures (°C and accumuluted pluviometric precipitation (mm when compared with the said agricultural pest.O monitoramento populacional de insetos considerados pragas agrícolas constitui uma importante ferramenta para a escolha do melhor método de controle a ser empregado em determinada cultura. Desta forma, o objetivo desta pesquisa foi analisar a flutuação populacional de Anastrepha spp. correlacionada com a fenologia da mangueira e com os elementos meteorológicos, temperatura, umidade relativa e precipitação pluviométrica. O estudo foi desenvolvido no período entre março de 2009 a agosto de 2010 no município de Jaboticabal, SP. Para o

  1. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  2. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  3. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira

    2006-03-01

    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  4. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  5. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  6. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  7. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  8. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  9. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  10. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape.

    Science.gov (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D

    2016-08-01

    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  11. Limits to the host range of the highly polyphagous tephritid fruit fly Anastrepha ludens in its natural habitat.

    Science.gov (United States)

    Birke, A; Acosta, E; Aluja, M

    2015-12-01

    Anastepha ludens (Diptera: Tephritidae) is a highly polyphagous fruit fly that is able to develop in a wide range of hosts. Understanding the limits of this pest's host range could provide valuable information for pest management and plant breeding for pest resistance. Previous studies have shown that guavas (Psidium guajava (Myrtaceae) L.), are not attacked under natural conditions by A. ludens. To understand this phenomenon, guavas were exposed to natural infestation by A. ludens and to other fruit fly species that infest guavas in nature (Anastrepha striata Schiner, Anastepha fraterculus (Wiedemann), Anastepha obliqua (Macquart)). Once the susceptible phenological stage of guavas was determined, fruit infestation levels were compared between A. ludens and A. striata. Choice and non-choice tests were performed under field-cage conditions. Under field conditions, guavas were susceptible to A. striata and A. fraterculus attack all the way from when fruit was undeveloped to when fruit began to ripen. No infestation by A. ludens was recorded under natural conditions. Similar results were obtained when forced exposures were performed, indicating that unripe guavas were preferred by A. striata over ripe fruit, and that infestation rates were higher at early fruit maturity stages. Under forced oviposition conditions, A. ludens larvae were unable to develop in unripe guavas but did so in fully ripe fruit. However, A. ludens fitness parameters were dramatically affected, exhibiting reduced survival and reduced pupal weight compared to conspecifics that developed in a natural host, grapefruit. We confirm that P. guajava should not be treated as a natural host of this pestiferous species, and suggest that both behavioral aspects and the fact that larvae are unable to adequately develop in this fruit, indeed represent clear limits to A. ludens's broad host range.

  12. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  13. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Calore

    2013-03-01

    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..

  14. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  15. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  16. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com

  17. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina.

    Science.gov (United States)

    Cladera, Jorge L; Vilardi, Juan C; Juri, Marianela; Paulin, Laura E; Giardini, M Cecilia; Gómez Cendra, Paula V; Segura, Diego F; Lanzavecchia, Silvia B

    2014-01-01

    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication.

  18. Himenópteros parasitóides de larvas de Anastrepha spp. em frutos de carambola (Averrhoa carambola L. na região de Divinópolis, Minas Gerais, Brasil Himenopterous parasitoids of Anastrepha spp. larvae, in star fruit (Averrhoa carambola L. In divinópolis region, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Cláudio Gonçalves Silva

    2003-12-01

    Full Text Available Este trabalho foi conduzido com o objetivo de conhecer os parasitóides de moscas-da-fruta na região de Divinópolis-MG. As pupas foram obtidas pelo método de flutuação, sendo individualizadas em cápsulas de gelatina até a emergência das moscas adultas ou de seus parasitóides. A prevalência total de parasitismo foi de 14,8%. Trichopria anastrepha foi a espécie mais comum, com 44,5%.The objective of this work was to identify the parasitoids of fruit flies in Divinópolis-MG region. The pupae were obtained by the flotation method. They were individually placed in gelatin capsules until the emergency of the adult flies or their parasitoids. The overall prevalence of parasitism was 14,8%. Trichopria anastrepha was the most common specie with a frequency of 44,5%.

  19. Long aculeus and behavior of Anastrepha ludens render gibberellic acid ineffective as an agent to reduce 'ruby red' grapefruit susceptibility to the attack of this pestiferous fruit fly in commercial groves.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martín; Greany, Patrick; Bigurra, Everardo; Pérez-Staples, Diana; McDonald, Roy

    2006-08-01

    Treating Mexican grapefruit with gibberellic acid (GA3) before color break, significantly delayed peel color change and increased peel puncture resistance, but it did not reduce grapefruit susceptibility to Mexican fruit fly, Anastrepha ludens (Loew) attack under natural conditions. Despite GA3 treatments, larval infestation levels increased with higher fruit fly populations, which also increased as the season progressed. Late in the season, infestation levels were even higher in GA3-treated fruit compared with untreated fruit, possibly because treated fruit were in better condition at that stage. Egg clutch size was significantly greater in very unripe, hard, GA3-treated fruit at the beginning of the harvest season and in December, compared with control fruit. Under laboratory conditions, egg injection into different regions of the fruit suggested that A. ludens eggs are intoxicated by peel oil content in the flavedo region. However, A. ludens' long aculeus allows females to oviposit eggs deeper into the peel (i.e., albedo), avoiding toxic essential oils in the flavedo. This makes A. ludens a particularly difficult species to control compared with other citrus-infesting species such as Anastrepha suspensa (Loew), Anastrepha fraterculus (Wiedemann), and Ceratitis capitata (Wiedemann) (fly species with significantly shorter aculei), which can be effectively managed with GA3 sprays. We discuss our findings in light of their practical implications and with respect to the oviposition behavior of various fruit flies attacking citrus.

  20. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder

    1993-09-01

    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  1. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  2. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel

    2015-08-01

    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  3. Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype.

    Science.gov (United States)

    Hernández-Ortiz, V; Gómez-Anaya, J A; Sánchez, A; McPheron, B A; Aluja, M

    2004-12-01

    Discriminant function and cluster analyses were performed on 19 morphometric variables of the aculeus, wing and mesonotum to determine whether populations of Anastrepha fraterculus (Wiedemann) from different parts of Mexico could be distinguished from populations from South America. Samples were collected from seven localities across Mexico, two from Brazil, and one each from Colombia and Argentina. Results showed there were statistically significant differences between Mexican and South American populations with respect to the aculeus (tip length, length of serrated section, mean number of teeth) and wing (width of S-band and connection between S- and V-bands). The degree of morphological variation observed among Mexican populations was extremely low, and as a consequence, the Mexican populations were identified as a single morphotype by discriminant analysis. The 'Andean morphotype'consisting of the Colombian population, and the 'Brazilian morphotype'consisting of the two Brazilian populations plus the single Argentinian population were also distinguished. It was concluded that the macro-geographical morphotypes from Mexico, Colombia, and Brazil plus Argentina correspond to three distinct taxonomic entities. Comparisons of results with those obtained from behavioural, karyotypic, isozyme and DNA studies suggest that sufficient evidence now exists to name a new Mexican species from within the A. fraterculus complex. This will be done in a separate publication. A provisional key to the morphotypes of A. fraterculus studied is provided.

  4. Can consumption of antioxidant rich mushrooms extend longevity?: antioxidant activity of Pleurotus spp. and its effects on Mexican fruit flies' (Anastrepha ludens) longevity.

    Science.gov (United States)

    Sánchez, José E; Jiménez-Pérez, Gabriela; Liedo, Pablo

    2015-12-01

    The variability of antioxidant capacity of 14 strains of the edible oyster mushroom Pleurotus spp. was determined, and the effect of selected mushroom supplements on the longevity of the Mexican fruit fly, Anastrepha ludens, was evaluated. The antioxidant capacity of the fruiting bodies was determined by three different methods, measuring the free radical scavenging activity of methanolic extracts, the OH radical scavenging capacity, and the total phenol content. The inhibition percentage of the DPPH radical varied between 32.6 and 85.7% and total phenols varied between 30.6 and 143.3 mg/g. The strains with the highest (Pleurotus djamor ECS-0142) and lowest (Pleurotus ostreatus ECS-1123) antioxidant capacity were selected to study their effect on the survival, life expectancy, and mortality of the Mexican fruit fly A. ludens. The results demonstrated differing responses between male and female flies. High concentrations of mushrooms (5 and 20%) in the diet resulted in a decrease in life expectancy. However, flies on the diet with 1% P. djamor ECS-0142 showed slightly but significantly greater survival than those on the control diet. The possible adverse effect of protein content in mushroom extracts is discussed.

  5. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    E. Foelkel

    Full Text Available Abstract Entomopathogenic nematodes (EPNs are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  6. OCORRÊNCIA E ÍNDICE DE INFESTAÇÃO DE Anastrepha spp. (DIP., TEPHRITIADE EM Pouteria gardneriana Radlk. E Pouteria ramiflora (Mart. Radlk. (SAPOTACEAE, NOS CERRADOS DE GOIÁS OCCURENCE AND INFESTATION INDEXES OF Anastrepha spp. (DIP., TEPHIRITIDAE IN Pouteria gardneriana RADLK AND Pouteria ramjflora (MART. RADLK. (SAPOTACEAE IN “CERRADOS” OF THE STATE OF GOIÁS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Nelson Augusto Canal Daza

    2007-09-01

    Full Text Available

    Dentre as frutíferas nativas dos cerrados goianos destacam-se as do gênero Pouteria, com ampla distribuição nas regiões tropicais e subtropicais de todo o mundo, sendo a P. ramiflora (curriola a mais comum. Pouteria gardneriana (guapeva ocorre geralmente nos solos mais úmidos, sempre agrupada na faixa de separação cerrados-veredas. Dos 25 municípios do Estado de Goiás amostrados, em nove foi registrada a ocorrência dessas duas espécies de Pouteria, cujos frutos são bastante suscetíveis ao ataque de moscas-das-frutas. Dos frutos de guapeva e curriola, emergiram adultos de Anastrepha (99,82% e apenas alguns exemplares de Ceratitis capitata (0,18%. As espécies coletadas em P. gardneriana foram: Anastrepha bistrigata, A. fraterculus, A. leptozona, A. serpentina, A. zenildae, A. zernyi e C. capitata. De P. ramiflora foram obtidas: A. fraterculus, A. leptozona, A. serpentina e A. zernyi. Dos pupários de Anastrepha

  7. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae)

    Science.gov (United States)

    Costa, M. L. Z.; Pacheco, M. G.; Lopes, L. A.; Botteon, V. W.; Mastrangelo, T.

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata. Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata. The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. PMID:27638956

  8. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  9. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  10. Selection of artificial hosts for oviposition by wild Anastrepha obliqua (Macquart (Diptera, Tephritidae: influence of adult food and effect of experience Seleção de hospedeiros artificiais para oviposição por Anastrepha obliqua (Macquart (Diptera, Tephritidae selvagem: influência do alimento do adulto e efeito da experiência

    Directory of Open Access Journals (Sweden)

    Thamara A. B. S. Leal

    2008-09-01

    Full Text Available Several factors influence the selection of oviposition substrates by insects. The aim of the present work was to find answers to the following questions related to the oviposition behavior of Anastrepha obliqua. Can carbohydrates (glucose or sucrose present in the adult diet have influence on the female preference for an oviposition substrate with similar composition? Can the previous experience with a host containing one of mentioned carbohydrates interfere in further selection of oviposition substrates? The results showed that the kind of carbohydrate present in the adult diet did not affect the female preference for an artificial oviposition substrate, neither when it was presented by itself nor in combination with brewer's yeast. The effect of experience in the oviposition behavior was observed when there was a previous contact with artificial oviposition substrates containing yeast and sucrose. The data are discussed in terms of the behavioral plasticity presented by this species in relation to feeding and oviposition behaviors.Vários fatores podem atuar durante a seleção de substratos para oviposição por insetos. O presente estudo teve por objetivo responder às seguintes questões relacionadas ao comportamento de oviposição de Anastrepha obliqua. O carboidrato presente na dieta do adulto (glicose ou sacarose pode influenciar a preferência da fêmea por um substrato para oviposição com composição semelhante? A experiência prévia com um hospedeiro que possui um dos dois carboidratos citados pode interferir em escolhas futuras entre substratos para oviposição? Os resultados indicaram que o tipo de carboidrato presente na dieta do adulto não exerceu influência sobre a preferência das fêmeas por um substrato artificial para oviposição, tanto quando em combinação com lêvedo de cerveja ou quando sozinho. O efeito da experiência no comportamento de oviposição foi notado quando o contato prévio foi com substratos

  11. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  12. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  13. Conditional lethality strains for the biological control of Anastrepha species

    Science.gov (United States)

    Pro-apoptotic cell death genes are promising candidates for biologically-based autocidal control of pest insects as demonstrated by tetracycline (tet)-suppressible systems for conditional embryonic lethality in Drosophila melanogaster (Dm) and the medfly, Ceratitis capitata (Cc). However, for medfly...

  14. Solar sterilization of abscised fruit: a cultural practice to reduce infestations of Anastrepha obliqua around orchards

    Science.gov (United States)

    Abscised mangoes, Mangifera indica L., of several varieties were stored under varying conditions of insolation, including no sun (stored in a laboratory), shade (stored under the shade of a mango tree), full sun (stored in direct view of the sun), and covered in a black plastic bag and stored in dir...

  15. Contribución al estudio de las moscas anastrephas en colombia.

    OpenAIRE

    González Mendoza, Rafael

    2012-01-01

    1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponder...

  16. Response of Anastrepha suspensa to liquid protein baits and synthetic lure formulations

    Energy Technology Data Exchange (ETDEWEB)

    Epsky, Nancy D.; Kendra, Paul E.; Heath, Robert R., E-mail: Nancy.Epsky@ars.usda.go, E-mail: Paul.Kendra@ars.usda.go, E-mail: Bob.Heath@ars.usda.go [U.S. Department of Agriculture (USDA/ARS/SHRS), Miami, FL (United States). Agricultural Research Service. Subtropical Horticulture Research Station

    2006-07-01

    Traps baited with AAPt captured more A. suspensa than traps baited with ABPt even when the ammonia release rates were similar. Reducing dosage of ammonia by 50% of the commercially available AA lure slightly increased female capture, but reducing dosage to 25% tended to decrease female capture. The 5% CPH/3% borax bait captured the same number of flies as TYB, and was more effective than 10% CPH/3% borax. Further decreasing the amount of borax added to CPH may improve its effectiveness. As has been observed in field tests, fresh TYB captures more A. suspensa than fresh Nulure/borax but this difference decreases as the bait solutions age. EAG analysis indicates that volatiles from fresh Nulure/ borax elicit a higher antennal response than TYB, but this difference decreases as the TYB solution ages. Chemical analysis will be needed to determine the nature of reduced capture by fresh Nulure/borax and to identify additional attractive chemicals emitted by these protein baits. (author)

  17. Pro-apoptotic gene regulation in the Caribbean fruit fly, Anastrepha suspensa

    Science.gov (United States)

    Transcriptional activation of pro-apoptotic genes in response to cytotoxic stimuli is a conserved feature of the cell death pathway proposed for metazoans. However, understanding the extent of this conservation in insects, as well as other organisms, has been limited by the lack of known pro-apoptot...

  18. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  19. 墨西哥按实蝇在我国的适生性分析%Analysis of the suitability of Mexican fruit fly, Anastrepha ludens in China

    Institute of Scientific and Technical Information of China (English)

    耿建; 李志红; 万方浩; 王之岭

    2008-01-01

    墨西哥按实蝇是美洲地区严重危害水果生产的一种重要害虫.本研究采用CLIMEX模型与ArcGIS分析相结合的预测方法,明确了墨西哥按实蝇的CLIMEX参数指标体系和适生性评判标准,分析了该实蝇在我国的的适生范围和适生程度.研究发现冬季低温构成了影响墨西哥按实蝇分布的主要限制因素,墨西哥按实蝇在我国南部较为适生,分布在16.43~27.12°N,97.67~121.29°E和28.19~30.83°N,102.53~108.42°E范围内,其中云南、广西、广东、海南和台湾5省入侵并适生的可能性较高.鉴于该实蝇在我国南方地区适生范围较广,适生程度较高,我国应加强墨西哥按实蝇的植物检疫措施力度,严防该虫的传入.

  20. Biodemography of a long-lived tephritid: Reproduction and longevity in a large cohort of female Mexican fruit flies, Anastrepha ludens

    Science.gov (United States)

    Carey, James R.; Liedoc, Pablo; Muüller, Hans-Georg; Wang, Jane-Ling; Senturke, Damla; Harshman, Lawrence

    2008-01-01

    Age of sexual maturity, daily and lifetime reproductive rates, and life span were recorded in a laboratory cohort of Mexican fruit flies consisting of over 1100 females maintained individually. The results revealed that, relative to the medfly, the Mexfly is slower maturing (14 vs 17 days), more fecund (1400 vs 650–1100 eggs/female), and longer lived (50 vs 35 days). The results reinforced the generality of several earlier findings on the medfly including the deceleration of mortality at older ages and the weakness of the correlation between the rate of egg laying at early ages and both subsequent reproduction and remaining longevity. Discussion includes perspectives on the role of artificial selection in shaping the demographic traits of the mass-reared strain of Mexfly used in this study, as well as the overall significance of large scale biodemographic studies in understanding aging and longevity. PMID:16154309

  1. Relative utility of arrhenotokous and Wolbachia-associated thelytokous Odontosema anastrephae figitid fruit fly parasitoids for mass rearing and biological control

    Science.gov (United States)

    Thelytokous parasitoid strains are theoretically advantageous when utilized for biological control, as the absence of males should reduce production costs and potentially increase field efficacy. The maternally inherited intracellular bacterium, Wolbachia pipientis, is capable of inducing reproducti...

