
Sample records for anastrepha ludens diptera

  1. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico. (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José


    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  2. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico. (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M


    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  3. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications. (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N


    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  4. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars. (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín


    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack.

  5. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)


    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  6. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils. (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin


    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  7. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'. (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J


    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  8. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards. (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco


    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  9. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico. (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel


    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  10. Evaluating the quality of the Mexican fruit-fly, Anastrepha ludens, as host for the parasitoid Melittobia digitata

    Directory of Open Access Journals (Sweden)

    J.M. González


    Full Text Available We investigated the presence of Melittobia digitata (Hymenoptera: Eulophidae and its associations with its natural hosts in Veracruz, Mexico. The parasitoid was confirmed to be present and found to attack prepupae of Trypoxylon and Sceliphron (Hymenoptera: Crabronidae and Sphecidae, respectively mud daubers as well as pupae of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae. Since A. ludens is a very important pest of citrus and mango in Mexico and Central America, we evaluated, in laboratory experiments, the quality of A. ludens as host of M. digitata comparing the development of the parasitoid in another unrelated fly species (Sarcophaga [Neobellieria] bullata (Diptera: Sarcophagidae and in mud dauber wasps (Trypoxylon sp. and Sceliphron sp.. The Mexican fruit fly appears to be a good-quality host for M. digitata, and the results are discussed in the context of their possible interest as a natural enemy of A. ludens.

  11. Limits to the host range of the highly polyphagous tephritid fruit fly Anastrepha ludens in its natural habitat. (United States)

    Birke, A; Acosta, E; Aluja, M


    Anastepha ludens (Diptera: Tephritidae) is a highly polyphagous fruit fly that is able to develop in a wide range of hosts. Understanding the limits of this pest's host range could provide valuable information for pest management and plant breeding for pest resistance. Previous studies have shown that guavas (Psidium guajava (Myrtaceae) L.), are not attacked under natural conditions by A. ludens. To understand this phenomenon, guavas were exposed to natural infestation by A. ludens and to other fruit fly species that infest guavas in nature (Anastrepha striata Schiner, Anastepha fraterculus (Wiedemann), Anastepha obliqua (Macquart)). Once the susceptible phenological stage of guavas was determined, fruit infestation levels were compared between A. ludens and A. striata. Choice and non-choice tests were performed under field-cage conditions. Under field conditions, guavas were susceptible to A. striata and A. fraterculus attack all the way from when fruit was undeveloped to when fruit began to ripen. No infestation by A. ludens was recorded under natural conditions. Similar results were obtained when forced exposures were performed, indicating that unripe guavas were preferred by A. striata over ripe fruit, and that infestation rates were higher at early fruit maturity stages. Under forced oviposition conditions, A. ludens larvae were unable to develop in unripe guavas but did so in fully ripe fruit. However, A. ludens fitness parameters were dramatically affected, exhibiting reduced survival and reduced pupal weight compared to conspecifics that developed in a natural host, grapefruit. We confirm that P. guajava should not be treated as a natural host of this pestiferous species, and suggest that both behavioral aspects and the fact that larvae are unable to adequately develop in this fruit, indeed represent clear limits to A. ludens's broad host range.

  12. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses. (United States)

    Orozco-Dávila, Dina; Adriano-Anaya, Maria de Lourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel


    A genetic sexing strain of Anastrepha ludens (Loew), Tapachula-7, was developed by the Mexican Program Against Fruit Flies to produce and release only males in programs where the sterile insect technique (SIT) is applied. Currently, breeding are found at a massive scale, and it is necessary to determine the optimum irradiation dose that releases sterile males with minimum damage to their sexual competitiveness. Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild females and offspring survivorship. The results of the study indicate that irradiation doses have a significant effect on the sexual behavior of males. A reduction of mating capacity was inversely proportional to the irradiation dose of males. It is estimated that a dose of 60 Gy can induce more than 99% sterility in wild females. In all treatments, the degree of offspring fertility was correlated with the irradiation dose of the parents. In conclusion, the results of the study indicate that a dose of 60 Gy can be applied in sterile insect technique release programs. The application of this dose in the new genetic sexing strain of A. ludens is discussed.

  13. Selection by mating competitiveness improves the performance of Anastrepha ludens males of the genetic sexing strain Tapachula-7. (United States)

    Quintero-Fong, L; Toledo, J; Ruiz, L; Rendón, P; Orozco-Dávila, D; Cruz, L; Liedo, P


    The sexual performance of Anastrepha ludens males of the Tapachula-7 genetic sexing strain, produced via selection based on mating success, was compared with that of males produced without selection in competition with wild males. Mating competition, development time, survival, mass-rearing quality parameters and pheromone production were compared. The results showed that selection based on mating competitiveness significantly improved the sexual performance of offspring. Development time, survival of larvae, pupae and adults, and weights of larvae and pupae increased with each selection cycle. Differences in the relative quantity of the pheromone compounds (Z)-3-nonenol and anastrephin were observed when comparing the parental males with the F4 and wild males. The implications of this colony management method on the sterile insect technique are discussed.

  14. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits. (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani


    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  15. Long aculeus and behavior of Anastrepha ludens render gibberellic acid ineffective as an agent to reduce 'ruby red' grapefruit susceptibility to the attack of this pestiferous fruit fly in commercial groves. (United States)

    Birke, Andrea; Aluja, Martín; Greany, Patrick; Bigurra, Everardo; Pérez-Staples, Diana; McDonald, Roy


    Treating Mexican grapefruit with gibberellic acid (GA3) before color break, significantly delayed peel color change and increased peel puncture resistance, but it did not reduce grapefruit susceptibility to Mexican fruit fly, Anastrepha ludens (Loew) attack under natural conditions. Despite GA3 treatments, larval infestation levels increased with higher fruit fly populations, which also increased as the season progressed. Late in the season, infestation levels were even higher in GA3-treated fruit compared with untreated fruit, possibly because treated fruit were in better condition at that stage. Egg clutch size was significantly greater in very unripe, hard, GA3-treated fruit at the beginning of the harvest season and in December, compared with control fruit. Under laboratory conditions, egg injection into different regions of the fruit suggested that A. ludens eggs are intoxicated by peel oil content in the flavedo region. However, A. ludens' long aculeus allows females to oviposit eggs deeper into the peel (i.e., albedo), avoiding toxic essential oils in the flavedo. This makes A. ludens a particularly difficult species to control compared with other citrus-infesting species such as Anastrepha suspensa (Loew), Anastrepha fraterculus (Wiedemann), and Ceratitis capitata (Wiedemann) (fly species with significantly shorter aculei), which can be effectively managed with GA3 sprays. We discuss our findings in light of their practical implications and with respect to the oviposition behavior of various fruit flies attacking citrus.

  16. Can consumption of antioxidant rich mushrooms extend longevity?: antioxidant activity of Pleurotus spp. and its effects on Mexican fruit flies' (Anastrepha ludens) longevity. (United States)

    Sánchez, José E; Jiménez-Pérez, Gabriela; Liedo, Pablo


    The variability of antioxidant capacity of 14 strains of the edible oyster mushroom Pleurotus spp. was determined, and the effect of selected mushroom supplements on the longevity of the Mexican fruit fly, Anastrepha ludens, was evaluated. The antioxidant capacity of the fruiting bodies was determined by three different methods, measuring the free radical scavenging activity of methanolic extracts, the OH radical scavenging capacity, and the total phenol content. The inhibition percentage of the DPPH radical varied between 32.6 and 85.7% and total phenols varied between 30.6 and 143.3 mg/g. The strains with the highest (Pleurotus djamor ECS-0142) and lowest (Pleurotus ostreatus ECS-1123) antioxidant capacity were selected to study their effect on the survival, life expectancy, and mortality of the Mexican fruit fly A. ludens. The results demonstrated differing responses between male and female flies. High concentrations of mushrooms (5 and 20%) in the diet resulted in a decrease in life expectancy. However, flies on the diet with 1% P. djamor ECS-0142 showed slightly but significantly greater survival than those on the control diet. The possible adverse effect of protein content in mushroom extracts is discussed.

  17. Ammonia Formulations and Capture of Anastrepha Fruit Flies (Diptera: Tephritidae) (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted in numbers to protein baits. Synthetic lures based on the principle components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important ...

  18. New mariner elements in Anastrepha species (Diptera: Tephritidae). (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L


    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  19. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder


    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  20. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key. (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio


    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  1. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae) (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  2. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato


    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  3. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)


    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  4. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae). (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L


    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus.

  5. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae). (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A


    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  6. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae) (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  7. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha


    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study

  8. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae) (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  9. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  10. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant. (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  11. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees. (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M


    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap.

  12. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz


    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate

  13. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli


    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain

  14. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source



    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  15. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas


    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  16. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures. (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R


    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  17. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia


    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  18. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla


    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  19. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia. (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma


    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  20. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  1. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini


    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  2. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae). (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David


    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  3. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo


    Full Text Available ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae is recorded for the first time parasitizing Anastrepha obliqua (Macquart (Diptera: Tephritidae in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae in Brazil.

  4. Tetrastichus giffardianus on pupae of Anastrepha in Brazil


    Almerinda Amélia Rodrigues Araújo; Paulo Roberto Ramalho Silva; Ranyse Barbosa Querino Silva; Elizangela Pereira da Silva Sousa


    ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae) is recorded for the first time parasitizing Anastrepha obliqua (Macquart) (Diptera: Tephritidae ) in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae) in Brazil.

  5. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  6. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  7. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica



    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  8. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira


    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  9. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García


    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  10. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.


    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  11. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr


    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  12. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences. (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson


    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  13. Evaluation of the efficacy of the methyl bromide fumigation schedule against Mexican fruit fly (Diptera: Tephritidae) in citrus fruit. (United States)

    Hallman, Guy J; Thomas, Donald B


    Methyl bromide fumigation is widely used as a phytosanitary treatment. Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), is a quarantine pest of several fruit, including citrus (Citrus spp.), exported from Texas, Mexico, and Central America. Recently, live larvae have been found with supposedly correctly fumigated citrus fruit. This research investigates the efficacy of the previously approved U.S. Department of Agriculture-Animal and Plant Health Inspection Service treatment schedule: 40 g/m3 methyl bromide at 21-29.4 degrees C for 2 h. Tolerance ofA. ludens to methyl bromide in descending order when fumigated in grapefruit (Citrus X paradisi Macfad.) is third instar > second instar > first instar > egg. Two infestation techniques were compared: insertion into fruit of third instars reared in diet and oviposition by adult A. ludens into fruit and development to the third instar. Inserted larvae were statistically more likely to survive fumigation than oviposited larvae. When fruit were held at ambient temperature, 0.23 +/- 0.12% of larvae were still observed to be moving 4 d postfumigation. Temperatures between 21.9 and 27.2 degrees C were positively related to efficacy measured as larvae moving 24 h after fumigation, pupariation, and adult emergence. Coating grapefruit with Pearl Lustr 2-3 h before fumigation did not significantly affect the proportion of third instars moving 24 h after fumigation, pupariating, or emerging as adults. In conclusion, fumigation with 40 g/m3 methyl bromide for 2 h at fruit temperatures >26.7 degrees C is not found to be inefficacious for A. ludens. Although a few larvae may be found moving >24 h postfumigation, they do not pupariate.

  14. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape. (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D


    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  15. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)



    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  16. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano


    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  17. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix


    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com

  18. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (Diptera;Tephritidae) (United States)

    Lures based on odors released by hydrolyzed protein were assessed for their attractiveness to Anastrepha obliqua and A. suspensa at three locations in Puerto Rico in August through October 2009. Lures compared included ammonium acetate combined with putrescine, hydrolyzed corn protein (Nulure) with ...

  19. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico (United States)

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua and A. suspensa at four sites in Guánica, Puerto Rico; one forest fragment in Ponce, Puerto Rico; in a commercial mango orchard in Guayanilla, PR; and an experimental carambola orcha...

  20. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico. (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo


    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  1. Response of Anastrepha suspensa (Diptera: Tepritidae) to white and brown cane, coconut, date, date jaggery and panela sugar solutions with varying degrees of fermentation (United States)

    We measured the EAG response of Anastrepha suspensa (Loew), the Caribbean fruit fly to six different sugars (white and brown cane, coconut, date, date jaggery and panela sugars). Wild and lab female flies of different physiological states (immature and mature) were tested in dry crystals and 10% su...

  2. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  3. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel


    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.


    Directory of Open Access Journals (Sweden)

    Wilson Carlos Pazini


    Full Text Available The population monitoring of agricultural pests is an important tool to select the best control methodto be employed in a determined culture. Thus, the objective of this research was analyze the population fluctuation of Anastrepha spp. correlated with the mango tree phenology and the meteorological elements, temperature, relative humidity and pluviometric precipitation. The study was conducted between Mach 2009 to August 2010 in Jaboticabal, SP. For Anastrepha spp. monitoring, we randomly installed five yellow stick traps in an experimental orchard composed by a collection of mango varieties. These traps were replaced every fifteen days and carried to the Laboratory of Ecological Selectivity of the Department of Plant Protection (FCAV/UNESP to evaluate the sampled specimens. The meteorological data were recorded at the FCAV/UNESP Meteorological Station, located approximately 200 m from the study area. The results showed that the greater and more consistent Anastrepha spp. population density is between the spring and summer seasons, particularly related to the mature fruits. A weak positive correlation is observed between maximum temperature (°C and relative humitidy (% when compared with the Anastrepha spp. population density. There is moderate positive correlation between minimum and medium temperatures (°C and accumuluted pluviometric precipitation (mm when compared with the said agricultural pest.O monitoramento populacional de insetos considerados pragas agrícolas constitui uma importante ferramenta para a escolha do melhor método de controle a ser empregado em determinada cultura. Desta forma, o objetivo desta pesquisa foi analisar a flutuação populacional de Anastrepha spp. correlacionada com a fenologia da mangueira e com os elementos meteorológicos, temperatura, umidade relativa e precipitação pluviométrica. O estudo foi desenvolvido no período entre março de 2009 a agosto de 2010 no município de Jaboticabal, SP. Para o

  5. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio


    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  6. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region


    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio


    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  7. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais


    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  8. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia


    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  9. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)


    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  10. Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype. (United States)

    Hernández-Ortiz, V; Gómez-Anaya, J A; Sánchez, A; McPheron, B A; Aluja, M


    Discriminant function and cluster analyses were performed on 19 morphometric variables of the aculeus, wing and mesonotum to determine whether populations of Anastrepha fraterculus (Wiedemann) from different parts of Mexico could be distinguished from populations from South America. Samples were collected from seven localities across Mexico, two from Brazil, and one each from Colombia and Argentina. Results showed there were statistically significant differences between Mexican and South American populations with respect to the aculeus (tip length, length of serrated section, mean number of teeth) and wing (width of S-band and connection between S- and V-bands). The degree of morphological variation observed among Mexican populations was extremely low, and as a consequence, the Mexican populations were identified as a single morphotype by discriminant analysis. The 'Andean morphotype'consisting of the Colombian population, and the 'Brazilian morphotype'consisting of the two Brazilian populations plus the single Argentinian population were also distinguished. It was concluded that the macro-geographical morphotypes from Mexico, Colombia, and Brazil plus Argentina correspond to three distinct taxonomic entities. Comparisons of results with those obtained from behavioural, karyotypic, isozyme and DNA studies suggest that sufficient evidence now exists to name a new Mexican species from within the A. fraterculus complex. This will be done in a separate publication. A provisional key to the morphotypes of A. fraterculus studied is provided.

  11. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    E. Foelkel

    Full Text Available Abstract Entomopathogenic nematodes (EPNs are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  12. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae) (United States)

    Costa, M. L. Z.; Pacheco, M. G.; Lopes, L. A.; Botteon, V. W.; Mastrangelo, T.


    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata. Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata. The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. PMID:27638956

  13. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae). (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L


    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  14. Mexican fruit fly (Diptera: tephritidae) and the phenology of its native host plant, Yellow Chapote (Rutaceae) in Mexico (United States)

    In northeastern Mexico, the Mexican fruit fly, Anastrepha ludens (Loew), breeds on its native host, yellow chapote, Casimiroa greggii (Wats.), which typically produces fruit in the spring. Peak populations of the fly occur in late spring or early summer when adults emerge from the generation of lar...

  15. A safe and effective propylene glycol based capture liquid for fruit fly (Diptera: Tephritidae) traps baited with synthetic lures (United States)

    Antifreeze is often used as the capture liquid in insect traps for its preservation and evaporation attributes. In tests reported herein, fruit fly traps using non-toxic household propylene glycol based antifreeze captured significantly more Anastrepha ludens than did traps with the automotive anti...

  16. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder


    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  17. Selection of artificial hosts for oviposition by wild Anastrepha obliqua (Macquart (Diptera, Tephritidae: influence of adult food and effect of experience Seleção de hospedeiros artificiais para oviposição por Anastrepha obliqua (Macquart (Diptera, Tephritidae selvagem: influência do alimento do adulto e efeito da experiência

    Directory of Open Access Journals (Sweden)

    Thamara A. B. S. Leal


    Full Text Available Several factors influence the selection of oviposition substrates by insects. The aim of the present work was to find answers to the following questions related to the oviposition behavior of Anastrepha obliqua. Can carbohydrates (glucose or sucrose present in the adult diet have influence on the female preference for an oviposition substrate with similar composition? Can the previous experience with a host containing one of mentioned carbohydrates interfere in further selection of oviposition substrates? The results showed that the kind of carbohydrate present in the adult diet did not affect the female preference for an artificial oviposition substrate, neither when it was presented by itself nor in combination with brewer's yeast. The effect of experience in the oviposition behavior was observed when there was a previous contact with artificial oviposition substrates containing yeast and sucrose. The data are discussed in terms of the behavioral plasticity presented by this species in relation to feeding and oviposition behaviors.Vários fatores podem atuar durante a seleção de substratos para oviposição por insetos. O presente estudo teve por objetivo responder às seguintes questões relacionadas ao comportamento de oviposição de Anastrepha obliqua. O carboidrato presente na dieta do adulto (glicose ou sacarose pode influenciar a preferência da fêmea por um substrato para oviposição com composição semelhante? A experiência prévia com um hospedeiro que possui um dos dois carboidratos citados pode interferir em escolhas futuras entre substratos para oviposição? Os resultados indicaram que o tipo de carboidrato presente na dieta do adulto não exerceu influência sobre a preferência das fêmeas por um substrato artificial para oviposição, tanto quando em combinação com lêvedo de cerveja ou quando sozinho. O efeito da experiência no comportamento de oviposição foi notado quando o contato prévio foi com substratos

  18. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia


    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  19. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (United States)

    Different lures based on hydrolyzed protein products were assayed in the field for their ability to attract Anastrepha suspensa and A. obliqua (Diptera: Tephritidae). Typically, ammonium acetate with putrescine and freeze-dried NuLure with ammonium acetate and putrescine attracted more flies than ot...

  20. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Calore


    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..


    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha


    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI:


    Directory of Open Access Journals (Sweden)



    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  3. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut


    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  4. Viability of Cabralea canjerana extracts to control the South American fruit fly, Anastrepha fraterculus. (United States)

    Magrini, Flaviane Eva; Specht, Alexandre; Gaio, Juliano; Girelli, Cristiane Priscila; Migues, Ignacio; Heinzen, Horacio; Sartori, Valdirene Camatti; Cesio, Veronica


    Several representatives of Meliaceae contain biologically active compounds that are toxic to insects with few negative effects on the environment and humans. Our study evaluated the activity of ethyl acetate and ethanol extracts from the fruit and seeds of Cabralea canjerana (Vellozo) Mart (Sapindales: Meliaceae) on Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae). Limonoids and triterpenes were detected in fruit and seed extracts. Each extract was added to an artificial diet at three concentrations and tested after 24, 48, and 72 hr of extract application. Ethyl acetate extracts were the most active ones and showed the effect of both dose and time elapses after application on the insects. The highest toxic effect on A. fraterculus adults was from ethyl acetate extracts from fruit, followed by extracts from seeds. These extracts showed antifeedant activities. Extract solutions sprinkled on fruits of Carica papaya (L.) (Brassicales: Caricaceae) caused oviposition repellency and negatively affected the biological development of A. fraterculus. Ethyl acetate extracts highly hampered oviposition, but seed extracts showed lesser oviposition deterrence. The fruit and seed extracts diminished pupal viability. Particularly, the ethyl acetate fruit extract caused malformed adults. The sex ratio was also affected, resulting in female predominance for the fruit extract, while the seed extract showed a dose-dependent effect. Low doses caused male abundance, but at higher concentrations the effect was reversed. These encouraging results showed that the C. canjerana extracts have great potential as new tools to be used in integrated pest management programs to protect fruits against A. fraterculus.

  5. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico. (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo


    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control.

  6. Homo Ludens Revisited: Huizinga y el deporte moderno

    Directory of Open Access Journals (Sweden)

    Gastaldo, Edison


    Full Text Available En este artículo me gustaría proponer una lectura del fenómeno del deporte contemporáneo, desde la perspectiva del magistral Homo Ludens, obra del filósofo holandés publicado originalmente en 1938. Para esto, después de una breve presentación del autor y su obra, se exploran algunas condiciones de posibilidad de la existencia del principio del juego en el deporte moderno. Para Huizinga, el "espíritu del juego" encabeza las principales manifestaciones de la cultura humana en todas las épocas y sociedades. Sin embargo, este principio se estaría pervirtiendo en el mundo moderno, donde el trabajo asume aspectos de un juego (el ganar de los concurrentes, vencer el récord de las ventas y el mundo del juego asume el carácter de trabajo (atletas profesionales, negocios, contratos, patrocinadores. ¿Como pensaría la perspectiva humanista y libertaria de Huizinga sobre el juego el mundo de los deportes contemporáneos? O, dicho de otro modo, ¿hay espacio para la práctica de ocio creativo y humanización en el mundo del deporte?

  7. Tapachula-7, a new genetic sexing strain of the Mexican fruit fly (Diptera: Tephritidae): sexual compatibility and competitiveness. (United States)

    Orozco, Dina; Meza, J Salvador; Zepeda, Silvia; Solís, Eduardo; Quintero-Fong, J Luis


    A new genetic sexing strain of the Mexican fruit fly, Anastrepha ludens (Loew), was evaluated in tests of sexual behavior to determine its possible application using the sterile insect technique. Tests in field cages measuring time to sexual maturity, compatibility with wild flies, and competitiveness were compared between the genetic sexing strain, Tapachula-7, and the mass-reared standard bisexual strain. The results indicated that the onset of sexual maturity was similar for both laboratory strains. Males from the Tapachula-7 strain do not differ from the standard bisexual strain in compatibility and competitiveness with wild insects. The results indicate that the release of Tapachula-7 males in the field would be viable in programs that use the sterile insect technique for the control of the Mexican fruit fly.

  8. Distribution of Anastrepha spp. in carambola orchards: Evidence for migration (United States)

    Carambola orchards in Juana Diaz, Corozal, and Isabela, PR, were monitored for Anastrepha spp. fruit flies using Multi-lure traps baited with putrescine and ammonium acetate. The number of flies at various locations within the orchards were statistically compared with the expected distribution if fl...

  9. Evaluation of the Host Status of Mature Green Papayas 'Maradol' for the Mexican Fruit Fly (Diptera: Tephritidae). (United States)

    Arredondo, José; Ruiz, Lia; Díaz-Fleischer, Francisco


    The suitability of mature green 'Maradol' papaya as a host of Anastrepha ludens (Loew) was studied under field and laboratory conditions. Field tests were conducted on commercial-ripened and spot-ripened fruit in two orchards and during two seasons in the state of Chiapas. Fruits at exportation ripeness are in "commercial ripeness", while fruits that are harvested immediately preceding exportation ripeness are in "spot ripeness." The field tests consisted of forced infestation experiments that evaluated papayas at two ripeness stages: the commercial- or exportation-ripened fruit (green fruits with one or two yellow stripes) and fruit before exportation ripeness called "spot ripeness." These tests were conducted in two orchards and during two seasons in the state of Chiapas, Mexico. Laboratory trials were performed with commercial-ripened fruit only. Fruit from four different postharvest periods (3, 24, 48, and 72 h) were exposed to groups of gravid flies. No larvae emerged from the fruit that was collected in the field experiments. However, some larvae and several fertile flies were obtained from the commercial-ripened fruit 72 h postharvest but not 3, 24, and 48 h postharvest in the laboratory. The results of this study indicate that the commercially ripe fruits of papaya Maradol were resistant to or free from infestation of A. ludens flies under field conditions, though these fruits must be considered nonnatural, conditional host because they became infested in the laboratory.

  10. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo


    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  11. The temporal pattern of mating behavior of the fruit fly, Anastrepha zenildae in the laboratory. (United States)

    Almeida, Lucia M de; Araújo, Arrilton; Mendes, Norma H D; Souza, João M G A de; Menezes, Alexandre A L


    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00-19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5-6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5-7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5-163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation.

  12. Ammonium Acetate and Ammonium Bicarbonate in Traps for Anastrepha Fruit Flies (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Anastrepha s...

  13. 墨西哥按实蝇在我国的适生性分析%Analysis of the suitability of Mexican fruit fly, Anastrepha ludens in China

    Institute of Scientific and Technical Information of China (English)

    耿建; 李志红; 万方浩; 王之岭



  14. Biodemography of a long-lived tephritid: Reproduction and longevity in a large cohort of female Mexican fruit flies, Anastrepha ludens (United States)

    Carey, James R.; Liedoc, Pablo; Muüller, Hans-Georg; Wang, Jane-Ling; Senturke, Damla; Harshman, Lawrence


    Age of sexual maturity, daily and lifetime reproductive rates, and life span were recorded in a laboratory cohort of Mexican fruit flies consisting of over 1100 females maintained individually. The results revealed that, relative to the medfly, the Mexfly is slower maturing (14 vs 17 days), more fecund (1400 vs 650–1100 eggs/female), and longer lived (50 vs 35 days). The results reinforced the generality of several earlier findings on the medfly including the deceleration of mortality at older ages and the weakness of the correlation between the rate of egg laying at early ages and both subsequent reproduction and remaining longevity. Discussion includes perspectives on the role of artificial selection in shaping the demographic traits of the mass-reared strain of Mexfly used in this study, as well as the overall significance of large scale biodemographic studies in understanding aging and longevity. PMID:16154309

  15. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael


    Full Text Available 1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponderante. 3. Las moscas Anastrephas constituyen la plaga más importante de la fruticultura nacional, y por esta razón, un estudio sobre estos insectos es un tema de importancia. 4. Las principales "moscas de las frutas" pertenecen dentro de la familia Trypetidae, a los géneros: Dacus, Rhaglethis, Ceratitis, Dactrocera y Anastrepha. 5. Los nombres comunes con que se conocen las moscas Anastrephas varían de un país a otro y se relacionan particularmente con el lugar de origen de las distintas especies o la fruta determinada como preterida por la mosca en una localidad. En Colombia la denominación vernácula más difundida es la de "gusano de las frutas". También se nombra el insecto como "mosca o gusano del mango" o "gusano de la guayaba". 6. Los nombres científicos de las moscas distinguen a una, gran cantidad de especies. En Colombia, varios autores han reportado la existencia de las especies A.fraterculus, A. ludens, A. mombinpracoptans, A. pikeli y A. serpentina. Todas estas especies inciden en las regiones colombianas comprendidas entre 0 y 2000 metros de altura, es decir, en casi todas las regiones agrícolas importantes (frutales, café, cacao de temperaturas entre 14° y 30° C. 7. Las moscas Anastrephas están confinadas casi exclusivamente al continente americano entre las latitudes 27° N. y 35° S. Particularmente, la especie A. fraterculus, una de las más difundidas en Colombia, fué determinada por Wiedemann (1830


    Directory of Open Access Journals (Sweden)

    Ezequiel da Glória de Deus


    Full Text Available As moscas-das-frutas (Diptera: Tephritidae estão entre as principais pragas da agricultura mundial, sendo motivo de preocupação especialmente para países tropicais em desenvolvimento, os quais têm na fruticultura um importante componente de sua balança comercial. Esta revisão tem por objetivo compilar informações geradas nos últimos 10 anos sobre moscas-das-frutasno estado do Amapá, com ênfase em distribuição, hospedeiros e parasitoides. Além disso, visa indicar as prioridades de pesquisa para os próximos anos.No estado do Amapá, os estudos com moscas-das-frutas e seus inimigos naturais apresentaram, nos últimos anos, significativo crescimento. Atualmente, além Bactrocera carambolae, estão assinaladas para o Estado 34 espécies de Anastrepha. Anastrepha distincta, Anastrepha coronilli, Anastrepha fraterculus e Anastrepha striata são as espécies mais amplamente distribuídas. Estão assinaladas para o estado 37 espécies vegetais hospedeiras (pertencentes a 19 famílias botânicas de moscas-das-frutas. Anastrepha striata é espécie mais polífaga, estando associada a 25 hospedeiros. Nove espécies de parasitoides específicos de moscas-das-frutas estão registrados, sendo Doryctobracon areolatuso mais abundante. Apesar do significativo avanço, novos estudos sobre biologia, genética, ecologia, distribuição e dispersão populacional, bem como fatores reguladores dos níveis populacionais são necessários, com vista a desenvolver estratégias de controle menos onerosas com efeitos não nocivos ao ambiente. Palavras-chave: Anastrepha, Bactrocera carambolae, parasitoides, Amazônia. DOI:

  17. Survey of ear flies (Diptera, Ulidiidae in maize (Zea mays L. and a new record of Euxesta mazorca Steyskal in Brazil

    Directory of Open Access Journals (Sweden)

    Ivan Cruz


    Full Text Available Survey of ear flies (Diptera, Ulidiidae in maize (Zea mays L. and a new record of Euxesta mazorca Steyskalin Brazil. Species of Euxesta (Diptera, Ulidiidae, known as silk flies or ear flies, are becoming increasingly important as maize insect pests in South America, although very little is known about them in Brazil. The larvae of some species of this genus initially damage female reproductive tissues, and then the developing kernels on the ear. As a result of feeding, fermentation and associated odors cause complete loss of the grain because it is no longer fit for human or livestock consumption. The main objective of this work was to evaluate the incidence of Euxesta spp. in Brazilian maize fields and to determine the most prevalent species using two different hydrolyzed protein foods attractants, BioAnastrepha® (hydrolyzed maize protein and Torula, placed inside McPhail traps. The two species identified were E. eluta Loew and E. mazorca Steyskal, the latter being a new record from Brazil. Between the two species, E. eluta was the more abundant in maize fields. Both attractants were efficient in capturing the two species. However, BioAnastrepha® captured significantly more insects than Torula.