  2. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  3. Mass production in liquid diet and radiosterilization of South American fruit fly Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae); Criacao massal em dieta liquida e radioesterilizacao da mosca-sulamericana Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Kamiya, Aline Cristiane

    2010-07-01

    Both the biological control techniques as the Sterile Insect Technique (SIT), are used in many countries to control, suppress and even eradicate fruit flies and other pests in agriculture and public health. The use of such techniques minimizes the continuous employment of insecticides, protects the environment and conforms to standards for food safety. However, it is necessary to implement such programs, technology to produce millions of parasitoids and the pest in its own laboratory with biological quality similar to the insects found in nature and cost competitive with chemical control. The objectives of this study was to establish protocols for artificial rearing of A. sp. 1 aff. fraterculus in liquid larval diet that will achieve levels of mass production for a possible reduction in the cost of establishing and determining the dose of radiation sterilization of adult A. sp. 1 aff. fraterculus meeting the quality parameters required by the Sterile Insect Technique with insects from the creation of Radioentomology Laboratory of CENA/USP. Seven experimental diets compared to the conventional diet used in Radioentomology Lab. of CENA/USP, which was used as control. All seven diets have in common the exclusion of agar in its formulation. Only two of the diets tested were suitable for larval development of the fly, they compared with the standard diet, showed inferior results with respect to the volume of recovered larvae, pupae and weight of emergency, however, no significant differences regarding the periods of development , pupal recovery, sex ratio and longevity under stress. It is possible to replace the diet with agar for liquid diets for artificial creation of A. sp. 1 aff. fraterculus, reduced cost and greater convenience of handling, but due to their quality standards lower than the standard diet, more tests are needed especially regarding the adaptability of the insect to the new environment. To determine the sterilizing dose this study examined the fertility, fecundity, emergence, flight ability and longevity under stress in A. fraterculus irradiated with 40, 50, 60, 70 and 80 Gy. The radiation source was a gamma irradiator with a Co-60 (Gamma beam-650) located in the same laboratory. The tests were performed under the following environmental conditions: 26 +- 1 deg C, 70 +- 5% RH and photoperiod of 12:12. The dose of gamma radiation sterilization for male A. sp. 1 aff. fraterculus was determined with 70 Gy. Irradiates females, even with the lower dose of 40 Gy, laid no eggs, possibly due to atrophy of the ovaries caused by radiation. The radiation did not affect the other quality parameters such as insect emergence, longevity and ability to fly. (author)

  4. Closely related Wolbachia recovered from different genera of Mexican Thelytokous figitidae (Hymenoptera)

    Science.gov (United States)

    Closely related novel Wolbachia strains were recovered from the thelytokous figitids Odontosema anastrephae Borgmeier and Aganaspis alujai Ovruski et al. No Wolbachia were detected in a bi-sexual strain of O. anastrephae. While the presence or absence of Wolbachia does not demonstrate that Wolbachia...

  5. 78 FR 68021 - Notice of Affirmation of Addition of a Treatment Schedule for Methyl Bromide Fumigation of...

    Science.gov (United States)

    2013-11-13

    ... species, Ceratitis capitata (Mediterranean fruit fly) and Anastrepha fraterculus (South American fruit fly... bromide treatment schedule to mitigate risk from C. capitata and A. fraterculus, as described in the...

  6. 7 CFR 319.56-44 - Untreated grapefruit, sweet oranges, and tangerines from Mexico for processing.

    Science.gov (United States)

    2010-01-01

    ... program using sterile insect technique for Mexican fruit fly. (h) Compliance agreements. Processing plants... Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE FOREIGN... technique for the Mexican fruit fly (Anastrepha ludens). (b) Fruit fly trapping protocol. (1)...

  7. Avaliação de atrativos alimentares utilizados no monitoramento de mosca-das-frutas em pessegueiro na lapa- PR Food attractants used in the monitoring of fruit flies in peach trees in lapa, Paraná (PR, Brazil

    Directory of Open Access Journals (Sweden)

    Lino Bittencourt Monteiro

    2007-04-01

    Full Text Available As moscas-das-frutas do gênero Anastrepha são uma praga-chave na cultura do pessegueiro no Paraná. Atrativos alimentares foram testados para determinar a sua eficiência no monitoramento de moscas-das-frutas capturadas em frascos caça-moscas McPhail. O experimento foi conduzido por três anos, sendo que, em 2002, foram testados como atrativo o suco de uva da marca Maguari®, o hidrolisado enzimático de proteína da marca BioAnastrepha® e o vinagre da marca Chemin Agrin®. Nos dois anos seguintes, o vinagre foi substituído pelo composto protéico hidrolisável da marca Torula®. As substâncias atrativas à base de proteína foram as mais eficientes na captura de Anastrepha spp., e as capturas ocorreram antecipadas em relação ao suco de uva. De acordo com os resultados, recomendam-se atrativos à base de proteína para monitoramento de Anastrepha spp em pessegueiro, na Lapa.Fruit flies of Anastrepha genus are a key pest in peach trees in Paraná. Food attractants were tested to determine their efficiency in monitoring fruit flies captured in McPhail fly traps. The experiment was conducted over a period of three years. In 2002 the following attractors were tested: Maguari® brand grape juice, BioAnastrepha® brand hydrolyzed enzymatic protein and Chemin Agrin® vinegar. Over the next two years, the vinegar was replaced by Torula® hydrolyzed protein compound. Protein-based attractants were the most efficient in trapping Anastrepha spp. and captured flies earlier comparing to grape juice. According to the results, the use of protein-based attractants for monitoring Anastrepha spp in the Lapa peach trees was recommended.

  8. Larval endoparasitoids (Hymenoptera of frugivorous flies (Diptera, Tephritoidea reared from fruits of the cerrado of the State of Mato Grosso do Sul , Brazil

    Directory of Open Access Journals (Sweden)

    Manoel A. Uchôa-Fernandes

    2003-01-01

    Full Text Available This paper presents a five years survey of endoparasitoids obtained from the larvae of frugivorous Tephritidae and Lonchaeidae flies. The insects were reared from cultivated and wild fruits collected in areas of the cerrado in the State of Mato Grosso do Sul, Brazil. The flies obtained from 14 host fruit species were eight Anastrepha species, Ceratitis capitata (Wiedemann, 1824 (Tephritidae; Dasiops sp. and Neosilba spp. (Lonchaeidae. Eleven parasitoid species were collected: Braconidae - Asobara anastrephae (Muesebek, 1958, Doryctobracon areolatus (Szépligeti, 1911, D. fluminensis (Costa Lima, 1938, Opius bellus Gahan, 1930 and Utetes anastrephae (Viereck, 1913; Figitidae - Aganaspis nordlanderi Wharton, 1998, Lopheucoila anastrephae (Rhower, 1919, Odontosema anastrephae (Borgmeier, 1935 and Trybliographa infuscata Gallardo, Díaz & Uchôa-Fernandes, 2000 and, Pteromalidae - Spalangia gemina Boucek, 1963 and S. endius Walker, 1839. In all cases only one parasitoid emerged per puparium. D. areolatus was the most abundant and frequent parasitoid of fruit fly species, as was L. anastrephae in Neosilba spp. larvae. This is the first record of A. nordlanderi in the midwestern Brazilian region.

  9. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  10. ANÁLISE FAUNÍSTICA DE ESPÉCIES DE MOSCA-DAS-FRUTAS (DIP., TEPHRITIDAE EM MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    N.A. CANAL

    1998-01-01

    Full Text Available Em seis locais de quatro municípios (Janaúba, Jaíba, Nova Porteirinha e Itacarambí do norte do Estado de Minas Gerais, foram coletados 29.454 espécimes de mosca-das-frutas, pertencentes a Ceratitis capitata e a 20 espécies de Anastrepha. O levantamento foi feito entre janeiro de 94 e dezembro de 96, utilizando armadilhas plásticas tipo McPhail. Ceratitis capitata foi a espécie predominante em áreas urbanas. As espécies de Anastrepha predominaram em áreas rurais. A. obliqua, A. zenildae e Anastrepha n. sp.3 foram as espécies predominantes do gênero, entretanto, essa predominância variou de local para local em função da disponibilidade de hospedeiros. As comunidades apresentaram índices de diversidade baixos e quocientes de similaridade entre 73 e 100%.A total of 29,454 specimens of fruit fly were trapped in six sites of four counties (Janaúba, Jaíba, Nova Porteirinha and Itacarambí of the north of the State of Minas Gerais, Brazil. The specimens were collected using McPhail plastic traps from January 1994 to December 1996. The trapped fruit flies belonged to Ceratitis capitata and to 20 species of Anastrepha. Ceratitis capitata was the predominant species in the urban areas and Anastrepha species were predominant in the field areas. A. obliqua, A. zenildae and Anastrepha n. sp.3 were the predominant species of the genera, whereas the predominant species differed among localities, according to host availability. The diversity indexes were low and the coefficient of similarity varied from 73 to 100%.

  11. Umbu-cajá como repositório natural de parasitoide nativo de moscas-das-frutas Umbu-cajá as natural repository of native fruit fly parasitoids

    Directory of Open Access Journals (Sweden)

    Romulo da Silva Carvalho

    2010-10-01

    Full Text Available O objetivo deste trabalho foi avaliar diversidade de espécies de mosca-das-frutas e de parasitóides nativos em frutos de umbu-cajá (Spondias spp.. Os frutos foram coletados em nove municípios do Estado da Bahia. Estimaram-se: a infestação dos frutos pelas moscas; o índice de parasitismo das moscas; e a frequência de ocorrência das espécies de parasitóides. Pela primeira vez, a infestação de Anastrepha obliqua em frutos de umbu-cajá e a presença do parasitóide Asobara anastrephae em larvas de Anastrepha obliqua foram registradas. O parasitoide nativo Doryctobracon areolatus foi o mais frequente. A umbu-cajazeira é repositório natural de parasitoides de tefritídeos, e sua preservação é fundamental para a manutenção das relações tróficas entre as espécies de mosca-das-frutas e parasitoides.The objective of this work was to assess the species diversity of fruit fly and their parasitoids in fruit of umbu-cajá (Spondias spp.. Fruit were collected in nine municipalities of the state of Bahia, Brazil. Fruit infestation, fruit fly parasitism rates, and frequencies of the parasitoid species were estimated. For the first time, Anastrepha obliqua infesting umbu-cajá fruit and the presence of the native parasitoid Asobara anastrephae in Anastrepha oblique larvae were recorded. The native parasitoid Doryctobracon areolatus was the most frequent. Umbu-cajá tree is a natural repository of Tephritidae parasitoids, and its preservation is essential for the maintenance of trophic relationships between fruit fly species and parasitoids.

  12. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2008-11-15

    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  13. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  14. Antennal and behavioral responses to putrescine and ammonium bicarbonate in the Caribbean fruit fly (Diptera: tephritidae)

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies uses a 2-component lure that emits ammonia and putrescine, both regarded as protein cues. This study used electroantennography and flight tunnel bioassays to quantify olfactory and behavioral responses of A. suspensa to vapors from ammonium bicar...

  15. EAG and behavioral responses of the Caribbean fruit fly (Diptera:Tephritidae) to terminal diamines in a food-based lure.

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies utilize a food-based synthetic lure consisting of ammonium acetate and putrescine (1, 4 diaminobutane). Identification of additional attractant chemicals may lead to development of a more effective trapping system. This study, conducted with the...

  16. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    Traps baited with synthetic food-based lures that include blends of ammonia, either as ammonium acetate or ammonium bicarbonate, and putrescine capture a number of Anastrepha and Bactrocera species fruit flies. However, for many of these species, more flies are captured in traps baited with the pro...

  17. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures

    Science.gov (United States)

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  18. New developments in food-based synthetic attractants for pest Tephritidae.

    Science.gov (United States)

    Optimal capture of several species of Anastrepha and Bactrocera spp. tephritid fruit flies is in traps baited with the aqueous protein bait Nulure combined with borax. Nulure is produced by acid hydrolysis of corn and has an acidic pH. Addition of borax makes the solution more alkaline and more att...

  19. Ammonia as a component of fruit fly attractants.

    Science.gov (United States)

    Abstract Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Ana...

  20. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic

    Science.gov (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  1. Pheromones, male lures and trapping of tephritid fruit flies

    Science.gov (United States)

    The dipteran family of Tephritidae consists of many genera, of which several namely, Anastrepha, Bactrocera, Ceratitis, Dacus, Rhagoletis and Toxotrypana possess species of high economic importance as major pests of fruits and vegetables. Hitherto, pheromones isolated and identified for possible use...

  2. Species of fruit flies (Tephritidae obtained of McPhail trap in the Bahia State, Brazil/ Espécies de moscas-das-frutas (Tephritidae obtidas em armadilhas McPhail no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Miguel Francisco de Souza Filho

    2006-07-01

    Full Text Available The objective of this study was to provide knowledge on the species of fruit flies in commercial orchards in counties of the southern and extreme southern regions of the State of Bahia, Brazil. Flies were captured weekly by McPhail traps, using a hydrolyzed corn protein at 5%, as attractant. A total of 257 female was collected, and the species were identified as: Anastrepha fraterculus (77.4%, A. sororcula (4.7%, A. obliqua (2.7%, A. zenildae (0.8%, A. distincta (0.4%, A. consobrina (0.4%, Anastrepha sp.1 (5.1% and Ceratitis capitata (8.5%.O objetivo deste trabalho foi conhecer as espécies de moscas-das-frutas que ocorrem em pomares comerciais em alguns municípios da região sul e extremo-sul do estado da Bahia, Brasil. As moscas-dasfrutas foram capturadas, semanalmente, utilizando-se armadilhas McPhail, tendo como atrativo proteína hidrolisada de milho a 5%. Foi obtido um total de 257 espécimes fêmeas, pertencentes às espécies: Anastrepha fraterculus (77,4%, A. sororcula (4,7%, A. obliqua (2,7%, A. zenildae (0,8%, A. distincta (0,4%, A. consobrina (0,4%, Anastrepha sp.1 (5,1% e Ceratitis capitata (8,5%.

  3. Mexican fruit fly (Diptera: tephritidae) and the phenology of its native host plant, Yellow Chapote (Rutaceae) in Mexico

    Science.gov (United States)

    In northeastern Mexico, the Mexican fruit fly, Anastrepha ludens (Loew), breeds on its native host, yellow chapote, Casimiroa greggii (Wats.), which typically produces fruit in the spring. Peak populations of the fly occur in late spring or early summer when adults emerge from the generation of lar...

  4. Laboratory and Field Age of Aqueous Grape Juice Bait and Capture of Zaprionus indianus (Diptera: Drosophilidae)

    Science.gov (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  5. Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida

    Science.gov (United States)

    Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

  6. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  7. Enhancing male sexual success in a lekking fly (Ananstrepha suspensa (Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality

    Science.gov (United States)

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual su...

  8. A safe and effective propylene glycol based capture liquid for fruit fly (Diptera: Tephritidae) traps baited with synthetic lures

    Science.gov (United States)

    Antifreeze is often used as the capture liquid in insect traps for its preservation and evaporation attributes. In tests reported herein, fruit fly traps using non-toxic household propylene glycol based antifreeze captured significantly more Anastrepha ludens than did traps with the automotive anti...

  9. Functional comparison of three transformer gene introns regulating conditional female lethality

    Science.gov (United States)

    The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...

  10. DEZ ANOS DE PESQUISAS SOBRE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO ESTADO DO AMAPÁ: AVANÇOS OBTIDOS E DESAFIOS FUTUROS.

    Directory of Open Access Journals (Sweden)

    Ezequiel da Glória de Deus

    2013-12-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae estão entre as principais pragas da agricultura mundial, sendo motivo de preocupação especialmente para países tropicais em desenvolvimento, os quais têm na fruticultura um importante componente de sua balança comercial. Esta revisão tem por objetivo compilar informações geradas nos últimos 10 anos sobre moscas-das-frutasno estado do Amapá, com ênfase em distribuição, hospedeiros e parasitoides. Além disso, visa indicar as prioridades de pesquisa para os próximos anos.No estado do Amapá, os estudos com moscas-das-frutas e seus inimigos naturais apresentaram, nos últimos anos, significativo crescimento. Atualmente, além Bactrocera carambolae, estão assinaladas para o Estado 34 espécies de Anastrepha. Anastrepha distincta, Anastrepha coronilli, Anastrepha fraterculus e Anastrepha striata são as espécies mais amplamente distribuídas. Estão assinaladas para o estado 37 espécies vegetais hospedeiras (pertencentes a 19 famílias botânicas de moscas-das-frutas. Anastrepha striata é espécie mais polífaga, estando associada a 25 hospedeiros. Nove espécies de parasitoides específicos de moscas-das-frutas estão registrados, sendo Doryctobracon areolatuso mais abundante. Apesar do significativo avanço, novos estudos sobre biologia, genética, ecologia, distribuição e dispersão populacional, bem como fatores reguladores dos níveis populacionais são necessários, com vista a desenvolver estratégias de controle menos onerosas com efeitos não nocivos ao ambiente. Palavras-chave: Anastrepha, Bactrocera carambolae, parasitoides, Amazônia. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v3n3p157-168

  11. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros Attractiveness of food baits to the fruit flies in citrus orchard

    Directory of Open Access Journals (Sweden)

    Adalton Raga

    2006-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritoidea são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied. e Ceratitis capitata (Wied.. O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atrativos testados foram: proteínas hidrolisadas comerciais Bio Anastrepha, Isca Mosca e Aumax®, todas diluídas em água a 5%; melaço a 7% isoladamente e melaço a 7% em mistura com suco de laranja a 10%. Foram utilizados semanalmente, 400mL da solução atrativa por frasco plástico McPhail instalado na copa de laranjeiras da variedade 'Pêra Rio'. As soluções eram renovadas semanalmente, ocasião em que os adultos eram coletados e çevados ao laboratório para contagem, sexagem e identificação. Foram capturados 1.821 adultos de Tephritoidea, sendo 892 de Anastrepha spp., 731 de C. capitata e 198 de Neosilba spp. Para essas espécies, as proteínas Bio Anastrepha e Isca Mosca foram altamente eficientes e semelhantes entre si, capturando 44,5% e 41,3% dos adultos de Tephritidae respectivamente. Não houve diferença entre as espécies de Tephritidae analisadas por sexo capturadas em Bio Anastrepha, Aumax® e melaço. Aumax®, melaço isoladamente e melaço + suco de laranja atraíram apenas 4,6%, 1,3% e 1,2% do total de adultos de Tephritidae, respectivamente. Melaço isoladamente e melaço com suco de laranja foram mais eficazes na atratividade de Zaprionus indianus (Gupta (Diptera: Drosophilidae.Fruit flies (Diptera: Tephritoidea are key pests in citrus production in the State of São Paulo, Brazil, mainly Anastrepha fraterculus (Wied. and Ceratitis capitata (Wied.. The objective of this study was to evaluate food baits to monitor fruit fly

  12. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  13. Contribución al Conocimiento de las Moscas de las Frutas (Tephritidae y sus Parasitoides en el Departamento de Antioquia

    Directory of Open Access Journals (Sweden)

    Yepes R. Francisco

    1989-12-01

    Full Text Available Las moscas de las frutas constituyen, como grupo, la plaga insectil mas importante de estos cultivos en Colombia y en el mundo. Además de Anastrepha spp., la especie más dañina dentro de las verdaderas moscas de las frutas (Tephritidae, la mosca del Mediterráneo, fue detectada por primera vez en Colombia en 1986 y confirmada su presencia en Antioquia en abril de 1987. El trabajo se realizó en tres fases simultáneamente; una de campo (11 regiones, otra de laboratorio (procesamiento de muestras y la tercera consistió en la obtención de la identificación de las especies (moscas y parasitoides Los resultados fueron: 1.la especie más distribuida y frecuentemente registrada en mayor número de hospedantes fue Anastrepha striata; fue reportada por primera vez en guayabo anselmo (Campomanesia cornifolia y guayabo de mono (Bellucia axinanthera, 2.la especie que ataca a B. axinanthera en el nordeste y oriente antioqueños es A sp. "F-]", aparentemente no descrita y considerada dentro de un grupo actualmente bajo revisión, 3.en total se encontraron 13 especies diferentes de Tephritidae (incluyendo los géneros de Anastrepha, Ceratitis y Toxotrypana y siete especies de Lonchaeidae (Neosilba spp. y Dasiops spp., 4.dentro de los parasitoides de larva-pupa de Anastrepha spp. se destacan: Doryctobracon areolatus y D. crawfordi¡ Opius anastrephae, Asobara anastrephaey Microcrasis sp. pertenecientes a la familia Braconidae y Aganaspis pelleranoi (Eucoilidae y Aceratoneuromyia indicum (Eulophidae.

  14. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  15. Parasitóides associados às moscas-das-frutas (Diptera: Tephritoidea em café orgânico com e sem arborização em Valença, RJ, Brasil Parasitoids associated with fruit flies (Diptera: Tephritoidea in organic coffee plantation under shaded and unshaded management in Valença, RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Elen de Lima Aguiar-Menezes

    2008-12-01

    Full Text Available Objetivou-se, com esse trabalho, determinar as espécies de parasitóides associados às moscas-das-frutas infestando seis cultivares de café arábica (Coffea arabica L., em sistema de cultivo com e sem arborização, sob manejo orgânico. Uma amostra de 1 kg de frutos maduros por cultivar foi colhida em maio de 2005. Os frutos foram depositados em bandejas plásticas, contendo uma camada de areia, a qual serviu como substrato para a fase de pupa. Os pupários foram quantificados e mantidos em copos plásticos transparentes com areia até a emergência dos insetos. Sete espécies de parasitóides da ordem Hymenoptera foram identificadas, das quais cinco da família Braconidae: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, Utetes anastrephae (Viereck, Opius bellus Gahan e Opius sp., e duas da Figitidae: Aganaspis pelleranoi (Brèthes e Lopheucoila anastrephae Weld. Larvas de Tephritidae e Lonchaeidae infestando frutos dos seis cultivares foram parasitadas por Braconidae e Figitidae, com média de 14,2% e 7,7% nos sistemas sem e com arborização, respectivamente.The aim of this work was to determine the parasitoid species associated with fruit flies infesting six cultivars of arabic coffee under shaded and unshaded organic management. A 1kg-sample of maturing fruits per cultivar was harvested in May 2005. The fruits were placed in plastic trays containing a layer of thin sand, as a substrate for pupa phase. The puparia were quantified and kept in transparent plastic cups with sand until the emergence of the insects. Seven parasitoid species of the order Hymenoptera were identified, from which five belong to the family Braconidae: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, Utetes anastrephae (Viereck, Opius bellus Gahan and Opius sp., and two of the Figitidae: Aganaspis pelleranoi (Brèthes and Lopheucoila anastrephae Weld. Larvae of Tephritidae and Lonchaeidae infesting fruits of the six

  16. Longevity of multiple species of tephritid (Diptera) fruit fly parasitoids (Hymenoptera: Braconidae: Opiinae) provided exotic and sympatric-fruit based diets.

    Science.gov (United States)

    Stuhl, Charles; Cicero, Lizette; Sivinski, John; Teal, Peter; Lapointe, Stephen; Paranhos, Beatriz Jordão; Aluja, Martín

    2011-11-01

    While adult parasitic Hymenoptera in general feed on floral and extrafloral nectars, hemipteran-honeydews and fluids from punctured hosts, Diachasmimorpha longicaudata (Ashmead), an Old World opiine braconid introduced to tropical/subtropical America for the biological control of Anastrepha spp. (Tephritidae), can survive on fruit juices as they seep from injured fruit. An ability to exploit fruit juice would allow such a parasitoid to efficiently forage for hosts and food sources simultaneously. Two New World opiines, Doryctobracon areolatus (Szepligeti) and Utetes anastrephae (Viereck), are also prominent Anastrepha parasitoids and are roughly sympatric. All three species were provided with: (1) pulp and juice diets derived from a highly domesticated Old World fruit (orange, Citrus sinensis L.) that is only recently sympatric with the Mexican flies and parasitoids and so offered little opportunity for the evolution of feeding-adaptations and (2) a less-domesticated New World fruit (guava, Psidium guajava L.), sympatric over evolutionary time with D. areolatus and U. anastrephae. Both sexes of D. longicaudata died when provided guava pulp or juice at a rate similar to a water-only control. D. areolatus and U. anastrephae, presumably adapted to the nutrient/chemical constituents of guava, also died at a similar rate. Survival of all three species on orange pulp and juice was greater than on water, and often equaled that obtained on a honey and water solution. In confirmatory experiments in Mexico, D. areolatus and U. anastrephae, as well as other tephritid parasitoids Doryctobracon crawfordi (Viereck) and Opius hirtus (Fisher), all died at a significantly higher rates when provided guava in comparison to a honey and water diet. Such a result is likely due to guavas being repellent, innutritious or toxic. D. longicaudata clearly consumed guava juice tagged with a colored dye. Dilutions of orange and guava juice resulted in shorter lifespans than dilutions of orange

  17. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.

  18. ESPÉCIES E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS EM UM POMAR COMERCIAL DE MANGUEIRA, NO LITORAL DO ESTADO DO CEARÁ

    Directory of Open Access Journals (Sweden)

    Joseph Jonathan Dantas de Oliveira

    2009-01-01

    Full Text Available The objective of this research was to know the species and the population fluctuation of fruit flies (Diptera: Tephritidae in a commercial mango (Mangifera indica L. orchard in the coast of Ceará State. The study was developed from July of 2005 to July of 2007, in the municipality of Beberibe (CE. The capture of the fruit flies was performed using McPhail traps with 5% corn protein hydrolyzed solution as attractant. Weekly, the captured insects were sorted, the fruit flies were maintained in 70% alcohol solution and subsequently identified. The population fluctuation was estimated using the FTD (Fly/Trap/Day index. During the research, six fruit flies species were captured: Anastrepha obliqua (Macquart (63%, A. zenildae Zucchi (7%, A. sororcula Zucchi (5%, A. fraterculus (Wied. (2%, A. distincta Greene (2% and Ceratitis capitata (Wied. (21%. The Anastrepha spp. and C. capitata population peaked was between April and July, in both years of study.

  19. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch

    2012-10-01

    Full Text Available Apesar do incentivo e do investimento na produção de frutas no estado do Paraná, pouca informação está disponível sobre as moscas-das-frutas, uma das principais pragas da fruticultura. O presente trabalho teve os objetivos de registrar pela primeira vez a fauna de tefritídeos, na região de Ponta Grossa, e caracterizar a sua comunidade por meio de diferentes índices faunísticos. Adultos de tefritídeos foram coletados por meio de frascos caça-moscas com atrativos alimentares em quatro pomares de agosto a dezembro de 2009. Foi coletado um total de 2.428 tefritídeos distribuídos em sete espécies: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann, Rhagoletis sp. Loew e Hexachaeta sp. Loew. A. fraterculus foi a única espécie comum aos quatro pomares, ocorrendo com frequência acima de 80%. Este é o primeiro registro de A. montei no Paraná. A. fraterculus, A. sororcula e C. capitata apresentaram os maiores índices de frequência, abundância, dominância e constância, sendo, portanto, consideradas espécies predominantes. O maior índice de diversidade (H'=0,4360 ocorreu no pomar 2, diferindo significativamente dos demais pomares (teste t, PIn spite of encouragement and investment in fruit production in the state of Paraná, little information is available on the fruit flies, a major pest in fruit growing. The present study had the objective of recording for the first time the tephritid fauna in the region of Ponta Grossa, and characterize the insect community through different faunal indices. Adult tephritids were collected by means of flapper bottles with food baits in four orchards from August to December 2009. A total of 2,428 tephritids distributed in seven species were collected: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann

  20. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil Natural parasitism in fruit-flies in the fruticulture area of anagé, semi-arid of southwestern Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.Parasitoids are important natural control agents of tephritids and knowledge about the tritrophic relationships can support the management of these pests. This study aimed to estimate of parasitism indexes in fruit flies in 21 plant species and identify the species of parasitoids associated, in semiarid conditions of Southwestern Bahia. Eight hosts showed infestation by Anastrepha spp. and, of these, four occurred parasitism above 20.0%, of which: 20.8% (Ziziphus joazeiro L.; 21.3% (Spondias tuberosa L.; 32.4% (Spondias purpurea L. and 57.1% (Malpighia emarginata L.. The collected parasitoids belong to the Braconidae family, 89% of Doryctobracon areolatus and 11% of Asobara anastrephae.

  1. Moscas-das-frutas em pomares de pessegueiro e maracujazeiro, no Município de Iraceminha, Santa Catarina, Brasil Fruit flies in peach and passion fruit orchards in Iraceminha, Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2009-08-01

    Full Text Available Este estudo teve o objetivo de caracterizar a comunidade de moscas-das-frutas de ocorrência em pomares de pessegueiro e maracujazeiro, no Município de Iraceminha, Santa Catarina (SC, por meio da análise faunística. Os adultos de moscas-das-frutas foram capturados semanalmente, em armadilhas McPhail, contendo glicose invertida a 10%, no período de abril de 2006 a março de 2007. Na caracterização, foram calculados os índices de abundância, constância, dominância, frequência e diversidade. Foram coletados 697 adultos de moscas-das-frutas. Anastrepha grandis e Anastrepha fraterculus foram as espécies mais abundantes, frequentes, constantes e dominantes nos pomares estudados, predominando sobre as outras espécies de moscas-das-frutas. Ceratitis capitata foi caracterizada como dispersa e pouco frequente. O maior índice de diversidade encontrado foi de 1,99 no pomar de maracujazeiro.This research had the objective to characterize the community of fruit flies in peach and passion fruit orchards in Iraceminha, Santa Catarina, Brazil, through faunistic analyses. The adults fruit flies were weekly captured in McPhail traps with 10% inverted glucose, from April 2006 to March 2007. In the characterization, the indices for abundance, constancy, dominance, frequency and diversity were calculated. A total of 697 adults fruit flies were collected. Anastrepha grandis and Anastrepha fraterculus species were the most abundant, frequent, constant and dominant in orchards studied, predominating upon other fruit flies species. Ceratitis capitata was dispersed and not very frequent. The biggest index of diversity of 1.99 was in passion fruit orchard.

  2. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  3. Hymenopteran parasitoids associated with frugivorous larvae in a Brazilian caatinga-cerrado ecotone.

    Science.gov (United States)

    De Souza, A R; Lopes-Mielezrski, G N; Lopes, E N; Querino, R B; Corsato, C D A; Giustolin, T A; Zucchi, R A

    2012-04-01

    The purpose of this study was to investigate native species of parasitoids of frugivorous larvae and their associations with host plants in commercial guava orchards and in typical native dry forests of a caatinga-cerrado ecotone in the State of Minas Gerais, Brazil. Nine species of parasitoids were associated with larvae of Anastrepha (Tephritidae) and Neosilba (Lonchaeidae) in fruit of Psidium guajava L. (Myrtaceae), Ziziphus joazeiro Mart. (Rhamnaceae), Spondias tuberosa Arruda (Anacardiaceae), Spondias dulcis Forst. (Anacardiaceae), Syzygium cumini (L.) Skeels (Myrtaceae), and Randia armata (Sw.) DC. (Rubiaceae). Doryctobracon areolatus was the most abundant species, obtained from puparia of Anastrepha zenildae, An. sororcula, An. fraterculus, An. obliqua, and An. turpiniae. This is the first report of Asobara obliqua in Brazil and of As. anastrephae and Tropideucoila weldi in dry forests of Minas Gerais State. The number of species of parasitoids was higher in areas with greater diversity of cultivated species and lower pesticide use. The forest fragments adjacent to the orchards served as shelter for parasitoids of frugivorous larvae.

  4. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control.

  5. Population fluctuation of fruit flies (Diptera, Tephritidae in peach and passion fruit orchards in Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2012-06-01

    Full Text Available The objective of this study was learn more about the population fluctuation of fruit flies in peach and passion fruit orchards in the municipality of Iraceminha, Santa Catarina. In order to carry out the survey, McPhail traps were set up with 10% inverted glucose from April 2006 to March 2007. Captured flies were identified at the Laboratório de Entomologia at UNOCHAPECÓ. The collected females belonged to twelve species and four genera. The adults of Anastrepha fraterculus were trapped during all seasons, with a population peak in October 2006 in the peach orchards. The population levels of Anastrepha grandis remained higher during the first five months in the passion fruit orchard. There were low infestation rates by flies of the genera Ceratitis, Blepharoneura and Tomoplagia when compared to flies of the genus Anastrepha. The results showed that the presence of flies in the orchards was associated with the availability of host fruit and not with climatic conditions.

  6. Disinfestation of mangoes by irradiation; Desinfestacion de mango por irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E

    1992-05-15

    The mango is a fruit-bearing very important in the mexican economy. Mexico is between the first positions of the world like country producing with an average export volume of 40,000 annual tons in the last years. For this reason it was decided to make this investigation, which was developed according to the investigation protocols proposed by the Agricultural Research Service of the USA (ARS - US DOA). The objective is to account with the technical and scientific necessary bases to propose to the US DOA the regulation of the irradiation process like quarantine treatment for Mexican export mango. The goals are: to determine in the laboratory the minimum dose (Dmin.) to inhibit the emergency of adults of the species of the fruit flies of more importance for Mexico. To confirm the least radiation dose Dmin. for quarantine treatment based on the safety value Probit-9. To evaluate the mango quality irradiated to 2 and 2.5 times the Dmin. proposal for quarantine treatment. According to information provided by the General Direction of Vegetable Sanity, it was determined that the fly species of the fruit of more economic importance for Mexico are of the genus Anastrepha ludens, Anastrepha serpentina, Anastrepha obliqua and Ceratitis capitata. (Author)

  7. Relações interespecíficas entre parasitoides nativos de moscas-das-frutas e o braconídeo exótico Diachasmimorpha longicaudata em frutos de 'umbu-cajá' Interespecific relations between native parasitoids of fruit flies and exotic braconid Diachasmimorpha longicaudata in fruits of 'umbu-cajá'

    Directory of Open Access Journals (Sweden)

    Zuzinaide Vidal Bomfim

    2010-02-01

    Full Text Available Espécies de vespas parasitoides (Hymenoptera: Braconidae são importantes agentes de controle biológico de moscas-das-frutas (Diptera: Tephritidae. Este trabalho teve por objetivo conhecer os efeitos da liberação e as relações de competitividade interespecífica do parasitoide exótico Diachasmimorpha longicaudata Ashmead sobre o complexo de parasitoides nativos de moscas-das-frutas associado a frutos de 'umbu-cajá' (Spondias spp. na região do Recôncavo Baiano. Entre os meses de abril e julho de 2006, 8.955 frutos (192,93kg foram coletados antes e após (24 e 48 horas a liberação de 9.600 fêmeas de D. longicaudata em campo. Obteve-se um total de 8.724 pupários de Tephritidae, dos quais emergiram 3.963 adultos de Anastrepha obliqua (Macquart e 1.115 parasitoides. A maior frequência relativa foi de Doryctobracon areolatus (Szépligeti, seguida por Asobara Anastrephae (Muesebeck e Utetes Anastrephae (Viereck. Após 24 e 48 horas da liberação do parasitoide exótico D. longicaudata em campo, constatou-se que o índice de parasitismo total aumentou de 15,86 para 20,4 e 45,19%, respectivamente. Assim, observou-se que a liberação da espécie exótica D. longicaudata não apresenta efeitos negativos na ocorrência dos parasitoides nativos e contribui para complementar o controle biológico natural de A. obliqua em frutos de 'umbu-cajá', nas condições deste estudo.Wasps parasitoid species (Hymenoptera: Braconidae are fruit flies (Diptera: Tephritidae biological control important agents. This study aimed to know the effects of the release and interspecific competitive relationships of the exotic parasitoid Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae on the native parasitoid complex of fruit flies in Spondias spp. in the region of Recôncavo Baiano. From April to July of 2006, 8.955 fruits (192.93kg were collected before and after (24 and 48 hours release of 9.600 females of D. longicaudata. Exactly 8.724 Tephritidae

  8. Ocorrência de moscas-das-frutas (Diptera: Tephritidae em mangueiras (Mangifera indica L. em Boa Vista, Roraima = The occurrence of fruit fly (Diptera: Tephritidae in mango (Mangifera indica L. in Boa Vista, Roraima

    Directory of Open Access Journals (Sweden)

    Adriana Bezerra Lima

    2012-08-01

    Full Text Available Um estudo foi conduzido no período de junho de 2007 a janeiro de 2008, em pomares comerciais de manga das variedades: Tommy Atkins, Haden e Palmer sendo 3 ha de cada cultivar, localizado na região do Bom Intento no Município de Boa Vista. Os espécimes de moscas-das-frutas foram coletados, por meio de armadilhas, confeccionadas com garrafas pet, que foram penduradas na copa das árvores a 1,60 m de altura. Como atrativo alimentar foi utilizado 200 mL de suco de maracujá a 30%. Foram utilizadas nove armadilhas, sendo uma armadilha por hectare. Semanalmente as armadilhas eram examinadas, ocasião em que se substituía o atrativo e os insetos capturados retirados e colocados em frascos de vidro devidamente etiquetados e transportados ao Laboratório de Entomologia do Centro de Ciências Agrárias da Universidade Federal de Roraima. As identificações dos espécimes foram feitas no Instituto Nacional de Pesquisa da Amazônia - INPA. No período de oito meses foram coletados 24 espécimes adultos do gênero Anastrepha (nove fêmeas e 15 machos. Quatro espécies foram identificadas: A. serpentina, A. striata, A. obliqua e A. turpinae. A maior frequência foi A. serpentina (44,44%, seguida de A. striata e A. obliqua ambas com 22,22% e A. turpinae com 11,11%. Os meses de maior ocorrência de Anastrepha spp. foram junho, julho e agosto. Este é o primeiro registro da espécie Anastrepha turpinae Stone, 1942, em Roraima. The study was done during th period of June 2007 to January of 2008, in commercial mango orchards having: 3 ha of cv. Tommy Atkins, 3 ha of cv. Haden. and 3 ha of cv. Palmer, located at Bom Intento in the municipal district of Boa Vista - RR. The specimens of fruit flies were collected, by trapping, made with transparent bottles pet, which were hung in the cup of the trees at 1.60 m of height. 200 mL of passion fruit juice (30% was used as an attractant feed; 9 traps were used, being one trap for hectare. Weekly The traps were

  9. Advances and perspectives in the mass rearing of fruit fly parasitoids in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Cancino, Jorge; Montoya, Pablo [Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (DGSV/SENASICA/SAGARPA), Chiapas (Mexico). Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria. Programa Moscamed-Moscafrut