  18. Morphological characterization of the reproductive system of irradiated Anastrepha fraterculus

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Andrea, E-mail: [Instituto de Sanidad y Calidad Agropecuaria de Mendoza (ISCAMEN), Mendoza (Argentina); Vera, M. Teresa [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), (Argentina); Yusef, Veronica [Comision Nacional de Energia Atomica (Argentina). Centro Atomico Ezeiza; Oviedo, Andrea [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)


    Field identification of released sterile insects is a major issue for eradication and suppression programs. Irradiated flies are normally identified by the presence of a fluorescent dye. When a fly lacks fluorescent dye, determination of gonadal state is necessary to identified between sterile or fertile flies. This is particularly relevant when population levels have decreased. Animal and identification is required to be as unequivocal as possible. Here we describe the reproductive system of irradiated Anastrepha fraterculus of different ages and we compare it with that of fertile flies in order to provide a diagnosis tool. Fertile and irradiated A. fraterculus were dissected from the day of emergence and until 15 days of age. Gross morphology was described and the gonads were measured. Germ cells were visualized in the testis. The reproductive systems of both males and females contained the same structures as other Anastrepha species. From day 1 to day 3, there were no detectable differences between irradiated and fertile males. The growing region encompassed half the testis total length and there was no free sperm in the seminal vesicle. On day 4 the presence of free sperm was seen in the seminal vesicle. At this stage irradiated males started differentiating from fertile ones: the growing region reduced in size and totally disappeared by day 11; sperm bundle zones occupied most of the testis; spermatids lost their triangular shape and sperm remained in the seminal vesicle without moving into the apical region. Testis length and width of irradiated males did not differ from fertile males. In females, the maturation of the ovaries involved a change in size that was more pronounced in the length of the ovary. This became noticeable at day 3. At this stage, the formation of yolk and the basal follicle began in fertile females and the oocyte had the same size as the trophocytes. From this point, the oocyte started growing. After day 8, the maturing oocyte reached

  19. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae) (United States)

    Mascarenhas, Rodrigo O; Prezotto, Leandro F; Perondini, André Luiz P; Marino, Celso Luiz; Selivon, Denise


    Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids. PMID:27648768

  20. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae and parasitoid wasps (Braconidae

    Directory of Open Access Journals (Sweden)

    Rodrigo O Mascarenhas

    Full Text Available Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

  1. Insecticidal activity of raw ethanolic extracts from Magnolia dealbata Zucc on a tephritid pest. (United States)

    Flores-Estévez, Norma; Vasquez-Morales, Suria G; Cano-Medina, Tomás; Sánchez-Velásquez, Lázaro R; Noa-Carrazana, Juan C; Díaz-Fleischer, Francisco


    Ethanolic extracts from Magnolia dealbata (Zucc.) (Magnoliaceae); leaves, bark, seeds, sarcotesta and flowers were evaluated for insecticidal activity against adults of the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae). Using feeding bioassays composed from sugar-extract mixtures, only the extract from sarcotesta indicated insecticidal activity against the flies. The extracts from the other four plant tissues (leaves, bark, seeds and flowers) did not manifest any biological activity. The most effective extract was obtained from oven-dried sarcotesta, whereas extracts from fresh sarcotesta were inactive. Our results suggest that M. dealbata sarcotesta contains secondary metabolites with insecticidal activity against A. ludens adults. These metabolites are as potent as natural pyrethins and represent a potential substance for controlling this type of pest.

  2. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages. (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa


    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  3. Mexican Fruit Fly Populations in the Semi-Arid Highlands of the Sierra Madre Oriental in Northeastern Mexico. (United States)

    Vanoye-Eligio, V; Mora-Olivo, A; Gaona-García, G; Reyes-Zepeda, F; Rocandio-Rodríguez, M


    The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most important pests of citrus in Mexico. We report the results of an analysis of A. ludens populations that inhabit the semi-arid highlands of the Sierra Madre Oriental in northeastern Mexico. This study aimed to provide information on population fluctuation of A. ludens and how it relates to climate variables, as well as insights into habitat and native parasitoids. Population peaked in the period July-November when ripe fruits of the wild host, Casimiroa pubescens Ramírez, were available. No adults were captured the rest of the year, suggesting that high populations depend on the availability of wild host fruit. No significant relationships between population fluctuation and climatic variables were observed, except for minimum temperature. Fruit samples of citron (Citrus medica L.), pomegranate (Punica granatum L.), and C. pubescens were collected to determine degree of infestation. Infestation levels (pupae/g) ranged between 0.0006 for citron, 0.0047 for pomegranate, and 0.0240 for C. pubescens. A native parasitoid of Tephritidae, Doryctobracon crawfordii (Viereck) (Braconidae), was identified. Parasitism percentage was calculated at 12.5% on C. pubescens fruits. No parasitoids were observed on citron or pomegranate fruit samples. These results contribute to knowledge on behavior of A. ludens native to temperate environments where no commercial hosts are available. Further research on host expansion of this pest in light of scenarios of global climate change is suggested.

  4. Electroantennogram response and attraction of Anastrepha suspensa to volatiles of various sugar sources and aged sugar sollutions (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  5. Male sexual behavior and pheromone emission is enhanced by exposure to guava fruit volatiles in Anastrepha fraterculus (United States)

    Host plant chemicals can influence sex pheromone communication of tephritid fruit flies, and affect strategies optimizing mating and reproduction. Previous studies suggest that females of the South American fruit fly, Anastrepha fraterculus, prefer to mate with laboratory males previously exposed to...


    Directory of Open Access Journals (Sweden)



    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  7. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas


    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  8. 7 CFR 319.56-44 - Untreated grapefruit, sweet oranges, and tangerines from Mexico for processing. (United States)


    ... program using sterile insect technique for Mexican fruit fly. (h) Compliance agreements. Processing plants... Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE FOREIGN... technique for the Mexican fruit fly (Anastrepha ludens). (b) Fruit fly trapping protocol. (1)...

  9. La pédagogie des langues-cultures comme science et comme art ; Homo sapiens, faber, loquens, ludens : l’intérité humaine

    Directory of Open Access Journals (Sweden)

    Jacques Demorgon


    Homo sapiens, faber, loquens, ludens: The human interity Abstract: The most common attitude consists in separating techniques, sciences, arts and languages. Unfortunately, by losing sight of their common origin, we lose the means of associating them in our learning processes and our teaching practices. These have to base themselves in human “interity” (between-ness. It makes anthropological references necessary to human adaptation and historical and geographical references to their joint developments. It is on these bases that sciences and educational arts are going to allow the appropriate exchanges between the singular persons in interaction in and outside the class. This new pedagogy of the languages-cultures places them in a humanity in progress: competitive, conflicting, and complementary. It can be better understood and reinforced with works as those of Giorgio Agamben, François Jullien and Henri Van Lier.

  10. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail:, e-mail:


    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  11. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo


    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  12. An improved quarantine method for mangoes against the Mexican fruit fly based on high-pressure processing combined with heat. (United States)

    Velazquez, Gonzalo; Candelario, Hugo Ernesto; Ramírez, José A; Montoya, Pablo; Loera-Gallardo, Jesús; Vázquez, Manuel


    The Mexican fruit fly Anastrepha ludens Loew (Diptera: Tephritidae) is one of the most important insects infesting mangoes, citrus, and other fruits in Mexico and other Latin-American countries. Quarantine methods approved to destroy this insect decrease the shelf life of commodities. The objective of this study was to determine the effect of high-pressure processing using an initial temperature of 50 degrees C on the survivorship of eggs and larvae of the Mexican fruit fly. Eggs and larvae were pressurized at 25, 50, 75, 100, or 150 MPa for 0, 5, 10, or 20 min. The hatching ability of pressurized eggs of 1, 2, 3, and 4 days old and survivorship of the first, second, and third instars were registered. Further, the ability to pupate was studied in surviving third instars. The results showed that eggs were more resistant than larvae to the high-pressure processing. Treatments at 150 MPa at initial 50 degrees C for 10 min destroyed all eggs and larvae of A. ludens, indicating that this process might be useful as a quarantine method for infested mangoes or other fruits.

  13. Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida (United States)

    Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

  14. Tabanid flies (Insecta: Diptera from Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Kailash Chandra


    Full Text Available The paper presents an account on the Tabanidae (Diptera from Chhattisgarh, which includes 16 species representing five genera under three subfamilies: Pangoniinae, Chrysopsinae and Tabaninae. Among these species, Haematopota latifascia Ricardo is new addition to the fauna of Chhattisgarh. The distributional area of the collection localities, key characters are also provided. 

  15. The gene transformer-2 of Sciara (Diptera, Nematocera and its effect on Drosophila sexual development

    Directory of Open Access Journals (Sweden)

    Ruiz María F


    Full Text Available Abstract Background The gene transformer-2, which is involved in sex determination, has been studied in Drosophila, Musca, Ceratitis, Anastrepha and Lucilia. All these members of Diptera belong to the suborder Brachycera. In this work, it is reported the isolation and characterisation of genes transformer-2 of the dipterans Sciara ocellaris and Bradysia coprophila (formerly Sciara coprophila, which belong to the much less extensively analysed Sciaridae Family of the Suborder Nematocera, which is paraphyletic with respect to Suborder Brachycera. Results The transformer-2 genes of the studied Sciara species were found to be transcribed in both sexes during development and adult life, in both the soma and germ lines. They produced a single primary transcript, which follows the same alternative splicing in both sexes, giving rise to different mRNAs isoforms. In S. ocellaris the most abundant mRNA isoform encoded a full-length protein of 251 amino acids, while that of B. coprophila encoded a protein of 246 amino acids. Both showed the features of the SR protein family. The less significant mRNA isoforms of both species encoded truncated, presumably non-functional Transformer-2 proteins. The comparison of the functional Sciara Transformer-2 proteins among themselves and those of other insects revealed the greatest degree of conservation in the RRM domain and linker region. In contrast, the RS1 and RS2 domains showed extensive variation with respect to their number of amino acids and their arginine-serine (RS dipeptide content. The expression of S. ocellaris Transformer-2 protein in Drosophila XX pseudomales lacking the endogenous transformer-2 function caused their partial feminisation. Conclusions The transformer-2 genes of both Sciaridae species encode a single protein in both sexes that shares the characteristics of the Transformer-2 proteins of other insects. These proteins showed conserved sex-determination function in Drosophila; i.e., they were

  16. Nieuwe en zeldzame vliegen voor de Nederlandse fauna (Diptera)

    NARCIS (Netherlands)

    Aartsen, van B.


    New and rare flies for the Dutch fauna (Diptera) In this paper an overview is given of captures of rare and interesting Diptera, belonging to different families, mainly from the years 19941996. In total 46 species are presented, of which 13 are new to the Dutch fauna (marked with an *), viz.: Spania

  17. Een nieuwe daas voor Nederland: Hybomitra arpadi (Diptera: Tabanidae)

    NARCIS (Netherlands)

    Zeegers, T.


    A new horsefly for the Netherlands: Hybomitra arpadi (Diptera: Tabanidae) The horsefly Hybomitra arpadi (Diptera: Tabanidae) is recorded for the first time from the Netherlands. New features for the recognition of the males and some notes on the biology are given.

  18. Mass production in liquid diet and radiosterilization of South American fruit fly Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae); Criacao massal em dieta liquida e radioesterilizacao da mosca-sulamericana Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Kamiya, Aline Cristiane


    Both the biological control techniques as the Sterile Insect Technique (SIT), are used in many countries to control, suppress and even eradicate fruit flies and other pests in agriculture and public health. The use of such techniques minimizes the continuous employment of insecticides, protects the environment and conforms to standards for food safety. However, it is necessary to implement such programs, technology to produce millions of parasitoids and the pest in its own laboratory with biological quality similar to the insects found in nature and cost competitive with chemical control. The objectives of this study was to establish protocols for artificial rearing of A. sp. 1 aff. fraterculus in liquid larval diet that will achieve levels of mass production for a possible reduction in the cost of establishing and determining the dose of radiation sterilization of adult A. sp. 1 aff. fraterculus meeting the quality parameters required by the Sterile Insect Technique with insects from the creation of Radioentomology Laboratory of CENA/USP. Seven experimental diets compared to the conventional diet used in Radioentomology Lab. of CENA/USP, which was used as control. All seven diets have in common the exclusion of agar in its formulation. Only two of the diets tested were suitable for larval development of the fly, they compared with the standard diet, showed inferior results with respect to the volume of recovered larvae, pupae and weight of emergency, however, no significant differences regarding the periods of development , pupal recovery, sex ratio and longevity under stress. It is possible to replace the diet with agar for liquid diets for artificial creation of A. sp. 1 aff. fraterculus, reduced cost and greater convenience of handling, but due to their quality standards lower than the standard diet, more tests are needed especially regarding the adaptability of the insect to the new environment. To determine the sterilizing dose this study examined the fertility, fecundity, emergence, flight ability and longevity under stress in A. fraterculus irradiated with 40, 50, 60, 70 and 80 Gy. The radiation source was a gamma irradiator with a Co-60 (Gamma beam-650) located in the same laboratory. The tests were performed under the following environmental conditions: 26 +- 1 deg C, 70 +- 5% RH and photoperiod of 12:12. The dose of gamma radiation sterilization for male A. sp. 1 aff. fraterculus was determined with 70 Gy. Irradiates females, even with the lower dose of 40 Gy, laid no eggs, possibly due to atrophy of the ovaries caused by radiation. The radiation did not affect the other quality parameters such as insect emergence, longevity and ability to fly. (author)

  19. Metalimnobia crane flies (Diptera: Limoniidae) from Korea. (United States)

    Podenas, Sigitas; Byun, Hye-Woo


    Korean species of the crane fly genus Metalimnobia Matsumura, 1911 (Diptera: Limoniidae), are taxonomically revised. Metalimnobia (Metalimnobia) channpayna new species, is described and figured, M. (M.) bifasciata (Schrank, 1781), M. (M.) quadrinotata (Meigen, 1818) and M. (M.) zetterstedti (Tjeder, 1968) are listed for the first time in Korea, new information for previously known species, M. (M.) quadrimaculata (Linnaeus, 1760) is added. Identification key for all Korean Metalimnobia species is given. Wings, male and female terminalia are illustrated for all species.

  20. Numerous transitions of sex chromosomes in Diptera. (United States)

    Vicoso, Beatriz; Bachtrog, Doris


    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  1. Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Tiago Ledesma Taira


    Full Text Available Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart. Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw. Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping, nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae, and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered, where Doryctobracon areolatus (Szépligeti was the most abundant parasitoid in larvae of tephritids infesting both cultivated and wild host fruits.

  2. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues


    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  3. Revision of the family Nothybidae (Diptera: Schizophora). (United States)

    Lonsdale, O; Marshall, S A


    The family Nothybidae (Diptera: Schizophora) is revised. The family consists of 11 species in the single genus Nothybus Rondani, which occurs in Papua New Guinea, Nepal and much of the Oriental Region. Three species are described as new: N. absens spec. nov. (China), N. cataractus spec. nov. (Laos, Thailand) and N. procerus spec. nov. (India). Nothybus longithorax Rondani, 1875 is treated as a junior synonym of N. longicollis (Walker, 1856). Nothybus decorus Meijere, 1924 syn. nov. is included as a junior synonym of N. lineifer Enderlein, 1922.

  4. Rhipidia crane flies (Diptera: Limoniidae) from Korea. (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu


    Korean species of the crane fly genus Rhipidia Meigen, 1818 (Diptera: Limoniidae), are taxonomically revised. Rhipidia (Rhipidia) serena, new species, is described and figured. Rhipidia (R.) longa Zhang, Li, Yang, 2014, R. (R.) maculata Meigen, 1818 and R. (R.) sejuga Zhang, Li, Yang, 2014 are recorded for the first time in Korea. Previously known species, Rhipidia (R.) septentrionis Alexander, 1913 is redescribed and illustrated. Identification key for all Korean Rhipidia species is given. Most antennae, wings, male and female terminalia of all species are illustrated for the first time.

  5. Recombination rate predicts inversion size in Diptera. (United States)

    Cáceres, M; Barbadilla, A; Ruiz, A


    Most species of the Drosophila genus and other Diptera are polymorphic for paracentric inversions. A common observation is that successful inversions are of intermediate size. We test here the hypothesis that the selected property is the recombination length of inversions, not their physical length. If so, physical length of successful inversions should be negatively correlated with recombination rate across species. This prediction was tested by a comprehensive statistical analysis of inversion size and recombination map length in 12 Diptera species for which appropriate data are available. We found that (1) there is a wide variation in recombination map length among species; (2) physical length of successful inversions varies greatly among species and is inversely correlated with the species recombination map length; and (3) neither the among-species variation in inversion length nor the correlation are observed in unsuccessful inversions. The clear differences between successful and unsuccessful inversions point to natural selection as the most likely explanation for our results. Presumably the selective advantage of an inversion increases with its length, but so does its detrimental effect on fertility due to double crossovers. Our analysis provides the strongest and most extensive evidence in favor of the notion that the adaptive value of inversions stems from their effect on recombination.

  6. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina. (United States)

    Cladera, Jorge L; Vilardi, Juan C; Juri, Marianela; Paulin, Laura E; Giardini, M Cecilia; Gómez Cendra, Paula V; Segura, Diego F; Lanzavecchia, Silvia B


    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication.

  7. Himenópteros parasitóides de larvas de Anastrepha spp. em frutos de carambola (Averrhoa carambola L. na região de Divinópolis, Minas Gerais, Brasil Himenopterous parasitoids of Anastrepha spp. larvae, in star fruit (Averrhoa carambola L. In divinópolis region, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Cláudio Gonçalves Silva


    Full Text Available Este trabalho foi conduzido com o objetivo de conhecer os parasitóides de moscas-da-fruta na região de Divinópolis-MG. As pupas foram obtidas pelo método de flutuação, sendo individualizadas em cápsulas de gelatina até a emergência das moscas adultas ou de seus parasitóides. A prevalência total de parasitismo foi de 14,8%. Trichopria anastrepha foi a espécie mais comum, com 44,5%.The objective of this work was to identify the parasitoids of fruit flies in Divinópolis-MG region. The pupae were obtained by the flotation method. They were individually placed in gelatin capsules until the emergency of the adult flies or their parasitoids. The overall prevalence of parasitism was 14,8%. Trichopria anastrepha was the most common specie with a frequency of 44,5%.

  8. Rehydration of forensically important larval Diptera specimens. (United States)

    Sanford, Michelle R; Pechal, Jennifer L; Tomberlin, Jeffery K


    Established procedures for collecting and preserving evidence are essential for all forensic disciplines to be accepted in court and by the forensic community at large. Entomological evidence, such as Diptera larvae, are primarily preserved in ethanol, which can evaporate over time, resulting in the dehydration of specimens. In this study, methods used for rehydrating specimens were compared. The changes in larval specimens with respect to larval length and weight for three forensically important blow fly (Diptera: Calliphoridae) species in North America were quantified. Phormia regina (Meigen), Cochliomyia macellaria (F.), and Chrysomya rufifacies (Macquart) third-instar larvae were collected from various decomposing animals and preserved with three preservation methods (80% ethanol, 70% isopropyl alcohol, and hot-water kill then 80% ethanol). Preservative solutions were allowed to evaporate. Rehydration was attempted with either of the following: 80% ethanol, commercial trisodium phosphate substitute solution, or 0.5% trisodium phosphate solution. All three methods partially restored weight and length of specimens recorded before preservation. Analysis of variance results indicated that effects of preservation, rehydration treatment, and collection animal were different in each species. The interaction between preservative method and rehydration treatment had a significant effect on both P. regina and C. macellaria larval length and weight. In addition, there was a significant interaction effect of collection animal on larval C. macellaria measurements. No significant effect was observed in C. rufifacies larval length or weight among the preservatives or treatments. These methods could be used to establish a standard operating procedure for dealing with dehydrated larval specimens in forensic investigations.

  9. Antennal and behavioral responses to putrescine and ammonium bicarbonate in the Caribbean fruit fly (Diptera: tephritidae) (United States)

    A current trapping system for Anastrepha fruit flies uses a 2-component lure that emits ammonia and putrescine, both regarded as protein cues. This study used electroantennography and flight tunnel bioassays to quantify olfactory and behavioral responses of A. suspensa to vapors from ammonium bicar...

  10. Laboratory and Field Age of Aqueous Grape Juice Bait and Capture of Zaprionus indianus (Diptera: Drosophilidae) (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...


    Directory of Open Access Journals (Sweden)



    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  12. A new species of Culcua Walker (Diptera: Stratiomyidae) from Vietnam (United States)

    A new species of Culcua Walker (Diptera: Stratiomyidae), C. lingafelteri Woodley, new species, is described from northern Vietnam. It is diagnosed relative to other species using the recent revision of the genus by Rozkošný and Kozánek (2007). This is the first species of Culcua reported from Viet...

  13. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.


    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  14. Checklist of the family Simuliidae (Diptera of Finland

    Directory of Open Access Journals (Sweden)

    Jari Ilmonen


    Full Text Available A checklist of the family Simuliidae (Diptera is provided for Finland and recognizes 56 species. One new record has been added (Simulium latipes and one name sunken in synonymy (Simulium carpathicum. Furthermore, Simulium tsheburovae is treated as a doubtful record.

  15. Six new species of Microdon Meigen from Madagascar (Diptera: Syrphidae). (United States)

    Reemer, Menno; Bot, Sander


    Six new species of the myrmecophilous hoverfly genus Microdon Meigen (Diptera: Syrphidae) are described from Madagascar. Redescriptions are given for the three other Madagascan species of this genus. Keys are presented to the Madagascan genera of the subfamily Microdontinae and to the Madagascan species of Microdon.

  16. Anopheles (Anopheles) pseudopunctipennis Theobald (Diptera: Culicidae): Neotype Designation and Description (United States)


    Diptera Ð Culicidae). Guayaquil Univ., Guayaquil, Ecuador. Levi-Castillo, R. 1945. Los anofelinos de la Republica del Ecuador, vol. 1: 1Ð172. Artes ...BritishMuseumNatural History, Lon- don, England. Vargas, L., and A. Martinez Palacios. 1956. Anofelinos mexicanos . Taxonomia y distribucion. Secretaria

  17. Surface ultrastructure of third-instar Megaselia scalaris (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Sukontason Kabkaew L


    Full Text Available We describe some ultrastructure of the third-instar Megaselia scalaris (Diptera: Phoridae using scanning electron microscopy, with the cephalic segment, anterior spiracle and posterior spiracle being emphasized. This study provides the taxonomic information of this larval species, which may be useful to differentiate from other closely-related species.

  18. Development of Rhagoletis indifferens Curran (Diptera:Tephritidae) in crabapple (United States)

    Western cherry fruit fly, Rhagoletis indifferens, Curran, 1932 (Diptera: Tephritidae), was reared from naturally-infested Chinese crabapple, Malus spectabilis (Ait.) Borkh. (Rosaceae), in Washington state, U.S.A. Pupae from Chinese crabapple were smaller than those from sweet cherry, Prunus avium (...

  19. World catalog of extant and fossil Corethrellidae (Diptera). (United States)

    Borkent, Art


    A world catalog of extant and fossil frog-biting midges (Diptera: Corethrellidae) provides full type information, known life stages, and distribution of each species. There are 105 extant and seven fossil species of Corethrellidae but unnamed species are known from Costa Rica, Colombia and Madagascar. New information on types and other important specimens are provided.

  20. Scanning electron microscopy of the male genitalia of Sarcophagidae (Diptera

    Directory of Open Access Journals (Sweden)

    Hugo de Souza Lopes


    Full Text Available The male genitalia of nine species of Sarcophagidae (Diptera - Goniophyto honsuensis Rohdendorf, 1962, Tricharaea brevicornis (Wiedemann, 1830, Chaetoravinia derelicta (Walker, 1852, Austrohartigia spinigena (Rondani, 1864, Chrysagria duodecimpunctata Townsend, 1935, Boettcheria bisetosa Parker, 1914, Lipoptilocnema lanei Townsend, 1934, L. crispina (Lopes, 1938 and Euboettcheria alvarengai Lopes & Tibana, 1982 - were examined by scanning electron microscope (SEM and the main morphological features are descirbed.

  1. Wolbachia in two populations of Melittobia digitata Dahms (Hymenoptera: Eulophidae)

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Claudia S.; Sivinski, John [United States Dept. of Agriculture, Gainesville, FL (United States). Center for Medical, Agriculture and Veterinary Entomology]. E-mails:;; Matthews, Robert W. [University of Georgia, Athens, GA (United States). Dept. of Entomology]. E-mail:; Gonzalez, Jorge M. [Texas A and M Univ., College Station, TX (United States). Dept. of Entomology]. E-mail:; Aluja, Martin [Instituto de Ecologia A.C., Veracruz (Mexico)]. E-mail:


    We investigated two populations of Melittobia digitata Dahms, a gregarious parasitoid (primarily upon a wide range of solitary bees, wasps, and flies), in search of Wolbachia infection. The first population, from Xalapa, Mexico, was originally collected from and reared on Mexican fruit fly pupae, Anastrepha ludens Loew (Diptera: Tephritidae); the other, from Athens, Georgia, was collected from and reared on prepupae of mud dauber wasps, Trypoxylon politum Say (Hymenoptera: Crabronidae). PCR studies of the ITS2 region corroborated that both parasitoid populations were the same species; this potentially provides a useful molecular taxonomic profile since females of Melittobia species are superficially similar. Amplification of the Wolbachia surface protein gene (wsp) confirmed the presence of this endosymbiont in both populations. Sequencing revealed that the Wolbachia harbored in both populations exhibited a wsp belonging to a unique subgroup (denoted here as Dig) within the B-supergroup of known wsp genes. This new subgroup of wsp may either belong to a different strain of Wolbachia from those previously found to infect Melittobia or may be the result of a recombination event. In either case, known hosts of Wolbachia with a wsp of this subgroup are only distantly related taxonomically. Reasons are advanced as to why Melittobia - an easily reared and managed parasitoid - holds promise as an instructive model organism of Wolbachia infection amenable to the investigation of Wolbachia strains among its diverse hosts. (author)

  2. Superparasitism in the Fruit Fly Parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) and the Implications for Mass Rearing and Augmentative Release. (United States)

    Montoya, Pablo; Pérez-Lachaud, Gabriela; Liedo, Pablo


    Superparasitism, a strategy in which a female lays eggs in/on a previously parasitized host, was attributed in the past to the inability of females to discriminate between parasitized and non-parasitized hosts. However, superparasitism is now accepted as an adaptive strategy under specific conditions. In fruit fly parasitoids, superparasitism has mainly been studied as concerns the new association between Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae) and the Mexican fruit fly Anastrepha ludens (Loew) (Diptera: Tephritidae), wherein this phenomenon is a common occurrence in both mass rearing and field conditions. Studies of this species have shown that moderate levels of superparasitism result in a female-biased sex ratio and that both massreared and wild females superparasitize their hosts without detrimental effects on offspring demographic parameters, including longevity and fecundity. These studies suggest that superparasitism in this species is advantageous. In this paper, we review superparasitism in D. longicaudata, discuss these findings in the context of mass rearing and field releases and address the possible implications of superparasitism in programs employing augmentative releases of parasitoids for the control of fruit fly pests.