    2006-07-01

    Biological control by augmentation is applied in Mexico as part of an integrated pest management program against native fruit flies of the genus Anastrepha Schiner. The exotic parasitoid Diachasmimorpha longicaudata has been the most important species used within this context. A program for the mass rearing of 50 million parasitized pupa per week has been established in southeast Mexico, and these are released into the field according to a yearly national plan based on industry requirements. In order to reduce costs and optimize procedures, important advances have been made in the technology for mass production, including an increase in the weight of host larvae (24 mg), changes in the management of host exposition, improvements in the management of environmental conditions, suitability in time and motions are the main areas addressed. Furthermore, a quality control program is routinely applied, and the key parameters under constant evaluation are: 1) weight and volume of host larvae, 2) host mortality after exposure, 3) weight and volume of pupae, and 4) percent parasitoid viability and percent emergence. Good performance in these parameters produces adults with adequate longevity and fecundity, high flight ability and good searching behavior. The introduced egg parasitoid Fopius arisanus and the native pupal parasitoid Coptera hawardi are being evaluated for use in the future as a complement to releases into the field of D. longicaudata. Manipulating host size and exposition time, the use of starting diet and suppressing host development by irradiation, have permitted the effective use of Anastrepha eggs as hosts for the rearing of F. arisanus. Further achievements in the mass rearing of C. haywardi (e.g., the suppression of unparasitized hosts after irradiation), could give us the opportunity to employ new options to reinforce the augmentative biological control of Anastrepha fruit flies in Mexico. (author)

  10. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  11. Evaluating mating compatibility within fruit fly cryptic species complexes and the potential role of sex pheromones in pre-mating isolation

    Science.gov (United States)

    Juárez, M. Laura; Devescovi, Francisco; Břízová, Radka; Bachmann, Guillermo; Segura, Diego F.; Kalinová, Blanka; Fernández, Patricia; Ruiz, M. Josefina; Yang, Jianquan; Teal, Peter E.A.; Cáceres, Carlos; Vreysen, Marc J.B.; Hendrichs, Jorge; Vera, M. Teresa

    2015-01-01

    Abstract The study of sexual behavior and the identification of the signals involved in mate recognition between con-specifics are key components that can shed some light, as part of an integrative taxonomic approach, in delimitating species within species complexes. In the Tephritidae family several species complexes have received particular attention as they include important agricultural pests such as the Ceratitis fasciventris (Bezzi), Ceratitis anonae (Graham) and Ceratitis rosa Karsch (FAR) complex, the Bactrocera dorsalis (Hendel) complex and the Anastrepha fraterculus (Wiedemann) complex. Here the value and usefulness of a methodology that uses walk-in field cages with host trees to assess, under semi-natural conditions, mating compatibility within these complexes is reviewed, and the same methodology to study the role of chemical communication in pre-mating isolation among Anastrepha fraterculus populations is used. Results showed that under the same experimental conditions it was possible to distinguish an entire range of different outcomes: from full mating compatibility among some populations to complete assortative mating among others. The effectiveness of the methodology in contributing to defining species limits was shown in two species complexes: Anastrepha fraterculus and Bactrocera dorsalis, and in the case of the latter the synonymization of several established species was published. We conclude that walk-in field cages constitute a powerful tool to measure mating compatibility, which is also useful to determine the role of chemical signals in species recognition. Overall, this experimental approach provides a good source of information about reproductive boundaries to delimit species. However, it needs to be applied as part of an integrative taxonomic approach that simultaneously assesses cytogenetic, molecular, physiological and morphological traits in order to reach more robust species delimitations. PMID:26798257

  12. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros

    OpenAIRE

    Raga, Adalton; Machado,Rogério Amaro; Dinardo,Welci; Strikis,Pedro Carlos

    2006-01-01

    As moscas-das-frutas (Diptera: Tephritoidea) são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied.) e Ceratitis capitata (Wied.). O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atra...

  13. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  14. Desarrollo de herramientas moleculares para la evaluación de la calidad genética y productividad en la cría artificial de Diachasmimorpha longicaudata, agente de control biológico de moscas plaga de los frutos

    OpenAIRE

    2016-01-01

    Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae) es un endoparasitoide solitario de estadios larvales de moscas de la fruta perteneciente a la familia Tephritidae. Es criado a nivel masivo en bioplantas y utilizado en diversas partes del mundo para las estrategias de control biológico (CB) principalmente de dípteros de importancia económica de los géneros Ceratitis, Anastrepha y Bactrocera. Actualmente, se estudia su implementación en nuestro país para el control de Ceratitis ca...

  15. Parámetros de las interacciones planta-herbívoros-enemigos naturales en Schoepfia schreberi J. F. GMEL. (Olacaceae): el fruto es el detalle.

    OpenAIRE

    2013-01-01

    En este trabajo se describe de manera general las interacciones de las especies de herbívoros asociados a los frutos de Schoepfia schreberi (Olacaceae). La investigación se llevó a cabo en tres sitios experimentales durante tres años (2009-2011). Los arbustos de S. schreberi producen frutos de enero a mayo, periodo en el que se establecen relaciones directas e indirectas por el uso de sus frutos entre la mosca de la fruta Anastrepha spatulata (Diptera: Tephritidae), dos especies de palomillas...

  16. Biologia da mosca‑das‑frutas sul‑americana em frutos de mirtilo, amoreira‑preta, araçazeiro e pitangueira Biology of South American fruit fly in blueberry, blackberry, strawberry guava, and Surinam cherry crops

    Directory of Open Access Journals (Sweden)

    Maicon Bisognin

    2013-02-01

    Full Text Available O objetivo deste trabalho foi descrever a biologia de Anastrepha fraterculus em frutos de mirtilo (Vaccinium ashei, amoreira‑preta (Rubus spp., araçazeiro (Psidium cattleyanum e pitangueira (Eugenia uniflora. O experimento foi realizado em laboratório, em condições controladas de temperatura (25±2ºC, umidade relativa (70±10% e fotófase (12 horas, para determinação dos parâmetros biológicos do inseto nos estágios de desenvolvimento imaturos e adultos. Anastrepha fraterculus completa o ciclo biológico em todos hospedeiros estudados, embora os frutos nativos (pitanga e araçá ofereçam melhores condições para seu desenvolvimento. Os parâmetros biológicos determinados para as fases imaturas foram semelhantes nos quatro hospedeiros. Insetos criados em pitanga e araçá apresentam, na fase adulta, maior período de oviposição, fecundidade e longevidade de fêmeas, em comparação aos criados em mirtilo e amora‑preta. O ritmo diário de oviposição é mais prolongado e uniforme nos insetos criados em araçá e pitanga, o que mostra que A. fraterculus está mais bem adaptada a estas frutas, nativas da região Sul.The objective of this work was to describe the biology of Anastrepha fraterculus in blueberry (Vaccinium ashei, blackberry (Rubus spp., strawberry guava (Psidium cattleyanum and Surinam cherry (Eugenia uniflora fruits. The experiment was carried out in laboratory under controlled conditions of temperature (25±2ºC, relative humidity (70±10%, and photophase (12 hours to determine insect biological parameters in immature and adult development stages. Anastrepha fraterculus finishes its biological cycle in all studied hosts; however, the Brazilian native fruits (strawberry guava and Surinam cherry provide better conditions for development of the insect. Biological parameters determined for immature development stadium were similar in the four hosts. Insects reared in Surinam cherry and strawberry guava showed, in the

  17. Flutuação populacional de moscas-das-frutas em pomares de citros no oeste de Santa Catarina, Brasil Population fluctuation of fruit flies in citrus orchards in the West of Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Luís Antônio Chiaradia

    2004-04-01

    Full Text Available As moscas-das-frutas (Diptera, Tephritidae causam danos econômicos em muitas frutíferas. Para conhecer a flutuação populacional destas moscas em pomares de citros da região Oeste de Santa Catarina, Brasil, e estudar as interferências de fatores climáticos sobre estes insetos, cinco frascos "caça-mosca", tendo vinagre de vinho tinto a 25% como atrativo, foram semanalmente instalados em dois pomares de laranjeiras da variedade Valência, em Águas de Chapecó e Chapecó, no período de outubro de 1999 a setembro de 2001. As moscas capturadas nas armadilhas foram triadas no Laboratório de Fitossanidade da Epagri de Chapecó. Análises de correlação e regressão polinomial foram realizadas entre o número mensal de moscas do gênero Anastrepha e os dados mensais de precipitação pluviométrica, insolação, umidade relativa do ar, velocidade do vento e temperatura ambiente. Temperatura máxima e mínima mostraram interferir na população destas moscas mais do que os outros fatores climáticos. O número mensal acumulado de moscas capturadas foi submetido à análise de regressão não linear, que revelou picos de captura destes insetos de março a junho. Anastrepha fraterculus (Wiedemann, 1830 predominou sobre outras espécies de moscas-das-frutas.Fruit flies (Diptera, Tephritidae cause economic damages in many fruit orchards. To know the population fluctuation of these flies in Citrus orchards in the west of Santa Catarina, Brazil, and to study the environmental factor interferences on these insects, five traps with 25% vinegar were weekly installed in two orange Valência variety orchards, in Águas de Chapecó and Chapecó, from October of 1999 to September of 2001. The samples of flies trap captured were counted at Epagri Fitossanity Laboratory in Chapecó. A correlation and regression polynomial analyses between flies monthly captured of genus Anastrepha and monthly datas of rain precipitation, isolation, air humidity, wind speed

  18. Hongos de importancia agrícola presentes en moscas de la fruta del valle de Ica, Perú

    OpenAIRE

    Carlos E. Tipismana; Lilian R. Astudillo; Juan J. Guillermo

    2013-01-01

    El objetivo del presente trabajo fue aislar e identificar hongos de especímenes de moscas de la fruta de los géneros Ceratitis (Macleay) y Anastrepha (Schiner), del valle de Ica, Perú. Se aislaron hongos pertenecientes a los géneros Alternaria, Aspergillus, Cladosporium, Mucor, Penicillium, Rhizoctonia, Rhizopus y Trichoderma;así como levaduras y micelios estériles. Los recuentos de hongos presentaron rangos entre 8x103 a 8x104 UFC/g para el género Ceratitis; y 7x103 a 7x104 UFC/g para el g...

  19. Isolation, identification and determination of the biological activity of candidate fruit volatile components from Argania spinosa L. (Sapotacea)

    Energy Technology Data Exchange (ETDEWEB)

    Bakri, A., E-mail: bakri@ucam.ac.m [University Cadi Ayyad, Marrakech (Morocco). Fac. of Science Semlalia. Insect Biological Control Unit; Dueben, B.D.; Proveaux, A.T.; Heath, R.R., E-mail: rheath@saa.ars.usda.go [U.S. Department of Agriculture (USDA/REE-ARS), Miami, FL (United States). Agricultural Research Service

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  20. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea) em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea) in native forests and orchards in two counties of the State of Tocantins, Brazil

    OpenAIRE

    Darcy A. do Bomfim; Manoel A. Uchôa-Fernandes; Marcos A. L. Bragança

    2007-01-01

    Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002) com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De L...

  1. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  2. Hongos de importancia agrícola presentes en moscas de la fruta del valle de Ica, Perú

    Directory of Open Access Journals (Sweden)

    Carlos E. Tipismana

    2013-05-01

    Full Text Available El objetivo del presente trabajo fue aislar e identificar hongos de especímenes de moscas de la fruta de los géneros Ceratitis (Macleay y Anastrepha (Schiner, del valle de Ica, Perú. Se aislaron hongos pertenecientes a los géneros Alternaria, Aspergillus, Cladosporium, Mucor, Penicillium, Rhizoctonia, Rhizopus y Trichoderma;así como levaduras y micelios estériles. Los recuentos de hongos presentaron rangos entre 8x103 a 8x104 UFC/g para el género Ceratitis; y 7x103 a 7x104 UFC/g para el género Anastrepha. El IVI% (Índice de Valor de Importancia demostró que Cladosporium es el género con mayor valor ecológico con un 78,05%. El Índice de Similitud de especies de hongos entre ambos géneros de mosca de la fruta analizados fue 0,5. Los resultados obtenidos confirman la presencia de hongos en moscas de la fruta; y se deduce el posible impacto de estos dípteros en el área agrícola como potenciales agentes vectores de enfermedades fúngicas para los cultivos locales de importancia económica.

  3. Ocorrência precoce da mosca das frutas em ameixas Incidence of the southamerican fruit fly on plums

    Directory of Open Access Journals (Sweden)

    Luiz Antonio Salles

    1999-06-01

    Full Text Available O objetivo deste estudo foi verificar qual o estágio fenológico mais precoce da fruta de ameixeira em que ocorreria o ataque de mosca das frutas Anastrepha fraterculus. Os estudos foram conduzidos em plantas adultas de ameixeira, expondo-se fêmeas grávidas da mosca das frutas, confinadas em gaiolas com frutos protegidos do ataque natural. Cinco cultivares de ameixeira foram estudados (Amarelinha, Pluma 7, Reubennel, Santa Rosa e Wade. Essa praga ataca frutos de qualquer um dos cultivares logo nos primeiros estádios do desenvolvimento, quando os mesmos têm somente cerca de 2 a 3cm de diâmetro.The incidence of the southamerican fruit fly, Anastrepha fraterculus, on plum cultivars is reported. The objective of this study was to know the earliest fruit phase that fly attack could occur. Fertilized females were confined with fruits in plum trees in an orchard. Five plums cultivars were studied: Amarelinha; Pluma 7; Reubennel; Santa Rosa and Wade. This pest attack fruits during first stages of their development, mainly they have only from 2 to 3 centimeters of diameter.

  4. Survey of ear flies (Diptera, Ulidiidae in maize (Zea mays L. and a new record of Euxesta mazorca Steyskal in Brazil

    Directory of Open Access Journals (Sweden)

    Ivan Cruz

    2011-03-01

    Full Text Available Survey of ear flies (Diptera, Ulidiidae in maize (Zea mays L. and a new record of Euxesta mazorca Steyskalin Brazil. Species of Euxesta (Diptera, Ulidiidae, known as silk flies or ear flies, are becoming increasingly important as maize insect pests in South America, although very little is known about them in Brazil. The larvae of some species of this genus initially damage female reproductive tissues, and then the developing kernels on the ear. As a result of feeding, fermentation and associated odors cause complete loss of the grain because it is no longer fit for human or livestock consumption. The main objective of this work was to evaluate the incidence of Euxesta spp. in Brazilian maize fields and to determine the most prevalent species using two different hydrolyzed protein foods attractants, BioAnastrepha® (hydrolyzed maize protein and Torula, placed inside McPhail traps. The two species identified were E. eluta Loew and E. mazorca Steyskal, the latter being a new record from Brazil. Between the two species, E. eluta was the more abundant in maize fields. Both attractants were efficient in capturing the two species. However, BioAnastrepha® captured significantly more insects than Torula.

  5. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  6. Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., two yeast species isolated from Cerrado ecosystem in North Brazil.

    Science.gov (United States)

    Rosa, Carlos A; Morais, Paula B; Lachance, Marc-André; Santos, Renata O; Melo, Weilan G P; Viana, Rodney H O; Bragança, Marcos A L; Pimenta, Raphael S

    2009-05-01

    Two novel yeast species, Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., were isolated, respectively, from larvae of Anastrepha mucronata (Diptera: Tephritidae) collected from ripe fruit of Peritassa campestris ('Bacupari', Hippocrateaceae) and from flowers of Centropogon cornutus (Campanulaceae) in the Cerrado ecosystem of the state of Tocantins, Brazil. Analysis of the D1/D2 large-subunit rRNA gene sequences placed W. queroliae in the Wickerhamomyces clade near Wickerhamomyces ciferri and Candida silvicultrix. Candida jalapaonensis belongs to the Wickerhamiella clade and is related to Candida drosophilae. The type strain of Wickerhamomyces queroliae is UFMG-05-T200.1(T) (=CBS 10936(T)=NRRL Y-48478(T)) and the type strain of Candida jalapaonensis is UFMG-03-T210(T) (=CBS 10935(T)=NRRL Y-48477(T)).

  7. Índice de infestação e diversidade de moscas-das-frutas em hospedeiros exóticos e nativos no pólo de fruticultura de Anagé, BA Index of infestation and diversity of fruit-flies in exotic hosts native to the fruitculture area in Anagé, Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2008-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são os principais entraves às exportações de manga nos pólos de fruticultura da Região Sudoeste da Bahia. O presente trabalho teve como objetivo estudar índices de infestação e a diversidade de moscas-das-frutas no pólo de fruticultura de Anagé, BA, visando obter subsídios para o manejo integrado dessas pragas na mangueira, na região. Os estudos foram realizados em 2004 e 2005, nos municípios de Anagé, Belo Campo e Caraíbas, BA, procedendo-se à coleta de frutos de 21 espécies vegetais, nativas e exóticas, e identificação das espécies de moscas associadas. Estimaram-se os índices de infestação em pupários/kg de fruto e pupários/fruto. Os maiores índices de infestação, em pupários/kg de fruto, ocorreram em serigüela (Spondias purpurea L. com 61,3, juá (Ziziphus joazeiro L., 38,3 e umbu (Spondias tuberosa L., 33,1, considerados hospedeiros primários de Anastrepha fraterculus (Wiedemann e A. obliqua (Macquart. As maiores infestações em pupários/fruto ocorreram em serigüela (0,9; umbu (0,7 e cajarana (Spondias sp. (0,2. Com base no monitoramento larval, registra-se, para as condições do pólo de fruticultura de Anagé, a ocorrência das espécies Anastrepha fraterculus, A. obliqua, A. dissimilis, A. amita, A. distincta, A. sororcula, A. zenildae e Ceratitis capitata. Registram-se, pela primeira vez, as seguintes associações bitróficas: juá com A. fraterculus, A. obliqua, A. dissimilis e A. distincta; e umbu com A. amita e A. sororcula.Fruit-flies (Diptera: Tephritidae are the main hindrance for mango exportation in the fruitculture areas of the Southwestern Region of Bahia. The purpose of the present work was to study the indexes of infestation and diversity of fruit-flies in the fruitculture area of Anagé, BA, in order to obtain subsidies to the integrated management of these pests in mango, in this region. Studies were carried out in 2004 and 2005 in the

  8. Tephritid Integrative Taxonomy: Where We Are Now, with a Focus on the Resolution of Three Tropical Fruit Fly Species Complexes.

    Science.gov (United States)

    Schutze, Mark K; Virgilio, Massimiliano; Norrbom, Allen; Clarke, Anthony R

    2017-01-31

    Accurate species delimitation underpins good taxonomy. Formalization of integrative taxonomy in the past decade has provided a framework for using multidisciplinary data to make species delimitation hypotheses more rigorous. We address the current state of integrative taxonomy by using as a case study an international project targeted at resolving three important tephritid species complexes: Bactrocera dorsalis complex, Anastrepha fraterculus complex, and Ceratitis FAR (C. fasciventris, C. anonae, C. rosa) complex. The integrative taxonomic approach has helped deliver significant advances in resolving these complexes: It has been used to identify some taxa as belonging to the same biological species as well as to confirm hidden cryptic diversity under a single taxonomic name. Nevertheless, the general application of integrative taxonomy has not been without issue, revealing challenges that must be considered when undertaking an integrative taxonomy project. Scrutiny of this international case study provides a unique opportunity to document lessons learned for the benefit of not only tephritid taxonomists, but also the wider taxonomic community.

  9. 柳州市2000~2008年检疫性实蝇监测调查报告

    Institute of Scientific and Technical Information of China (English)

    谢晓雁; 贝荣良; 殷积奎

    2010-01-01

    2000~2008 年在柳州市以及各县区范围内建立检疫性实蝇监测体系,对柳州市及周边县区实蝇的发生进行监测调查,通过对调查结果的统计分析,确定柳州市检疫性实蝇发生的优势种和高发期,监测调查结果表明:柳州市未发现地中海实蝇Ceratitis capitata(Widedmann)、墨西哥实蝇Anastrepha ludens、加勒比实蝇A.suspensa 等我国过去没有报道的实蝇种类.