    Directory of Open Access Journals (Sweden)

    Nelson Augusto Canal Daza


    Full Text Available

    Dentre as frutíferas nativas dos cerrados goianos destacam-se as do gênero Pouteria, com ampla distribuição nas regiões tropicais e subtropicais de todo o mundo, sendo a P. ramiflora (curriola a mais comum. Pouteria gardneriana (guapeva ocorre geralmente nos solos mais úmidos, sempre agrupada na faixa de separação cerrados-veredas. Dos 25 municípios do Estado de Goiás amostrados, em nove foi registrada a ocorrência dessas duas espécies de Pouteria, cujos frutos são bastante suscetíveis ao ataque de moscas-das-frutas. Dos frutos de guapeva e curriola, emergiram adultos de Anastrepha (99,82% e apenas alguns exemplares de Ceratitis capitata (0,18%. As espécies coletadas em P. gardneriana foram: Anastrepha bistrigata, A. fraterculus, A. leptozona, A. serpentina, A. zenildae, A. zernyi e C. capitata. De P. ramiflora foram obtidas: A. fraterculus, A. leptozona, A. serpentina e A. zernyi. Dos pupários de Anastrepha

  4. The forgotten flies: the importance of non-syrphid Diptera as pollinators. (United States)

    Orford, Katherine A; Vaughan, Ian P; Memmott, Jane


    Bees, hoverflies and butterflies are taxa frequently studied as pollinators in agricultural and conservation contexts. Although there are many records of non-syrphid Diptera visiting flowers, they are generally not regarded as important pollinators. We use data from 30 pollen-transport networks and 71 pollinator-visitation networks to compare the importance of various flower-visiting taxa as pollen-vectors. We specifically compare non-syrphid Diptera and Syrphidae to determine whether neglect of the former in the literature is justified. We found no significant difference in pollen-loads between the syrphid and non-syrphid Diptera. Moreover, there was no significant difference in the level of specialization between the two groups in the pollen-transport networks, though the Syrphidae had significantly greater visitation evenness. Flower visitation data from 33 farms showed that non-syrphid Diptera made up the majority of the flower-visiting Diptera in the agricultural studies (on average 82% abundance and 73% species richness), and we estimate that non-syrphid Diptera carry 84% of total pollen carried by farmland Diptera. As important pollinators, such as bees, have suffered serious declines, it would be prudent to improve our understanding of the role of non-syrphid Diptera as pollinators.

  5. Medical Entomology Studies - XV. A Revision of the Subgenus Paraedes of the Genus Aedes (Diptera: Culicidae) (United States)


    Med. Res. 10: 430-75. Diptera Nematocera from the Federated Malay States museums. J. Fed. Malay States Mus. 14: l-139. Philippine nematocerous...Culicidae. p. 266-343. In M. D. Delfinado and D. E. Hardy, Ed. A catalog of the Diptera of the Oriental region. Volume I. Suborder Nematocera . Univ

  6. Larval endoparasitoids (Hymenoptera of frugivorous flies (Diptera, Tephritoidea reared from fruits of the cerrado of the State of Mato Grosso do Sul , Brazil

    Directory of Open Access Journals (Sweden)

    Manoel A. Uchôa-Fernandes


    Full Text Available This paper presents a five years survey of endoparasitoids obtained from the larvae of frugivorous Tephritidae and Lonchaeidae flies. The insects were reared from cultivated and wild fruits collected in areas of the cerrado in the State of Mato Grosso do Sul, Brazil. The flies obtained from 14 host fruit species were eight Anastrepha species, Ceratitis capitata (Wiedemann, 1824 (Tephritidae; Dasiops sp. and Neosilba spp. (Lonchaeidae. Eleven parasitoid species were collected: Braconidae - Asobara anastrephae (Muesebek, 1958, Doryctobracon areolatus (Szépligeti, 1911, D. fluminensis (Costa Lima, 1938, Opius bellus Gahan, 1930 and Utetes anastrephae (Viereck, 1913; Figitidae - Aganaspis nordlanderi Wharton, 1998, Lopheucoila anastrephae (Rhower, 1919, Odontosema anastrephae (Borgmeier, 1935 and Trybliographa infuscata Gallardo, Díaz & Uchôa-Fernandes, 2000 and, Pteromalidae - Spalangia gemina Boucek, 1963 and S. endius Walker, 1839. In all cases only one parasitoid emerged per puparium. D. areolatus was the most abundant and frequent parasitoid of fruit fly species, as was L. anastrephae in Neosilba spp. larvae. This is the first record of A. nordlanderi in the midwestern Brazilian region.

  7. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola


    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  8. Sarcosaprophagous Diptera assemblages in natural habitats in central Spain: spatial and seasonal changes in composition. (United States)

    Martín-Vega, D; Baz, A


    The composition and spatial distribution of sarcosaprophagous Diptera assemblages were studied using carrion-baited traps along a bioclimatic gradient of natural habitats in central Spain throughout the different seasons during 1 year. Calliphoridae and Muscidae were the most abundant families, accounting for, respectively, 41.9% and 35.1% of all Diptera specimens collected. Other abundant families were Heleomyzidae (8.4%), Sarcophagidae (6.9%) and Piophilidae (5.1%). Fly assemblage compositions differed among bioclimatic levels, with Chrysomya albiceps (Wiedemann) (Diptera: Calliphoridae) being the dominant species in mesomediterranean habitats, Muscina levida (Harris) (Diptera: Muscidae) the dominant species in supramediterranean habitats, and Prochyliza nigrimana (Meigen) (Diptera: Piophilidae) the dominant species in oromediterranean habitats. Differences in assemblage composition were also found among seasons. Thermophobic species such as Calliphora vicina Robineau-Desvoidy (Diptera: Calliphoridae) and some species of Heleomyzidae were well represented during autumn, winter and spring in the three bioclimatic levels sampled. By contrast, thermophilic species such as Ch. albiceps and Lucilia sericata (Meigen) (Diptera: Calliphoridae) and most Muscidae and Sarcophagidae species were more abundant during summer and in mesomediterranean habitats located at lower elevations. Knowledge of the preferences of some species for certain habitats may be of ecological and forensic value and may establish a starting point for further research.

  9. Contrasting rates of mitochondrial molecular evolution in parasitic Diptera and Hymenoptera. (United States)

    Castro, L R; Austin, A D; Dowton, M


    We investigated the putative association between the parasitic lifestyle and an accelerated rate of mt genetic divergence, compositional bias, and gene rearrangement, employing a range of parasitic and nonparasitic Diptera and Hymenoptera. Sequences were obtained for the cox1, cox2, 16S, 28S genes, the regions between the cox2 and atp8 genes, and between the nad3 and nad5 genes. Relative rate tests indicated generally that the parasitic lifestyle was not associated with an increased rate of genetic divergence in the Diptera but reaffirmed that it was in the Hymenoptera. Similarly, a departure from compositional stationarity was not associated with parasitic Diptera but was in parasitic Hymenoptera. Finally, mitochondrial (mt) gene rearrangements were not observed in any of the dipteran species examined. The results indicate that these genetic phenomena are not accelerated in parasitic Diptera compared with nonparasitic Diptera. A possible explanation for the differences in the rate of mt molecular evolution in parasitic Diptera and Hymenoptera is the extraordinary level of radiation that has occurred within the parasitic Hymenoptera but not in any of the dipteran parasitic lineages. If speciation events in the parasitic Hymenoptera are associated with founder events, a faster rate of molecular evolution is expected. Alternatively, biological differences between endoparasitic Hymenoptera and endoparasitic Diptera may also account for the differences observed in molecular evolution.

  10. Medical Entomology Studies - XVI. A Review of the Species of Subgenus Verrallina, Genus Aedes, from Sri Lanka and a Revised Description of the Subgenus (Diptera: Culicidae) (United States)


    351-401. Diptera Nematocera from the Federated Malay States Museums. J. Fed. Malay States Mus. 14: 1-139, 2 pls. Diptera, Fam. Culicidae. In P...266-343. In M. D. Delfinado and D. E. Hardy, Ed. A catalog of the Diptera of the Oriental region. Volume I. Suborder Nematocera . Univ. Press Hawaii

  11. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae) (United States)

    Traps baited with synthetic food-based lures that include blends of ammonia, either as ammonium acetate or ammonium bicarbonate, and putrescine capture a number of Anastrepha and Bactrocera species fruit flies. However, for many of these species, more flies are captured in traps baited with the pro...

  12. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures (United States)

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  13. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  14. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg


    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  15. Systematics of the blackfly subgenus Trichodagmia Enderlein (Diptera: Simuliidae: Simulium) in the new world

    NARCIS (Netherlands)

    Hernández Triana, L.M.


    Systematics of the blackfly subgenus Trichodagmia ENDERLEIN (Diptera: Simuliidae: Simulium) in the New World The systematics of the New World subgenus Trichodagmia has been reassessed by employing an integrated taxonomic approach based upon revisionary taxonomy, phylogenetic (cladistics) analysis

  16. The African species of the subgenus Tipula Linnaeus, 1758 (Diptera, Tipulidae)

    NARCIS (Netherlands)

    Hollander, den J.


    An account is given on the African species of the subgenus Tipula (Diptera, Tipulidae) present in the Institute of Taxonomic Zoology (Zoological Museum), Amsterdam, and a new species, T. (Tipula) lourensi, is described.

  17. New Dicranoptycha Osten Sacken, 1859 Crane flies (Diptera: Limoniidae) of North and South Korea. (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu


    Two new species of Dicranoptycha Osten Sacken, 1859, crane flies (Diptera, Limoniidae) from the Korean peninsula are described, illustrated and compared with already known and related species. An identification key and check-list of all Korean Dicranoptycha is presented.

  18. Cardiocladius oliffi (Diptera: Chironomidae as a potential biological control agent against Simulium squamosum (Diptera: Simuliidae

    Directory of Open Access Journals (Sweden)

    Wilson Michael D


    Full Text Available Abstract Background The control of onchocerciasis in the African region is currently based mainly on the mass drug administration of ivermectin. Whilst this has been found to limit morbidity, it does not stop transmission. In the absence of a macrofilaricide, there is a need for an integrated approach for disease management, which includes vector control. Vector control using chemical insecticides is expensive to apply, and therefore the use of other measures such as biological control agents is needed. Immature stages of Simulium squamosum, reared in the laboratory from egg masses collected from the field at Boti Falls and Huhunya (River Pawnpawn in Ghana, were observed to be attacked and fed upon by larvae of the chironomid Cardiocladius oliffi Freeman, 1956 (Diptera: Chironomidae. Methods Cardiocladius oliffi was successfully reared in the rearing system developed for S. damnosum s.l. and evaluated for its importance as a biological control agent in the laboratory. Results Even at a ratio of one C. oliffi to five S. squamosum, they caused a significant decrease in the number of adult S. squamosum emerging from the systems (treatments. Predation was confirmed by the amplification of Simulium DNA from C. oliffi observed to have fed on S. squamosum pupae. The study also established that the chironomid flies could successfully complete their development on a fish food diet only. Conclusion Cardiocladius oliffi has been demonstrated as potential biological control agent against S. squamosum.

  19. Characterisation of novel Bacillus thuringiensis isolates against Aedes aegypti (Diptera: Culicidae) and Ceratitis capitata (Diptera: Tephridae). (United States)

    Elleuch, Jihen; Tounsi, Slim; Ben Hassen, Najeh Belguith; Lacoix, Marie Noël; Chandre, Fabrice; Jaoua, Samir; Zghal, Raida Zribi


    Bacillus thuringiensis is successfully used in pest management strategies as an eco-friendly bioinsecticide. Isolation and identification of new strains with a wide variety of target pests is an ever growing field. In this paper, new B. thuringiensis isolates were investigated to search for original strains active against diptera and able to produce novel toxins that could be used as an alternative for the commercial H14 strain. Biochemical and molecular characterization revealed a remarkable diversity among the studied strains. Using the PCR method, cry4C/Da1, cry30Ea, cry39A, cry40 and cry54 genes were detected in four isolates. Three strains, BLB355, BLB196 and BUPM109, showed feeble activities against Aedes aegypti larvae. Interestingly, spore-crystal mixtures of BLB361, BLB30 and BLB237 were found to be active against Ceratitis capitata with an LC50 value of about 65.375, 51.735 and 42.972 μg cm(-2), respectively. All the studied strains exhibited important mortality levels using culture supernatants against C. capitata larvae. This suggests that these strains produce a wide range of soluble factors active against C. capitata larvae.

  20. Aedes aegypti (Diptera: Culicidae) Biting Deterrence: Structure-Activity Relationship of Saturated and Unsaturated Fatty Acids (United States)


    VECTOR CONTROL, PEST MANAGEMENT, RESISTANCE, REPELLENTS Aedes aegypti (Diptera: Culicidae) Biting Deterrence: Structure- Activity Relationship of...deterrent effects of a series of saturated and unsaturated fatty acids against Aedes aegypti (L), yellow fever mosquito (Diptera: Culicidae) using theK...greater thanDEET againstAe. aegypti and their relative repellency varied according to species tested. The MED values of 120 (C11:0), 145 (C12:0) and

  1. Descriptions of syntypes of Brumptamyia brumpti (Lsrrousse, 1920 (Diptera: Psychodidae-Phlebotominae

    Directory of Open Access Journals (Sweden)

    Paul Williams


    Full Text Available The male and female of Brumptomyia brumpti (Larrousse, 1920, the type species of the genus Brumptomyia França & Parrot, 1921 (Diptera: Psychodidae - phlebotominae are redescribed from syntypes in the British Museum (Natural History.É apresentada a redescrição de sinotipos macho e fêmea de Brumptomya brumpti (Larrousse, 1920, a espécie típica do gênero Brumptomyia França e Parrot, 1921 (diptera: Psychodidae - Phlebotominae.

  2. Species of Oukuriella Epler (Diptera, Chironomidae inside freshwater sponges in Brazil

    Directory of Open Access Journals (Sweden)

    Fabio de Oliveira Roque


    Full Text Available Larvae of Oukuriella Epler, 1986 (Diptera, Chironomidae inside freshwater sponges are reported for the first time in Brazil.Espécies de Oukuriella Epler (Diptera, Chironomidae no interior de esponjas de água doce no Brasil. Larvas de Oukuriella Epler, 1986 no interior de esponjas de água doce são registradas pela primeira vez no Brasil.

  3. Chironomid (Diptera species recorded from UK lakes as pupal exuviae

    Directory of Open Access Journals (Sweden)

    L.P. Ruse


    Full Text Available An inventory of chironomid species (Diptera, Chironomidae data collected from 221 lake basins or reservoirs is detailed together with major physical and chemical characteristics of these waterbodies. Aquatic species of Chironomidae must rise to the water surface for adult emergence. Floating exuviae are transported by wind and water currents to lakeshores. Species data were obtained by collecting lake marginal floating pupal exuviae representing juvenile stages dwelling from across the lake. Among the 450 species found, several were new records for the British Isles.

  4. Ammonium carbonate loss rates from lures differentially affect trap captures of Rhagoletis indifferens (Diptera: Tephritidae) and non-target flies (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherry (Prunus spp.) in western North America that can be monitored using traps baited with ammonia. However, ammonia-based attractants also attract non-target Diptera that clutter traps. Here, the hypothe...

  5. Traumatic Myiasis Caused by an Association of Sarcophaga tibialis (Diptera: Sarcophagidae) and Lucilia sericata (Diptera: Calliphoridae) in a Domestic Cat in Italy. (United States)

    Pezzi, Marco; Whitmore, Daniel; Chicca, Milvia; Lanfredi, Margherita; Leis, Marilena


    We describe here a rare case of traumatic myiasis occurred in August 2014, caused by an association of 2 Diptera species, Sarcophaga tibialis Macquart (Diptera: Sarcophagidae) and Lucilia sericata (Meigen) (Diptera: Calliphoridae), in a domestic cat in northern Italy. Species identification was based on adult male morphology. The present case is the first report of S. tibialis as an agent of myiasis in Italy, and also the first ever report of myiasis caused by an association of S. tibialis and L. sericata. The cat developed an extensive traumatic myiasis in a large wound on the rump, which was treated pharmacologically and surgically. The biology, ecology, and distribution of S. tibialis and L. sericata are also discussed. A literature review is provided on cases of myiasis caused by S. tibialis, and cases of myiasis by L. sericata involving cats worldwide and humans and animals in Italy.

  6. Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae) (United States)

    Zhang, Dong; Yan, Liping; Zhang, Ming; Chu, Hongjun; Cao, Jie; Li, Kai; Hu, Defu; Pape, Thomas


    The complete mitogenome of the horse stomach bot fly Gasterophilus pecorum (Fabricius) and a near-complete mitogenome of Wohlfahrt's wound myiasis fly Wohlfahrtia magnifica (Schiner) were sequenced. The mitogenomes contain the typical 37 mitogenes found in metazoans, organized in the same order and orientation as in other cyclorrhaphan Diptera. Phylogenetic analyses of mitogenomes from 38 calyptrate taxa with and without two non-calyptrate outgroups were performed using Bayesian Inference and Maximum Likelihood. Three sub-analyses were performed on the concatenated data: (1) not partitioned; (2) partitioned by gene; (3) 3rd codon positions of protein-coding genes omitted. We estimated the contribution of each of the mitochondrial genes for phylogenetic analysis, as well as the effect of some popular methodologies on calyptrate phylogeny reconstruction. In the favoured trees, the Oestroidea are nested within the muscoid grade. Relationships at the family level within Oestroidea are (remaining Calliphoridae (Sarcophagidae (Oestridae, Pollenia + Tachinidae))). Our mito-phylogenetic reconstruction of the Calyptratae presents the most extensive taxon coverage so far, and the risk of long-branch attraction is reduced by an appropriate selection of outgroups. We find that in the Calyptratae the ND2, ND5, ND1, COIII, and COI genes are more phylogenetically informative compared with other mitochondrial protein-coding genes. Our study provides evidence that data partitioning and the inclusion of conserved tRNA genes have little influence on calyptrate phylogeny reconstruction, and that the 3rd codon positions of protein-coding genes are not saturated and therefore should be included. PMID:27019632

  7. Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae). (United States)

    Zhang, Dong; Yan, Liping; Zhang, Ming; Chu, Hongjun; Cao, Jie; Li, Kai; Hu, Defu; Pape, Thomas


    The complete mitogenome of the horse stomach bot fly Gasterophilus pecorum (Fabricius) and a near-complete mitogenome of Wohlfahrt's wound myiasis fly Wohlfahrtia magnifica (Schiner) were sequenced. The mitogenomes contain the typical 37 mitogenes found in metazoans, organized in the same order and orientation as in other cyclorrhaphan Diptera. Phylogenetic analyses of mitogenomes from 38 calyptrate taxa with and without two non-calyptrate outgroups were performed using Bayesian Inference and Maximum Likelihood. Three sub-analyses were performed on the concatenated data: (1) not partitioned; (2) partitioned by gene; (3) 3rd codon positions of protein-coding genes omitted. We estimated the contribution of each of the mitochondrial genes for phylogenetic analysis, as well as the effect of some popular methodologies on calyptrate phylogeny reconstruction. In the favoured trees, the Oestroidea are nested within the muscoid grade. Relationships at the family level within Oestroidea are (remaining Calliphoridae (Sarcophagidae (Oestridae, Pollenia + Tachinidae))). Our mito-phylogenetic reconstruction of the Calyptratae presents the most extensive taxon coverage so far, and the risk of long-branch attraction is reduced by an appropriate selection of outgroups. We find that in the Calyptratae the ND2, ND5, ND1, COIII, and COI genes are more phylogenetically informative compared with other mitochondrial protein-coding genes. Our study provides evidence that data partitioning and the inclusion of conserved tRNA genes have little influence on calyptrate phylogeny reconstruction, and that the 3rd codon positions of protein-coding genes are not saturated and therefore should be included.

  8. Fumigant Toxicity of Phenylpropanoids Identified in Asarum sieboldii Aerial Parts to Lycoriella ingenua (Diptera: Sciaridae) and Coboldia fuscipes (Diptera: Scatopsidae). (United States)

    Yi, Jee Hwan; Perumalsamy, Haribalan; Sankarapandian, Karuppasamy; Choi, Byeoung-Ryeol; Ahn, Young-Joon


    Lycoriella ingenua (Dufour) (Diptera: Sciaridae) and Coboldia fuscipes (Meigen) (Diptera: Scatopsidae) are two of the most economically important insect pests of cultivated mushrooms. The toxicities to the fly larvae of the three phenylpropanoids (methyleugenol, myristicin, and safrole) from aerial parts of Asarum sieboldii Miquel (Aristolochiaceae) were compared with those of the currently available carbamate insecticide benfuracarb. In a contact+fumigant mortality bioassay with L. ingenua and C. fuscipes larvae, methyleugenol (1.46 and 2.33 µg/cm2) was the most toxic compound, followed by safrole (2.03 and 2.59 µg/cm2) and myristicin (3.59 and 4.96 µg/cm2), based on 24-h LC50 values. The phenylpropanoids were less toxic than benfuracarb (LC50, 0.75 and 0.55 µg/cm2). In vapor-phase mortality tests with the larvae, the phenylpropanoids were consistently more toxic in closed versus open containers, indicating that the effect of the compounds was largely a result of vapor action. Global efforts to reduce the level of highly toxic synthetic insecticides in the agricultural environment justify further studies on A. sieboldii plant-derived products as potential fumigants for the control of mushroom fly populations in mushroom houses and mushroom compost.

  9. Checklist of the Diptera (Insecta of Finland: an introduction and a summary of results

    Directory of Open Access Journals (Sweden)

    Jere Kahanpää


    Full Text Available Nearly thirty-five years have passed since Hackman published his “Check list of the Finnish Diptera” (1980. The number of true flies (Diptera known from Finland has increased by more than two thousand species since then. At the same time, hundreds of erroneous records have been recognized and purged from the checklist. ZooKeys issue 441 provides a new checklist of the Diptera species of the Republic of Finland. This introductory paper presents the rationale behind the project, provides technical documentation on the checklist format and sources used, and summarizes the results. The remaining papers in this issue cover one or more Diptera families in detail. Two electronic appendices are provided: supporting data (additional references to first published records and the previous checklist and a complete list of Finnish Diptera taxa in Darwin Core compliant format for easy computer access and processing. The new checklist records 6920 fly species from Finland, 2932 belonging to the nematoceran or lower flies and 3989 to the suborder Brachycera. The changes since 1980 are most prominent in the Lower Diptera. For example, more than 400 non-biting midges (Chironomidae have been added since 1980, and the number of moth flies (Psychodidae known from Finland has more than tripled. Among the larger families, large increases in known Finnish species are also seen in Cecidomyiidae (161% increase, Pipunculidae (98%, and Chironomidae (90%.

  10. Effects of tree and herb biodiversity on Diptera, a hyperdiverse insect order. (United States)

    Scherber, Christoph; Vockenhuber, Elke A; Stark, Andreas; Meyer, Hans; Tscharntke, Teja


    Biodiversity experiments have shown that plant diversity has largely positive effects on insect diversity and abundance. However, such relationships have rarely been studied in undisturbed and more complex ecosystems such as forests. Flies (Diptera) are among the most dominant taxa in temperate ecosystems, influencing many ecosystem processes. As it is unknown how Diptera respond to changes in forest biodiversity, we examined how community characteristics of Diptera respond to varying levels of tree and herb diversity and vegetation structure. The study was conducted in the Hainich National Park (Central Germany) on 84 plots along a gradient of tree (from two to nine species) and herb (from two to 28 species) diversity. We found that herb and canopy cover as well as spatial effects were the best predictors of Diptera community composition, consisting of 62 families, including 99 Empidoidea and 78 Phoridae species. Abundance of Empidoidea was positively influenced by herb diversity, indicating bottom-up control. A complex causal pathway influenced Dipteran species richness: species-rich forest stands, with low beech cover, had lower canopy cover, resulting in higher Dipteran species richness. In addition, Diptera benefited from a more dense and diverse herb community. Individual species responded differentially to herb layer diversity, indicating that effects of plant diversity on higher trophic levels depend on species identity. We conclude that tree and herb canopy cover as well as herb diversity predominately shape Dipteran communities in temperate deciduous forests, which is in contrast to expectations from grassland studies exhibiting much closer relationships between plant and insect diversity.

  11. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá


    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.

  12. Population fluctuation of fruit flies (Diptera, Tephritidae in peach and passion fruit orchards in Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti


    Full Text Available The objective of this study was learn more about the population fluctuation of fruit flies in peach and passion fruit orchards in the municipality of Iraceminha, Santa Catarina. In order to carry out the survey, McPhail traps were set up with 10% inverted glucose from April 2006 to March 2007. Captured flies were identified at the Laboratório de Entomologia at UNOCHAPECÓ. The collected females belonged to twelve species and four genera. The adults of Anastrepha fraterculus were trapped during all seasons, with a population peak in October 2006 in the peach orchards. The population levels of Anastrepha grandis remained higher during the first five months in the passion fruit orchard. There were low infestation rates by flies of the genera Ceratitis, Blepharoneura and Tomoplagia when compared to flies of the genus Anastrepha. The results showed that the presence of flies in the orchards was associated with the availability of host fruit and not with climatic conditions.

  13. Essays on the history of Brazilian dipterology. I. The first notices about Brazilian Diptera (16th century

    Directory of Open Access Journals (Sweden)

    Nelson Papavero


    Full Text Available Essays on the history of Brazilian dipterology. I. The first notices about Brazilian Diptera (16th century. This paper presents a historical resume of the first notices about Brazilian Diptera during the 16th century, given by Francisco Pires in 1552 (the oldest mention known, José de Anchieta, Leonardo do Valle, Pero de Magalhães de Gandavo, Jean de Léry and Gabriel Soares de Souza, ending with Fernão Cardim, who made the last mentions of Brazilian Diptera in that century.

  14. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia


    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  15. The complete mitochondrial genome of Dixella aestivalis (Diptera: Nematocera: Dixidae). (United States)

    Briscoe, Andrew G; Sivell, Duncan; Harbach, Ralph E


    Dixidae, meniscus midges, belong to the suborder Nematocera of the order Diptera. The family includes 197 known species classified in nine genera. The complete mitochondrial genome of the Dixella aestivalis (Meigen) from the United Kingdom is reported here, along with its annotation and comparison with the genome of an unidentified species of Dixella from China. The circular genome consists of 16 465 bp and has a gene content consisting of 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes and a non-coding, A + T-rich, control region. The mitochondrial genome of D. aestivalis can be used to identify genetic markers for species identification, and will be valuable for resolving phylogenetic relationships within the genus, family Dixidae and suborder Nematocera.

  16. Bartonella species in bat flies (Diptera: Nycteribiidae) from western Africa. (United States)

    Billeter, S A; Hayman, D T S; Peel, A J; Baker, K; Wood, J L N; Cunningham, A; Suu-Ire, R; Dittmar, K; Kosoy, M Y


    Bat flies are obligate ectoparasites of bats and it has been hypothesized that they may be involved in the transmission of Bartonella species between bats. A survey was conducted to identify whether Cyclopodia greefi greefi (Diptera: Nycteribiidae) collected from Ghana and 2 islands in the Gulf of Guinea harbour Bartonella. In total, 137 adult flies removed from Eidolon helvum, the straw-coloured fruit bat, were screened for the presence of Bartonella by culture and PCR analysis. Bartonella DNA was detected in 91 (66·4%) of the specimens examined and 1 strain of a Bartonella sp., initially identified in E. helvum blood from Kenya, was obtained from a bat fly collected in Ghana. This is the first study, to our knowledge, to report the identification and isolation of Bartonella in bat flies from western Africa.

  17. Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Márcia S. Couri


    Full Text Available Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae is a very well represented genus in the Neotropical Region, known from almost 100 species. In Bolivia, it is known only from four species: N. declivis, N. incurva, N. oculata and N. recedens, all described by Stein. The study of material from South America deposited at Muséum national d'Histoire naturelle (Paris, France, enabled the description of one new species to science. A key for the recognition of the five species known to Bolivia is given.

  18. On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region

    Directory of Open Access Journals (Sweden)

    Silvio Shigueo Nihei


    Full Text Available On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

  19. EAG and behavioral responses of the Caribbean fruit fly (Diptera:Tephritidae) to terminal diamines in a food-based lure. (United States)

    Current monitoring programs for Anastrepha fruit flies utilize a food-based synthetic lure consisting of ammonium acetate and putrescine (1, 4 diaminobutane). Identification of additional attractant chemicals may lead to development of a more effective trapping system. This study, conducted with the...

  20. Enhancing male sexual success in a lekking fly (Ananstrepha suspensa (Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality (United States)

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual su...

  1. Dasineura gigantea sp.n. (Diptera, Cecidomyiidae associada a Psidium cattleianum Sabine (Myrtaceae no Brasil Dasineura gigantea sp.n. (Diptera, Cecidomyiidae associated with Psidium cattleianum Sabine (Myrtaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Alessandro C. Angelo


    Full Text Available A new species of Dasineura Rondani, 1840 (Diptera, Cecidomyiidae which causes galls on Psidium cattleianum Sabine, 1821 is described and illustrated (larva, pupa, male, female. The gall is characterized and some biological notes are given.

  2. Cordiamyia globosa gen.n. e sp.n. (Diptera, Cecidomyiidae, Cecidomyiidi associado com Cordia Verbenacea DC. (Boraginaceae no Brasil Cordiamyia globosa gen.n. and sp.n. (Diptera, Cecidomyiidae associated with Cordia verbekacea DC. (Boraginaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia


    Full Text Available Cordiamyia globosa gen.n., sp.n. (Diptera, Cecidomyiidae, Cecidomyiidi associated with Cordia verbenacea (Boraginaceae, in Brazil, is described and illustrated (larva, pupa, male, female and gall.