  10. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão

    2008-09-01

    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  11. Diversidade de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides nas regiões Norte e Noroeste do Estado do Rio de Janeiro, Brasil Fruit fly diversity, their host plants and their parasitoids in the northern and northwestern regions of Rio de Janeiro State, Brazil

    Directory of Open Access Journals (Sweden)

    Michela Rocha Leal

    2009-06-01

    Full Text Available Em razão da exploração crescente da fruticultura nas regiões Norte e Noroeste do Estado do Rio de Janeiro e da importância econômica e quarentenária das moscas-das-frutas para essa atividade agrícola no mundo, este estudo foi conduzido em cinco municípios dessas regiões: Cambuci, Campos dos Goytacazes, Itaocara, São Francisco do Itabapoana e São João da Barra, com objetivo de registrar as espécies de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides. Os espécimes foram coletados por meio de armadilhas McPhail com solução aquosa de proteína hidrolisada a 5% e em amostras de frutos. Nas armadilhas, 4% do total de moscas-das-frutas capturadas foram Ceratitis capitata e 96% eram do gênero Anastrepha, num total de 15 espécies. Das moscas capturadas nas armadilhas, apenas seis espécies infestaram frutos entre as 12 espécies de fruteiras amostradas. Fruteiras das famílias Anacardiaceae, Malpighiaceae, Myrtaceae, Oxalidaceae, Passifloraceae e Sapotaceae foram plantas hospedeiras de moscas-das-frutas. Apenas três espécies de Anastrepha (A. fraterculus, A. sororcula e A. zenildae infestaram goiabas da variedade comercial Paluma. Os parasitóides de larvas de moscas-das-frutas encontrados foram Doryctobracon areolatus e Aganaspis pelleranoi, parasitando-as em frutos de goiabeira e de outras fruteiras nessas regiões.Due to the increase in fruit crops acreage in the northern and northwestern regions of Rio de Janeiro State and to the economic and quarantine importance of the fruit flies to this agricultural activity in the world, this study was carried out in five municipalities of these regions: Cambuci, Campos dos Goytacazes, Itaocara, São Francisco do Itabapoana, and São João da Barra, aiming to study the fruit fly species, their host plants and their parasitoids. The specimens were collected using McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruit samples. In the traps, 4% of the total

  12. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  13. Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espírito Santo, Brazil.

    Science.gov (United States)

    Uramoto, K; Martins, D S; Zucchi, R A

    2008-10-01

    The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-July 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espírito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

  14. Tapachula-7, a new genetic sexing strain of the Mexican fruit fly (Diptera: Tephritidae): sexual compatibility and competitiveness.

    Science.gov (United States)

    Orozco, Dina; Meza, J Salvador; Zepeda, Silvia; Solís, Eduardo; Quintero-Fong, J Luis

    2013-04-01

    A new genetic sexing strain of the Mexican fruit fly, Anastrepha ludens (Loew), was evaluated in tests of sexual behavior to determine its possible application using the sterile insect technique. Tests in field cages measuring time to sexual maturity, compatibility with wild flies, and competitiveness were compared between the genetic sexing strain, Tapachula-7, and the mass-reared standard bisexual strain. The results indicated that the onset of sexual maturity was similar for both laboratory strains. Males from the Tapachula-7 strain do not differ from the standard bisexual strain in compatibility and competitiveness with wild insects. The results indicate that the release of Tapachula-7 males in the field would be viable in programs that use the sterile insect technique for the control of the Mexican fruit fly.

  15. Insecticidal activity of raw ethanolic extracts from Magnolia dealbata Zucc on a tephritid pest.

    Science.gov (United States)

    Flores-Estévez, Norma; Vasquez-Morales, Suria G; Cano-Medina, Tomás; Sánchez-Velásquez, Lázaro R; Noa-Carrazana, Juan C; Díaz-Fleischer, Francisco

    2013-01-01

    Ethanolic extracts from Magnolia dealbata (Zucc.) (Magnoliaceae); leaves, bark, seeds, sarcotesta and flowers were evaluated for insecticidal activity against adults of the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae). Using feeding bioassays composed from sugar-extract mixtures, only the extract from sarcotesta indicated insecticidal activity against the flies. The extracts from the other four plant tissues (leaves, bark, seeds and flowers) did not manifest any biological activity. The most effective extract was obtained from oven-dried sarcotesta, whereas extracts from fresh sarcotesta were inactive. Our results suggest that M. dealbata sarcotesta contains secondary metabolites with insecticidal activity against A. ludens adults. These metabolites are as potent as natural pyrethins and represent a potential substance for controlling this type of pest.

  16. Assessing the Risk of Invasion by Tephritid Fruit Flies: Intraspecific Divergence Matters.

    Science.gov (United States)

    Godefroid, Martin; Cruaud, Astrid; Rossi, Jean-Pierre; Rasplus, Jean-Yves

    2015-01-01

    Widely distributed species often show strong phylogeographic structure, with lineages potentially adapted to different biotic and abiotic conditions. The success of an invasion process may thus depend on the intraspecific identity of the introduced propagules. However, pest risk analyses are usually performed without accounting for intraspecific diversity. In this study, we developed bioclimatic models using MaxEnt and boosted regression trees approaches, to predict the potential distribution in Europe of six economically important Tephritid pests (Ceratitis fasciventris (Bezzi), Bactrocera oleae (Rossi), Anastrepha obliqua (Macquart), Anastrepha fraterculus (Wiedemann), Rhagoletis pomonella (Walsh) and Bactrocera cucurbitae (Coquillet)). We considered intraspecific diversity in our risk analyses by independently modeling the distributions of conspecific lineages. The six species displayed different potential distributions in Europe. A strong signal of intraspecific climate envelope divergence was observed in most species. In some cases, conspecific lineages differed strongly in potential distributions suggesting that taxonomic resolution should be accounted for in pest risk analyses. No models (lineage- and species-based approaches) predicted high climatic suitability in the entire invaded range of B. oleae-the only species whose intraspecific identity of invading populations has been elucidated-in California. Host availability appears to play the most important role in shaping the geographic range of this specialist pest. However, climatic suitability values predicted by species-based models are correlated with population densities of B. oleae globally reported in California. Our study highlights how classical taxonomic boundaries may lead to under- or overestimation of the potential pest distributions and encourages accounting for intraspecific diversity when assessing the risk of biological invasion.

  17. Assessing the Risk of Invasion by Tephritid Fruit Flies: Intraspecific Divergence Matters.

    Directory of Open Access Journals (Sweden)

    Martin Godefroid

    Full Text Available Widely distributed species often show strong phylogeographic structure, with lineages potentially adapted to different biotic and abiotic conditions. The success of an invasion process may thus depend on the intraspecific identity of the introduced propagules. However, pest risk analyses are usually performed without accounting for intraspecific diversity. In this study, we developed bioclimatic models using MaxEnt and boosted regression trees approaches, to predict the potential distribution in Europe of six economically important Tephritid pests (Ceratitis fasciventris (Bezzi, Bactrocera oleae (Rossi, Anastrepha obliqua (Macquart, Anastrepha fraterculus (Wiedemann, Rhagoletis pomonella (Walsh and Bactrocera cucurbitae (Coquillet. We considered intraspecific diversity in our risk analyses by independently modeling the distributions of conspecific lineages. The six species displayed different potential distributions in Europe. A strong signal of intraspecific climate envelope divergence was observed in most species. In some cases, conspecific lineages differed strongly in potential distributions suggesting that taxonomic resolution should be accounted for in pest risk analyses. No models (lineage- and species-based approaches predicted high climatic suitability in the entire invaded range of B. oleae-the only species whose intraspecific identity of invading populations has been elucidated-in California. Host availability appears to play the most important role in shaping the geographic range of this specialist pest. However, climatic suitability values predicted by species-based models are correlated with population densities of B. oleae globally reported in California. Our study highlights how classical taxonomic boundaries may lead to under- or overestimation of the potential pest distributions and encourages accounting for intraspecific diversity when assessing the risk of biological invasion.

  18. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  19. SELETIVIDADE DE INSETICIDAS A Neoseiulus californicus MCGREGOR (ACARI: PHYTOSEIIDAE EM MACIEIRA, NO RIO GRANDE DO SUL AGROCHEMICAL SELECTIVITY TO Neoseiulus californicus MCGREGOR (ACARI: PHYTOSEIIDAE ON APPLE IN RIO GRANDE DO SUL

    Directory of Open Access Journals (Sweden)

    LINO BITTENCOURT MONTEIRO

    2001-12-01

    Full Text Available Testes para determinar os efeitos de agroquímicos homologados para macieira foram realizados em laboratório sobre Neoseiulus californicus (Acari: Phytoseiidae. Os indivíduos testados foram coletados de um pomar comercial da Agriflor Ltda, em Vacaria, Rio Grande do Sul, após várias liberações inoculativas. Os inseticidas utilizados foram os tradicionalmente recomendados para o controle de pragas, principalmente mosca-das-frutas Anastrepha fraterculus (Diptera: Tephritidae. A oviposição e a mortalidade dos ácaros foram avaliadas 12; 24; 48 e 96 horas após a pulverização, cujos produtos foram classificados em quatro classes de toxicidade (IOBC/WPRS. Azinphos ethyl, deltametrina e fenthion provocaram 100% de mortalidade, sendo que dimethoate, fenitrotion, paration, phosmet e triclorfon foram levemente nocivos (classe 2. Malation foi considerado neutro para esta população.The side-effects of agrochemical to Neoseiulus californicus (Acari: Phytoseiidae were studied in laboratory. The mites were collected in commercial apple orchard of Agropastoril Rincão das Flores, in Vacaria, Rio Grande do Sul, Brazil, after successive inoculative releases. The insecticids used were recommended to control of same pest, as Anastrepha fraterculus (Diptera: Tephritidae. The reproduction effect and mortality were evalued 12, 24, 48 and 96 hours after pulverization, while the agrochemical were ranked in toxicity classes, according to IOBC/WPRS. Azinphos ethyl, deltametrina e fenthion were harmful with ca. 100% of mortality in 24 hours, dimethoate, fenitrotion, paration, phosmet e triclorfon were slightly harmful (class 2. Malation was harmless.

  20. EMBALAGENS NA PROTEÇÃO CONTRA PRAGAS DE FRUTOS DE CAQUIZEIRO

    Directory of Open Access Journals (Sweden)

    Carine Rusin

    2015-12-01

    Full Text Available The persimmon culture can be attacked by several pests and diseases, however, there are few studies related to the control. In addition, there is a lack of pesticides registered in the Ministry of Agriculture, Livestock and Supply (MAPA, in Portuguese “Ministério da Agricultura, Pecuária e Abastecimento”, emerging the fruit bagging as an alternative. The aim of this study was to evaluate different kinds of protective packs for bagging persimmon fruits, in order to control pests and diseases and, consequently, improve the fruit quality. The experiment was conducted in a persimmon orchard on the experimental station of the Instituto Federal de Educação, Ciência e Tecnologia do Rio Grande do Sul (IFRS, located in the Tuiuty District, in Bento Gonçalves, RS. Were performed four treatments: control (not bagged fruits, perforated polypropylene packaging, white TNT (non woven tissue packing, and kraft brown paper packing. The harvested fruits were evaluated for weight, symptoms of caterpillars damage, presence of mealybug (Pseudococcus sp. and symptoms of Schyzothyrium pomi. The fluctuation population of Anastrepha fraterculus was performed using McPhail trap with hydrolyzed protein. Among the treatments, only the fruits protected with perforated polypropylene differ significantly from the control on the evaluations of weight and Schyzothyrium pomi symptoms. However, there was no significant difference on the damage caused by caterpillars and presence of mealybugs. The use of perforated polypropylene has demonstrated efficiency on the control of Anastrepha fraterculus, and it can be used to reduce the damage in the fruits.

  1. Irradiation of mangoes as a quarantine treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E.; Enkerlin H, W.; Toledo A, J.; Reyes F, J.; Casimiro G, A

    1991-06-15

    This research project was conducted following guidelines of research protocols for post-harvest treatments developed by the United States Department of Agriculture CUSA. Laboratory bioassays included the irradiation of mangoes infested with third instar larvae of Anastrepha serpentina (Wied), A. ludens (Loew), A. obliqua (Macquart) and Ceratitis capitata (Wied) , at doses from 10 to 250 Gy. Irradiation doses were applied using a Co-60 AECL Model JS-7400 irradiator. The design was chosen to obtain a maximum to minimum ratio equal to, or less than, 1.025. C. capitata was the species most tolerant to irradiation. A dose of 60 Gy applied to third instar fruit fly larvae sterilized this species and prevented emergence of adults of the other three species. A dose of 250 Gy was required to prevent emergence of C. capitata. In fertility tests using emerged adults of A . Iudens, and A. obliqua a dose of 30 Gy gave 45 % and 27 % fertility, respectively. Adults of A. serpentina that emerged, died before reaching sexual maturity. The confirmatory tests, at probit-9 security level, were done at 100 Gy for the three species of Anastrepha and at 150 Gy for C. capitata. The quality of mangoes irradiated up to 1000 Gy was evaluated by chemical, physiological, and sensorial tests. The determination of vitamin C indicated that there was no loss of the nutritive value of the fruit. It also was observed that fruit metabolism was not accelerated since no significant increase in respiration or transpiration was registered and consumers accepted both treated and untreated fruit in the same way. (Author)

  2. The smart aerial release machine, a universal system for applying the sterile insect technique.

    Directory of Open Access Journals (Sweden)

    Ruben Leal Mubarqui

    Full Text Available Beyond insecticides, alternative methods to control insect pests for agriculture and vectors of diseases are needed. Management strategies involving the mass-release of living control agents have been developed, including genetic control with sterile insects and biological control with parasitoids, for which aerial release of insects is often required. Aerial release in genetic control programmes often involves the use of chilled sterile insects, which can improve dispersal, survival and competitiveness of sterile males. Currently available means of aerially releasing chilled fruit flies are however insufficiently precise to ensure homogeneous distribution at low release rates and no device is available for tsetse.Here we present the smart aerial release machine, a new design by the Mubarqui Company, based on the use of vibrating conveyors. The machine is controlled through Bluetooth by a tablet with Android Operating System including a completely automatic guidance and navigation system (MaxNav software. The tablet is also connected to an online relational database facilitating the preparation of flight schedules and automatic storage of flight reports. The new machine was compared with a conveyor release machine in Mexico using two fruit flies species (Anastrepha ludens and Ceratitis capitata and we obtained better dispersal homogeneity (% of positive traps, p<0.001 for both species and better recapture rates for Anastrepha ludens (p<0.001, especially at low release densities (<1500 per ha. We also demonstrated that the machine can replace paper boxes for aerial release of tsetse in Senegal.This technology limits damages to insects and allows a large range of release rates from 10 flies/km2 for tsetse flies up to 600,000 flies/km2 for fruit flies. The potential of this machine to release other species like mosquitoes is discussed. Plans and operating of the machine are provided to allow its use worldwide.

  3. INFESTAÇÃO DE MOSCAS-DAS-FRUTAS EM VARIEDADES DE MANGA (Mangifera indica L. NO ESTADO DE GOIÁS INFESTATION OF FRUIT FLY IN VARIETIES OF MANGO IN THE STATE OF GOIÁS

    Directory of Open Access Journals (Sweden)

    Juracy Rocha Braga Filho

    2007-09-01

    Full Text Available

    A mangueira (Mangifera indica L. é a principal espécie frutífera da família Anacardiaceae cultivada no Brasil. A expansão dessa cultura nos últimos anos, tanto para o consumo in natura como para a exportação, é limitada por diversas pragas, principalmente pelas moscas-das-frutas. No período de setembro de 1999 a fevereiro de 2000 foi estudado o nível de infestação natural de moscas-das-frutas em dez variedades de manga, em três municípios do Estado de Goiás. Foram obtidos 1.195 pupários, dos quais emergiram 484 adultos de Anastrepha (80% dos insetos identificados, 104 lonqueídeos (17,2 % e 17 braconídeos (2,8%. Das fêmeas identificadas, 77,9% pertenciam ao gênero Anastrepha e 22,08%, a Neosilba. As espécies identificadas foram: A. obliqua (48,78%, A. fraterculus (47,97%, A. sororcula (2,03% e A. turpiniae (1,22%, referida pela primeira vez em frutos de manga no Estado. O parasitóide Doryctobracon areolatus foi encontrado em larvas/pupas de moscas-das-frutas, nas variedades Imperial e Tommy Atkins. As variedades com maiores índices de infestação foram Imperial (15,3 pupários/fruto e 73,611 pupários/kg de frutos, em Goiânia, e Tommy Atkins (7,0 pupários/fruto e 17,503 pupários/kg de frutos, no município de Orizona. Em Goiânia, a variedade Bourbon não foi infestada, e a Sabina apresentou um índice de infestação de 0,076 pupários/fruto e 0,363 pupários/ kg de frutos.

    PALAVRAS-CHAVE: Insecta; Diptera; Tephritoidea; avaliação de danos; parasitóides.

    Mango (Mangifera indica L. production has expanded greatly in Brazil but several pests, especially fruit flies, have limited both fresh fruit consumption and

  4. Introducción y producción en laboratorio de Diachasmimorpha tryon i y Diachasmimorpha longicaudata (Hymenoptera: Braconidae para el control biológico de Ceratitis capitata (Diptera: Tephritidae en la Argentina Introduction and laboratory production of Diachasmimorpha tryoni and Diachasmimorpha longicaudata (Hymenoptera: Braconidae for the biological control of Ceratitis capitata (Diptera: Tephritidae in Argentina

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2003-12-01

    Full Text Available Con el propósito de reanudar la utilización de enemigos naturales contra la especie exótica Ceratitis capitata (Wiedemann, fueron introducidos a la Argentina en 1999 los agentes de control biológico Diachasmimorpha tryoni (Cameron y Diachasmimorpha longicaudata (Ashmead, dos endoparasitoides de larvas de tefrítidos. Por este motivo, en este trabajo se describen los procedimientos de cría en laboratorio del huésped y de ambas especies de parasitoides y, se presentan y discuten los resultados de un año de producción de D. tryoni y D. longicaudata a mediana escala (enero-diciembre/2000. Se realizó un análisis comparativo de los datos obtenidos sobre la producción de descendientes, proporción sexual, porcentaje de parasitismo y viabilidad de puparios por jaula de cría durante 15 generaciones entre ambas especies de parasitoides exóticos, utilizando como huésped larvas de C. capitata del tercer estadio de siete días de edad. Además, se discuten las posibilidades para implementar el control biológico aumentativo contra C. capitata y Anastrepha fraterculus (Wiedemann en el país.The biocontrol agents Diachasmimorpha tryoni (Cameron and Diachasmimorpha longicaudata (Ashmead, two endoparasitoids of fruit fly larvae, were introduced to Argentina in 1999 with the purpose of renewing the employment of natural enemies against Ceratitis capitata (Wiedemann. For this reason, the general procedure and maintenance of the host and parasitoids rearing in the laboratory are described, and the results of one year insectary production (January-December/2000 of both D. tryoni and D. longicaudata are discussed. Data are presented of the progeny production, offpring sex ratio, host parasitism percentage, and pupal viability per parasitoid rearing cage during 15 generations of D. longicaudata and D. tryoni reared using late third instar larvae of C. capitata. New perspectives are discussed on the establishment of a biological control program for C

  5. Diversidade de moscas-das-frutas em pomares de citros no município de Araruama, RJ Diversity of fruit flies in citrus groves in the municipality of Araruama, RJ

    Directory of Open Access Journals (Sweden)

    Jorge Ferreira de Souza

    2008-04-01

    Full Text Available O objetivo deste estudo foi determinar as espécies de Tephritidae e Lonchaeidae (Diptera: Tephritoidea de ocorrência em pomares de laranja doce (Citrus sinensis Osbeck e tangerina (Citrus reticulata Blanco, no município de Araruama, RJ, durante o período de dezembro de 2002 a novembro de 2003. Os espécimes foram coletados em armadilhas McPhail contendo solução aquosa de proteína hidrolisada a 5% e em amostras de frutos de seis variedades de citros. Nas armadilhas, o total de 2.543 adultos de Tephritoidea (1.430 fêmeas e 1.023 machos foi capturado, sendo dez espécies de Tephritidae, quatro espécies e dois morfotipos de Lonchaeidae. Dos Tephritidae e capturados nas McPhail, quatro espécies (Anastrepha fraterculus, A. obliqua, A. sororcula e Ceratitis capitata infestaram frutos cítricos, enquanto que, dos Lonchaeidae, somente os morfotipos não infestaram as amostras de citros. Os resultados demonstram que a densidade populacional das moscas-das-frutas pode ser superestimada, quando baseada no número de moscas por armadilha, devido à captura de espécies que não infestam os frutos de interesse comercial.This study was aimed at determining the species of Tephritidae and Lonchaeidae (Diptera: Tephritoidea that occur on groves of sweet orange (Citrus sinensis Osbeck and tangerine (Citrus reticulata Blanco in the municipality of Araruama, state of Rio de Janeiro, Brazil, from December, 2002 to November, 2003. The specimens were collected by McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruits samples of six varieties of citrus. In the traps the total of 2,543 adults of Tephritoidea (1,430 females and 1,023 males was captured, being ten species of Tephritidae, four species and two morphotypes of Lonchaeidae. From the Tephritidae caught by the McPhail, four species (Anastrepha fraterculus, A. obliqua, A. sororcula and Ceratitis capitata infested citric fruits while the Lonchaeidae, the morphotypes did not infest

  6. Levantamento de moscas-das-frutas e seus parasitoides em citros, no município de Viçosa, Minas Gerais Survey of fruit-flies and their parasitoids in citrus in Viçosa, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Daniel Lucas Magalhães Machado

    2012-12-01

    Full Text Available As moscas-das-frutas são responsáveis por grandes perdas em fruteiras comerciais no Brasil, por isso é fundamental conhecer as espécies predominantes na região. Objetivou-se com este trabalho estudar a ocorrência de moscas-das-frutas (Diptera: Tephritidae e seus parasitoides em laranjas doces (Citrus sinensis L. Osbeck, tangerina Poncã (Citrus reticulata Blanco e mexerica Rio (Citrus deliciosa Ten, no município de Viçosa, Minas Gerais. Os frutos foram coletados em abril de 2008. No laboratório eles foram acondicionados em caixas plásticas contendo areia umedecida e em ambiente controlado para obtenção dos pupários, que foram contados, acondicionados em frascos de vidro com areia fina e mantidos em estufa até a emergência dos adultos. Somente uma espécie de mosca-das-frutas (Anastrepha fraterculus (Wiedemann, 1830 e uma de parasitoide (Doryctobracon brasiliensis Szépligeti foram identificadas. Dentre as variedades, a laranja doce Baianinha apresentou o maior índice de infestação, e os menores foram atribuídos à mexerica Rio e à tangerina Poncã.Fruit flies are responsible for large losses in commercial orchards in Brazil, thus, it is important to know the predominant species in the region. The objective of this study was to study the occurrence of fruit flies (Diptera: Tephritoidae and of their parasitoids in sweet orange (Citrus sinensis L. Osbeck, 'Poncã' mandarin (Citrus reticulate Blanco and 'Rio' tangerine (Citrus deliciosa Ten, in Viçosa, Minas Gerais. The fruits were collected in April 2008. In the laboratory, the fruits were stored in plastic boxes containing moist sand in a controlled environment, to obtain pupae. Then, the pupae were counted, placed in glass bottles with fine sand and kept in an oven until adult emergence. Only one species of fruit fly (Anastrepha fraterculus (Wiedemann, 1830 and one species of parasitoid (Doryctobracon brasiliensis Szépligeti were identified. Among the varieties, the sweet

  7. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2012-08-01

    Full Text Available Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri; similarly, establishment of Bactrocera dorsalis (Hendel in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan, Diachasmimorpha longicaudata (Ashmead and Fopius vandenboschi (Fullaway were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa. Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more

  8. Incidence of fruit flies on coffee and citrus and quarantine treatment of citrus fruits by gamma radiation; Incidencia de moscas-das-frutas em cafe e citros e tratamento quarentenario de frutos citricos com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Raga, Adalton

    1996-12-31

    The objective of this study was to evaluate the fruit fly infestation on coffee and citrus, and also to determine gamma radiation doses for immature stages of Ceratitis capitata and Anastrepha fraterculus, in order to satisfy quarantine regulations. Coffee arabica varieties Icatu Vermelho, Catuai Amarelo, Mundo Novo and Sarchimor showed the highest infestation indices (pupa/berry): 0.53; 0,41; 0.33 and 0.36. respectively Icatu Vermelho and Catuai Vermelho showed the highest values of pupa/berry weight (0.49 and 0.39, respectively), and Robusta (Coffea canephora) presented the lowest index (0.01). The following fruit flies were found in coffee berries: C. capitata (76.6%) Anastrepha spp. (7.4%) and Lonchaeidae (17.0%). In area near coffee plantation, fruit fly infestation indices in sweet oranges were of 4.77 larvae/kg and 0.55 larva/fruit. The infestation indices for sweet orange, collected from five regions of the State of Sao Paulo ranged from 0.73 to 7.60 pupa/kg and 0.12 to 1.27 pupa/fruit. The same species of fruit flies were found in oranges. In the case of C. capitata eggs with 24-48 hours old, 20 Gy prevented completely adult emergence (artificial diet and orange). No emergence of adult occurred when C. capitata larvae of third instar were irradiated at 20 Gy in their rearing medium. But at 25 Gy, the number of adults was reduced by 54% and 97% from larval infestation in oranges and grapefruit, respectively. A dose of 30 Gy was required to prevent medfly emergence from third instar larvae in grapefruit. A dose of 15 Gy was required for third instar, to prevent adult emergence of A. fraterculus. No adult emerged from C third instar, to prevent adult emergence of A. fraterculus. No adult emerged from C capitata pre-pupa irradiated at 30 Gy. One medfly adult emerged from pupa (3-4 days after pupating) irradiated at 120 Gy. At the same dose, sixteen A. fraterculus adults emergency from irradiated pupa with 5-6 days old. (author) 85 refs., 2 figs., 13 tabs.

  9. Neem derivatives are not effective as toxic bait for tephritid fruit flies.

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Mastrangelo, T; Forim, M R

    2013-08-01

    Neem derivatives have been widely touted as replacements for pesticides. A feasible replacement of synthetic insecticides in the management of fruit flies could be to use neem products in baits. This study evaluated the bioactivity of neem (Azadirachta indica A. Juss) derivatives in bait for adults of Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann). The estimated LCs50 values for A. fraterculus and C. capitata were 7,522 ppm (18.40 ppm of azadirachtin) and 1,368 ppm (3.35 ppm of azadirachtin), respectively, using an aqueous extract of neem seeds in bait after 10 d of experimentation. No significant differences in the mortality of A. fraterculus and C. capitata adults exposed to baits made from different extracts and neem oil were observed after 3 h or 2 or 6 d; differences among the treatments were observed only on the 10th day of the evaluation. We conclude that neem derivatives applied as a bait spray over citrus plants did not demonstrate a toxic effect on A. fraterculus and C. capitata. The reasons for the low efficacy of the neem bait on Tephritid fruit flies are discussed.

  10. Genetic technologies to enhance the Sterile Insect Technique (SIT)

    Energy Technology Data Exchange (ETDEWEB)

    Alphey, Luke; Baker, Pam; Condon, George C.; Condon, Kirsty C.; Dafa' alla, Tarig H.; Fu, Guoliang; Jin, Li; Labbe, Genevieve; Morrison, Neil M.; Nimmo, Derric D.; O' Connell, Sinead; Phillips, Caroline E.; Plackett, Andrew; Scaife, Sarah; Woods, Alexander, E-mail: luke.alphey@zoo.ox.ac.u [Oxitec Ltd., Oxford (United Kingdom); Burton, Rosemary S.; Epton, Matthew J.; Gong, Peng [University of Oxford (United Kingdom). Dept. of Zoology

    2006-07-01

    The Sterile Insect Technique (SIT) has been used very successfully against range of pest insects, including various tephritid fruit flies, several moths and a small number of livestock pests. However, modern genetics could potentially provide several improvements that would increase the cost-effectiveness of SIT, and extend the range of suitable species. These include improved identification of released individuals by incorporation of a stable, heritable, genetic marker; built-in sex separation (genetic sexing); reduction of the hazard posed by non-irradiated accidental releases from mass-rearing facility (fail-safe); elimination of the need for sterilization by irradiation (genetic sterilization). We discuss applications of these methods and the state of the art, at the time of this meeting, in developing suitable strains. We have demonstrated, in several key pest species, that the required strains can be constructed by introducing a repressible dominant lethal genetic system, a method known as RIDL(trade mark). Based on field experience with Medfly, incorporation of a genetic sexing system into SIT programs for other tephritids could potentially provide a very significant improvement in cost-effectiveness. We have now been able to make efficient female-lethal strains for Medfly. One advantage of our approach is that it should be possible rapidly to extend this technology to other fruit fly species; indeed we have recently been able also to make genetic sexing strains of Medfly (Anastrepha ludens). (author)

  11. Diet Shapes Mortality Response to Trauma in Old Tephritid Fruit Flies.

    Directory of Open Access Journals (Sweden)

    James R Carey

    Full Text Available Despite the importance of trauma in healthspan and lifespan in humans as well as in non-human species, with one important exception the literature in both gerontology and ecology contains virtually no experimental demographic studies concerned with trauma in any species. We used dietary manipulation [full diet (F versus sugar-only (S] to produce four levels of frailty in 55-day old tephritid fruit flies (Anastrepha ludens that were then subject to the trauma of cage transfer stress (n = 900/sex in each of the 4 treatments. The key results included the following: (1 there is a trauma effect caused by the transfer that depends on previous diet before transfer, new diet after transfer and gender of the fly; (2 males are more vulnerable than females; (3 if initial diet was F, flies are relatively immune against the trauma, and the subsequent diet (F or S does not matter; (4 however if initial diet was S, then the effect of the trauma depends largely on the diet after the transfer; (5 flies transferred from S to F diets do very well in terms of remaining longevity (i.e. greatest remaining longevity, while flies transferred from S to S diet do poorly (i.e. shortest remaining longevity. We discuss both the strengths and weaknesses of this study and implications of the results.

  12. Mango resistance to fruit flies. II - resistance of the alfa cultivar

    Energy Technology Data Exchange (ETDEWEB)

    Rossetto, C.J.; Bortoletto, N., E-mail: rossetto@iac.sp.gov.b [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Votuporanga, SP (Brazil). Polo Regional do Noroeste Paulista; Walder, J.M.M.; Mastrangelo, T. de A., E-mail: jmwalder@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil); Carvalho, C.R.L.; Castro, J.V. de, E-mail: climonta@iac.sp.gov.b, E-mail: josalba@iac.sp.gov.b [Instituto Agronomico de Campinas, SP (Brazil); Pinto, A.C. de Q. [EMBRAPA, Brasilia, DF (Brazil); Cortelazzo, A.L., E-mail: angelo@unicamp.b [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia

    2006-07-01

    The percentage of infested mango fruits of five selected mango varieties was evaluated during three years under field conditions. Three varieties with field resistance to fruit flies had less then 10% of fruits infested. Tommy Atkins, the susceptible commercial check, had 42,9% and the susceptible check had 98.9 % of infested fruits. The three field resistant varieties plus the susceptible commercial check, Tommy Atkins, were further tested in laboratory, under caged conditions, with artificial infestation of Anastrepha obliqua. The attempts of oviposition and the number of pupae developed from each fruit were evaluated. Under caged conditions, the cultivar Alfa maintained its field resistance and Espada Stahl and IAC 111 lost the field resistance and were as susceptible as Tommy Atkins. The attempts of oviposition were positively and highly correlated with the number of pupae developed in the fruits. Non preference for oviposition was confirmed as the main mechanism of resistance of mango fruits to fruit flies. In the absence of a more susceptible variety (no choice test) the cultivar Alfa has kept the resistance (author)

  13. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil

    Directory of Open Access Journals (Sweden)

    Flávio R. M. Garcia

    2012-12-01

    Full Text Available The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA to evaluate the parasitoid’s potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  14. Development of Myrmeleon brasiliensis (Navas) (Neuroptera, Myrmeleontidae), in laboratory, with different natural diets

    Energy Technology Data Exchange (ETDEWEB)

    Missirian, Giani L.B. [Centro Universitario da Grande Dourados, MS (Brazil). Curso de Ciencias Biologicas; Uchoa-Fernandes, Manoel A. [Universidade Federal da Grande Dourados, MS (Brazil). Faculdade de Ciencias Biologicas e Ambientais]. E-mail: uchoa.fernandes@ufgd.edu.br; Fischer, Erich [Universidade Federal de Mato Grosso do Sul, Campo Grande, MS (Brazil). Dept. de Biologia

    2006-07-01

    Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp.), fruit fly larvae (Anastrepha spp. and Ceratitis capitata) and mixed diet (Atta spp. plus fruit fly larvae)] on the development of larvae and pupae of M. brasiliensis (Navas, 1914) and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days) of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm), the mean weight (mg) or the mean body size (mm) in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments. (author)

  15. Moscas frugívoras e seus parasitoides nos municípios de Pelotas e Capão do Leão, Rio Grande do Sul, Brasil Frugivorous flies and their parasitoids in the cities of Pelotas and Capão do Leão, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2012-01-01

    Full Text Available As moscas frugívoras (Tephritoidea são as principais pragas da fruticultura de clima temperado no Brasil. O objetivo do presente trabalho foi avaliar a infestação desses dípteros e a ocorrência de seus parasitoides em frutíferas nos municípios de Pelotas e Capão do Leão, localizados na região Sul, nas safras agrícolas de 2007/08 e 2008/09. Foram coletados frutos de araçazeiro-amarelo e vermelho (Psidium cattleianum Sabine, 1821, butiazeiro [Butia capitata (Mart. Becc., 1916], caquizeiro (Diospyros kaki Linnaeus, 1753, cerejeira-do-mato (Eugenia involucrata DC., 1828, goiabeira [Psidium guajava (Linnaeus, 1753], goiabeira-serrana [Acca sellowiana (Berg. Burret, 1941], nespereira [Eriobotrya japonica (Thunb. Lindley, 1822], pessegueiro [Prunus persicae (L. Batsch, 1801], pitangueira (Eugenia uniflora Linnaeus,1753 e uvalheira (Eugenia pyriformis Cambessèdes, 1832. Os frutos foram coletados e transportados para o laboratório, onde foram individualizados e determinados os seguintes parâmetros: índice de infestação das moscas, índice de parasitismo e frequência de indivíduos por espécie de parasitoide. Foram constatadas duas espécies de Tephritidae, Anastrepha fraterculus (Wiedemann, 1830 (90,5% e Ceratitis capitata (Wiedemann, 1824 (9,5% e duas de Lonchaeidae, Neosilba zadolicha McAlpine & Steyskal, 1982 (87,8% e uma espécie ainda não descrita, referida como Neosilba n. sp. 3 (12,2%. Anastrepha fraterculus é a espécie mais abundante nos dois municípios, sendo constatada na maioria das frutíferas coletadas. Caquizeiro e goiabeira foram os hospedeiros que apresentaram o maior índice de infestação por C. capitata. Quanto às espécies de Neosilba, a maior infestação ocorreu em frutos de goiabeira-serrana. Dos parasitoides emergidos, foram identificadas três espécies, sendo duas de Braconidae, Doryctobracon areolatus (Szépligeti, 1911 (52,6% e Opius bellus (Gahan, 1930 (27,5% e uma espécie de Figitidae, Aganaspis

  16. Hole diameters in pet bottles used for fruit fly capture

    Directory of Open Access Journals (Sweden)

    Maurico Paulo Batistella Pasini

    2015-05-01

    Full Text Available Two experiments were conducted during the period from 31 January to 6 March 2012 in Santa Maria, Rio Grande do Sul State, Brazil to determine the efficiency of different hole diameters in PET trap bottles on pests in guava and persimmon orchards. In a randomised block design in a factorial scheme, we assessed the average number adults of Anastrepha fraterculus, Ceratitis capitata (Diptera: Tephitidae and Zaprionus indianus (Diptera: Drosophilidae infruits thatemerged in two situations (in the plant and on the soil; we also assessed the number of captured adults in trap bottlesunder two conditions, different hole diameters and different days after placement of the attractive solution. Smaller diameter sizescaptured more A. fraterculus, C. capitata and Z. indianusadults. The 1.0 cm diameter was the most efficient hole size in reducing the adult emergence of Tephritidae to Z. indianus, whereas the smallest diameter hole sizes, 0.6 and 0.8 cm, showed the highest efficiencies in controlling adult emergence in persimmon fruit and guava fruit.

  17. Biology of Fopius arisanus (Hymenoptera: Braconidae) in Two Species of Fruit Flies

    Science.gov (United States)

    Groth, M. Z.; Loeck, A. E.; Nörnberg, S. D.; Bernardi, D.; Nava, D. E.