  3. An emerging example of tritrophic coevolution between flies (Diptera: Fergusoninidae) and nematodes (Nematoda: Neotylenchidae) on Myrtaceae host plants (United States)

    A unique obligate mutualism occurs between species of Fergusonina Malloch flies (Diptera: Fergusoninidae) and nematodes of the genus Fergusobia Currie (Nematoda: Neotylenchidae). These mutualists together form different types of galls on Myrtaceae, mainly in Australia. The galling association appear...

  4. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  5. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail:; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola


    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  6. Morphology of immature stages of Atherigona reversura (Diptera: Muscidae), with notes on the recent invasion of North America

    DEFF Research Database (Denmark)

    Grzywacz, Andrzej; Pape, Thomas; Hudson, William G.


    The muscid shoot-fly Atherigona reversura Villeneuve (Diptera: Muscidae), recently introduced to North America, is reported for the first time from the Neotropical Region: Mexico, Chiapas, Chiapa de Corzo. Information about distribution throughout the continent is summarized. Morphology of the se......The muscid shoot-fly Atherigona reversura Villeneuve (Diptera: Muscidae), recently introduced to North America, is reported for the first time from the Neotropical Region: Mexico, Chiapas, Chiapa de Corzo. Information about distribution throughout the continent is summarized. Morphology...

  7. Description of the Immature Stages of Anopheles (Nyssorhynchus) rondoni (Neiva & Pinto) (Diptera: Culicidae) (United States)


    Neiva & Pinto) (Diptera: Culicidae) Maria Anice Mureb Sallum/+, Richard C Wilkerson* Núcleo de Pesquisa Taxonômica e Sistemática em Entomologia ...Taxonômica e Sistemática em Entomologia Médica, Universidade de São Paulo, São Paulo. The following specimens were used for setal counts and measurements (the

  8. Description of the female of Ctenodontina nairae Vieira (Diptera, Asilidae, Asilinae, with new distribution records

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira


    Full Text Available Description of the female of Ctenodontina nairae Vieira (Diptera, Asilidae, Asilinae, with new distribution records. The female of Ctenodontina nairae Vieira, 2012 is described for the first time. Description and illustrations of the habitus, wing and terminalia of the female are provided. The distribution is extended to Bolivia and Peru.

  9. Systematics and phylogeny of Centrioncidae, a new afromontane family of Diptera (Schizophora)

    NARCIS (Netherlands)

    Feijen, H.R.


    Arguments are put forward for the erection of a new family of Diptera, named Centrioncidae. Centrioncus prodiopsis, its only previously described representative, was originally placed in the Sepsidae and later transferred to the Diopsidae. This species is now redescribed and five more Centrioncus ar

  10. Phylogeny of Anophelinae (Diptera: Culicidae) Based on Nuclear Ribosomal and Mitochondrial DNA Sequences (United States)


    combining data from nuclear protein-encoding enes for phylogenetic analyses of Noctuoidea (Insecta: Lepidoptera ). Systematic Biology, 49, 202 224. Nixon... Systematic Entomology (2002) 27, 361 382 Phylogeny of Anophelinae (Diptera: Culicidae) based on nuclear ribosomal and mitochondrial DNA sequences...Entomologia M•dica, Departamento de Epidemiologia, Faculdade de Safide Pfiblica, Universidade de S•o Paulo, Brazil, -• Department of Systematic

  11. Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Márcia S. Couri


    Full Text Available Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae is a very well represented genus in the Neotropical Region, known from almost 100 species. In Bolivia, it is known only from four species: N. declivis, N. incurva, N. oculata and N. recedens, all described by Stein. The study of material from South America deposited at Muséum national d'Histoire naturelle (Paris, France, enabled the description of one new species to science. A key for the recognition of the five species known to Bolivia is given.Neodexiopsis Malloch da Bolivia com descrição de uma espécie nova (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae é um gênero muito bem representado na região Neotropical, conhecido por quase 100 espécies. Na Bolívia, ele é conhecido por apenas quatro espécies: N. declivis, N. incurva, N. oculata e N. recedens, todas descritas por Stein. O estudo do material da América do Sul depositado no Muséum national d'Histoire naturelle (Paris, France, permitiu a descrição de uma nova espécie para a ciência. Uma chave para o reconhecimento das cinco espécies presentes na Bolívia é fornecida.

  12. Trapping African fig fly (Diptera: Drosophilidae) with combinations of vinegar and wine (United States)

    The African fig fly, Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States. Tests were conducted in southern Florida that recorded the response of Z. indianus to baits that included Merlot wine, rice vinegar, et...

  13. Wine and vinegar-based attractants for the African fig fly (Diptera: Drosophilidae) (United States)

    The African fig fly (AFF), Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States after first being detected in Florida in 2005. This drosophilid is a primary pest of figs in Brazil, so there were initial concern...

  14. Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira


    Full Text Available Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae. The robber fly genus Aristofolia Ayala-Landa, 1978 is a monotypic taxon of Asilinae. The status of Aristofolia is revalidated, and addenda to the original description of the genus is provided. The habitus, wings, male and female terminalia are described and illustrated.

  15. Vertical stratification of beetles (Coleoptera) and flies (Diptera) in temperate forest canopies. (United States)

    Maguire, Dorothy Y; Robert, Katleen; Brochu, Kristen; Larrivée, Maxim; Buddle, Christopher M; Wheeler, Terry A


    Forest canopies support high arthropod biodiversity, but in temperate canopies, little is known about the spatial distribution of these arthropods. This is an important first step toward understanding ecological roles of insects in temperate canopies. The objective of this study was to assess differences in the species composition of two dominant and diverse taxa (Diptera and Coleoptera) along a vertical gradient in temperate deciduous forest canopies. Five sugar maple trees from each of three deciduous forest sites in southern Quebec were sampled using a combination of window and trunk traps placed in three vertical strata (understory, mid-canopy, and upper-canopy) for three sampling periods throughout the summer. Coleoptera species richness and abundance did not differ between canopy heights, but more specimens and species of Diptera were collected in the upper-canopy. Community composition of Coleoptera and Diptera varied significantly by trap height. Window traps collected more specimens and species of Coleoptera than trunk traps, although both trap types should be used to maximize representation of the entire Coleoptera community. There were no differences in abundance, diversity, or composition of Diptera collected between trap types. Our data confirm the relevance of sampling all strata in a forest when studying canopy arthropod biodiversity.

  16. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae(Cocquillett)(Diptera:Tephritidae) (United States)

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  17. Picture-winged fly (Euxesta, Chaetopsis spp.; Diptera: Ulidiidae) semiochemical investigations (United States)

    Picture-winged flies (Euxesta, Chaetopsis spp., Diptera: Ulidiidae) are severe primary pests of sweet corn in southern Florida. Females oviposit in silks and larvae consume the silks and kernels, rendering the ear unmarketable. Growers treat their fields with numerous broad spectrum insecticide ap...

  18. First North American record of the Palaearctic rhinophorid Stevenia deceptoria (Loew) (Diptera: Rhinophoridae). (United States)

    O'hara, James E; Cerretti, Pierfilippo; Dahlem, Gregory A


    The Rhinophoridae (Diptera) have a cosmopolitan distribution and a known fauna of about 150 species (Cerretti & Pape 2007). So far as known, all species are parasitoids of terrestrial woodlice (sow bugs) of the order Isopoda (Oniscoidea) (Pape 2010). Female rhinophorids lay eggs in the vicinity of potential hosts and the planidial first instars parasitize sow bugs as they pass by (Pape 1998).

  19. A remarkable new species of Eutrichopoda Townsend, 1908 (Diptera: Tachinidae: Phasiinae). (United States)

    Dios, Rodrigo De Vilhena Perez; Nihei, Silvio Shigueo


    A new Tachinidae species, Eutrichopoda flavipenna sp. nov. (Diptera: Tachinidae: Phasiinae), from Brazil and Paraguay is described and illustrated by photographs and line drawings. The remarkable yellow, feather-like setae on the hind tibia distinguishes the new species from all other species in the tribe Trichopodini.

  20. The oldest accurate record of Scenopinidae in the Lowermost Eocene amber of France (Diptera: Brachycera). (United States)

    Garrouste, Romain; Azar, Dany; Nel, Andre


    Eocenotrichia magnifica gen. et sp. nov. (Diptera: Scenopinidae: Metatrichini) is described and illustrated from the Lowermost Eocene amber of Oise (France) and represents the oldest definitive window fly fossil. The present discovery in the Earliest Eocene supports the Late Cretaceous-Paleocene age currently proposed for the emergence of Metatrichini.

  1. An Annotated Bibliography of the Mosquitoes and Mosquito-Borne Diseases of Guam (Diptera: Culicidae) (United States)


    Nematocera . University Press of Hawaii, Honolulu, Hawaii. 618 pp. Family Culicidae; see A. Stone and M.D. Delfinado, 1973. 359 Edgren, D.C., V.S...Culicidae, in Delfinado, M.D. and D.E. Hardy (Eds.), A Catalog of the Diptera of the Oriental Region, Vol. 1: Nematocera , pp. 266-343. University Press

  2. On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region

    Directory of Open Access Journals (Sweden)

    Silvio Shigueo Nihei


    Full Text Available On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.Sobre o primeiro taquinídeo (Diptera, Tachinidae carregando polinários de Asclepiadoideae na Região Neotropical. Esta contribuição relata a primeira espécie neotropical de Tachinidae possivelmente associada à polinização de Asclepiadoideae: uma fêmea de Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini transportando dois polinários de Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae presos à sua probóscide. O espécime foi coletado no Paraguai, Departamento Canindeyú. O polinário é ilustrado e caracterizado. Este é o primeiro registro de antofilia para G. parviflorus e para o gênero.

  3. [The mosquitoes (Diptera Culicidae) of Morocco. Bibliographic review (1916-2001) and inventory of the species]. (United States)

    Trari, B; Dakki, M; Himmi, O; el Agbani, M A


    The history of the Culicidae of Morocco was related from bibliographical data. A synthesis of the almost entire works carried out on these Insects (Diptera) since 1916 allowed to bring out the main stages of research of which they were the subject, while emphasizing the important periods of large malaria epidemics in Morocco. A short list of species is also given.

  4. Corrections and additions to Catalogue of Neotropical Diptera (Tabanidae of Coscarón & Papavero (2009

    Directory of Open Access Journals (Sweden)

    Augusto Loureiro Henriques


    Full Text Available Some corrections and omitted taxonomic information for the "Catalogue of Neotropical Diptera. Tabanidae" are presented. Fifteen recently described species are listed for the Neotropical region. Presently, the Neotropical region has 1,205 Tabanidae species, besides 35 unrecognized species and 29 nomina nuda.

  5. Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae)


    Rodrigo Vieira; José Manuel Ayala Landa


    Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae). The robber fly genus Aristofolia Ayala-Landa, 1978 is a monotypic taxon of Asilinae. The status of Aristofolia is revalidated, and addenda to the original description of the genus is provided. The habitus, wings, male and female terminalia are described and illustrated.

  6. Pollinating flies (Diptera): A major contribution to plant diversity and agricultural production (United States)

    Diptera are one of the three largest and most diverse animal groups of the world. As an often neglected, but important group of pollinators, they play a significant role in agrobiodiversity and biodiversity of plants everywhere. Flies are present in almost all habitats and biomes and for many food p...

  7. Cutaneous neoplasm in Phaeotabanus litigiosus (Diptera, Tabanidae collected on the Marambaia Island, Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    RR Guimarães


    Full Text Available A female specimen of Phaeotabanus litigiosus (Diptera: Tabanidae collected on Marambaia Island was found with a tumor in the abdominal integument. Histopathological examination revealed an epithelial dysplasia with anisokariosis and hyperchromasia. This is the first record of a neoplasm found in tabanid collected from natural environment. Key Words: Atlantic island; displasia; horse fly; insect disease; insect vector; neotropical region

  8. Chironomid (Chironomidae: Diptera checklist from Nahuel Huapi National Park, Patagonia, Argentina Lista de los quironómidos (Chironomidae: Diptera del Parque Nacional Nahuel Huapi, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Mariano Donato


    Full Text Available This paper presents the first inventory of modern and subfossil taxa of the Family Chironomidae (Insecta: Diptera from Nahuel Huapi National Park in Patagonia, Argentina. The catalogued fauna contains 104 species in 48 genera and 6 sub-families for modern fauna and 52 morphotypes in 36 genera and 4 subfamilies for sub-fossil fauna.Este trabajo presenta el primer catálogo de taxones modernos y subfósiles de la familia Chironomidae (Insecta: Diptera del Parque Nacional Nahuel Huapi en Patagonia, Argentina. La fauna catalogada contiene 104 especies en 48 géneros y 6 subfamilias para la fauna moderna y 52 morfotipos en 36 géneros y 4 subfamilias para la fauna subfósil.

  9. Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae) in Southern Pantanal, Brazil Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae) no Pantanal Sul-mato-grossense, Brasil



    Cochliomyia macellaria (Diptera: Calliphoridae), known as the secondary screwworm, occurs in the Americas and has medical-veterinary and forensic importance. This study aimed to describe the seasonal fluctuation of this species in the Pantanal region, Central-Western Brazil. From December 2004 to November 2007 fly catches using four windoriented traps baited with decaying bovine liver were carried out at the Nhumirim ranch, Nhecolândia subregion, Southern Pantanal. Traps remained active throu...

  10. Sampling strategies for phlebotomine sand flies (Diptera: Psychodidae) in Europe. (United States)

    Alten, B; Ozbel, Y; Ergunay, K; Kasap, O E; Cull, B; Antoniou, M; Velo, E; Prudhomme, J; Molina, R; Bañuls, A-L; Schaffner, F; Hendrickx, G; Van Bortel, W; Medlock, J M


    The distribution of phlebotomine sand flies is widely reported to be changing in Europe. This can be attributed to either the discovery of sand flies in areas where they were previously overlooked (generally following an outbreak of leishmaniasis or other sand fly-related disease) or to true expansion of their range as a result of climatic or environmental changes. Routine surveillance for phlebotomines in Europe is localized, and often one of the challenges for entomologists working in non-leishmaniasis endemic countries is the lack of knowledge on how to conduct, plan and execute sampling for phlebotomines, or how to adapt on-going sampling strategies for other haematophagous diptera. This review brings together published and unpublished expert knowledge on sampling strategies for European phlebotomines of public health concern in order to provide practical advice on: how to conduct surveys; the collection and interpretation of field data; suitable techniques for the preservation of specimens obtained by different sampling methods; molecular techniques used for species identification; and the pathogens associated with sand flies and their detection methods.

  11. Evolution and Structural Analyses of Glossina morsitans (Diptera; Glossinidae Tetraspanins

    Directory of Open Access Journals (Sweden)

    Edwin K. Murungi


    Full Text Available Tetraspanins are important conserved integral membrane proteins expressed in many organisms. Although there is limited knowledge about the full repertoire, evolution and structural characteristics of individual members in various organisms, data obtained so far show that tetraspanins play major roles in membrane biology, visual processing, memory, olfactory signal processing, and mechanosensory antennal inputs. Thus, these proteins are potential targets for control of insect pests. Here, we report that the genome of the tsetse fly, Glossina morsitans (Diptera: Glossinidae encodes at least seventeen tetraspanins (GmTsps, all containing the signature features found in the tetraspanin superfamily members. Whereas six of the GmTsps have been previously reported, eleven could be classified as novel because their amino acid sequences do not map to characterized tetraspanins in the available protein data bases. We present a model of the GmTsps by using GmTsp42Ed, whose presence and expression has been recently detected by transcriptomics and proteomics analyses of G. morsitans. Phylogenetically, the identified GmTsps segregate into three major clusters. Structurally, the GmTsps are largely similar to vertebrate tetraspanins. In view of the exploitation of tetraspanins by organisms for survival, these proteins could be targeted using specific antibodies, recombinant large extracellular loop (LEL domains, small-molecule mimetics and siRNAs as potential novel and efficacious putative targets to combat African trypanosomiasis by killing the tsetse fly vector.

  12. Chironomid (Diptera, Chironomidae species assemblages in northeastern Algerian hydrosystems

    Directory of Open Access Journals (Sweden)

    N. Chaib


    Full Text Available The aim of this paper was to analyze the distribution of chironomids (Diptera, Chironomidae, and determine their substrate preferences, from two hydrosystems located in northeastern Algeria: the Kebir-East and the Seybouse wadis. Sixty-five species were recorded in 49 sampling sites distributed along the main courses of the two hydrographic nets and their tributaries. The majority of taxa comprised cosmopolitan species widely distributed along these two hydrosystems. Cricotopus (Cricotopus bicinctus showed the highest abundance and frequency of occurrence (29.52% and was widespread in almost all the sampling sites. Species richness ranged from 4 to 23, Shannon diversity between 0.15 and 0.90, Evenness from 0.23 to 1. A cluster analysis was carried out to represent the different groups of sites sharing similar species composition. Agglomerative cluster analysis grouped the sampling sites into four clusters according to the community data. An Indval analysis was then carried out to detect indicator species for each group of the sampling sites. Cricotopus (Isocladius sylvestris was indicator of the first group of the sampling sites. Orthocladius pedestris, Rheocricotopus chalybeatus and C. bicinctus were indicators of the second group, and Polypedilum cultellatum of the third group. The fourth group was not characterized by any species. Indval analysis allowed also to determine species preferences for substrate size: Corynoneura scutellata and Dicrotendipes nervosus emphasized a preference to fine gravel, and Glyptotendipes pallens to fine sand.

  13. The larval head of Exechia (Mycetophilidae) and Bibio (Bibionidae) (Diptera). (United States)

    Bauernfeind, René; Schneeberg, Katharina; Beutel, Rolf Georg


    Exechia and Bibio have retained several plesiomorphic groundplan features of Diptera and Bibionomorpha, including a fully exposed and sclerotized head capsule, the transverse undivided labrum, the absence of movable premandibles, and undivided mandibles without combs. The fusion of the hypostomal bridge with the head capsule and largely reduced antennae are derived features shared by both taxa. The absence of teeth at the anterior hypostomal margin is a potential autapomorphy of Bibionomorpha. A basal position of Anisopodidae is suggested by a number of plesiomorphies retained in this family. Apomorphies of Bibionomorpha excluding Anisopodidae are the reduction of tentorial elements, the partial fusion of the labrum and clypeus, one-segmented antennae, the absence of a separate submental sclerite, the loss of the labial palpus, and the reduction of the pharyngeal filter apparatus. Head structures of Bibio are largely unmodified. The subprognathous orientation is one of few autapomorphic features. In contrast, the mouthparts of Exechia are highly modified in correlation with the specialized food uptake. The rasping counterrotating movements of maxillae and mandibles with teeth oriented in opposite directions are carried out by strongly developed extensors and flexors of the paired mouthparts. The modified labium mechanically supports the "drill head" formed by the mandibles und maxillae. The necessary stability of the head capsule is provided by the hypostomal bridge which also compensates the far-reaching reduction of the tentorium.

  14. Diel periodicity of Drosophila suzukii (Diptera: Drosophilidae) under field conditions (United States)

    Evans, Richard K.; Toews, Michael D.


    Drosophila suzukii Matsumura (Diptera: Drosophilidae), an economically important pest of blueberry and other thin-skinned fruits, persists and prolifically reproduces under seemingly lethal climatic conditions in the field. However, behavioral and physiological mechanisms employed by D. suzukii to tolerate such extreme climatic conditions in the field are unknown. The primary objective of this project was to investigate diel periodicity of D. suzukii and their reproductive success under field conditions as related by climatic factors such as temperature and relative humidity. Results show that D. suzukii reproductive success was significantly higher during the night (including dawn and dusk periods) than the day in terms of oviposition, pupation, adult eclosion, and the number of progeny per female. Female D. suzukii reproductive success was not significantly different between specific regions of a blueberry bush in relation to the amount of shade provided by the canopy. Our studies indicate that D. suzukii flight activity is crepuscular and is sensitive to fluctuations in temperature and relative humidity. Results also suggest that the majority of fly activity during peak hours is concentrated in areas around the border and within the center of blueberry orchards with little activity in the surrounding wooded areas. These findings suggest that D. suzukii prefers microclimate with mild temperatures and high humidity, and does not function well when exposed to direct sunlight with extreme heat. The authors propose that D. suzukii management strategies should be implemented during the early morning and immediately before darkness to maximize efficacy. PMID:28187140

  15. Blood meal analysis of culicoides (Diptera: ceratopogonidae) in central Tunisia. (United States)

    Slama, Darine; Haouas, Najoua; Mezhoud, Habib; Babba, Hamouda; Chaker, Emna


    To evaluate the host preferences of Culicoides species (Diptera: Ceratopogonidae) in Central Tunisia, we identified the source of blood meals of field collected specimens by sequencing of the cytochrome b (cyt b) mitochondrial locus and Prepronociceptine single copy nuclear gene. The study includes the most common and abundant livestock associated species of biting midges in Tunisia: C. imicola, C. jumineri, C. newsteadi, C. paolae, C. cataneii, C. circumscriptus, C. kingi, C. pseudojumineri, C. submaritimus, C. langeroni, C. jumineri var and some unidentified C. species. Analysis of cyt b PCR products from 182 field collected blood-engorged females' midges revealed that 92% of them fed solely on mammalian species, 1.6% on birds, 2.4% on insects and 0.8% on reptiles. The blast results identified the blood origin of biting midges to the species level with exact or nearly exact matches (≥98%). The results confirm the presence of several Culicoides species, including proven vectors in Central Tunisia. Blood meal analyses show that these species will indeed feed on bigger mammals, thereby highlighting the risk that these viruses will be able to spread in Tunisia.

  16. Biogeography of Drosophila (Diptera: Drosophilidae) in East and Southeast Asia. (United States)

    Liu, Fu-Guo Robert; Tsaur, Shun-Chern; Huang, Hsiao-Ting


    The causes of high biological diversity in biodiversity hotspots have long been a major subject of study in conservation biology. To investigate this matter, we conducted a phylogeographic study of five Drosophila (Diptera: Drosophilidae) species from East and Southeast Asia: Drosophila albomicans Duda, D. formosana Duda, D. immigrans Sturtevant, D. melanogaster Meigen, and D. simulans Sturtevant. We collected 185 samples from 28 localities in eight countries. From each collected individual, we sequenced the autosomal extra sex comb gene (esc) and seven mitochondrial genes, including nicotinamide adenine dinucleotide hydrate-reductase dehydrogenase subunit 4 (ND4), ND4L, tRNA-His, tRNA-Pro, tRNA-Thr, partial ND5, and partial ND6. Phylogenetic analyses using maximum- likelihood and Bayesian methods revealed interesting population structure and identified the existence of two distinct D. formosana lineages (Southeast Asian and Taiwanese populations). Genetic differentiation among groups of D. immigrans suggests the possibility of endemic speciation in Taiwan. In contrast, D. melanogaster remained one extensively large population throughout East and Southeast Asia, including nearby islets. A molecular clock was used to estimate divergence times, which were compared with past geographical events to infer evolutionary scenarios. Our findings suggest that interglacial periods may have caused population isolation, thus enhancing population differentiation more strongly for some of the Drosophila species. The population structure of each Drosophila species in East and Southeast Asia has been influenced by past geographic events.

  17. DNA-based identification of forensically important Australian Sarcophagidae (Diptera). (United States)

    Meiklejohn, Kelly A; Wallman, James F; Dowton, Mark


    The utility of the forensically important Sarcophagidae (Diptera) for time since death estimates has been severely limited, as morphological identification is difficult and thermobiological histories are inadequately documented. A molecular identification method involving the sequencing of a 658-bp 'barcode' fragment of the mitochondrial cytochrome oxidase subunit I (COI) gene from 85 specimens, representing 16 Australian species from varying populations, was evaluated. Nucleotide sequence divergences were calculated using the Kimura-two-parameter distance model and a neighbour-joining phylogenetic tree generated. All species were resolved as reciprocally monophyletic, except Sarcophaga dux. Intraspecific and interspecific variation ranged from 0.000% to 1.499% (SE = 0.044%) and 6.658% to 8.983% (SE = 0.653%), respectively. The COI 'barcode' sequence was found to be suitable for the molecular identification of the studied Australian Sarcophagidae: 96.5% of the examined specimens were assigned to the correct species. Given that the sarcophagid fauna is poorly described, it is feasible that the few incorrectly assigned specimens represent cryptic species. The results of this research will be instrumental for implementation of the Australian Sarcophagidae in forensic entomology.

  18. Ocorrência de moscas-das-frutas (Diptera: Tephritidae em mangueiras (Mangifera indica L. em Boa Vista, Roraima = The occurrence of fruit fly (Diptera: Tephritidae in mango (Mangifera indica L. in Boa Vista, Roraima

    Directory of Open Access Journals (Sweden)

    Adriana Bezerra Lima


    Full Text Available Um estudo foi conduzido no período de junho de 2007 a janeiro de 2008, em pomares comerciais de manga das variedades: Tommy Atkins, Haden e Palmer sendo 3 ha de cada cultivar, localizado na região do Bom Intento no Município de Boa Vista. Os espécimes de moscas-das-frutas foram coletados, por meio de armadilhas, confeccionadas com garrafas pet, que foram penduradas na copa das árvores a 1,60 m de altura. Como atrativo alimentar foi utilizado 200 mL de suco de maracujá a 30%. Foram utilizadas nove armadilhas, sendo uma armadilha por hectare. Semanalmente as armadilhas eram examinadas, ocasião em que se substituía o atrativo e os insetos capturados retirados e colocados em frascos de vidro devidamente etiquetados e transportados ao Laboratório de Entomologia do Centro de Ciências Agrárias da Universidade Federal de Roraima. As identificações dos espécimes foram feitas no Instituto Nacional de Pesquisa da Amazônia - INPA. No período de oito meses foram coletados 24 espécimes adultos do gênero Anastrepha (nove fêmeas e 15 machos. Quatro espécies foram identificadas: A. serpentina, A. striata, A. obliqua e A. turpinae. A maior frequência foi A. serpentina (44,44%, seguida de A. striata e A. obliqua ambas com 22,22% e A. turpinae com 11,11%. Os meses de maior ocorrência de Anastrepha spp. foram junho, julho e agosto. Este é o primeiro registro da espécie Anastrepha turpinae Stone, 1942, em Roraima. The study was done during th period of June 2007 to January of 2008, in commercial mango orchards having: 3 ha of cv. Tommy Atkins, 3 ha of cv. Haden. and 3 ha of cv. Palmer, located at Bom Intento in the municipal district of Boa Vista - RR. The specimens of fruit flies were collected, by trapping, made with transparent bottles pet, which were hung in the cup of the trees at 1.60 m of height. 200 mL of passion fruit juice (30% was used as an attractant feed; 9 traps were used, being one trap for hectare. Weekly The traps were

  19. Longevity of multiple species of tephritid (Diptera) fruit fly parasitoids (Hymenoptera: Braconidae: Opiinae) provided exotic and sympatric-fruit based diets. (United States)

    Stuhl, Charles; Cicero, Lizette; Sivinski, John; Teal, Peter; Lapointe, Stephen; Paranhos, Beatriz Jordão; Aluja, Martín


    While adult parasitic Hymenoptera in general feed on floral and extrafloral nectars, hemipteran-honeydews and fluids from punctured hosts, Diachasmimorpha longicaudata (Ashmead), an Old World opiine braconid introduced to tropical/subtropical America for the biological control of Anastrepha spp. (Tephritidae), can survive on fruit juices as they seep from injured fruit. An ability to exploit fruit juice would allow such a parasitoid to efficiently forage for hosts and food sources simultaneously. Two New World opiines, Doryctobracon areolatus (Szepligeti) and Utetes anastrephae (Viereck), are also prominent Anastrepha parasitoids and are roughly sympatric. All three species were provided with: (1) pulp and juice diets derived from a highly domesticated Old World fruit (orange, Citrus sinensis L.) that is only recently sympatric with the Mexican flies and parasitoids and so offered little opportunity for the evolution of feeding-adaptations and (2) a less-domesticated New World fruit (guava, Psidium guajava L.), sympatric over evolutionary time with D. areolatus and U. anastrephae. Both sexes of D. longicaudata died when provided guava pulp or juice at a rate similar to a water-only control. D. areolatus and U. anastrephae, presumably adapted to the nutrient/chemical constituents of guava, also died at a similar rate. Survival of all three species on orange pulp and juice was greater than on water, and often equaled that obtained on a honey and water solution. In confirmatory experiments in Mexico, D. areolatus and U. anastrephae, as well as other tephritid parasitoids Doryctobracon crawfordi (Viereck) and Opius hirtus (Fisher), all died at a significantly higher rates when provided guava in comparison to a honey and water diet. Such a result is likely due to guavas being repellent, innutritious or toxic. D. longicaudata clearly consumed guava juice tagged with a colored dye. Dilutions of orange and guava juice resulted in shorter lifespans than dilutions of orange

  20. Multiple species of scuttle flies (Diptera: Phoridae) as contaminants in forensic entomology laboratory insect colony. (United States)

    Zuha, R M; Jenarthanan, L X Q; Disney, R H L; Omar, B


    In forensic entomology, larval rearing usually includes the presence of biological contaminants including scuttle flies (Diptera: Phoridae). Scuttle flies are recognized as forensically important insects and have been reported causing nuisance and contamination in laboratory environments. This paper reports for the first time the finding of multiple scuttle fly species affecting colonies of third instar larvae of the Oriental latrine blowfly, Chrysomya megacephala (Fabricius) (Diptera: Calliphoridae), reared indoors at the Forensic Science Simulation Site, Universiti Kebangsaan Malaysia. Adult scuttle flies were discovered inside a rearing container after the emergence of adult C. megacephala., The scuttle fly species are Megaselia scalaris (Loew), M. spiracularis Schmitz and Puliciphora borinquenensis (Wheeler). Notes on the life history and biology of these species are discussed herein.