    2016-01-01

    Fopius arisanus (Sonan, 1932) (Hymenoptera: Braconidae) is an egg–larval parasitoid used in control programs of Bactrocera dorsalis (Hendel) and Ceratitis capitata (Wiedemann). In Brazil, C. capitata and Anastrepha fraterculus (Wiedemann) are considered the main tephritid pests of exotic and indigenous fruits. The objective of this study was to study the biology of F. arisanus in C. capitata and A. fraterculus. Eggs of the two fruit fly species were used to determine the parasitism rate, number of offspring, emergence rate, sex ratio, adult weight and longevity of male and female F. arisanus. These biological parameters were used to develop a fertility life table. We observed higher parasitism and emergence rates of adults, a shorter duration of the egg–adult period and a sex ratio biased to females when F. arisanus was reared in eggs of C. capitata than in those of A. fraterculus. However, adults of F. arisanus from eggs of A. fraterculus were heavier and had greater longevity than those obtained from C. capitata eggs. The fertility life table showed better biological and reproductive performance for F. arisanus reared in eggs of C. capitata, although eggs of A. fraterculus also provided positive values for population increase. PMID:27638954

  18. IMPROVING MASS REARING TECHNOLOGY FOR SOUTH AMERICAN FRUIT FLY (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-01-01

    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  19. Levantamento de moscas-das-frutas e seus parasitoides em citros, no município de Viçosa, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Daniel Lucas Magalhães Machado

    2012-12-01

    Full Text Available As moscas-das-frutas são responsáveis por grandes perdas em fruteiras comerciais no Brasil, por isso é fundamental conhecer as espécies predominantes na região. Objetivou-se com este trabalho estudar a ocorrência de moscas-das-frutas (Diptera: Tephritidae e seus parasitoides em laranjas doces (Citrus sinensis L. Osbeck, tangerina Poncã (Citrus reticulata Blanco e mexerica Rio (Citrus deliciosa Ten, no município de Viçosa, Minas Gerais. Os frutos foram coletados em abril de 2008. No laboratório eles foram acondicionados em caixas plásticas contendo areia umedecida e em ambiente controlado para obtenção dos pupários, que foram contados, acondicionados em frascos de vidro com areia fina e mantidos em estufa até a emergência dos adultos. Somente uma espécie de mosca-das-frutas (Anastrepha fraterculus (Wiedemann, 1830 e uma de parasitoide (Doryctobracon brasiliensis Szépligeti foram identificadas. Dentre as variedades, a laranja doce Baianinha apresentou o maior índice de infestação, e os menores foram atribuídos à mexerica Rio e à tangerina Poncã.

  20. Assessment of differences between X and gamma rays in order to validate a new generation of irradiators for insect sterilization

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago; Walder, Julio M.M., E-mail: piaui@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil); Parker, Andrew G.; Jessup, Andrew; Orozco-Davila, Dina; Islam, Amirul; Dammalage, Thilakasiri, E-mail: A.Jessup@iaea.or [Joint FAO/IAEA-UN A-2444, Seibersdorf (Austria). Insect Pest Control Subprogramme; Pereira, Rui, E-mail: R.Cardoso-Pereira@iaea.or [Joint FAO/IAEA-UN, Vienna (Austria). Insect Pest Control Subprogramme

    2009-07-01

    Recent fears of terrorism provoked an increase in delays and denials of transboundary shipments of radioisotopes. This represents a serious constraint to sterile insect technique (SIT) programs around the world as they rely on the use of ionizing energy from radioisotopes for insect sterilization. In order to validate a novel Xray irradiator, a series of studies on Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) were carried out, comparing the relative biological effectiveness (RBE) between X-rays and traditional gamma radiation from {sup 60}Co. Male C. capitata pupae and pupae of both sexes of A. fraterculus, both 24 to 48 h before adult emergence, were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Estimated mean doses of 91.2 Gy of X and 124.9 Gy of gamma radiation induced 99% sterility in C. capitata males. Irradiated A. fraterculus were 99% sterile at about 40-60 Gy for both radiation treatments. Standard quality control parameters were not significantly affected by the two types of radiation. There were no significant differences between X and gamma radiation regarding mating indices. The RBE did not differ significantly between the tested X and gamma radiation, and X-rays are as biologically effective for SIT purposes as gamma rays are. This work confirms the suitability of this new generation of X-ray irradiators for pest control programs in UN Member States. (author)

  1. Wolbachia in two populations of Melittobia digitata Dahms (Hymenoptera: Eulophidae)

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Claudia S.; Sivinski, John [United States Dept. of Agriculture, Gainesville, FL (United States). Center for Medical, Agriculture and Veterinary Entomology]. E-mails: cclaudia@bioinf.uni-leipzig.de; john.sivinski@ars.usda.gov; Matthews, Robert W. [University of Georgia, Athens, GA (United States). Dept. of Entomology]. E-mail: rmatthew@uga.edu; Gonzalez, Jorge M. [Texas A and M Univ., College Station, TX (United States). Dept. of Entomology]. E-mail: jmgonzalez@neo.tamu.edu; Aluja, Martin [Instituto de Ecologia A.C., Veracruz (Mexico)]. E-mail: martin.aluja@inecol.edu.mx

    2008-11-15

    We investigated two populations of Melittobia digitata Dahms, a gregarious parasitoid (primarily upon a wide range of solitary bees, wasps, and flies), in search of Wolbachia infection. The first population, from Xalapa, Mexico, was originally collected from and reared on Mexican fruit fly pupae, Anastrepha ludens Loew (Diptera: Tephritidae); the other, from Athens, Georgia, was collected from and reared on prepupae of mud dauber wasps, Trypoxylon politum Say (Hymenoptera: Crabronidae). PCR studies of the ITS2 region corroborated that both parasitoid populations were the same species; this potentially provides a useful molecular taxonomic profile since females of Melittobia species are superficially similar. Amplification of the Wolbachia surface protein gene (wsp) confirmed the presence of this endosymbiont in both populations. Sequencing revealed that the Wolbachia harbored in both populations exhibited a wsp belonging to a unique subgroup (denoted here as Dig) within the B-supergroup of known wsp genes. This new subgroup of wsp may either belong to a different strain of Wolbachia from those previously found to infect Melittobia or may be the result of a recombination event. In either case, known hosts of Wolbachia with a wsp of this subgroup are only distantly related taxonomically. Reasons are advanced as to why Melittobia - an easily reared and managed parasitoid - holds promise as an instructive model organism of Wolbachia infection amenable to the investigation of Wolbachia strains among its diverse hosts. (author)

  2. Superparasitism in the Fruit Fly Parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) and the Implications for Mass Rearing and Augmentative Release.

    Science.gov (United States)

    Montoya, Pablo; Pérez-Lachaud, Gabriela; Liedo, Pablo

    2012-09-25

    Superparasitism, a strategy in which a female lays eggs in/on a previously parasitized host, was attributed in the past to the inability of females to discriminate between parasitized and non-parasitized hosts. However, superparasitism is now accepted as an adaptive strategy under specific conditions. In fruit fly parasitoids, superparasitism has mainly been studied as concerns the new association between Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae) and the Mexican fruit fly Anastrepha ludens (Loew) (Diptera: Tephritidae), wherein this phenomenon is a common occurrence in both mass rearing and field conditions. Studies of this species have shown that moderate levels of superparasitism result in a female-biased sex ratio and that both massreared and wild females superparasitize their hosts without detrimental effects on offspring demographic parameters, including longevity and fecundity. These studies suggest that superparasitism in this species is advantageous. In this paper, we review superparasitism in D. longicaudata, discuss these findings in the context of mass rearing and field releases and address the possible implications of superparasitism in programs employing augmentative releases of parasitoids for the control of fruit fly pests.

  3. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil.

    Science.gov (United States)

    Garcia, Flávio R M; Ricalde, Marcelo P

    2012-12-21

    The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus) was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA) to evaluate the parasitoid's potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  4. Biological Control of Tephritid Fruit Flies in Argentina: Historical Review, Current Status, and Future Trends for Developing a Parasitoid Mass-Release Program

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2012-09-01

    Full Text Available In Argentina there are two tephritid fruit fly species of major economic and quarantine importance: the exotic Ceratitis capitata that originated from Southeast Africa and the native Anastrepha fraterculus. In recent years, the use of fruit fly parasitoids as biocontrol agents has received renewed attention. This increasing interest has recently led to the establishment of a program for the mass rearing of five million Diachasmimorpha longicaudata parasitoids per week in the BioPlanta San Juan facility, San Juan, Argentina. The first augmentative releases of D. longicaudata in Argentina are currently occurring on commercial fig crops in rural areas of San Juan as part of an integrated fruit fly management program on an area-wide basis. In this context, research is ongoing to assess the suitability of indigenous parasitoid species for successful mass rearing on larvae of either C. capitata or A. fraterculus. The purpose of this article is to provide a historical overview of the biological control of the fruit fly in Argentina, report on the strategies currently used in Argentina, present information on native parasitoids as potential biocontrol agents, and discuss the establishment of a long-term fruit fly biological control program, including augmentative and conservation modalities, in Argentina’s various fruit growing regions.

  5. An improved quarantine method for mangoes against the Mexican fruit fly based on high-pressure processing combined with heat.

    Science.gov (United States)

    Velazquez, Gonzalo; Candelario, Hugo Ernesto; Ramírez, José A; Montoya, Pablo; Loera-Gallardo, Jesús; Vázquez, Manuel

    2010-05-01

    The Mexican fruit fly Anastrepha ludens Loew (Diptera: Tephritidae) is one of the most important insects infesting mangoes, citrus, and other fruits in Mexico and other Latin-American countries. Quarantine methods approved to destroy this insect decrease the shelf life of commodities. The objective of this study was to determine the effect of high-pressure processing using an initial temperature of 50 degrees C on the survivorship of eggs and larvae of the Mexican fruit fly. Eggs and larvae were pressurized at 25, 50, 75, 100, or 150 MPa for 0, 5, 10, or 20 min. The hatching ability of pressurized eggs of 1, 2, 3, and 4 days old and survivorship of the first, second, and third instars were registered. Further, the ability to pupate was studied in surviving third instars. The results showed that eggs were more resistant than larvae to the high-pressure processing. Treatments at 150 MPa at initial 50 degrees C for 10 min destroyed all eggs and larvae of A. ludens, indicating that this process might be useful as a quarantine method for infested mangoes or other fruits.

  6. Mexican Fruit Fly Populations in the Semi-Arid Highlands of the Sierra Madre Oriental in Northeastern Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Mora-Olivo, A; Gaona-García, G; Reyes-Zepeda, F; Rocandio-Rodríguez, M

    2017-01-04

    The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most important pests of citrus in Mexico. We report the results of an analysis of A. ludens populations that inhabit the semi-arid highlands of the Sierra Madre Oriental in northeastern Mexico. This study aimed to provide information on population fluctuation of A. ludens and how it relates to climate variables, as well as insights into habitat and native parasitoids. Population peaked in the period July-November when ripe fruits of the wild host, Casimiroa pubescens Ramírez, were available. No adults were captured the rest of the year, suggesting that high populations depend on the availability of wild host fruit. No significant relationships between population fluctuation and climatic variables were observed, except for minimum temperature. Fruit samples of citron (Citrus medica L.), pomegranate (Punica granatum L.), and C. pubescens were collected to determine degree of infestation. Infestation levels (pupae/g) ranged between 0.0006 for citron, 0.0047 for pomegranate, and 0.0240 for C. pubescens. A native parasitoid of Tephritidae, Doryctobracon crawfordii (Viereck) (Braconidae), was identified. Parasitism percentage was calculated at 12.5% on C. pubescens fruits. No parasitoids were observed on citron or pomegranate fruit samples. These results contribute to knowledge on behavior of A. ludens native to temperate environments where no commercial hosts are available. Further research on host expansion of this pest in light of scenarios of global climate change is suggested.

  7. Evaluation of the Host Status of Mature Green Papayas 'Maradol' for the Mexican Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; Díaz-Fleischer, Francisco

    2014-10-01

    The suitability of mature green 'Maradol' papaya as a host of Anastrepha ludens (Loew) was studied under field and laboratory conditions. Field tests were conducted on commercial-ripened and spot-ripened fruit in two orchards and during two seasons in the state of Chiapas. Fruits at exportation ripeness are in "commercial ripeness", while fruits that are harvested immediately preceding exportation ripeness are in "spot ripeness." The field tests consisted of forced infestation experiments that evaluated papayas at two ripeness stages: the commercial- or exportation-ripened fruit (green fruits with one or two yellow stripes) and fruit before exportation ripeness called "spot ripeness." These tests were conducted in two orchards and during two seasons in the state of Chiapas, Mexico. Laboratory trials were performed with commercial-ripened fruit only. Fruit from four different postharvest periods (3, 24, 48, and 72 h) were exposed to groups of gravid flies. No larvae emerged from the fruit that was collected in the field experiments. However, some larvae and several fertile flies were obtained from the commercial-ripened fruit 72 h postharvest but not 3, 24, and 48 h postharvest in the laboratory. The results of this study indicate that the commercially ripe fruits of papaya Maradol were resistant to or free from infestation of A. ludens flies under field conditions, though these fruits must be considered nonnatural, conditional host because they became infested in the laboratory.

  8. [Susceptibility of six Arabic coffee cultivars to fruit flies (Diptera: Tephritoidea) under shaded and unshaded organic management in Valença, State of Rio de Janeiro, Brazil].

    Science.gov (United States)

    Aguiar-Menezes, Elen L; Souza, Silvana A S; Santos, Carlos M A; Resende, André L S; Strikis, Pedro C; Costa, Janaína R; Ricci, Marta S F

    2007-01-01

    The infestation indices by fruit flies were determined for six cultivars of Coffea arabica L. in shaded and unshaded systems under organic management. The experiment was set in a completely randomized design with a split-split-plot arrangement and four replicates. A 250g-sample of maturing fruits per plot was harvested in May 2005. The cultivars Icatu Amarelo and Catucaí Amarelo were the least susceptible to attack by tephritids in both systems. As for lonchaeids, Oeiras, Catucaí Amarelo and Catuaí Vermelho were the least susceptible cultivars in the shaded system, and there was no difference among the cultivars in the unshaded system. The following tephritid species were obtained: Ceratitis capitata (Wiedemann), Anastrepha fraterculus (Wiedemann) and A. sororcula Zucchi (Tephritidae). Lonchaeids were represented by Neosilba bifida Strikis & Prado, N. certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. pseudopendula (Korytkowski and Ojeda), Dasiops rugifrons Hennig, Neosilba n.sp.10 and Neosilba n.sp.14.

  9. Virulence of nematodes against larvae of the south-American fruit fly in laboratory using soil from Porto Amazonas, Paraná, Brazil, as substrate

    Directory of Open Access Journals (Sweden)

    Ester Foelkel

    2015-01-01

    Full Text Available ABSTRACT: Anastrepha fraterculus is an important orchard pest. Its management has been based in chemical sprays, but biological control is a growing demand. The objective of this work was to evaluate, under laboratory conditions, the virulence of eight nematode isolates to A. fraterculus in a soil collected in Porto Amazonas, Paraná, Brazil, and to estimate lethal doses (LD50 and LD90 for the more virulent isolate. Steinernema carpocapsae CB 02, three Heterorhabditis sp., two H. amazonensis and two Oscheius sp. isolates were tested in laboratory against A. fraterculus third-instar larvae using as substrate a loam Cambisol collected in an apple orchard. S. carpocapsae CB 02 isolate caused the higher percent mortality of A. fraterculus. Heterorhabditis sp. isolates and LAMIP 9 ( Oscheius sp. isolates were intermediate, while LAMIP 92 (Oscheius sp. didn't differ from the control. S. carpocapsae CB 02 is able to kill 50% and 90% of A. fraterculus population with 96.3 and 314.7 infective juveniles per larva, respectively, in that soil. As a conclusion, CB 02 is the most virulent to A. fraterculus when the substrate is Porto Amazonas' apple orchard soil and it is able to kill 50 and 90% larval population with 96.3 and 314.7 infective juveniles per larva, respectively.

  10. First register of fruit flies (Diptera: Tephritidae in star fruit in Teresina, Altos and Parnaiba, state of Piaui, Brazil/ Primeiro registro de moscas-das-frutas (Diptera: Tephritidae em carambola nos municípios de Teresina, Altos e Parnaíba no estado do Piauí

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo Soares

    2007-08-01

    Full Text Available The present work aims to register the occurrence of the fruit flies associated to star fruit (Averrhoa carambola L. in three counties of the state of Piaui, as well as to determine the frequency and the index of infestation of these insects. The fruits had been collected during the months of August and September 2005, and had been placed in plastic trays with sterilized soil, stored in metal cages, and left in environmental temperature at the laboratory. Until emergency, the adults had been kept in bottles with alcohol 70% and later identified in the species level. The biggest index of infestation (flies/fruit of C. capitata has occurred in the county of Altos (3.66, followed by Teresina and Parnaiba that had presented index of infestation of 2.18 and 0.016, respectively. C. capitata was the most frequent species in all the counties, presenting frequencies of 100%, 96.5%, and 100% in Teresina, Altos and Parnaiba, respectively. Ceratitis capitata is registered for the first time in star fruit in Teresina, Altos and Parnaiba, state of the Piaui. Anastrepha fraterculus is registered for the first time in the county of Altos. A. fraterculus and C. capitata occur simultaneously in star fruits.O presente trabalho visou conhecer as espécies de moscas-das-frutas associadas à carambola (Averrhoa carambola L. em três municípios do Estado do Piauí, bem como determinar a freqüência e o índice de infestação desses insetos. Os frutos foram coletados durante os meses de agosto e setembro de 2005, colocados em bandejas plásticas com solo esterilizado, armazenados em gaiolas metálicas e deixados em temperatura ambiente no laboratório. Até a emergência dos adultos, estes foram acondicionados em frascos contendo álcool 70% e posteriormente identificados em nível de espécie. O maior índice de infestação (moscas/fruto de C. capitata ocorreu no município de Altos (3,66, seguido pelos municípios de Teresina e Parnaíba que apresentaram

  11. Development of Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, in laboratory, with different natural diets Desenvolvimento de Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, em laboratório, com diferentes dietas naturais

    Directory of Open Access Journals (Sweden)

    Giani L. B. Missirian

    2006-12-01

    Full Text Available Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp., fruit fly larvae (Anastrepha spp. and Ceratitis capitata and mixed diet (Atta spp. plus fruit fly larvae] on the development of larvae and pupae of M. brasiliensis (Navás, 1914 and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm, the mean weight (mg or the mean body size (mm in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments.Larvas de formiga-leão são conhecidas por suas armadilhas ("funis" que constroem em solo arenoso, sob as quais esperam por suas presas. Este trabalho teve como objetivos verificar o efeito de diferentes dietas naturais [formigas-cortadeiras (Atta spp., larvas de moscas-das-frutas (Anastrepha spp. e Ceratitis capitata e dieta mista (Atta spp. e larvas de moscas-das-frutas] sobre o desenvolvimento larval e pupal de M. brasiliensis (Navás, 1914 e estimar o número e tamanho de presas capturadas, por instar larval, em cada dieta. No segundo e terceiro instares, as larvas de M. brasiliensis alimentadas com formigas-cortadeiras consumiram um número maior de presas e a

  12. Escape of Mexican Fruit Flies from Traps Baited with CeraTrap and Effect of Lure Feeding on Reproduction and Survival.