  1. First report of Zaprionus indianus (Diptera: Drosophilidae) in commercial fruits and vegetables in Pennsylvania. (United States)

    Joshi, Neelendra K; Biddinger, David J; Demchak, Kathleen; Deppen, Alan


    Zaprionus indianus (Gupta) (Diptera: Drosophilidae), an invasive vinegar fly, was found for the first time in Adams County, Pennsylvania, in 2011. It was found in a commercial tart cherry orchard using apple cider vinegar (ACV) traps that were monitoring another invasive vinegar fly, the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). Coincidentally, the first record of D. suzukii found in Pennsylvania was also found in this same cherry orchard only 3 months earlier as part of a spotted wing drosophila survey effort in raspberry, blackberry, grape, and tart cherry in Adams County. These same crops plus blueberry and tomato were monitored again in 2012. In this article, adult Z. indianus captures in ACV traps and other traps deployed in the aforementioned crops during 2012 season are presented and the economic importance of Z. indianus is discussed.

  2. The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    María M. Ronderos


    Full Text Available The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. The pupa of Neobezzia fittkaui Wirth & Ratanaworabhan, 1972, collected from a mat of floating fern (Salvinia auriculata Aubl., Salviniaceae in Ilha da Marchantaria near Manaus, Brazil and the reared adult male are described, photographed and illustrated for the first time. This is the first detailed pupal description for the genus Neobezzia Wirth & Ratanaworabhan.Pupa e adulto macho previamente desconhecidos de Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. A pupa de Neobezzia fittkaui Wirth & Ratanaworabhan, 1972 foi coletada em macrófitas aquáticas flutuantes (Salvinia auriculata Aubl., Salviniaceae na Ilha da Marchantaria próximo a Manaus, Brasil e o adulto macho criado foi descrito, fotografado e ilustrado pela primeira vez. Esta é a primeira descrição para a pupa do gênero Neobezzia Wirth & Ratanaworabhan.

  3. The Effect of Clothing on the Rate of Decomposition and Diptera Colonization on Sus scrofa Carcasses. (United States)

    Card, Allison; Cross, Peter; Moffatt, Colin; Simmons, Tal


    Twenty Sus scrofa carcasses were used to study the effect the presence of clothing had on decomposition rate and colonization locations of Diptera species; 10 unclothed control carcasses were compared to 10 clothed experimental carcasses over 58 days. Data collection occurred at regular accumulated degree day intervals; the level of decomposition as Total Body Score (TBSsurf ), pattern of decomposition, and Diptera present was documented. Results indicated a statistically significant difference in the rate of decomposition, (t427  = 2.59, p = 0.010), with unclothed carcasses decomposing faster than clothed carcasses. However, the overall decomposition rates from each carcass group are too similar to separate when applying a 95% CI, which means that, although statistically significant, from a practical forensic point of view they are not sufficiently dissimilar as to warrant the application of different formulae to estimate the postmortem interval. Further results demonstrated clothing provided blow flies with additional colonization locations.

  4. Confirming Hypoderma tarandi (Diptera: Oestridae) human ophthalmomyiasis by larval DNA barcoding. (United States)

    Rukke, Bjørn Arne; Cholidis, Symira; Johnsen, Arild; Ottesen, Preben


    DNA barcoding is a practical tool for species identification, when morphological classification of an organism is difficult. Herein we describe the utilisation of this technique in a case of ophthalmomyiasis interna. A 12-year-old boy was infested during a summer holiday in northern Norway, while visiting an area populated with reindeer. Following medical examination, a Diptera larva was surgically removed from the boy's eye and tentatively identified from its morphological traits as Hypoderma tarandi (L.) (Diptera: Oestridae). Ultimately, DNA barcoding confirmed this impression. The larval cytochrome c oxidase subunit 1 (COI) DNA sequence was matched with both profiles of five adult H. tarandi from the same region where the boy was infested, and other established profiles of H. tarandi in the Barcode of Life Data Systems (BOLD) identification engine.

  5. The evolution of head structures in lower Diptera

    Directory of Open Access Journals (Sweden)

    Katharina Schneeberg


    Full Text Available The head of adult dipterans is mainly characterized by modifications and more or less far-reaching reductions of the mouthparts (e.g., mandibles and maxillae, linked with the specialization on liquid food and the reduced necessity to process substrates mechanically. In contrast, the compound eyes and the antennae, sense organs used for orientation and for finding a suitable mating partner and oviposition site, are well developed. Some evolutionary novelties are specific adaptations to feeding on liquefied substrates, such as labellae with furrows or pseudotracheae on their surface, and the strongly developed pre– and postcerebral pumping apparatuses. In some dipteran groups specialized on blood, the mandibles are still present as piercing stylets. They are completely reduced in the vast majority of families. Within the group far-reaching modifications of the antennae take place, with a strongly reduced number of segments and a specific configuration in Brachycera. The feeding habits and mouthparts of dipteran larvae are much more diverse than in the adults. The larval head is prognathous and fully exposed in the dipteran groundplan and most groups of lower Diptera. In Tipuloidea and Brachycera it is partly or largely retracted, and the sclerotized elements of the external head capsule are partly or fully reduced. The larval head of Cyclorrhapha is largely reduced. A complex and unique feature of this group is the cephaloskeleton. The movability of the larvae is limited due to the lack of thoracic legs. This can be partly compensated by the mouthparts, which are involved in locomotion in different groups. The mouth hooks associated with the cyclorrhaphan cephaloskeleton provide anchorage in the substrate.

  6. A new name for the Neotropical genus Aniarella Enderlein (Diptera, Sciaridae

    Directory of Open Access Journals (Sweden)

    Hüseyin Özdikmen


    Full Text Available A new name for the Neotropical genus Aniarella Enderlein (Diptera, Sciaridae. A junior homonym was detected among neotropical sciarid flies genera and the following replacement name is proposed: Novaniarella nom. nov. for Aniarella Enderlein, 1911 (nec Bolivar, 1906. Accordingly, new combinations are herein proposed for the species currently included in this genus: Novaniarella azteca (Lane, 1959 comb. nov., Novaniarella brevis (Rubsaamen, 1894 comb. nov. and Novaniarella pelluscens (Enderlein, 1911 comb. nov.

  7. Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae). Revision (United States)


    Am. Entomol. Inst. (Ann Arbor) 1(2):1-17. 1967. Estudios sobre mosquitos (Diptera, Culicidae). Ia. Un proyecto para un estudio sistematico de los...subgenero Nyssorhynchus do Brasil. Arq. Hig. Saude Publica 8:141-162. 1950. Do diagnostico diferencial entre A (N) strodel e A (N) pessoai na fase larvaria...Mex. , D. F. , Secr. Salubr. Asist. 181 p. Vargas V. M. 1956. Clave numerica para identificacion de larvas en cuarta fase de Anophelini en Costa Rica

  8. A Revision of the Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae) (United States)


    Middle America. Contrib. Am. Entomol. Inst. (Ann Arbor) 1(2):1-17. 1967. Estudios sobre mosquitos (Diptera, Culicidae). Ia. Un proyecto para un estudio...N) pessoai na fase larvaria. Rev. Bras. Malariol. 2:38-48. Galvao, A. L. A. and F. A. D. Amaral 1938. Sobre urn novo anofelino de Campos do Jordao...Salubr. Taxonomia y distribution. Mex., D. F., P* identification de larvas en cuarta fase de Rev. Biol. Trop. 4:27-34. identification de larvas

  9. Baby Killers: Documentation and Evolution of Scuttle Fly (Diptera: Phoridae) Parasitism of Ant (Hymenoptera: Formicidae) Brood


    Brown, Brian; Hash, John; Hartop, Emily; Porras, Wendy; Amorim, Dalton


    Numerous well-documented associations occur among species of scuttle flies (Diptera: Phoridae) and ants (Hymenoptera: Formicidae), but examples of brood parasitism are rare and the mechanisms of parasitism often remain unsubstantiated. We present two video-documented examples of ant brood (larvae and pupae) parasitism by scuttle flies. In footage from Estação Biológica de Boracéia in Brazil, adult females of Ceratoconus setipennis Borgmeier can be seen attacking workers of Linepithema h...

  10. Morphological description of the fourth instar larva: Culicoides cataneii and Culicoides sahariensis (Diptera: Ceratopogonidae). (United States)

    Slama, Darine; Khedher, Asma; Bdira, Sassi; Khayech, Fethi; Delecolle, Jean-claude; Mezhoud, Habib; Babba, Hamouda; Emna, Chaker


    This study was carried out of the region of Monastir in Central Tunisia, between July and August 2010. Larvae were collected using a floatation technique with magnesium sulfate in mud samples. The fourth instar larva of Culicoides cataneii Clastrier, 1957 and Culicoides sahariensis Callot, Kremer, Bailly-Choumara, 1970 are described, illustrated and drawn. Measurements of instars IV are also presented. This is the first record of Culicoides cataneii and Culicoides sahariensis (Diptera: Ceratopogonidae) to Tunisia.

  11. The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    María M. Ronderos


    Full Text Available The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. The pupa of Neobezzia fittkaui Wirth & Ratanaworabhan, 1972, collected from a mat of floating fern (Salvinia auriculata Aubl., Salviniaceae in Ilha da Marchantaria near Manaus, Brazil and the reared adult male are described, photographed and illustrated for the first time. This is the first detailed pupal description for the genus Neobezzia Wirth & Ratanaworabhan.

  12. Chironomid (Chironomidae: Diptera checklist from Nahuel Huapi National Park, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Mariano DONATO


    Full Text Available Este trabajo presenta el primer catálogo de taxones modernos y subfósiles de la familia Chironomidae (Insecta: Diptera del Parque Nacional Nahuel Huapi en Patagonia, Argentina. La fauna catalogada contiene 104 especies en 48 géneros y 6 subfamilias para la fauna moderna y 52 morfotipos en 36 géneros y 4 subfamilias para la fauna subfósil.

  13. Four cases of pediculosis caused by Pthirus pubis Linnaeus, 1758 (Diptera: Anoplura) from peninsular Malaysia. (United States)

    Pakeer, O; Jeffery, J; Mohamed, A M; Ahmad, F; Baharudin, O


    Four cases of pediculosis, two in adults and two in children, caused by the crab-louse, Pthirus pubis Linnaeus, 1758 (Diptera: Anoplura) is reported from peninsular Malaysia. This is the second report of the problem to be documented from the country. Although P. pubis is closely associated with genital hairs, it is, however, also found to occur on the eyelashes, eyebrows, hairs of the body, head and axilla. The few reported cases of pthiriasis probably do not reflect the true situation.

  14. Palpada panorama sp. n. (Diptera: Syrphidae), a big-eyed hoverfly from Peru and Suriname. (United States)

    Reemer, Menno; Morales, Mirian N


    The hoverfly species Palpada panorama sp. n. (Diptera: Syrphidae) is described based on specimens from Peru and Suriname. It belongs to the scutellaris species group and it is most similar to P. erratica (Curran, 1930), from which it differs most notably by the strongly enlarged ommatidia in the upper half of the eye. Additional differences between these two species and an adjustment for the latest identification key for the species of the scutellaris group are given.

  15. Review of the genus Parerigone Brauer (Diptera: Tachinidae) with five new species from China. (United States)

    Wang, Qiang; Zhang, Chuntian; Wang, Xinhua


    The genus Parerigone (Diptera, Tachinidae) is reviewed. Five new species from China, P. atrisetosa sp. nov., P. flava sp. nov., P. flavisquama sp. nov., P. laxifrons sp. nov. and P. wangi sp. nov., are described and illustrated. Parerigone flavihirta (Chao & Sun) is proposed as a new synonym of P. takanoi Mesnil. Diagnosis of species examined and a key to the 15 species of Parerigone are provided.

  16. Phlebotomus Sandflies of the Paloich Area in the Sudan (Diptera, Psychodidae) (United States)


    sandflies based on total collections in the area. Solid black bars. on R. H. and temperature rows represent average daily minimums per month and...and other arthropods of pUblic health and veterinary significance. DECK 2 PHLEBOTOMUS SANDFLIES OF THE PALOICH AREA IN THE SUDAN (DIPTERA...PSYCHODIDAE)’ 2860 By Laurence W. Quate2 Abstract: This report describes results of field studies on Phlebotomus sandflies from August 1962 to October

  17. The Brazilian Malaria Vector Anopheles (Kerteszia) Cruzii: Life Stages and Biology (Diptera: Culicidae) (United States)


    Mosquitos no litoral paranaense. I - Idade fisioldgica de no Parque National da Serra dos Orgaos, Anopheles cruzii (Diptera, Culicidae). Arq. Estado Parque National da Peryassii, A.G. 1908. OS culicideos do Brazil. Serra dos Grgaos, Estado do Rio de Janeiro, Inst. de Manguinhos, Rio de Janeiro...Kerteszia no litoral Guimar%es, A.E. and V.N.M. Victoria. 1986. do estado de Santa Catarina. Rev. Bras. Mosquitos no Parque National da Serra dos

  18. Richardia Robineau-Desvoidy (Diptera, Tephritoidea, Richardiidae from Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Letícia Barros de Alencar


    Full Text Available Richardia Robineau-Desvoidy (Diptera, Tephritoidea, Richardiidae from Central Amazon, Brazil. There are 11 species of Richardia known to Brazil. Of these, only four are known to occur in the Brazilian Amazon Region, where the diversity of Richardia is underestimated. Herein we describe and illustrate Richardia intemperata sp. nov. and Richardia parispina sp. nov. from Amazonas, Brazil. An illustrated key to males from this region is also provided.

  19. Second Supplement to "A Catalog of the Mosquitoes of the World" (Diptera: Culicidae) (United States)


    Faran 1979:27 (d*, ?*, P*, L*). Type-lot: 1.5 km S of Puyo, Pastaza, Ecuador (USNM). Name Rejected Anopheles subpictus var. vadakadiensis...25. Type Depositories AMC. Institute of Microbiology and Epidemiology, Academy of Medical Science, P.L.A., People’s Republic of China. BMC...YeZanoconion) from Bolivia and Ecuador (Diptera: Culicidae). Mosq. Syst. 11:135-138. Sirivanakarn, S. 1982 (1983). A review of the systematics and

  20. New records of Forcipomyia (Pterobosca) incubans (Diptera: Ceratopogonidae) parasitizing wings of Odonata in Brazil


    Guillermo-Ferreira, Rhainer; Vilela,Diogo Silva


    Forcipomyia (Pterobosca) incubans Macfie (1937) (Diptera: Ceratopogonidae) is recorded here for the first time for Brazil. Females were collected in the Brazilian Neotropical Savanna parasitizing the wings of Erythrodiplax juliana Ris (1911), Erythrodiplax aff. anomala Brauer (1865) and Erythemis credula Hagen (1861), all Libellulidae dragonflies. A map of potential distribution of this species in the New World is also provided. The results suggest that its distribution may range from souther...

  1. A Modified Trap for Adult Sampling of Medically Important Flies (Insecta: Diptera

    Directory of Open Access Journals (Sweden)

    Kamran Akbarzadeh


    Full Text Available Background: Bait-trapping appears to be a generally useful method of studying fly populations. The aim of this study was to construct a new adult flytrap by some modifications in former versions and to evaluate its applicability in a subtropical zone in southern Iran.Methods: The traps were constructed with modification by adding some equipment to a polyethylene container (18× 20× 33 cm with lid. The fresh sheep meat was used as bait. Totally 27 adult modified traps were made and tested for their efficacies to attract adult flies. The experiment was carried out in a range of different topographic areas of Fars Province during June 2010.Results: The traps were able to attract various groups of adult flies belonging to families of: Calliphoridae, Sarcophagidae, Muscidae, and Faniidae. The species of Calliphora vicina (Diptera: Calliphoridae, Sarcophaga argyrostoma (Diptera: Sarcophagidae and Musca domestica (Diptera: Muscidae include the majority of the flies collected by this sheep-meat baited trap.Conclusion: This adult flytrap can be recommended for routine field sampling to study diversity and population dynamics of flies where conducting of daily collection is difficult.

  2. Diptera of sanitary importance associated with composting of biosolids in Argentina

    Directory of Open Access Journals (Sweden)

    Valeria Alejandra Labud


    Full Text Available OBJECTIVE: Odorous compounds produced at the biosolids composting plant in Bariloche (NW Patagonia attract a variety of insects, mainly belonging to the order Diptera. In order to characterize these flies, collected specimens were taxonomically identified, their community characteristics were described and their sanitary and synanthropic importance and autochthonous or introduced character were determined. METHODS: Sampling was performed from October 1999 until March 2000. Adults were collected using an entomological net, and larvae and puparia were obtained from the composting material and incubated to obtain adults. Richness, abundance and sex ratio were calculated. RESULTS: A total of 9 taxa of Diptera were identified: Sarconesia chlorogaster, Phaenicia sericata, Calliphora vicina, Cochliomya macellaria, Ophyra sp, Muscina stabulans, Musca domestica, Sarcophaga sp and Fannia sp. Specimens of Anthomyiidae, Acaliptratae and one larva of Eristalis tenax were also found. Ophyra sp. was the most abundant taxa. All the captured Diptera belonged to introduced taxa. Most of them are considered to be eusynanthropic and/or hemisynanthropic and have sanitary importance as they may cause myiasis and pseudomyiasis. The high number of females registered and the finding of immature stages indicated that flies can develop their complete life cycle on biosolid composting windrows. CONCLUSIONS: The characterization of flies obtained in this study may be useful for defining locations of urban or semi-urban composting facilities. It also highlights the importance of sanitary precautions at such plants.

  3. Parasitóides associados às moscas-das-frutas (Diptera: Tephritoidea em café orgânico com e sem arborização em Valença, RJ, Brasil Parasitoids associated with fruit flies (Diptera: Tephritoidea in organic coffee plantation under shaded and unshaded management in Valença, RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Elen de Lima Aguiar-Menezes


    Full Text Available Objetivou-se, com esse trabalho, determinar as espécies de parasitóides associados às moscas-das-frutas infestando seis cultivares de café arábica (Coffea arabica L., em sistema de cultivo com e sem arborização, sob manejo orgânico. Uma amostra de 1 kg de frutos maduros por cultivar foi colhida em maio de 2005. Os frutos foram depositados em bandejas plásticas, contendo uma camada de areia, a qual serviu como substrato para a fase de pupa. Os pupários foram quantificados e mantidos em copos plásticos transparentes com areia até a emergência dos insetos. Sete espécies de parasitóides da ordem Hymenoptera foram identificadas, das quais cinco da família Braconidae: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, Utetes anastrephae (Viereck, Opius bellus Gahan e Opius sp., e duas da Figitidae: Aganaspis pelleranoi (Brèthes e Lopheucoila anastrephae Weld. Larvas de Tephritidae e Lonchaeidae infestando frutos dos seis cultivares foram parasitadas por Braconidae e Figitidae, com média de 14,2% e 7,7% nos sistemas sem e com arborização, respectivamente.The aim of this work was to determine the parasitoid species associated with fruit flies infesting six cultivars of arabic coffee under shaded and unshaded organic management. A 1kg-sample of maturing fruits per cultivar was harvested in May 2005. The fruits were placed in plastic trays containing a layer of thin sand, as a substrate for pupa phase. The puparia were quantified and kept in transparent plastic cups with sand until the emergence of the insects. Seven parasitoid species of the order Hymenoptera were identified, from which five belong to the family Braconidae: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, Utetes anastrephae (Viereck, Opius bellus Gahan and Opius sp., and two of the Figitidae: Aganaspis pelleranoi (Brèthes and Lopheucoila anastrephae Weld. Larvae of Tephritidae and Lonchaeidae infesting fruits of the six

  4. Diptera Brachycera found inside the esophagus of a mummified adult male from the early XIX century, Lisbon, Portugal

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri


    Full Text Available Fly puparia and adult fragments of diptera muscid were found inside the esophagus of a mummified body from the early XIX century, buried inside the crypt of the Sacrament Church (Lisbon, Portugal. The identification of the material revealed a monospecific colonization by Ophyra capensis (Wiedemann (Diptera: Muscidae, a species known to invade corpses in the ammoniacal fermentation wave. This species can be found in corpses kept indoors, not available to the early waves of blowflies (Diptera: Calliphoridae. In the present case, the number of pupae and their developmental stage suggest that the female invaded the mummified corpse through the partially opened mouth and the oviposition took place directly inside the esophagus. This is the first case of O. capensis infesting internal organs of an intact corpse. The use of chemical products for the embalming process probably explains why external colonization did not occur.

  5. Análise cladística de Euprepina Hull (Diptera, Bombyliidae, Bombyliinae Cladistic analysis of Euprepina Hull, (Diptera, Bombyliidae, Bombyliinae

    Directory of Open Access Journals (Sweden)

    Carlos José Einicker Lamas


    Full Text Available A cladistic analysis of Euprepina Hull, 1971 (Diptera, Bombyliidae, Bombyliinae, a Neotropical genus that includes ten species, was made. The cladogram was obtained from eight studied species, based on a data matrix with 21 characters, using the program Hennig86. Character states were polarized following outgroup analysis, and an hypothetical ancestor was included in the analysis in order to root the tree. The options used, "ie*" and "xs w", resulted in four most parsimonious trees with ci = 79, ri = 80 and length 115. The monophiletism of Euprepina was supported by two synapomorphies.

  6. Neolasioptera ramicola, a new species of Cecidomyiidae (Diptera associated with Physalis angulata (Solanaceae Neolasioptera ramicola, uma nova espécie de Cecidomyiidae (Diptera associada com Physalis angulata (Solanaceae

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia


    Full Text Available Neolasioptera ramicola Maia, a new species of Cecidomyiidae (Diptera that induces stem galls on Physalis angulata (Solanaceae is described and illustrated (larva, pupa, male, female and gall based on material from Bento Gonçalves, Rio Grande do Sul, Brazil.Neolasioptera ramicola Maia, uma nova espécie de Cecidomyiidae (Diptera que induz galhas caulinares em Physalis angulata (Solanaceae é descrita e ilustrada (larva, pupa, male, fêmea e galha com base em material coletado em Bento Gonçalves, Rio Grande do Sul, Brasil.

  7. A check list of necrophagous flies (Diptera: Calyptratae from urban area in Medellín, Colombia Lista de moscas necrófagas (Diptera: Calyptratae del área urbana del municipio de Medellín, Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Salazar-Ortega


    Full Text Available An updated checklist of necrophagous flies (Diptera, Calyptratae occurring in the urban area of Medellín-Colombia is presented. 27 species belonging to 4 families are reported. Data were obtained from field work and recent bibliography references.Se presenta una lista actualizada de moscas necrófagas (Diptera, Calyptratae presentes en el área urbana del municipio de Medellín. Se registran 27 especies incluidas en cuatro familias. Los datos se obtuvieron a partir de recolectas en campo y referencias bibliográficas.

  8. Seasonal patterns in tree swallow prey (Diptera) abundance are affected by agricultural intensification. (United States)

    Paquette, Sébastien Rioux; Garant, Dany; Pelletier, Fanie; Bélisle, Marc


    In many parts of the world, farmland bird species are declining at faster rates than other birds. For aerial insectivores, this decline has been related to a parallel reduction in the abundance of their invertebrate prey in agricultural landscapes. While the effects of agricultural intensification (AI) on arthropod communities at the landscape level have been substantially studied in recent years, seasonal variation in these impacts has not been investigated. To assess the contention that intensive cultures negatively impact food resources for aerial insectivorous birds, we analyzed the spatiotemporal distribution patterns of Diptera, the main food resource for breeding tree swallows Tachycineta bicolor), across a gradient of AI in southeastern Quebec, Canada. Linear mixed models computed from a data set of 5000 samples comprising >150,000 dipterans collected over three years (2006-2008) suggest that both Diptera abundance and biomass varied greatly during swallow breeding season, following a quadratic curve. Globally, AI had a negative effect on Diptera abundance (but not biomass), but year-by-year analyses showed that in one of three years (2008), dipterans were more abundant in agro-intensive landscapes. Analyses also revealed a significant interaction between the moment in the season and AI: In early June, Diptera abundances were similar regardless of the landscape, but differences increased as the season progressed, with highly intensive landscapes harboring fewer prey, possibly creating an "ecological trap" for aerial insectivores. While global trends in our results are in agreement with expectations (negative impact of Al on insect abundance), strong discrepancies in 2008 highlight the difficulty of predicting the abundance of insect communities. Our study indicates that predicting the effects of AI may prove more challenging than generally assumed, even when large data sets are collected, and that temporal variation within a season is important to take into

  9. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch


    Full Text Available Apesar do incentivo e do investimento na produção de frutas no estado do Paraná, pouca informação está disponível sobre as moscas-das-frutas, uma das principais pragas da fruticultura. O presente trabalho teve os objetivos de registrar pela primeira vez a fauna de tefritídeos, na região de Ponta Grossa, e caracterizar a sua comunidade por meio de diferentes índices faunísticos. Adultos de tefritídeos foram coletados por meio de frascos caça-moscas com atrativos alimentares em quatro pomares de agosto a dezembro de 2009. Foi coletado um total de 2.428 tefritídeos distribuídos em sete espécies: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann, Rhagoletis sp. Loew e Hexachaeta sp. Loew. A. fraterculus foi a única espécie comum aos quatro pomares, ocorrendo com frequência acima de 80%. Este é o primeiro registro de A. montei no Paraná. A. fraterculus, A. sororcula e C. capitata apresentaram os maiores índices de frequência, abundância, dominância e constância, sendo, portanto, consideradas espécies predominantes. O maior índice de diversidade (H'=0,4360 ocorreu no pomar 2, diferindo significativamente dos demais pomares (teste t, PIn spite of encouragement and investment in fruit production in the state of Paraná, little information is available on the fruit flies, a major pest in fruit growing. The present study had the objective of recording for the first time the tephritid fauna in the region of Ponta Grossa, and characterize the insect community through different faunal indices. Adult tephritids were collected by means of flapper bottles with food baits in four orchards from August to December 2009. A total of 2,428 tephritids distributed in seven species were collected: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann

  10. Implications of Rhagoletis zephyria, 1894 (Diptera: Tephritidae), captures for apple maggot surveys and fly ecology in Washington state, U.S.A (United States)

    The apple maggot, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), is an introduced quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in Washington state, U.S.A. A morphologically similar native fly, Rhagoletis zephyria Snow, 1894, infests snowberries (Symphoricarpos spp.) ...

  11. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza


    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  12. The Susceptibility and Behavioral Response of Anopheles Albimanus Weidemann and Anopheles Vestitipennis Dyar and Knab (Diptera: Culicidae) to Insecticides in Northern Belize, Central America (United States)


    33:205-211. 66 Marquetti, M.C.., A. Navarro and JA Bisset. 1990. Estudio de la actividad hematofagica de Anopheles vestitipennis Dyar & Knab, 1906...Garcia. 1986. Estudio estaeional de sitios de reposo de anophelinos (Diptera: Culicidae). [Studies of the resting places ofanophelines (Diptera...Anofelinos mexicanos . Taxonomia y distribucion [Mexican anophelines. Taxonomy and distribution]. Mex.., D.F.., ecr. Salubr. Assist. CNEP/SS~ 181 pp

  13. Temperature-mediated kill and oviposition of Western Cherry Fruit Fly (Diptera: Tephritidae) in the presence of Spinosad (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a quarantine pest of sweet cherry (Prunus avium (L.) L.) that is managed using insecticides, including spinosad, an organic compound that can be applied in low spray volumes. Identifying factors that can increase the...

  14. Impact of prolonged absence of low temperature on adult eclosion patterns of western cherry fruit fly (Diptera: Tephritidae) (United States)

    The western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the U.S.A. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in ...

  15. Reduction in Emergence of Rhagoletis indifferens (Diptera: Tephritidae) from Sweet Cherries with Different Egg and Larval Distributions Using Newer Insecticides (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is the major insect pest of sweet cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. To reduce fly populations in unharvested fruit following the completion of commercial harvest, it is important to cont...

  16. List of descriptions and other taxonomic proposals on american sand flies (Diptera, Psychodidae, Phlebotominae: 1975-1993

    Directory of Open Access Journals (Sweden)

    Carlos Brisóla Marcondes


    Full Text Available A check-list of new species, descriptions of other sex of previously described species, redescriptions, proposals of synonymy, and new status for species previously in synonymy or described as subspecies for american sand flies (Diptera, Psychodidae, Phlebotominae, for the period 1975-1993, and not included in the revision of Martins el at. (1978, are presented.

  17. Effect of fungus gnat Bradysia impatiens (Diptera: Sciaridae) feeding on subsequent Pythium aphanidermatum infection of geranium seedlings (Pelargonium x hortorum) (United States)

    Dark-winged fungus gnats in the genus Bradysia (Diptera: Sciaridae) and root rot pathogens in the genus Pythium (Oomycetes) are important pests of greenhouse floriculture. Observations have pointed to a possible correlation between Pythium root rot disease and fungus gnat infestations; however, inte...

  18. A new genus and species of Cecidomyiidae (Diptera) from leaf blister galls on Ribes (Grosulariaceae)in North America (United States)

    Ribesia sarae Gagné, new genus, new species(Diptera: Cecidomyiidae), is described from simple leaf blister galls on Ribes aureum(Grossulariaceae) from Montana. The female abdomen is superficially similar to that of CystiphoraKieffer and SackenomyiaFelt. The three genera are compared. Because of stro...

  19. House fly (Musca domestica) (Diptera: Muscidae) mortality after exposure to commercial fungal formulations in a sugar bait (United States)

    House flies (Musca domestica L.) (Diptera: Muscidae) are major pests of livestock. Biological control is an important tool in an integrated control framework. Increased mortality in filth flies has been documented with entomopathogenic fungi, and several strains are commercially available. Three str...

  20. Behavioral responses of Drosophila suzukii (Diptera: Drosophilidae) to visual stimuli under laboratory, semi-field, and field conditions (United States)

    Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) is an invasive pest in the United States that attacks soft-skinned ripening fruit such as raspberries, blackberries, and blueberries. Little is known regarding specific cues D. suzukii utilizes to locate and select host fruit, and inconsistenc...

  1. [The mushroom bodies of the lower nematocera: a link between those of the higher Diptera and other mecopteroids]. (United States)

    Panov, A A


    Nematoceran Diptera are nonuniform in the structure of their mushroom bodies. Members of the more basal families (Ptychopteridae, Pediciidae, and Tipulidae) have bipartite mushroom bodies, characteristic of members of the other mecopteroid complex orders. In members of Bibionomorpha (Bibionidae and Anisopodidae), tripartite mushroom bodies have been found characteristic of Brachycera Orthorrhapha.

  2. Laboratory Evaluation of Diflubenzuron as a Feed-Through for Control of Immature Sand Flies (Diptera: Psychodidae) (United States)


    Phlebotomine sand ßies are the vectors of the proto- zoan parasites that cause leishmaniasis. Sand ßies also are vectors of the disease agents Bartonella ...terrestrial larvae of several species of Diptera, including house ßies, Musca domestica L.; face ßies, Musca autumnalis De Geer; stable ßies, Stomoxys cal

  3. Nota sobre culicídeos (Diptera: Culicidae da bacia do rio Purus, Acre, Amazônia (Brasil

    Directory of Open Access Journals (Sweden)

    Delsio Natal


    Full Text Available Foram feitas coletas de mosquito (Diptera: Culicidae na área do projeto de Colonização Pedro Peixoto, no Estado do Acre, Brasil. Obteve-se um total de 4.588 exemplares pertencentes a 53 espécies ou grupos. Salienta-se a ocorrência de Anopheles (Nyssorhynchus oswaldoi.

  4. Attraction and Mortality of Oriental Fruit Flies (Diptera: Tephritidae) to SPLAT-MAT- Methyl Eugenol with Spinosad (United States)

    Studies were conducted in Hawaii to quantify attraction and feeding responses resulting in mortality of male oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to SPLAT-MAT-methyl eugenol (ME) with spinosad in comparison with Min-U-Gel-ME with naled (Dibrom). Our approach invol...

  5. The geographic distribution of Rhagoletis pomonella (Diptera:Tephritidae) in the western United States: Introduced species or native population? (United States)

    The apple maggot fly, Rhagoletis pomonella Walsh (Diptera: Tephritidae), is a major pest of commercially grown domesticated apple (Malus domestica) in North America. The shift of the fly from its native host hawthorn (Crataegus mollis) to apple in the eastern U.S. is often cited as an example of inc...

  6. Attractiveness of MM-X traps baited with human or synthetic odor to mosquitoes (Diptera: Culicidae) in The Gambia

    NARCIS (Netherlands)

    Qiu, Y.T.; Smallegange, R.C.; Braak, ter C.J.F.; Spitzen, J.; Loon, van J.J.A.; Jawara, M.; Milligan, P.; Galimard, A.M.S.; Beek, van T.A.; Knols, B.G.J.; Takken, W.


    Chemical cues play an important role in the host-seeking behavior of blood-feeding mosquitoes (Diptera: Culicidae). A field study was carried out in The Gambia to investigate the effects of human odor or synthetic odor blends on the attraction of mosquitoes. MM-X traps baited with 16 odor blends to

  7. Medical Entomology Studies - XI. The Subgenus Stegomyia of Aedes in the Oriental Region with Keys to the Species (Diptera: Culicidae) (United States)


    aegypti Linnaeus, 1762 ( Insecta , Diptera); proposed validation and interpretation under the plenary powers of the species so named. Z. N. (S.) 1216...Liverpool School of Tropical Medicine and Medical Parasitology. Part II. Filariasis. Mem. Lpool. Sch. Trop. Med. 4 (Ap. ) ii: l-14. Huang: Aedes

  8. Biological control of Tipula paludosa (Diptera : Nematocera) using entomopathogenic nematodes (Steinernema spp.) and Bacillus thuringiensis subsp israelensis

    NARCIS (Netherlands)

    Østergaard, J.; Belau, C.; Strauch, O.; Ester, A.; Rozen, van K.; Ehlers, R.U.


    Tipula paludosa (Diptera: Nematocera) is the major insect pest in grassland in Northwest Europe and has been accidentally introduced to North America. Oviposition occurs during late August and first instars hatch from September until mid-October. Laboratory and field trials were conducted to assess

  9. How Much Can Diptera-Borne Viruses Persist over Unfavourable Seasons? (United States)

    Charron, Maud V. P.; Balenghien, Thomas; Seegers, Henri; Langlais, Michel; Ezanno, Pauline


    Diptera are vectors of major human and animal pathogens worldwide, such as dengue, West-Nile or bluetongue viruses. In seasonal environments, vector-borne disease occurrence varies with the seasonal variations of vector abundance. We aimed at understanding how diptera-borne viruses can persist for years under seasonal climates while vectors overwinter, which should stop pathogen transmission during winter. Modeling is a relevant integrative approach for investigating the large panel of persistence mechanisms evidenced through experimental and observational studies on specific biological systems. Inter-seasonal persistence of virus may occur in hosts due to viremia duration, chronic infection, or vertical transmission, in vector resistance stages, and due to a low continuous transmission in winter. Using a generic stochastic modeling framework, we determine the parameter ranges under which virus persistence could occur via these different mechanisms. The parameter ranges vary according to the host demographic regime: for a high host population turnover, persistence increases with the mechanism parameter, whereas for a low turnover, persistence is maximal for an optimal range of parameter. Persistence in hosts due to long viremia duration in a few hosts or due to vertical transmission is an effective strategy for the virus to overwinter. Unexpectedly, a low continuous transmission during winter does not give rise to certain persistence, persistence barely occurring for a low turnover of the susceptible population. We propose a generic framework adaptable to most diptera-borne diseases. This framework allows ones to assess the plausibility of each persistence mechanism in real epidemiological situations and to compare the range of parameter values theoretically allowing persistence with the range of values determined experimentally. PMID:24023929

  10. How much can diptera-borne viruses persist over unfavourable seasons? (United States)

    Charron, Maud V P; Balenghien, Thomas; Seegers, Henri; Langlais, Michel; Ezanno, Pauline


    Diptera are vectors of major human and animal pathogens worldwide, such as dengue, West-Nile or bluetongue viruses. In seasonal environments, vector-borne disease occurrence varies with the seasonal variations of vector abundance. We aimed at understanding how diptera-borne viruses can persist for years under seasonal climates while vectors overwinter, which should stop pathogen transmission during winter. Modeling is a relevant integrative approach for investigating the large panel of persistence mechanisms evidenced through experimental and observational studies on specific biological systems. Inter-seasonal persistence of virus may occur in hosts due to viremia duration, chronic infection, or vertical transmission, in vector resistance stages, and due to a low continuous transmission in winter. Using a generic stochastic modeling framework, we determine the parameter ranges under which virus persistence could occur via these different mechanisms. The parameter ranges vary according to the host demographic regime: for a high host population turnover, persistence increases with the mechanism parameter, whereas for a low turnover, persistence is maximal for an optimal range of parameter. Persistence in hosts due to long viremia duration in a few hosts or due to vertical transmission is an effective strategy for the virus to overwinter. Unexpectedly, a low continuous transmission during winter does not give rise to certain persistence, persistence barely occurring for a low turnover of the susceptible population. We propose a generic framework adaptable to most diptera-borne diseases. This framework allows ones to assess the plausibility of each persistence mechanism in real epidemiological situations and to compare the range of parameter values theoretically allowing persistence with the range of values determined experimentally.

  11. Conservation of capa peptide-induced nitric oxide signalling in Diptera. (United States)

    Pollock, Valerie P; McGettigan, James; Cabrero, Pablo; Maudlin, Ian M; Dow, Julian A T; Davies, Shireen-A


    In D. melanogaster Malpighian (renal) tubules, the capa peptides stimulate production of nitric oxide (NO) and guanosine 3', 5'-cyclic monophosphate (cGMP), resulting in increased fluid transport. The roles of NO synthase (NOS), NO and cGMP in capa peptide signalling were tested in several other insect species of medical relevance within the Diptera (Aedes aegypti, Anopheles stephensi and Glossina morsitans) and in one orthopteran out-group, Schistocerca gregaria. NOS immunoreactivity was detectable by immunocytochemistry in tubules from all species studied. D. melanogaster, A. aegypti and A. stephensi express NOS in only principal cells, whereas G. morsitans and S. gregaria show more general NOS expression in the tubule. Measurement of associated NOS activity (NADPH diaphorase) shows that both D. melanogaster capa-1 and the two capa peptides encoded in the A. gambiae genome, QGLVPFPRVamide (AngCAPA-QGL) and GPTVGLFAFPRVamide (AngCAPA-GPT), all stimulate NOS activity in D. melanogaster, A. aegypti, A. stephensi and G. morsitans tubules but not in S. gregaria. Furthermore, capa-stimulated NOS activity in all the Diptera was inhibited by the NOS inhibitor l-NAME. All capa peptides stimulate an increase in cGMP content across the dipteran species, but not in the orthopteran S. gregaria. Similarly, all capa peptides tested stimulate fluid secretion in D. melanogaster, A. aegypti, A. stephensi and G. morsitans tubules but are either without effect or are inhibitory on S. gregaria. Consistent with these results, the Drosophila capa receptor was shown to be expressed in Drosophila tubules, and its closest Anopheles homologue was shown to be expressed in Anopheles tubules. Thus, we provide the first demonstration of physiological roles for two putative A. gambiae neuropeptides. We also demonstrate neuropeptide modulation of fluid secretion in tsetse tubule for the first time. Finally, we show the generality of capa peptide action, to stimulate NO/cGMP signalling and


    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho


    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  13. A pictorial key and diagnosis of the Brazilian genera of Micropezidae (Diptera, Nerioidea

    Directory of Open Access Journals (Sweden)

    Gustavo Borges Ferro


    Full Text Available A pictorial key and diagnosis of the Brazilian genera of Micropezidae (Diptera, Nerioidea. This paper provides the first pictorial key and diagnosis for the Brazilian genera of the Micropezidae, based on external morphological characters illustrated with photographs. The key includes 13 genera: Cardiacephala Macquart, Cliobata Enderlein, Grallipeza Rondani, Metasphen Frey, Micropeza Meigen, Parasphen Enderlein, Planipeza Marshall, Plocoscelus Enderlein, Poecilotylus Hennig, Ptilosphen Enderlein, Rainieria Rondani, Scipopus Enderlein and Taeniaptera Macquart. For each genus, the species known to occur in Brazil are listed and their distribution records, including new ones, are provided.

  14. Toxicity of Thiophenes from Echinops transiliensis (Asteraceae) against Aedes aegypti (Diptera: Culicidae) Larvae (United States)


    Toxicity of Thiophenes from Echinops transiliensis (Asteraceae) against Aedes aegypti (Diptera: Culicidae) Larvae by Hiroshi Nakano*a)b)c), Abbas...larvicides against Aedes aegypti . Structural differences among compounds 3, 5, and 8 consisted in differing AcO and OH groups attached to C(3’’) and C(, 4 (LC50 , 17.95 mg/ml), 6 (LC50 , 18.55 mg/ml), and 7 (LC50 , 19.97 mg/ml). These data indicated that A. aegypti larvicidal activities of

  15. A new record of Fannia pusio (Wiedemann) (Diptera:Fanniidae) from Malaysia. (United States)

    Omar, B; Kurahashi, H; Jeffery, J; Yasohdha, N; Lau, S Y; John, M C; Marwi, M A; Zuha, R M; Ahmad, M S


    Fannia pusio (Wiedemann) (Diptera: Fanniidae) is newly recorded from Malaysia. This record is based on 1male symbol 1female symbol from Sarawak, east Malaysia and 1male symbol 2female symbol from Selangor, peninsular Malaysia. It is included in the pusio group of Fannia wherein are included Fannia femoralis (Stein), Fannia howardi Malloch, Fannia trimaculata (Stein), Fannia leucosticta (Meigen) and Fannia punctiventris Malloch. The male of Fannia pusio is differentiated from other members of the group by the following features: hind femur with a swelling bearing a number of setae that are usually curled at tip; squamae creamy; tergite 1+2 broadly grey dusted at sides.

  16. Description of Lutzomyia (Pifanomyia robusta n. sp. (Diptera, Psychodidae, Phlebotominae from Peruvian Equadorean interandean areas

    Directory of Open Access Journals (Sweden)

    Eunice A. Bianchi Galati


    Full Text Available Description of Lutzomyia robusta, n. sp. (Diptera, Psychodidae, Phlebotominae from interandean areas of Peru and Equador. Lutzomyia robusta, n. sp., probable vector of human bartonellosis and cutaneous leishmaniasis, is described and illustrated. This species presents strong affinity with L. serrana (Damasceno & Arouck, 1949 but they can be distinguished by variance analysis of four male characteristics and only one female characteristic. In the variance analysis, populations of L. serrana, of Amazonian areas of Brazil, Peru and Bolivia, the coast of Equador and other areas of Brazil were studied. The synonymy of Lutzomyia guayasi (Rodriguez and L. serrana was corroborated.

  17. A sex pheromone receptor in the Hessian fly Mayetiola destructor (Diptera, Cecidomyiidae

    Directory of Open Access Journals (Sweden)

    Martin N. Andersson


    Full Text Available The Hessian fly, Mayetiola destructor Say (Diptera, Cecidomyiidae, is a pest of wheat and belongs to a group of gall-inducing herbivores. This species has a unique life history and several ecological features that differentiate it from other Diptera such as Drosophila melanogaster and blood-feeding mosquitoes. These features include a short, non-feeding adult life stage (1-2 days and the use of a long-range sex pheromone produced and released by adult females. Sex pheromones are detected by members of the odorant receptor (OR family within the Lepidoptera, but no receptors for similar long-range sex pheromones have been characterized from the Diptera. Previously, 122 OR genes have been annotated from the Hessian fly genome, with many of them showing sex-biased expression in the antennae. Here we have expressed, in HEK293 cells, five MdesORs that display male-biased expression in antennae, and we have identified MdesOR115 as a Hessian fly sex pheromone receptor. MdesOR115 responds primarily to the sex pheromone component (2S,8E,10E-8,10-tridecadien-2-yl acetate, and secondarily to the corresponding Z,E-isomer. Certain sensory neuron membrane proteins (i.e., SNMP1 are important for responses of pheromone receptors in flies and moths. The Hessian fly genome is unusual in that it encodes six SNMP1 paralogues, of which five are expressed in antennae. We co-expressed each of the five antennal SNMP1 paralogues together with each of the five candidate sex pheromone receptors from the Hessian fly and found that they do not influence the response of MdesOR115, nor do they confer responsiveness in any of the non-responsive ORs to any of the sex pheromone components identified to date in the Hessian fly. Using Western blots, we detected protein expression of MdesOrco, all MdesSNMPs, and all MdesORs except for MdesOR113, potentially explaining the lack of response from this OR. In conclusion, we report the first functional characterization of an OR from the

  18. Wing pattern variation in the Patagonian biting midge, Forcipomyia (Forcipomyia multipicta Ingram & Macfie (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    Gustavo R. SPINELLI


    Full Text Available Examination of the type-series and non-type specimens of the Patagonian biting midge, Forcipomyia (Forcipomyia multipicta Ingram & Macfie (Diptera: Ceratopogonidae, revealed considerable variation in wing patterns of both sexes. One pattern includes several distinct light spot areas, whereas another pattern (e.g, in the holotype only features marginal light spots in cell r3, while other light spots are barely perceptible or absent. The cause(s of the differential lack of dark macrotrichia in certain areas of the wing membrane in specimens of some series could not be attributed either to their age, sex, or method of preservation.

  19. Parasitoid wasps (Hymenoptera from puparia of sarcosaprophagous flies (Diptera: Calliphoridae; Sarcophagidae in Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    Adriana OLIVA


    Full Text Available Se registró la emergencia de parasitoides (Hymenoptera de crías experimentales de Diptera sarcosaprófagas (Calliphoridae, Sarcophagidae, atraídas a cebos de carne bovina, en Buenos Aires (Argentina durante 1998-2003. Se determinaron cuatro taxones: Tachinaephagus zealandicus Ashmead (Encyrtidae, Brachymeria podagrica (Fabricius (Chalcididae, Nasonia vitripennis (Walker (Pteromaliidae y Alysia sp. (Braconidae: Alysiinae. Sólo las dos primeras especies resultaron abundantes en todos los años. Se ha graficado el número total de emergencias de cada especie para cada mes, junto con las temperaturas promedio máxima y mínima.

  20. Taxonomic notes and new records of the genus Tabanus Linnaeus 1758 (Diptera: Tabanidae) from Malaysia (United States)

    Al-Talafha, Hazem; Yaakop, Salmah Binti; Ghani, Idris Bin Abd


    Horsefly (Diptera: Tabanidae) fauna of Malaysia consists currently of 120 species belonging to eight genera. The present study added four new records to this hematophagous family. The new records were Tabanus crassus (Walker, 1850), T. griseipalpis Schuurmans Stekhoven (1926), T. melanognathus (Bigot, 1890), and T. mesogaus Burton (1978). Tabanus auricircus Philip (1979) was recorded here for the first time from peninsular Malaysia, whereas T. perakiensis Ricardo (1911) was recorded from Sabah for the first time. Key characters for new records were illustrated based on the examined materials and range of distribution for each species was given.

  1. Revision of the genus Melanagromyza in California, with descriptions of three new species (Diptera: Agromyzidae). (United States)

    Shi, Li; Gaimari, Stephen D


    The 27 Californian species of the genus Melanagromyza Hendel (Diptera: Agromyzidae) are reviewed, including descriptions of three new species (Melanagromyza californiana sp. nov., M. chemsaki sp. nov. and M. gonzalesina sp. nov.) and the first record for one species (Melanagromyza martini Spencer) for California and the USA. All species in California are described or redescribed, with illustrations and photographs, and a key to the species is presented. Maps for the species in California, along with host distributions, are provided, with comments on biology and host plants.

  2. A new species, new immature stages, and new synonymy in Australian Dasybasis flies (Diptera: Tabanidae: Diachlorini). (United States)

    Ferguson, David J; Yeates, David K


    Australian beach sand is a productive habitat for lower brachyceran fly larvae but often overlooked by collectors. We collected two species of tabanid larvae from coastal beach sand in southern New South Wales in August 2013. Both species belong to the Dasybasis macrophthalma species-group of Mackerras (1959), one a new species, and the other D. exulans (Erichson, 1842). We describe both new immature stages and the new species adult as Dasybasis rieki sp. nov. (Diptera: Tabanidae: Diachlorini). Trojan (1994b) elevated the D. macrophthalma species group to the genus Sznablius. We review the evidence for the generic status of Sznablius, and synonymize it with Dasybasis.

  3. A review of the New World Coproica (Diptera: Sphaeroceridae) with a description of 8 new species. (United States)

    Bergeron, Matthew D; Marshall, Stephen A; Swann, John E


    The New World species of Coproica Rondani, 1861 (Diptera: Sphaeroceridae) are reviewed on the basis of over 17,000 examined specimens. The genus is divided into three major clades: the C. acutangula, C. vagans, and C. urbana species groups. Eight new species (C. bifurcata, C. bispatha, C. brachystyla, C. diabolica, C. emarginata, C. galapagosensis, C. novacula, and C. testudinea) are described, and redescriptions are provided for eleven additional species. Included are two keys (one for the twenty New World species only and one for all described species), updated New World distribution records, and illustrations of male and female genitalic structures.

  4. Phthiria sharafi sp. nov., a new record of the subfamily Phthiriinae (Bombyliidae, Diptera) from Saudi Arabia. (United States)

    El-Hawagry, Magdi S; Al Dhafer, Hathal M


    This new species (Phthiria sharafi sp. nov.) represents the first record of the subfamily Phthiriinae (Bombyliidae, Diptera) from Saudi Arabia. The species was collected from Garf Raydah Protected Area, Abha, Asir Province, south-western part of Saudi Arabia, using a Malaise trap erected in a site rich in olive, cactus and Juniper trees. The type locality has an Afrotropical influence, with the Afrotropical elements predominant, and a closer affiliation to the Afrotropical region than to the Palearctic region or the Eremic zone. 

  5. Origin and development of the tergotrochanteral muscle in Chironomus (Diptera: Nematocera). (United States)

    Lebart-Pedebas, M C


    The origin and the development of the tubular tergo-trochanteral muscle (TTD) was studied by light and electron microscopy in Chironomus (Diptera: Nematocera). Unlike the flight muscles, the TTD was found to develop from myoblasts located around a larval axon, without contribution from a larval muscle. The myoblasts fuse together to form myotubes. Innervation of the TTD arises from the larval axon. The myotubes send out sarcoplasmic extensions towards the axon branches issued from the larval axon. The first differentiated synapses are described. The TTD begins to grow later than the flight muscles. The implications of this developmental lag are discussed.

  6. New locality record of Isomyia paurogonita Fang & Fan, 1986 (Diptera: Calliphoridae) from Peninsular Malaysia and Borneo. (United States)

    Heo, C C; Aisha, S; Kurahashi, H; Omar, B


    Isomyia paurogonita Fang & Fan, 1986 (Diptera: Calliphoridae), a rare species of the subfamily Rhiniinae (tribe Cosminini) was recorded for the first time in Malaysia. We collected one male and two females during a field trip conducted at Genting Highland, Pahang, peninsular Malaysia in May 2011. A 3-day old cow liver was offered as attractant and dipterans collected were transferred to the laboratory for specimens processing and identification. The adults of I. paurogonita were attracted to the odour and then captured by using a sweep net. Isomyia paurogonita was also recorded from two other localities in Peninsular and Malaysian Borneo, namely Gombak Utara, Selangor and Sibu, Sarawak.

  7. [Mosquitoes (Diptera, Culicidae) of Smir marshes (northwest of Morocco): inventory and biotypology]. (United States)

    El Joubari, M; Louah, A; Himmi, O


    The Smir marshes are a favorable environment for the growth of many mosquitoes (Diptera, Culicidae). The inventory of Culicidae species reveals 14 species, is 33% of the species of Morocco, distributed in four genera: Culex, Culiseta, Ochlerotatus and Anopheles (with 5, 2, 5 and 2 species respectively) which Anopheles labranchiae, vector of the agent of the malaria in Morocco until 2004. In this study, we investigated the spatiotemporal mesological affinities and we tried to explain the biotypology of mosquito populations of the site. These analyzes revealed several groups of stations and species according to various parameters, especially salinity.

  8. Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae preying on Microtheca spp. (Coleoptera: Chrysomelidae larvae

    Directory of Open Access Journals (Sweden)

    VS Sturza

    Full Text Available Microtheca spp. (Coleoptera: Chrysomelidae are insect pests primarily related to Brassicaceae crops. In the State of Rio Grande do Sul (RS, southern Brazil, they are found on forage turnip, Raphanus sativus L. var. oleiferus Metzg., which is commonly grown during fall/winter seasons. This work reports the predation of Microtheca spp. larvae by Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae larvae, on forage turnip crop, in Santa Maria, RS. This register provides new information about Microtheca spp. natural enemies in Brazil, which might be a new option for integrate pest management of these species.

  9. Complete mitochondrial genome of the Antarctic midge Parochlus steinenii (Diptera: Chironomidae). (United States)

    Kim, Sanghee; Kim, Hanna; Shin, Seung Chul


    Parochlus steinenii is a winged midge found in the Antarctic Peninsula and its offshore islands. We determined the complete mitochondrial genome sequence of P. steinenii, which is comprised of 16 803 nucleotides and contains 13 protein-coding genes (PCGs), 22 tRNA genes, and the large (rrnL) and small (rrnS) rRNA genes. Its total A + T content is 72.5%. The PCG arrangement of P. steinenii is identical to that of the ancestral Diptera ground pattern. This is the first report on the mitogenome sequence of an Antarctic midge, and provides insights into the evolution of dipterans in Antarctica.

  10. Culex Verutus, a New Species of the Subgenus Culex (Diptera: Culicidae) from Sierra Leone (United States)


    216 Cu7ex verutus, a new species of the subgenu s1 Cu7ex (Diptera: Culicidae) from Sierra Leone Ralph E. Harbach’ Walter Reed Biosystematics...sp. from Sierra Leone are described and illus- trated. The new species is compared to other members of the guiarti group. This paper describes species of Cu7ex collected in Sierra Leone by Dr. Yiau-Min Huang and Mr. James Pecor during field studies conducted in 1984. The species has been

  11. Sex-biased captures of sarcosaprophagous Diptera in carrion-baited traps. (United States)

    Martín-Vega, Daniel; Baz, Arturo


    The use of carrion-baited traps is a common and widely extended practice in the study of sarcosaprophagous Diptera. However, it implies different areas of bias, one of them being the different responses of males and females to carrion bait, which results in possible biased sex ratios in the captures. In the present study, the use of carrion-baited traps revealed significant female-biased captures in the families Calliphoridae, Muscidae, and Sarcophagidae, whereas the collected species of the families Piophilidae, Heleomyzidae, and Ulidiidae showed different patterns in the observed sex ratios. Possible explanations according to existing literature and the types of mating behaviors of the different families are discussed.

  12. Estirpes de Bacillus thuringiensis efetivas contra insetos das ordens Lepidoptera, Coleoptera e Diptera Bacillus thuringiensis strains effective against insects of Lepidoptera, Coleoptera and Diptera orders

    Directory of Open Access Journals (Sweden)

    Lílian Botelho Praça


    Full Text Available O objetivo deste trabalho foi selecionar entre 300 estirpes de Bacillus thuringiensis as efetivas simultaneamente contra larvas de Spodoptera frugiperda J.E. Smith e Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae, Anthonomus grandis Boheman (Coleoptera: Curculionidae, Aedes aegypti Linnaeus e Culex quinquefasciatus Say (Diptera: Culicidae. Foram selecionadas duas estirpes de B. thuringiensis, denominadas S234 e S997, que apresentaram atividade contra as três ordens de insetos. As estirpes foram caracterizadas por métodos morfológicos, bioquímicos e moleculares. As mesmas apresentaram duas proteínas principais de 130 e 65 kDa, produtos de reação em cadeia da polimerase de tamanho esperado para a detecção dos genes cry1Aa, cry1Ab, cry1Ac, cry1B e cry2 e cristais bipiramidais, cubóides e esféricos.The aim of this work was to select among 300 strains of Bacillus thuringiensis those which are simultaneously effective against larvae of Spodoptera frugiperda J.E. Smith and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae, Anthonomus grandis Boheman (Coleoptera: Curculionidae, Aedes aegypti Linnaeus and Culex quinquefasciatus Say (Diptera: Culicidae. Two strains of B. thuringiensis were selected, S234 and S997, which presented activity against those three insect orders. Both strains were characterized by morphological, biochemical and molecular methods. They have presented two main proteins with 130 and 65 kDa, polimerase chain reaction products with expected sizes for detection of the genes cry1Aa, cry1Ab, cry1Ac, cry1B and cry2 and bipiramidal, cubical and spherical crystals.