    Science.gov (United States)

    Perea-Castellanos, Cruz; Pérez-Staples, Diana; Liedo, Pablo; Díaz-Fleischer, Francisco

    2015-08-01

    McPhail type traps are commonly used to catch tephritid pests using liquid baits as attractants. Unfortunately, these traps allow that some flies escape after feeding on the bait. Recently, a long-lasting and nontoxic enzymatic-hydrolyzed protein, known commercially as CeraTrap, has been introduced as a novel liquid bait. Because feeding on hydrolyzed proteins can improve reproduction in many tephritids, questions remain as to whether CeraTrap could provide a nutritious meal to flies that ingest the bait but escape the trap. In this study, we analyzed the efficacy of CeraTrap baited traps in capturing Anastrepha ludens flies of two different physiological states and two different diets. We also explored the effect of feeding on CeraTrap on the mating performance of males, ovarian development and fecundity of females and fly survival. Results demonstrated that CeraTrap attracted more protein-deprived and immature flies of both sexes and 2-30% of flies that entered the trap managed to escape. However, after feeding on the bait for 24 h, males exhibited lower mating success, longer latency to mate and longer copula durations than males fed on either sugar or sugar+ protein. Interestingly, females fed CeraTrap for 24 h developed ovaries as large as those females fed on sugar+ protein, however, they laid no eggs. When feeding continuously on CeraTrap, flies exhibited shorter lifespans and females laid no eggs. These findings indicate that, although some flies can ingest the bait and escape from the trap, their reproductive traits are negatively affected.

  13. Modeling the cost-effectiveness of insect rearing on artificial diets: A test with a tephritid fly used in the sterile insect technique

    Science.gov (United States)

    Birke, Andrea; Williams, Trevor; Aluja, Martín

    2017-01-01

    We modeled the cost-effectiveness of rearing Anastrepha ludens, a major fruit fly pest currently mass reared for sterilization and release in pest control programs implementing the sterile insect technique (SIT). An optimization model was generated by combining response surface models of artificial diet cost savings with models of A. ludens pupation, pupal weight, larval development time and adult emergence as a function of mixtures of yeast, a costly ingredient, with corn flour and corncob fractions in the diet. Our model revealed several yeast-reduced mixtures that could be used to prepare diets that were considerably cheaper than a standard diet used for mass rearing. Models predicted a similar production of insects (pupation and adult emergence), with statistically similar pupal weights and larval development times between yeast-reduced diets and the standard mass rearing diet formulation. Annual savings from using the modified diets could be up to 5.9% of the annual cost of yeast, corn flour and corncob fractions used in the standard diet, representing a potential saving of US $27.45 per ton of diet (US $47,496 in the case of the mean annual production of 1,730.29 tons of artificial diet in the Moscafrut mass rearing facility at Metapa, Chiapas, Mexico). Implementation of the yeast-reduced diet on an experimental scale at mass rearing facilities is still required to confirm the suitability of new mixtures of artificial diet for rearing A. ludens for use in SIT. This should include the examination of critical quality control parameters of flies such as adult flight ability, starvation resistance and male sexual competitiveness across various generations. The method used here could be useful for improving the cost-effectiveness of invertebrate or vertebrate mass rearing diets worldwide. PMID:28257496

  14. Temporal Overlap and Co-Occurrence in a Guild of Sub-Tropical Tephritid Fruit Flies.

    Directory of Open Access Journals (Sweden)

    Gleidyane N Lopes

    Full Text Available Studies of community assembly have emphasized snapshot comparisons of spatially replicated samples from "natural" assemblages. Agro-ecosystems are characterized by relatively little habitat heterogeneity and no dispersal barriers for actively flying insects. Therefore, dynamic patterns of species segregation and aggregation are more likely to reflect the direct or indirect effects of species interactions. We studied the temporal organization of a guild of 21 congeneric species of Anastrepha that colonized fruit orchards in Monte Alegre do Sul, São Paulo, Brazil. This assemblage also included the introduced Mediterranean fruit fly Ceratitis capitata. One hundred six consecutive weekly censuses (11 Jan 2002-16 Jan 2004 of flies in guava, loquat, and peach orchards revealed a pattern of minimum abundance during the coldest months of each year (June and July and a maximum abundance during periods of flowering and fruit ripening. Overall, phenological overlap was greater than expected by chance. However, conditioned on the pattern of seasonal abundances, temporal occurrence and abundance matrices exhibited patterns of significant species segregation and anti-nestedness. In each year, the 3 orchards contained a small number of species pairs that exhibited statistically significant temporal segregation or aggregation. Most aggregated and segregated pairs reflected seasonal shifts in species presences that were not related to variation in air temperature. Most of the significant pairwise associations involved C. capitata: 8 of the 11 segregated pairs and 2 of the 7 aggregated pairs. These results suggest that species interactions between introduced and native species can be an important determinant of species associations in agro-ecosystems.

  15. Nível de infestação de moscas-das-frutas em faixa de fronteira, no Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Naymã Pinto Dias

    2013-08-01

    Full Text Available As moscas-das-frutas são as principais pragas da fruticultura mundial, destacando-se os tefritídeos e os lonqueídeos, sendo que, sobre este último grupo de insetos, existem poucas informações a respeito do seu potencial de danos. O objetivo deste trabalho foi identificar os níveis de infestação de moscas-das-frutas, em municípios da faixa de fronteira do Rio Grande do Sul com a Argentina e o Uruguai. O estudo foi realizado em 2011 e 2012, nos municípios de Itaqui, Quaraí, Santana do Livramento e Uruguaiana, RS. Foram realizadas coletas de frutos de 19 espécies vegetais exóticas e nativas, calculando-se os índices de infestação em pupários/kg de fruto e pupários/fruto. O maior índice de infestação de Ceratitis capitata ocorreu em nectarineira, com 72,01 pupários/kg e 2,51 pupários/fruto. Anastrepha fraterculus apresentou índices elevados em cerejeira, correspondendo a 57,57 pupários/kg e 0,23 pupários/fruto. Os lonqueídeos foram representados pelos gêneros Neosilba e Lonchaea, infestando frutos de mamoeiro e caramboleira, respectivamente. Registra-se para os municípios estudados do Rio Grande do Sul a ocorrência das seguintes espécies de moscas-das-frutas: C. capitata, A. fraterculus, Neosilba zadolicha e Lonchaea sp.

  16. Evaluation of the efficacy of the methyl bromide fumigation schedule against Mexican fruit fly (Diptera: Tephritidae) in citrus fruit.

    Science.gov (United States)

    Hallman, Guy J; Thomas, Donald B

    2011-02-01

    Methyl bromide fumigation is widely used as a phytosanitary treatment. Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), is a quarantine pest of several fruit, including citrus (Citrus spp.), exported from Texas, Mexico, and Central America. Recently, live larvae have been found with supposedly correctly fumigated citrus fruit. This research investigates the efficacy of the previously approved U.S. Department of Agriculture-Animal and Plant Health Inspection Service treatment schedule: 40 g/m3 methyl bromide at 21-29.4 degrees C for 2 h. Tolerance ofA. ludens to methyl bromide in descending order when fumigated in grapefruit (Citrus X paradisi Macfad.) is third instar > second instar > first instar > egg. Two infestation techniques were compared: insertion into fruit of third instars reared in diet and oviposition by adult A. ludens into fruit and development to the third instar. Inserted larvae were statistically more likely to survive fumigation than oviposited larvae. When fruit were held at ambient temperature, 0.23 +/- 0.12% of larvae were still observed to be moving 4 d postfumigation. Temperatures between 21.9 and 27.2 degrees C were positively related to efficacy measured as larvae moving 24 h after fumigation, pupariation, and adult emergence. Coating grapefruit with Pearl Lustr 2-3 h before fumigation did not significantly affect the proportion of third instars moving 24 h after fumigation, pupariating, or emerging as adults. In conclusion, fumigation with 40 g/m3 methyl bromide for 2 h at fruit temperatures >26.7 degrees C is not found to be inefficacious for A. ludens. Although a few larvae may be found moving >24 h postfumigation, they do not pupariate.

  17. Dietas artificiais para a criação de larvas e adultos da mosca-das-frutas sul-americana

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2013-10-01

    Full Text Available O objetivo deste trabalho foi adequar as dietas artificiais para o desenvolvimento dos estágios de larva e adulto da mosca-das-frutas sul-americana (Anastrepha fraterculus. Para o estágio larval, foram testadas as seguintes dietas: D1, original, com 10 g de ágar; D2, modificada, com 3,6 g de ágar; e, D3, modificada, com bagaço seco de cana-de-açúcar. Para os adultos, foram testadas quatro dietas: A, levedura de cerveja + mel (2:1; B, açúcar refinado + extrato de levedura + gérmen de trigo cru (3:1:1; C, extrato de soja + açúcar mascavo + gérmen de trigo cru (3:1:1; e D, levedura seca de cervejaria + mel (2:1. Avaliaram-se os parâmetros biológicos de duração do período ovo-pupa, duração e viabilidade do estágio de pupa, massa média de pupas, razão sexual e duração e viabilidade do período ovo-adulto. O desenvolvimento larval em D1 e D2 foi semelhante e indicou que a criação de larvas pode ser realizada com 1/3 da quantidade de ágar da utilizada em D1. A utilização do bagaço seco de cana-de-açúcar, na dieta artificial, afetou negativamente o desenvolvimento larval. As dietas artificiais com levedura de cerveja + mel e com açúcar refinado + extrato de levedura + gérmen de trigo cru são as mais adequadas para a criação de adultos.

  18. Conserved metallomics in two insect families evolving separately for a hundred million years.

    Science.gov (United States)

    Rempoulakis, Polychronis; Afshar, Negar; Osorio, Beatriz; Barajas-Aceves, Martha; Szular, Joanna; Ahmad, Sohel; Dammalage, Thilakasiri; Tomas, Ulysses Sto; Nemny-Lavy, Esther; Salomon, Mor; Vreysen, Marc J B; Nestel, David; Missirlis, Fanis

    2014-12-01

    Μetal cofactors are required for enzymatic catalysis and structural stability of many proteins. Physiological metal requirements underpin the evolution of cellular and systemic regulatory mechanisms for metal uptake, storage and excretion. Considering the role of metal biology in animal evolution, this paper asks whether metal content is conserved between different fruit flies. A similar metal homeostasis was previously observed in Drosophilidae flies cultivated on the same larval medium. Each species accumulated in the order of 200 µg iron and zinc and approximately ten-fold less manganese and copper per gram dry weight of the adult insect. In this paper, data on the metal content in fourteen species of Tephritidae, which are major agricultural pests worldwide, are presented. These fruit flies can be polyphagous (e.g., Ceratitis capitata) or strictly monophagous (e.g., Bactrocera oleae) or oligophagous (e.g., Anastrepha grandis) and were maintained in the laboratory on five distinct diets based on olive oil, carrot, wheat bran, zucchini and molasses, respectively. The data indicate that overall metal content and distribution between the Tephritidae and Drosophilidae species was similar. Reduced metal concentration was observed in B. oleae. Feeding the polyphagous C. capitata with the diet of B. oleae resulted in a significant quantitative reduction of all metals. Thus, dietary components affect metal content in some Tephritidae. Nevertheless, although the evidence suggests some fruit fly species evolved preferences in the use or storage of particular metals, no metal concentration varied in order of magnitude between these two families of Diptera that evolved independently for over 100 million years.

  19. Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Tiago Ledesma Taira

    2013-09-01

    Full Text Available Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart. Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw. Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping, nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae, and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered, where Doryctobracon areolatus (Szépligeti was the most abundant parasitoid in larvae of tephritids infesting both cultivated and wild host fruits.

  20. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  1. Efeito do ensacamento dos frutos no controle de pragas e doenças e na qualidade e maturação de maçãs 'Fuji Suprema'

    Directory of Open Access Journals (Sweden)

    Rosângela Teixeira

    2011-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de embalagens de diferentes materiais para a proteção contra pragas e doenças e seu efeito sobre a qualidade físico-química, maturação e teor de cálcio (Ca em maçãs 'Fuji Suprema'. O experimento foi desenvolvido nas safras de 2007/2008 e 2008/2009, em pomar manejado sob o sistema orgânico, localizado na região de São Joaquim (SC. O pomar era composto por plantas de dez anos de idade da cultivar Fuji Suprema, sobre porta-enxerto 'Marubakaido', com interenxerto 'EM-9'. Depois do raleio manual, aproximadamente 40 dias após a plena floração, os frutos foram ensacados com embalagens plásticas transparentes microperfuradas ou de tecido não texturizado (TNT. Os frutos foram mantidos ensacados até a colheita. A testemunha foi constituída por frutos não ensacados. Na colheita, os frutos foram avaliados quanto aos danos provocados por mosca-das-frutas (Anastrepha fraterculus, mariposa oriental (Grapholita molesta e lagarta enroladeira (Bonagota salubricola. As doenças foram avaliadas pela incidência de sarna da macieira (Venturia inaequalis, podridão amarga (Colletotrichum gloeosporioides e podridão carpelar (Alternaria sp., Fusarium sp.. Também foi avaliada a incidência de distúrbios fisiológicos "russeting" e "bitter pit", atributos físico-químicos de maturação e qualidade e o teor de Ca nos frutos. Independentemente do tipo de embalagem verificou-se que o ensacamento é prática eficaz na proteção contra o ataque de insetos, mas não reduz a incidência e o desenvolvimento de doenças nos frutos. Na safra de 2008/2009, o ensacamento dos frutos aumentou o teor de Ca e reduziu a incidência de "bitter pit", e aumentou a incidência do "russeting". O ensacamento dos frutos antecipou a maturação, especialmente com embalagem plástica transparente microperfurada, e reduziu a coloração vermelha, especialmente com embalagem TNT.

  2. The gene transformer-2 of Sciara (Diptera, Nematocera and its effect on Drosophila sexual development

    Directory of Open Access Journals (Sweden)

    Ruiz María F

    2011-03-01

    Full Text Available Abstract Background The gene transformer-2, which is involved in sex determination, has been studied in Drosophila, Musca, Ceratitis, Anastrepha and Lucilia. All these members of Diptera belong to the suborder Brachycera. In this work, it is reported the isolation and characterisation of genes transformer-2 of the dipterans Sciara ocellaris and Bradysia coprophila (formerly Sciara coprophila, which belong to the much less extensively analysed Sciaridae Family of the Suborder Nematocera, which is paraphyletic with respect to Suborder Brachycera. Results The transformer-2 genes of the studied Sciara species were found to be transcribed in both sexes during development and adult life, in both the soma and germ lines. They produced a single primary transcript, which follows the same alternative splicing in both sexes, giving rise to different mRNAs isoforms. In S. ocellaris the most abundant mRNA isoform encoded a full-length protein of 251 amino acids, while that of B. coprophila encoded a protein of 246 amino acids. Both showed the features of the SR protein family. The less significant mRNA isoforms of both species encoded truncated, presumably non-functional Transformer-2 proteins. The comparison of the functional Sciara Transformer-2 proteins among themselves and those of other insects revealed the greatest degree of conservation in the RRM domain and linker region. In contrast, the RS1 and RS2 domains showed extensive variation with respect to their number of amino acids and their arginine-serine (RS dipeptide content. The expression of S. ocellaris Transformer-2 protein in Drosophila XX pseudomales lacking the endogenous transformer-2 function caused their partial feminisation. Conclusions The transformer-2 genes of both Sciaridae species encode a single protein in both sexes that shares the characteristics of the Transformer-2 proteins of other insects. These proteins showed conserved sex-determination function in Drosophila; i.e., they were

  3. Purification and partial characterization of an entomopoxvirus (DlEPV from a parasitic wasp of tephritid fruit flies

    Directory of Open Access Journals (Sweden)

    Pauline O. Lawrence

    2002-05-01

    Full Text Available An insect poxvirus [entomopoxvirus (EPV] occurs in the poison gland apparatus of female Diachasmimorpha longicaudata , a parasitic wasp of the Caribbean fruit fly, Anastrepha suspensa and other tephritid fruit flies. The DlEPV virion is 250-300 nm in diameter, has a "bumpy" appearance and a unipartite double stranded DNA genome of 290-300 kb. DlEPV DNA restriction fragment profiles differed from those reported for Amsacta moorei EPV (AmEPV and Melanoplus sanguinipes EPV (MsEPV, the only two EPVs whose genomes have been sequenced, and from those reported for vaccinia (Vac, a vertebrate poxvirus (chordopoxvirus, ChPV. Blast search and ClustalW alignment of the amino acids deduced from the 2316 nucleotides of a DlEPV DNA fragment cloned from an EcoR1 genomic library revealed 75-78% homology with the putative DNA-directed RNA polymerases of AmEPV, MsEPV, and two ChPV homologs of the Vac J6R gene. Of the deduced 772 amino acids in the DlEPV sequence, 28.4% are conserved/substituted among the four poxviruses aligned, 12.9% occur in at least one EPV, 6.5% in at least one ChPV, 3.1 % in at least one EPV and one ChPV, and 49.1% occur only in DlEPV. Although the RI-36-1 fragment represents a portion of the gene, it contains nucleotides that encode the NADFDGDE consensus sequence of known DNA-directed RNA polymerases. Western blots using a mouse polyclonal anti-DlEPV serum recognized six major protein bands in combined fractions of sucrose-purified DlEPV, at least one band in homogenates of male and female wasps, and at least two bands in host hemolymph that contained DlEPV virions. A digoxigenin-labeled DlEPV genomic DNA probe recognized DNA in dot-blots of male and female wasps. These results confirm that DlEPV is a true EPV and probably a member of the Group C EPVs. Unlike other EPVs, DlEPV does not express the spheroidin protein. Since it also replicates in both the wasp and fly, members of two different insect Orders, DlEPV may represent a new EPV

  4. Efecto de la práctica de embolsado sobre la calidad del fruto en feijoa (Acca sellowiana Berg tander

    Directory of Open Access Journals (Sweden)

    Fánor Casierra-Posada

    2011-11-01

    Full Text Available El  cultivo de  feijoa  (Acca  sellowiana Berg.  se ha  extendido  durante  los últimos  años  en  el territorio colombiano, debido a que  la  fruta es muy apetecida en el mercado por las excelentes propiedades  organolépticas.  Sin  embargo,  la cal idad  y  sanidad  exigidas  para  la comercialización  se  ven  afectadas  por  varios factores,  entre  los  que  se  encuentra  el  daño causado  por  la mosca de  la  fruta  (Anastrepha spp..  Por  tanto,  la  evaluación  del  efecto  de embolsado sobre la calidad de la fruta de feijoa es un tema de gran interés. Además, esta técnica es comúnmente usada en guayaba que pertenecea la misma familia que la feijoa (Mirtáceae. Para el estudio, se embolsaron flores en el momento de  la caída de pétalos, y cada semana después hasta  cuat ro  semanas.   Los  frutos  que  se embolsaron a la caída de pétalos detuvieron su crecimiento; aquellos embolsados una, dos y tres semanas  después  de  la  caída  de  pétalos  no reportaron diferencias significativas en cuanto los parámetros  evaluados  (peso  fresco,  peso  seco, diámetro transversal y  longitudinal, intensidad de infestación,  sólidos  solubles  totales  y  acidez titulable Los frutos embolsados cuatro semanas después de la caída de pétalos fueron de mayor peso,  tamaño y más dulces con  respecto a  los demás. La efectividad en el control de mosca de la  fruta  fue evidente. El embolsado, además de mejorar la sanidad del fruto,  influyó en su calidad y permitió obtener un producto con características adecuadas para el mercado.