  13. Taxonomia e morfologia de espécies neotropicais de Graphomya Robineau-Desvoidy (Diptera, Muscidae Taxonomic study of neotropical species of Graphomya Robineau-Desvoidy (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Bianca Marques


    Full Text Available Graphomya Robineau-Desvoidy (Diptera, Muscidae pode ser reconhecido por padrões cromáticos característicos no mesonoto e abdômen e pelas cerdas catepisternais 0:2. Das 14 espécies citadas na literatura para a Região Neotropical, sete são redescritas, com descrições das terminálias masculina e feminina - G. analis (Macquart, G. maculata (Scopoli, G. meridionalis Townsend, G. mexicana Giglio-Tos, G. occidentalis Arntfield, G. podexaurea(Enderlein e G. tropicalis Malloch, aqui revalidada. Ilustrações coloridas do mesonoto e do abdômen são apresentadas para facilitar o reconhecimento das espécies. O neótipo de G. maculata é designado. A fêmea de G. podexaurea é registrada pela primeira vez. O registro geográfico das seguintes espécies é ampliado: G. meridionalis para o Equador e Peru; G. mexicana e G. podexaurea para o Brasil; G. tropicalis para Colômbia e Brasil.Graphomya Robineau-Desvoidy (Diptera, Muscidae is recognized by characteristic color patterns on mesonotum and abdomen and by the disposition of the katepisternal setae 0:2. From the 14 species recorded in the Neotropical Region, seven are redescribed with the descriptions of male and female terminalia - G. analis (Macquart, G. maculata (Scopoli, G. meridionalis Townsend, G. mexicana Giglio-Tos, G. occidentalis Arntfield, G. podexaurea(Enderlein and G. tropicalis Malloch, herein revalidated. Colored illustrations of mesonotum and abdomen are presented in order to aid the recognition of the species. The neotype of G. maculata is designated. The female of G. podexaurea is recorded for the first time. The geographic record of the following species is enlarged: G. meridionalis for Ecuador and Peru; G. mexicana and G. podexaurea for Brazil and G. tropicalis for Colombia and Brazil.

  14. Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae in Southern Pantanal, Brazil Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae no Pantanal Sul-mato-grossense, Brasil

    Directory of Open Access Journals (Sweden)

    Wilson Werner Koller


    Full Text Available Cochliomyia macellaria (Diptera: Calliphoridae, known as the secondary screwworm, occurs in the Americas and has medical-veterinary and forensic importance. This study aimed to describe the seasonal fluctuation of this species in the Pantanal region, Central-Western Brazil. From December 2004 to November 2007 fly catches using four windoriented traps baited with decaying bovine liver were carried out at the Nhumirim ranch, Nhecolândia subregion, Southern Pantanal. Traps remained active throughout the study period and collections were carried out on a weekly basis. A total of 159,397 Calliphoridae were caught and C. macellaria (57.33% was the most abundant species. C. macellaria occurred all over the year showing a bimodal behavior with peaks in May-July (late autumn/early winter and October-December (spring.Cochliomyia macellaria (Diptera: Calliphoridae, conhecida como mosca-varejeira, ocorre no continente americano e apresenta importância médico-veterinária e forense. O presente estudo teve como objetivo conhecer a flutuação sazonal dessa espécie na região do Pantanal. De dezembro/2004 a novembro/2007 foram realizadas coletas de dípteros na fazenda Nhumirim, sub-região da Nhecolândia, Pantanal sul-mato-grossense. Foram utilizadas quatro armadilhas orientadas pelo vento, iscadas com fígado bovino deteriorado. As armadilhas permaneceram ativas durante todo o período de estudo, e coletas foram realizadas semanalmente. Foram capturados 159.397 califorídeos, sendo C. macellaria (57,33% a espécie mais abundante. C. macellaria foi observada em todos os meses do ano, apresentando comportamento bimodal com picos populacionais em maio/julho (final de outono/início de inverno e outubro/dezembro (primavera.

  15. Indoor decomposition study in Malaysia with special reference to the scuttle flies (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Raja M. Zuha


    Full Text Available Scuttle flies (Diptera: Phoridae are a diversified insect group of forensic importance. Their frequent presence on human corpses indoors and in concealed environments can be the sole indicators to estimate the minimum post mortem interval (PMImin. However, bionomics of scuttle flies on decomposing animal carcasses are rarely documented indoors. The objective of this research is to observe and document the occurrence of scuttle flies on decomposing animal carcass placed inside a portable cabin maintained at room temperature (≈25.0 °C in Bangi, Malaysia. This study was conducted in two rounds for a period of 40-day each and samplings were carried out in different intervals. Adult scuttle flies were aspirated directly from the carcass and preserved in 70% ethanol. Their larvae and pupae were reared until adult stage to facilitate identification. Megaselia scalaris (Loew, Megaselia spiracularis (Schmitz and Dohrniphora cornuta (Bigot were the scuttle flies found on the carcasses with M. scalaris being the earliest and dominant to colonize the body. This cosmopolitan species proved to be the best indicator to estimate PMImin indoor but in the increased presence of other fly species, it might be relegated to a secondary role. The scuttle flies were also found to coexist with other dipterans of forensic importance in an indoor environment, mainly Chrysomya megacephala (Fabricius (Diptera: Calliphoridae. This information expands the knowledge on the bionomics of scuttle flies on decomposing animal remains indoors.

  16. Transcriptomes of three species of Tipuloidea (Diptera, Tipulomorpha) and implications for phylogeny of Tipulomorpha (United States)

    Kang, Zehui; Zhang, Xiao; Ding, Shuangmei; Tang, Chufei; Wang, Yuyu; de Jong, Herman; Cameron, Stephen L.; Wang, Mengqing; Yang, Ding


    Tipulomorpha has long been a problematic taxon in terms of familial composition, phylogenetic relationships among families and position relative to other ‘lower’ Diptera. Whole-transcriptome shotgun sequencing provides a powerful basis for phylogenetic studies. We performed de novo transcriptome sequencing to produce the first transcriptome datasets representing the families Pediciidae, Limoniidae and Cylindrotomidae using high-throughput sequencing technologies. We assembled cDNA libraries for Pedicia vetusta (Alexander) (Pediciidae), Rhipidia sejuga Zhang, Li and Yang (Limoniidae) and Liogma simplicicornis Alexander (Cylindrotomidae). Using the Illumina RNA-Seq method, we obtained 28,252, 44,152 and 44,281 unigenes, from the three respective species. Based on sequence similarity searches, 12,475 (44.16%), 20,334 (46.05%) and 17,478 (39.47%) genes were identified. Analysis of genes highly conserved at the amino acid sequence level revealed there were 1,709 single-copy orthologs genes across the analyzed species. Phylogenetic trees constructed using maximum likelihood (ML) based on the 1,709 single-copy orthologs genes indicated that the relationship between the four major infraorders of lower Diptera was: Culicomorpha + (Tipulomorpha + (Psychodomorpha + (Bibionomorpha + Brachycera))). Trichoceridae belongs within Tipulomorpha as the sister-group of Tipuloidea. Highly supported relationships within the Tipuloidea are Pediciidae + (Limoniidae + (Cylindrotomidae + Tipulidae)). Four-cluster likelihood mapping was used to study potential incongruent signals supporting other topologies, however, results were congruent with the ML tree. PMID:28264066

  17. The mitochondrial genome of the garden pea leafminer Chromatomyia horticola (Goureau, 1851) (Diptera: Agromyzidae). (United States)

    Wang, You-Zhu; Jin, Gui-Hua; Zhu, Jia-Ying; Wei, Shu-Jun


    Here we report the mitochondrial genome sequence of the garden pea leafminer Chromatomyia horticola (Goureau, 1851) (Diptera: Agromyzidae) (GenBank accession no. KR047789). This is the first species with sequenced mitochondrial genome from the genus Chromatomyia. The current length with partial A  +  T-rich region of this mitochondrial genome is 15,320 bp with an A  +  T content of 77.54%. All the 13 protein-coding, two rRNA, and 22 tRNA genes were sequenced, except for the A  +  T-rich region. As in most other sequenced mitochondrial genomes of Diptera, there is no rearrangement compared with the pupative ancestral arrangement of insects. All protein-coding genes start with the ATN start codon except for the gene cox1, which uses abnormal TTG. The A  +  T-rich region is located between rrnS and trnI with a sequenced length of 503 bp. Phylogenetic analysis using the Bayesian method based on the first and second codon positions of the 13 protein-coding genes recovered the monophyly of Agromyzidae with one species of Chromatomyia and four species of Liriomyza in our study. The superfamily Oestroidea (with Agromyzidae in analysis) is sister to the Opomyzoidea.

  18. Description of the male of Lepidodexia (Xylocamptopsis teffeensis (Townsend (Diptera, Sarcophagidae

    Directory of Open Access Journals (Sweden)

    Karlla Patrícia Silva


    Full Text Available Description of the male of Lepidodexia (Xylocamptopsis teffeensis (Townsend (Diptera, Sarcophagidae. The male of Lepidodexia (Xylocamptopsis teffeensis (Townsend, 1927 is described and illustrated for the first time based on material housed in the entomological collection of Museu Nacional, Rio de Janeiro (MNRJ. This monotypic subgenus has been recorded in the Brazilian Amazon Rainforest, first in the state of Amazonas and now in the state of Pará. The general structure of the male terminalia is similar that of other Lepidodexia, especially of the subgenus Lepidodexia, by the short distiphallus, juxta with apical projection, and vesica with a membranous spinous lobe.Descrição do macho de Lepidodexia (Xylocamptopsis teffeensis (Townsend, 1927 (Diptera: Sarcophagidae. O macho de Lepidodexia (Xylocamptopsis teffeensis é descrito e ilustrado pela primeira vez, com base em material depositado na coleção entomológica do Museu Nacional, Rio de Janeiro (MNRJ. Esse subgênero monotípico tem sido registrado na Floresta Amazônica brasileira, primeiramente no estado do Amazonas e agora no Pará. A estrutura geral da terminália masculina é similar a de outras espécies de Lepidodexia, especialmente do subgênero Lepidodexia, pelo distifalo curto, juxta com projeção apical e vesica com lobo membranoso e espinhoso.

  19. The adult head morphology of the hessian fly Mayetiola destructor (Diptera, Cecidomyiidae). (United States)

    Schneeberg, Katharina; Polilov, Alexey; Harris, Marion O; Beutel, Rolf G


    The adult head of the Hessian fly Mayetiola destructor was examined and described in detail. Morphological features are evaluated with respect to phylogenetic implications and possible effects of miniaturisation. Preserved groundplan features of Diptera are the orthognathous orientation of the head, the vestiture of small microtrichia (possible autapomorphy), filiform antennae inserted frontally between the compound eyes, the presence of a clypeolabral muscle (possible autapomorphy), the presence of labellae (autapomorphy), and the presence of only one premental retractor. Potential synapomorphies of the groups assigned to Bibionomorpha are the origin of M. tentorioscapalis medialis on the frons and the loss of M. craniolacinialis. Further apomorphies of Cecidomyiidae identified in Mayetiola are the unusually massive anterior tentorial arm, the absence of the labro-epipharyngeal food channel, the absence of the lacinia, and the presence of antennal sensilla connected by a seta, a feature not known from any other group of Diptera. The very large size of the compound eyes (in relation to the entire head surface) and the complete loss of ocelli are possible effects of miniaturization. The large size of the brain (in relation to the cephalic lumen), the unusual shape of the optic lobes, and the absence of the frontal ganglion as a separate structure are probably also linked with size reduction.

  20. Permethrin resistance in Aedes albopictus (Diptera: Culicidae) and associated fitness costs. (United States)

    Chan, Hiang Hao; Zairi, Jaal


    Insecticide resistance has become a serious issue in vector management programs. Information on insecticidal resistance and its associated mechanisms is important for successful insecticide resistance management. The selection of a colony of permethrin-resistant Aedes albopictus (Skuse) (Diptera: Culicidae), originating from Penang Island, Malaysia, yielded high larval-specific resistance to permethrin and cross-resistance to deltamethrin. Synergism assays showed that the major mechanism underlying this resistance involves cytochrome P450 monooxygenase. The resistance is autosomal, polygenically inherited and incompletely dominant (D = 0.26). Resistant larvae were reared under different conditions to assess the fitness costs. Under high larval density, larval development time of the resistant SGI strain was significantly longer than the susceptible VCRU strain. In both high- and low-density conditions SGI showed a lower rate of emergence and survival compared with the VCRU strain. Resistant larvae were more susceptible to predation by Toxorhynchites splendens (Wiedemann) (Diptera: Culicidae) larvae. The body size of SGI females reared under high-density conditions was larger compared with females of the susceptible strain. SGI females survived longer when starved than did VCRU females. The energy reserve upon eclosion was positively correlated with the size of the adults.

  1. Stenomicra (Diptera: Opomyzoidea in Argentina, with information on the biology of the genus Stenomicra (Diptera: Opomyzoidea en Argentina, con información sobre la biología del género

    Directory of Open Access Journals (Sweden)

    Raúl E. Campos


    Full Text Available This is the first literature record of the genus Stenomicra Coquillett (Diptera: Periscelididae from South America (Neotropical Region. New information on the biological cycle of Stenomicra species in the wild is provided, and four species of the genus Eryngium L. (Apiaceae are recorded as host plants for immature stages of this taxon. The specimens of Stenomicra sp. were collected in Sierra de la Ventana, Buenos Aires province, Argentina.En este estudio, se publica por primera vez para Sudamérica (Región Neotropical el género Stenomicra Coquillett (Diptera: Periscelididae. Se aporta información sobre su ciclo biológico en condiciones naturales y se mencionan cuatro especies del género Eryngium L. (Apiaceae, como plantas hospedadoras de los estados inmaduros. Los ejemplares de Stenomicra sp. fueron colectados en Sierra de la Ventana, Provincia de Buenos Aires, Argentina.

  2. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae em pupas de fannia pusio (Wiedemann, 1830 (Diptera: fanniidae no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori


    Full Text Available Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae em pupas de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae is reported. Pupae of F. pusio were collected in traps using human feces to attract the adults. Ten pupae were obtained, of which two were parasitized by S. nigroaenea, thus demonstrating a parasitism rate of 20.0%.

  3. Anomalías morfológicas en diferentes estructuras de cinco especies de Lutzomyia (Diptera: Psychodidae Morphological abnormalities in different structures of five species of Lutzomyia (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    Daniela Vergara


    Full Text Available Se describen e ilustran diversos casos de anomalías morfológicas de cinco diferentes especies de Lutzomyia França (Diptera Psychodidae. Estas teratologías se observan en varias estructuras importantes para la identificación taxonómica de dichas especies. Los diferentes individuos pertenecientes a las especies L. columbiana, L. hartmanni, L. reburra, L. ayrozai y L. panamensis fueron capturados en diversos departamentos en Colombia.Diverse morphological anomalies in five different species of Lutzomyia França (Diptera: Pychodidae are described and illustrated. These theratologies are observed in various structures important for the taxonomic identification of the species. The different individuals that belong to the species L. columbiana, L. hartmanni, L. reburra, L. ayrozai and L. panamensis were captured in diverse departments in Colombia.

  4. Parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae coletados em pupários no substrato rim bovino Parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae collected in pupae in the bovine kidney

    Directory of Open Access Journals (Sweden)

    Jean Patrick Bonani


    Full Text Available Objetivou-se com este estudo, identificar as principais espécies de parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae, em Lavras, Minas Gerais, Brasil, cujas larvas foram alimentadas com rim bovino. As coletas foram realizadas durante o período de agosto de 2003 a março de 2004. Um total de 921 parasitóides foram coletados em 942 pupas dessa mosca. A prevalência natural de parasitismo foi de 97%.The study aimed at identifying the main parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae. The larvae were feed on bovine kidney. Samplings were conducted from August 2003 to March 2004, in Lavras, Minas Gerais State, Brazil. A total of 921 parasitoids in 942 pupae fly were collected. The prevalence natural parasitism was 97%.

  5. Eurytoma sp. (Hymenoptera: Pteromalidae como parasitóide de Fannia pusio (Wiedemann (Diptera: Fanniidae no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae as a parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    C.H. Marchiori


    Full Text Available This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae as parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  6. Eurytoma sp. (Hymenoptera: Pteromalidae) como parasitóide de Fannia pusio (Wiedemann) (Diptera: Fanniidae) no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae) as a parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) in Brazil


    C.H. Marchiori


    This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae) as parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  7. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae) em pupas de fannia pusio (Wiedemann, 1830) (Diptera: fanniidae) no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) in pupae of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) in Brazil


    Carlos Henrique Marchiori; Vanessa Alves Alvarenga


    Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) em pupas de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae), no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Cur...

  8. Leaf extracts of Melia azedarach Linnaeus (Sapindales: Meliaceae) act as larvicide against Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae) Extratos de folhas de Melia azedarach Linnaeus (Sapindales: Meliaceae) atuam como larvicida de Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae)



    The objective of this study was to compare the larvicidal effect of hydroethanolic extracts of fresh and dry leaves of Melia azedarach Linnaeus (Sapindales: Meliaceae) on Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae). All the extracts evaluated induced mortality among the third and fourth instar larvae of Aedes aegypti after 24 and 48 hours of exposure to the products. Although previous studies had demonstrated the action of seeds and fruits of Melia azedarach against the larvae of diff...

  9. Scanning Electron Microscopy Investigations of Third-Instar Larva of Cordylobia rodhaini (Diptera: Calliphoridae), an Agent of Furuncular Myiasis. (United States)

    Pezzi, M; Cultrera, R; Chicca, M; Leis, M


    A scanning electron microscopy study of the third larval instar of Cordylobia rodhaini Gedoelst (Diptera: Calliphoridae), causing obligatory furuncular myiasis, is presented here for the first time. The larvae were collected from a patient exposed to them in the tropical rainforest of Kibale National Park (Uganda). Distinctive features are described in sequence from the anterior region to the posterior region, highlighting the morphological features of antennae, maxillary palps, structures related to mouth opening, sensory structures, thoracic and abdominal spines, and anterior and posterior spiracles. The results are compared with those of other Calyptrata flies, mainly from the family Calliphoridae and, when possible, with Cordylobia anthropophaga Blanchard (Diptera: Calliphoridae), the only other species of genus Cordylobia investigated by scanning electron microscopy.

  10. Review of Thompsoniella Guimarães with description of a new species from Colombia (Diptera, Calliphoridae, Mesembrinellinae

    Directory of Open Access Journals (Sweden)

    Marta Wolff


    Full Text Available Review of Thompsoniella Guimarães with description of a new species from Colombia (Diptera, Calliphoridae, Mesembrinellinae. The Mesembrinellinae (Diptera, Calliphoridae are exclusively Neotropical with nine genera comprising 36 recognized species, including the genus Thompsoniella Guimarães with a single species, T. anomala Guimarães. We describe a new species, Thompsoniella andina sp. nov., from the Departments of Antioquia and Caldas, Colombia (Cordillera Central of the Andes, between 2600 - 2700 m and redescribe T. anomala. A key to the nine genera of Mesembrinellinae and a key to the males of the two species of Thompsoniella are provided. Color photographs to illustrate the two species of Thompsoniella and drawings of the male genitalia of both species are also provided. Here we record Thompsoniella for the first time in Colombia.

  11. Golden Ratio-Based and Tapered Diptera Inspired Wings: Their Design and Fabrication Using Standard MEMS Technology

    Institute of Scientific and Technical Information of China (English)

    X. Q. Bao; E. Cattan


    This work presents our understanding of insect wings, and the design and micromachining of artificial wings with golden ratio-based and tapered veins. The geometric anisotropy of Leading Edge Veins (LEVs) selected by Diptera has a function able to evade impact. As a Diptera example, the elliptic hollow LEVs of cranefly wings are mechanically and aerodynamically significant. In this paper, an artificial wing was designed to be a fractal structure by mimicking cranefly wings and incorporating cross-veins and discal cell. Standard technologies of Microelectromechanical Systems (MEMS) were employed to materialize the design using the selected material. One SU-8 wing sample, light and stiff enough to be comparable to fresh cranefly wings,was presented. The as-prepared SU-8 wings are faithful to real wings not only in weight and vein pattern, but also in flexural stiffness and mass distribution. Thus our method renders possible mimicking with good fidelity of natural wings with complex geometry and morphology.

  12. Mitochondrial genome sequences of Nematocera (lower Diptera): evidence of rearrangement following a complete genome duplication in a winter crane fly. (United States)

    Beckenbach, Andrew T


    The complete mitochondrial DNA sequences of eight representatives of lower Diptera, suborder Nematocera, along with nearly complete sequences from two other species, are presented. These taxa represent eight families not previously represented by complete mitochondrial DNA sequences. Most of the sequences retain the ancestral dipteran mitochondrial gene arrangement, while one sequence, that of the midge Arachnocampa flava (family Keroplatidae), has an inversion of the trnE gene. The most unusual result is the extensive rearrangement of the mitochondrial genome of a winter crane fly, Paracladura trichoptera (family Trichocera). The pattern of rearrangement indicates that the mechanism of rearrangement involved a tandem duplication of the entire mitochondrial genome, followed by random and nonrandom loss of one copy of each gene. Another winter crane fly retains the ancestral diperan gene arrangement. A preliminary mitochondrial phylogeny of the Diptera is also presented.

  13. Developmental Variation of Indian Thermophilic Variety of Scuttle Fly Megaselia (Megaselia) scalaris (Loew, 1866) (Diptera: Phoridae) on Different Substrates


    Abesh Chakraborty; Atanu Naskar; Panchanan Parui; Dhriti Banerjee


    The scuttle flies (Diptera: Phoridae) are important in forensic dipterology, because of their necrophagous habit. They are amongst the first wave of insects visiting human corpses in mechanically barricaded environments; hence their immature stages are generally used for estimation of PMI. The effect of different substrates commonly used for developmental studies was studied to analyze the variation of growth of the thermophilic variety of Megaselia (M.) scalaris prevalent in India on GDM, ED...

  14. Posterior spiracles of fourth instar larvae of four species of phlebotomine sand flies (Diptera: Psychodidae under scanning electron microscopy

    Directory of Open Access Journals (Sweden)

    Pessoa Felipe Arley Costa


    Full Text Available In the present study, posterior spiracles of laboratory-reared fourth instar larvae of Lutzomyia longipalpis, L. migonei, L. lenti, and L. whitmani (Diptera: Psychodidae of the State of Ceará, Brazil, were examined under scanning electron microscopy. The number of papillae of spiracles examined varied according to the species examined, but no intraspecific differences were found. The importance of this structure to sand fly larva identification and phylogeny is commented.

  15. Bush Blitz aids description of three new species and a new genus of Australian beeflies (Diptera, Bombyliidae, Exoprosopini)


    Christine Lambkin; Justin Bartlett


    Bush Blitz is a three-year multimillion dollar program to document the plants and animals in hundreds of properties across Australia’s National Reserve System. The core focus is on nature discovery – identifying and describing new species of plants and animals. The Bush Blitz program has enabled the collection and description of beeflies (Diptera, Bombyliidae) from surveys in Western Australia and Queensland. Three new species of Australian beeflies belonging to the Exoprosopini a...

  16. Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) as a natural enemy to Peckia chrysostoma (Wiedemann) (Diptera: Sarcophagidae), in Brazil. (United States)

    Marchiori, C H; Pereira, L A; Filho, O M


    This paper reports the first occurence of the parasite Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) which was collected from Peckia chrysostoma pupae (Diptera: Sarcophagidae) by means of traps containing some fish baits in a wood area close to the Agronomy college (Faculdade of Agronomia) in Itumbiara, Goiás, in the period from March to September, 2001. A total of 362 gregarious specimens of parasitoids from 26 pupae of P. chrysostoma. Aphaereta sp. was collected, with several individuals emerging from the same pupae.

  17. An illustrated catalogue of the types of Stratiomyidae (Diptera: Brachycera) in the collection of Museu Nacional, Rio de Janeiro, Brazil. (United States)

    Fachin, Diego Aguilar; Couri, Márcia Souto; De Mello-Patiu, Cátia Antunes


    A catalogue of the type specimens of Stratiomyidae (Diptera: Brachycera) held in the collection of Museu Nacional, Rio de Janeiro, Brazil (MNRJ) is presented. A total number of 50 type specimens of 18 valid Neotropical species were recognized and are listed in alphabetical order of subfamily, genus and specific epithet. Photos of 12 primary types of the species and bibliographical data of the original descriptions, labels and condition of all type specimens are also provided.

  18. Calycomyza hyptidis Spencer (Diptera,Agromyzidae: descriptions, redescriptions and first record in Ocimum basilicum (Lamiaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Viviane Rodrigues de Sousa


    Full Text Available Calycomyza hyptidis Spencer (Diptera, Agromyzidae: descriptions, redescriptions and first record in Ocimum basilicum (Lamiaceae in Brazil. All phases of the leafminer Calycomyza hyptidis Spencer are for the first time described, including the larva, puparium and adult female. Illustrations are presented for male and female terminalia, mine, larva and pupa. The species is first recorded in leaves of Ocimum basilicum L. (Lamiaceae in Brazil.

  19. Leaf extracts of Melia azedarach Linnaeus (Sapindales: Meliaceae) act as larvicide against Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae)



    The objective of this study was to compare the larvicidal effect of hydroethanolic extracts of fresh and dry leaves of Melia azedarach Linnaeus (Sapindales: Meliaceae) on Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae). All the extracts evaluated induced mortality among the third and fourth instar larvae of Aedes aegypti after 24 and 48 hours of exposure to the products. Although previous studies had demonstrated the action of seeds and fruits of Melia azedarach against the larvae of diff...

  20. [Parasitic effect of Opius concolor (Spzl) (Hymenoptera, Braconidae) on an intermediate host Ceratitis capitata Wied (Diptera, Trypetidae)]. (United States)

    Ben Hamouda, M H; Ben Salah, H


    The parasitic incidence of Opius concolor (Hymenoptera, Braconidae) on a replacement host, Ceratitis capitata (Diptera, Trypetidae) was studied using polyacrylamide gel electrophoresis and immunoelectrophoresis methods. A noticeable modification of C. capitata proteins was observed when parasited by O. concolor. But the most important phenomenon is the finding of common antigens between the host and the parasite. These results are discussed with regard to trophic and parasitic behaviour of the parasite.

  1. Dasiops luzestelae: a new species of the genus dasiops rondani (diptera: lonchaeidae) associated with passion fruit crops in colombia


    Castro, Angela; Korytkowski, Cheslavo; Ebratt, Everth; Brochero, Helena L.


    Dasiops luzestelae n. sp. (Diptera: Lonchaeidae) is a species that previously was not described formally and is regarded as an undetermined pest affecting buds of Passiflora edulis f. flavicarpa Degener. This study evaluated material collected in 10 departments of Colombia where passion fruit crops constitute an important economic income. Data of geographical distribution and passion fruit crops associated with Dasiops luzestelae n. sp. are presented.

  2. How to inventory tropical flies (Diptera)--One of the megadiverse orders of insects. (United States)

    Borkent, Art; Brown, Brian V


    A new approach to inventory Diptera species in tropical habitats is described. A 150 x 266 m patch of cloud forest at Zurquí de Moravia, Costa Rica (10.047N, 84.008W) at 1585 meters asl was sampled with two Malaise traps for slightly more than one year (Sept. 12, 2012-Oct. 18, 2013). Further concomitant sampling with a variety of trapping methods for three days every month and collecting during a one-week intensive "Diptera Blitz", with 19 collaborators collecting on-site, provided diverse additional samples used in the inventory. Two other Costa Rican sites at Tapantí National Park (9.720N, 83.774W, 1600 m) and Las Alturas (8.951N, 82.834W, 1540 m), 40 and 180 km southeast from Zurquí de Moravia, respectively, were each sampled with a single Malaise trap to allow for beta-diversity assessments. Tapantí National Park was sampled from Oct. 28, 2012-Oct. 13, 2013 and Las Alturas from Oct. 13, 2012-Oct. 13, 2013. A worldwide group of 54 expert systematists are identifying to species level all 72 dipteran families present in the trap samples. Five local technicians sampled and prepared material to the highest curatorial standards, ensuring that collaborator efforts were focused on species identification. This project, currently in its final, third year of operation (to end Sept. 1, 2015), has already recorded 2,348 species and with many more yet expected. Unlike previous All Taxon Biodiversity Inventories, this project has attainable goals and will provide the first complete estimate of species richness for one of the four megadiverse insect orders in a tropical region. Considering that this is the first complete survey of one of the largest orders of insects within any tropical region of the planet, there is clearly great need for a consistent and feasible protocol for sampling the smaller but markedly more diverse smaller insects in such ecosystems. By weight of their species diversity and remarkable divergence of habit, the Diptera are an excellent model to

  3. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil Natural parasitism in fruit-flies in the fruticulture area of anagé, semi-arid of southwestern Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá


    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.Parasitoids are important natural control agents of tephritids and knowledge about the tritrophic relationships can support the management of these pests. This study aimed to estimate of parasitism indexes in fruit flies in 21 plant species and identify the species of parasitoids associated, in semiarid conditions of Southwestern Bahia. Eight hosts showed infestation by Anastrepha spp. and, of these, four occurred parasitism above 20.0%, of which: 20.8% (Ziziphus joazeiro L.; 21.3% (Spondias tuberosa L.; 32.4% (Spondias purpurea L. and 57.1% (Malpighia emarginata L.. The collected parasitoids belong to the Braconidae family, 89% of Doryctobracon areolatus and 11% of Asobara anastrephae.

  4. Seasonal, Locality, and Habitat Variation in Assemblages of Carrion-Associated Diptera in Gauteng Province, South Africa. (United States)

    Parry, N J; Mansell, M W; Weldon, C W


    Seasonal, spatial, and habitat responses of carrion-associated Diptera assemblages can provide valuable information about the presence or absence of species and their relative abundance, and thereby enhance understanding of their responses to environmental variables and how this may have an impact on forensic investigations. Three different nature reserves (localities) within the Municipality of Tshwane, South Africa, were selected to determine whether species assemblages of carrion-feeding flies differ between seasons, localities, and habitat types. A total of 59,511 adult Diptera, identified to 35 species in eight different families, were collected using modified Redtop hanging traps, baited with liver and fish, during four seasons in three different habitat types. Species assemblages differed temporally, with season being the main factor determining species diversity and not locality or habitat. However, savanna and human-disturbed habitats supported a higher abundance and species richness than grassland habitats. Areas adjacent to the localities, such as large urban expanses in Dinokeng or agricultural holdings in Rietvlei, led to an increase in the abundance and mean species richness of carrion-associated Diptera, and in increased numbers of pest or invasive species such as Chrysomya megacephala (F.). Despite this, the overall species assemblages present in human-disturbed areas were very similar to those recorded in natural habitats.

  5. "Jejenes" (Diptera: Simuliidae of Nahuel Huapi National Park, Patagonia, Argentina: Preliminary results "Jejenes" (Diptera: Simuliidae del Parque Nacional Nahuel Huapi, Patagonia, Argentina: Resultados preliminares

    Directory of Open Access Journals (Sweden)

    Luis M. Hernández


    Full Text Available The Simuliidae is a family of Diptera with approximately 2072 described species worldwide. The females of the majority of the species feed from vertebrates' blood, which makes them a significant plague that affects both men as well as cattle, birds, and other vertebrates. The objective of this paper is to create an inventory of Simuliidae and to reveal certain aspects of the biology and distribution of this family of aquatic insects in the Nahuel Huapi National Park. Moreover, information on the zoogeography of Simuliidae in Patagonia is provided. Five genera, 3 subgenera and 32 species Simuliidae are recorded from Patagonia: Cnesia (three spp., Cnesiamima (one sp., Gigantodax (14 spp., Paraustrosimulium (one sp., Simulium (Ectemnaspis (one sp., S. (Psaroniocompsa (one sp. and S. ( Pternaspatha (11 spp., At present, we have collected all five genera, one subgenus of Simulium (Pternaspatha, and 19 species of Simuliidae in the park, which amounts to 57% of the Simuliidae fauna in this area. Puerto Blest, a characteristic area of the High-Andean phytogeographical province (humid forest, showed the highest diversity of Simuliidae.Los simúlidos pertenecen a una familia de Diptera (Simuliidae con alrededor de 2.072 especies descritas a nivel mundial. Las hembras de la mayoría de las especies se alimentan con sangre de vertebrados, lo cual las convierte en importantes plagas que afectan tanto al hombre como al ganado, aves y otros vertebrados. Los objetivos de este trabajo son llevar a cabo un inventario de Simuliidae y dar a conocer algunos aspectos de la biología y la distribución de esta familia de insectos acuáticos en el Parque Nacional Nahuel Huapi, Argentina. Además, se proporciona información sobre la biogeografía de Simuliidae en la Patagonia. Cinco géneros, un subgénero y 32 especies de simúlidos han sido registrados para Patagonia: Cnesia (3 spp., Cnesiamima (1 sp., Gigantodax (14 spp., Paraustrosimulium (1 sp., Simulium

  6. Nematocera flies recorded in Serra do Courel, northwest Spain, May 2012 (Diptera: Anisopodidae, Blepharoceridae, Cylindrotomidae, Limoniidae, Pediciidae, Tipulidae and Trichoceridae) including descriptions of two new species of Limoniidae. (United States)

    Hancock, E Geoffrey; Hewitt, Stephen M; Horsfield, David; Lyszkowsi, Richard M; Macgowan, Iain; Ricarte, Antonio; Rotheray, Graham E; Watt, Kenneth


    During May 2012 Diptera were sampled in the Serro do Courel area of Lugo Province, Galicia, northwest Spain. The authors of this paper, members of the Malloch Society (see website) are active in attempting to understand the detailed ecology of flies. Much of this work is through targeting larval stages often with an emphasis on saproxylic situations. By rearing adults from larvae direct relationships between them and their detailed habitat requirements are established. The list of nematocerous Diptera that were sampled includes 36 species two of them new to science and records of six others new to the Iberian peninsula are provided. We describe Lipsothrix galiciensis Hancock & Hewitt sp. nov., and Prionolabis pjotri Hancock sp. nov. of the family Limoniidae and provide a key to adults of European Lipsothrix species. Such results from this brief opportunity indicate the potential of the area for further field work in these and other families of Diptera

  7. Foraging, Mating, and Thermoregulatory Behavior of Cyrtopogon willistoni Curran (Diptera: Asilidae

    Directory of Open Access Journals (Sweden)

    Kevin M. O'Neill


    Full Text Available The robber fly Cyrtopogon willistoni Curran was studied in SW Montana, where it was an opportunistic predator of relatively small insects from 25 families in 7 orders. The most common prey were Diptera (44% and Homoptera (21%, with Cicadellidae, Bibionidae, and Formicidae comprising 44% of the prey. The elaborate courtship behavior of males included audible airborne visual displays that made use of silvery-white combs of hairs on the males' foretarsi. While perching, the flies exhibited both lateral and dorsal basking postures, and were apparently capable of strong flight only when direct sunlight was available. I compare the foraging and courtship behaviors of C. willistoni to those of other Cyrtopogon, and their thermal responses to those of other robber flies in the same habitat.

  8. Molecular identification of sand flies (Diptera: Psychodidae) in eastern North America by using PCR-RFLP. (United States)

    Minter, Logan M; Yu, Tian; Florin, David A; Nukmal, Nismah; Brown, Grayson C; Zhou, Xuguo


    Sand flies (Diptera: Psychodidae) are small blood-feeding dipterans that are primary vectors of numerous human and livestock pathogens. Effective surveillance programs with accurate identification tools are critical in development and implementation of modern integrated pest management programs. Although morphological keys are available for North American species, identification can still be challenging owing to the nature of sample preparation and incompatibility with molecular or biochemical-based pathology assays. Further, the potential for introduction of Old World or other exotic species is not accounted for by current keys. Herein, we present the development and validation of a restriction fragment-length polymorphism-based molecular identification method. Specifically, cytochrome c oxidase subunit I, a mitochondrial DNA marker, was used to distinguish two species of adult sand flies indigenous to eastern North America with two exotic species not yet known to occur in the United States.

  9. Ovicidal activity of entomopathogenic hyphomycetes on Aedes aegypti (Diptera: Culicidae) under laboratory conditions. (United States)

    Luz, C; Tai, M H H; Santos, A H; Rocha, L F N; Albernaz, D A S; Silva, H H G


    The ovicidal activity of 21 hyphomycete fungi species against Aedes aegypti (L.) (Diptera: Culicidae) was tested. Fungi with ovicidal activity developed on high numbers of eggs (> or =70%) during 25 d of exposure. A clear ovicidal activity with low values of hatch (1.3-40%) was observed after 25 d of incubation with Isaria farinosa (Holm: Fries) Fries, Paecilomyces carneus (Duché & Heim) Brown & Smith, Paecilomyces marquandii (Massee) Hughes, Isaria fumosorosea (Wize), Metarhizium anisopliae (Metschnikoff) Sorokin, Penicillium sp., Paecilomyces lilacinus (Thom) Samson, Beauveria bassiana (Balsamo) Vuillemin, and Evlachovaea kintrischica Borisov & Tarasov. More than 63% of eggs hatched after 25-d exposures to 11 other fungi species deemed as ineffective. These are the first results to show the effects of entomopathogenic fungi against eggs of Ae. aegypti, and they suggest their potential as control agents of this vector.

  10. A survey of the family Muscidae (Diptera (except for Coenosiinae from Mbaracayú forest, Paraguay

    Directory of Open Access Journals (Sweden)

    Guilherme S. SCHÜHLI


    Full Text Available A survey of the Muscid (Diptera fauna of the Mbaracayú forest is presented. The forest is a UNESCO Biosphere Reserve located in Cuenca Alta del Río Jejuí, Canindeyú department, eastern Paraguay. The paper constitutes the first Muscid survey for Paraguay and contributes for the main priorities of the Paraguayan Plan Estratégico del Sistema Nacional de Áreas Silvestres Protegidas. The specimens were sampled in five different biomes within the park area during 1996. The sampling method employed continuous sampling with malaise traps. The survey accounted for 22 genera and 52 species, comprising four genera (Dolichophaonia Carvalho, Haematobia Le Peletier, Sarcopromusca Townsend, and Stomoxys Geoffroy and 21 species not yet registered for Paraguay. The results included sampled specimens information including biome, date and taxonomic position.

  11. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit. (United States)

    Gazit, Yoav; Kaspi, Roy


    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco.

  12. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis. (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro


    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  13. A fossil biting midge (Diptera: Ceratopogonidae) from early Eocene Indian amber with a complex pheromone evaporator (United States)

    Stebner, Frauke; Szadziewski, Ryszard; Rühr, Peter T.; Singh, Hukam; Hammel, Jörg U.; Kvifte, Gunnar Mikalsen; Rust, Jes


    The life-like fidelity of organisms captured in amber is unique among all kinds of fossilization and represents an invaluable source for different fields of palaeontological and biological research. One of the most challenging aspects in amber research is the study of traits related to behaviour. Here, indirect evidence for pheromone-mediated mating behaviour is recorded from a biting midge (Ceratopogonidae) in 54 million-year-old Indian amber. Camptopterohelea odora n. sp. exhibits a complex, pocket shaped structure on the wings, which resembles the wing folds of certain moth flies (Diptera: Psychodidae) and scent organs that are only known from butterflies and moths (Lepidoptera) so far. Our studies suggests that pheromone releasing structures on the wings have evolved independently in biting midges and might be much more widespread in fossil as well as modern insects than known so far.

  14. Thaumaleidae (Diptera) collected by the late Dr. W. Joost in the Caucasus Mountains. (United States)

    Wagner, Rüdiger; Bellstedt, Ronald


    The aquatic insect collection of the late Dr. W. Joost contained two new species of Thaumaleidae (Diptera) from the Caucasus Mountains: Thaumalea monikae sp. n. and Thaumalea biacuminata sp. n. These two new species are herein described, and the most abundant species in Dr. Joost's collection, Thaumalea martinovskyi Joost, 1979, is redescribed based on the type material. Figures of male and female genitalia for all species are provided. All three species show morphological similarities to taxa from the Eastern Mediterranean area. Thaumalea monikae is related to the European T. bezzii-species group, T. biacuminata to the T. serrata-group, and T. martinovskyi to T. kyladica Wagner, 1981 and T. malickyi Theischinger, 1979 from the Eastern Mediterranean area.

  15. Effects of bioirrigation of non-biting midges (Diptera: Chironomidae) on lake sediment respiration (United States)

    Baranov, Viktor; Lewandowski, Jörg; Romeijn, Paul; Singer, Gabriel; Krause, Stefan


    Bioirrigation or the transport of fluids into the sediment matrix due to the activities of organisms such as bloodworms (larvae of Diptera, Chironomidae), has substantial impacts on sediment respiration in lakes. However, previous quantifications of bioirrigation impacts of Chironomidae have been limited by technical challenges such as the difficulty to separate faunal and bacterial respiration. This paper describes a novel method based on the bioreactive tracer resazurin for measuring respiration in-situ in non-sealed systems with constant oxygen supply. Applying this new method in microcosm experiments revealed that bioirrigation enhanced sediment respiration by up to 2.5 times. The new method is yielding lower oxygen consumption than previously reported, as it is only sensitive to aerobic heterotrophous respiration and not to other processes causing oxygen decrease. Hence it decouples the quantification of respiration of animals and inorganic oxygen consumption from microbe respiration in sediment.

  16. The type specimens of Calyptratae (Diptera) housed in non-traditional institutions in Argentina. (United States)

    Patitucci, Luciano Damián; Mulieri, Pablo Ricardo; Domínguez, M Cecilia; Mariluis, Juan Carlos


    The type material of species of Calyptratae Diptera belonging to Anthomyiidae, Calliphoridae, Fanniidae, Muscidae, Sarcophagidae, and Tachinidae, housed in the collections of non-traditional institutions in Argentina were examined. These collections were included in the recently created "Sistema Nacional de Datos Biológicos" (National Biological Data System). We examined four collections: "Administración Nacional de Laboratorios e Institutos de Salud 'Dr. Carlos G. Malbrán'" (ANLIS), "Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires" (INTA), "Instituto Argentino de Investigaciones de las Zonas Áridas" (IADIZA); and "Fundación Félix de Azara" (CFA). Comparison of the original descriptions of these species with the label information revealed the existence of 24 holotypes, 5 lectotypes, 11 syntypes, and 441 paratypes/paralectotypes. Complete information is given for each type, including reference to the original description, label data, and preservation condition. 

  17. The relationship between morphological and behavioral mimicry in hover flies (Diptera: Syrphidae). (United States)

    Penney, Heather D; Hassall, Christopher; Skevington, Jeffrey H; Lamborn, Brent; Sherratt, Thomas N


    Palatable (Batesian) mimics of unprofitable models could use behavioral mimicry to compensate for the ease with which they can be visually discriminated or to augment an already close morphological resemblance. We evaluated these contrasting predictions by assaying the behavior of 57 field-caught species of mimetic hover flies (Diptera: Syrphidae) and quantifying their morphological similarity to a range of potential hymenopteran models. A purpose-built phylogeny for the hover flies was used to control for potential lack of independence due to shared evolutionary history. Those hover fly species that engage in behavioral mimicry (mock stinging, leg waving, wing wagging) were all large wasp mimics within the genera Spilomyia and Temnostoma. While the behavioral mimics assayed were good morphological mimics, not all good mimics were behavioral mimics. Therefore, while the behaviors may have evolved to augment good morphological mimicry, they do not advantage all good mimics.

  18. Nocturnal activity of phlebotomine sandflies (Diptera: Psychodidae) in a cutaneous leishmaniasis focus in Chichaoua, Morocco. (United States)

    Guernaoui, S; Boussaa, S; Pesson, B; Boumezzough, A


    The nocturnal activity of phlebotomine sandflies (Diptera: Psychodidae) was studied "at an epidemic focus" on human cutaneous leishmaniasis due to Leishmania tropica Wright in Chichaoua province, in Morocco. Sandflies were collected using light and sticky-paper traps changed at 2-h intervals, inside and around houses, in August and October 2004. Overall, 633 sandflies, belonging to six species of Phlebotomus and three of Sergentomyia, were collected. Sandfly activity was nocturnal and higher at twilight. Several activity patterns were observed according to the species. Phlebotomus (Paraphlebotomus) sergenti Parrot, 1917, the suspected vector of L. tropica in this focus, was caught during each collection performed from 1900 to 0500 hours, the numbers of species caught peaked at 1900-2100 hours. There were seasonal variations of the nocturnal activity, which could be related to the variations in temperature and relative humidity.

  19. National Mosquito (Diptera: Culicidae) Survey in The Netherlands 2010-2013. (United States)

    Ibañez-Justicia, A; Stroo, A; Dik, M; Beeuwkes, J; Scholte, E J


    From 2010 onwards, a nationwide mosquito monitoring scheme has been conducted in The Netherlands with the aim of gaining crucial information about mosquito (Diptera: Culicidae) species composition, geographical distributions, biodiversity, and habitat preferences. The results of this study are based on 778 randomly sampled mosquito locations. These are divided into three main habitat types: urban, rural-agricultural, and natural areas. Twenty-seven mosquito species were found: 26 indigenous and 1 exotic, Aedes japonicus japonicus (Theobald, 1901). The preliminary results are presented here, with details of their species distribution and seasonality. Monitoring the temporal and spatial distribution of mosquitoes is an essential step in the risk analysis of emerging mosquito-borne diseases.

  20. Phylogeny of genus Glossina (Diptera: Glossinidae) according to ITS2 sequences

    Institute of Scientific and Technical Information of China (English)

    陈小爱; 李嵩; 李昌本; 赵寿元; Aksoy; Serap


    The flies of genus Glossina (Diptera: Glossinidae) are an important vector of African trypanosomiases which cause diseases in humans and animals. The ribosomal DNA Internal Transcribed Spacer-2 (ITS-2) region sequences from different Glossina species were PCR-amplified and analyzed in order to construct a molecular phylogeny for genus Glossina. Trees generated by parsimony confirmed the monophyletic taxonomic placement of genus Glossina where fusca group species formed the deepest branch followed by morsitans and palpalis groups, respectively. The placement of Glossina austeni by both the traditional morphological and biochemical criteria has been controversial. Results presented here, based on ITS-2 locus sequence analysis, suggest that Glossina austeni can be placed into a separate subgenerus which forms a sister-group relationship with the morsitans group species.

  1. Graphomya Robineau-Desvoidy from Costa Rica: descriptions and first records (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    MS. Couri

    Full Text Available Graphomya Robineau-Desvoidy (Diptera, Muscidae occurs in temperate and tropical regions of the world. It is known in the Neotropical Region from fifteen species. The genus is here recorded for the first time from Costa Rica, on the basis of three species: G. auriceps Malloch, 1934; G. mexicana Giglio-Tos, 1893 and G. tropicalis Malloch, 1934. A key for the recognition of these three species is given. G. auriceps is redescribed, including the morphology of male and female terminalia and the male of G. tropicalis is described for the first time. For G. mexicana, a well-known species in the literature, only a brief diagnosis and the material examined are listed.

  2. Morphology and Developmental Rate of the Blow Fly, Hemipyrellia ligurriens (Diptera: Calliphoridae: Forensic Entomology Applications

    Directory of Open Access Journals (Sweden)

    Nophawan Bunchu


    Full Text Available Hemipyrellia ligurriens (Diptera: Calliphoridae is a forensically important blow fly species presented in many countries. In this study, we determined the morphology of all stages and the developmental rate of H. ligurriens reared under natural ambient conditions in Phitsanulok province, northern Thailand. Morphological features of all stages based on observing under a light microscope were described and demonstrated in order to use for identification purpose. Moreover, development time in each stage was given. The developmental time of H. ligurriens to complete metamorphosis; from egg, larva, pupa to adult, took 270.71 h for 1 cycle of development. The results from this study may be useful not only for application in forensic investigation, but also for study in its biology in the future.

  3. First record of the avian ectoparasite Philornis downsi Dodge & Aitken, 1968 (Diptera: Muscidae) in Argentina. (United States)

    Silvestri, L; Antoniazzi, L R; Couri, M S; Monje, L D; Beldomenico, P M


    Species of Philornis Meinert, 1890 (Diptera, Muscidae) are Neotropical dipterans that include species with parasitic larvae which feed on nestling birds. To date, all Philornis species that have been recorded from Argentina have parasitic subcutaneous larvae. Here, for the first time for Argentina, we report the finding of Philornis downsi Dodge & Aitken, 1968, a fly with a nest-dwelling, semi-haematophagous larva. This record, from the humid Chaco ecoregion of Argentina in the nest of a saffron finch Sicalis flaveola pelzelni Sclater, substantially extends the known distribution of this species. We also report the consensus sequences of the internal transcribed spacer 1 (ITS1) and ITS2 regions of three of the specimens for future reference and comparison. Further investigation is needed to determine whether Argentina is part of the historical range of P. downsi or, alternatively, represents a recent expansion of its range, perhaps due to climatic changes or other factors of global environmental variation.

  4. DNA barcoding identifies all immature life stages of a forensically important flesh fly (Diptera: Sarcophagidae). (United States)

    Meiklejohn, Kelly A; Wallman, James F; Dowton, Mark


    Carrion-breeding insects, such as flesh flies (Diptera: Sarcophagidae), can be used as evidence in forensic investigations. Despite their considerable forensic potential, their use has been limited because morphological species identification, at any life stage, is very challenging. This study investigated whether DNA could be extracted and cytochrome oxidase subunit I (COI) barcode sequences obtained for molecular identification of each immature life stage of the forensically important Australian flesh fly, Sarcophaga (Sarcorohdendorfia) impatiens (Walker). Genomic DNA extracts were prepared from all larval instars and puparia. Amplification of the barcoding region was successful from all extracts, but puparia amplicons were weak. All sequences were identified as S. impatiens with 99.95% confidence using the Barcoding of Life Database (BOLD). Importantly, crop removal was necessary to eliminate PCR inhibition for specimens from late second and early third instars. Similar results are expected for immatures of other carrion-breeding species, enhancing the use of evidence from immature flies in forensic investigations.

  5. Homo ludens / Aino Ugaste ; üles kirjutanud Anu Mõttus

    Index Scriptorium Estoniae

    Ugaste, Aino


    Vestlusest professor Aino Ugastega, kes kaitses Jyväskyla Ülikoolis pedagoogikadoktori kraadi teemal "Lapse mängumaailm kodus ja ema roll mängus" ("The Child's Play World at Home and the Mother's Role in the Play")

  6. Homo ludens in the loop playful human computation systems

    CERN Document Server

    Krause, Markus


    The human mind is incredible. It solves problems with ease that will elude machines even for the next decades. This book explores what happens when humans and machines work together to solve problems machines cannot yet solve alone. It explains how machines and computers can work together and how humans can have fun helping to face some of the most challenging problems of artificial intelligence. In this book, you will find designs for games that are entertaining and yet able to collect data to train machines for complex tasks such as natural language processing or image understanding. You wil

  7. Urbe Ludens: espacios para el juego en la ciudad


    Trachana, Angelique


    Partiendo del significado antropológico del «juego» en los estudios de Huizinga y Cadamer, en este estudio se analizan algunos paradigmas significativos de manifestaciones lúdicas en los espacios de la ciudad, desde las palestras y los gimnasios en la ciudad antigua hasta los nuevos espacios de ocio en la ciudad moderna. El objetivo de este trabajo es estudiar las bases tanto ideológica como psicológica de la creación de espacios lúdicos y su conexión con diferentes sensibilidades sociales...

  8. Familia Ludens: Reinforcing the Leisure Component in Family Life (United States)

    Orthner, Dennis K.


    Leisure is examined as a normal and potentially vital component in the contemporary family. Consideration is given to the interplay between work and leisure and the means by which leisure facilitates companionship and family interaction. (Author)

  9. New species and new records of Mydidae from the Afrotropical and Oriental regions (Insecta, Diptera, Asiloidea

    Directory of Open Access Journals (Sweden)

    Torsten Dikow


    Full Text Available New Mydidae species are described from the Afrotropical and Oriental regions including the first records of this family from several countries in eastern Africa (Kenya, Tanzania, and Uganda and Mauritania in western Africa as well as Nepal and Thailand in Asia. The new species are, Leptomydinae: Leptomydas notos sp. n. (south-western India, Leptomydas rapti sp. n. (south-central Nepal, Leptomydas tigris sp. n. (north-central Thailand; Syllegomydinae: Mydaselpidini: Mydaselpis ngurumani sp. n. (south-eastern Kenya, north-eastern Tanzania, Vespiodes phaios sp. n. (south-eastern Kenya; Syllegomydinae: Syllegomydini: Syllegomydas (Notobates astrictus sp. n. (Kenya, Syllegomydas (Notobates heothinos sp. n. (Kenya and Uganda, Syllegomydas (Syllegomydas elachys sp. n. (northern Zimbabwe. Syllegomydas (Syllegomydas proximus Séguy, 1928 is recorded from western Mauritania and re-described. Syllegomydas (Notobates dispar (Loew, 1852, which was previously listed as incertae sedis in the Afrotropical Diptera catalogue, is re-described and illustrated based on examination of the type specimens and several additional specimens from Mozambique. Cephalocera annulata Brunetti, 1912 and Syllegomydas bucciferus Séguy, 1928, described from north-eastern India and previously unplaced in the Oriental Diptera catalogue, are newly combined with Leptomydas Gerstaecker, 1868 and together with Leptomydas indianus Brunetti, 1912, also from north-eastern India, placed in Leptomydinae. Comments on the possible synonymy of the genera of Mydaselpidini are made. Illustrations and photographs are provided to support the descriptions and future identification. A provisional dichotomous key to Mydidae genera occurring in eastern Africa (Kenya, Malawi, Mozambique, Somalia, Tanzania, Uganda and the Oriental Region is provided. Distribution, occurrence in biodiversity hotspots and high-biodiversity wilderness areas, and seasonal incidence are discussed for all species.

  10. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić


    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  11. [The results of a trial in the Socialist Republic of Vietnam of clothing providing mechanical protection against the bites of blood-sucking Diptera]. (United States)

    Gornostaeva, R M; Zhukova, L I


    The tested overalls for protection in hot climate may be recommended only for the protection of people engaged in work involving little movement (fishermen, watchmen, etc.). For wider use of such overalls in hot regions the design should be changed, the alterations are described in the paper. Further trials of the overalls should be carried out with its modified design; this costume provides adequate mechanical protection from the bites of mosquitoes and other blood-sucking Diptera and it will be widely used in the tropics, where blood-sucking Diptera contribute much to infection transmission.

  12. A transcriptional and proteomic survey of Arachnocampa luminosa (Diptera: Keroplatidae) lanterns gives insights into the origin of bioluminescence from the Malpighian tubules in Diptera. (United States)

    Silva, J R; Amaral, D T; Hastings, J W; Wilson, T; Viviani, V R


    Fungus-gnats of the genus Arachnocampa are unique among bioluminescent insects for displaying blue-green bioluminescence, and are responsible for one of the most beautiful bioluminescence spectacles on the roofs of the Waitomo Caves. Despite morphological studies showing that Arachnocampa larval lanterns involve specialization of the Malpighian tubules, the biochemical origin of their bioluminescence remains enigmatic. Using a cDNA library previously constructed from lanterns of the New Zealand glowworm A. luminosa, we carried out the first transcriptional analysis of ~ 500 expressed sequence tags (ESTs) to identify putative candidate proteins for light production, and to better understand the molecular physiology of the lanterns and their relationship with Malpighian tubule physiology. The analysis showed an abundance of hexamerin-like proteins, as well as luciferase-like enzymes, indicating a possible critical role for these proteins in bioluminescence. These findings were corroborated by proteomic analysis of lantern extracts, which showed the presence of hexamerins and luciferase-like enzymes. Other gene products typical of Malpighian tubules, such as detoxifying enzymes, were also found. The results support the existence of an evolutionary link between Malpighian tubule detoxification and the origin of bioluminescence in these Diptera.

  13. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim


    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  14. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea) em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea) in native forests and orchards in two counties of the State of Tocantins, Brazil


    Darcy A. do Bomfim; Manoel A. Uchôa-Fernandes; Marcos A. L. Bragança


    Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002) com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De L...

  15. Chilling and host plant/site associated eclosion times of western cherry fruit fly (Diptera:Tephritidae) and a host-specific parasitoid (United States)

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is native to bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ~100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of ad...

  16. Vector Competence of Peruvian Mosquitoes (Diptera:Culicidae) for a Subtype IIIC Strain in the Venezuelan Equine Encephalomyelitis Complex Isolated from Mosquitoes Captured in Peru (United States)


    strains of Venezuelan equine encephalitis virus. J Am Mosq Control Assoc 15:295–298. Turell MJ, Gargan TP II, Bailey CL. 1984. Replication and dissemination...Venezuelan equine encephalitis (VEE) complex alphavirus by Culex (Melanoconion) gnomatos (Diptera: Culicidae) in northeastern Peru. J Med Entomol 42:404–408

  17. Tackling the growing threat of dengue: Phyllanthus niruri-mediated synthesis of silver nanoparticles and their mosquitocidal properties against the dengue vector Aedes aegypti (Diptera: Culicidae) (United States)

    Mosquitoes transmit pathogens that cause millions of human deaths each year. Dengue virus is transmitted to humans in tropical and subtropical areas by Aedes aegypti (Diptera: Culicidae). The use of synthetic insecticides to control this mosquito is accompanied by high operational costs and adverse...

  18. Direct Multiplex PCR (dmPCR) for the Identification of Six Phlebotomine Sand Fly Species (Diptera: Psychodidae), Including Major Leishmania Vectors of the Mediterranean (United States)

    Sand flies (Diptera: Psychodidae, subfamily Phlebotominae) are haematophagous insects that are known to transmit several anthroponotic and zoonotic diseases. Reliable identification of sand flies at species level is crucial for their surveillance, the detection and spread of their pathogens and the ...

  19. Two new species of sympatric Fergusonina flies (Diptera: Fergusoninidae) from bud galls on high elevation snow gums (Eucalyptus pauciflora Sieb. ex Spreng. complex) in the Australian Alps (United States)

    Two species of Fergusonina Malloch fly, F. daviesae Nelson sp.n. and F. taylori Nelson sp.n. (Diptera: Fergusoninidae), are described from terminal leaf bud galls on high elevation snow gums (Eucalyptus pauciflora complex) in the Australian Alps. These species occur in sympatry at the six locations...

  20. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae) (United States)

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  1. Effect of host decoys on the ability of the parasitoids Muscidifurax raptor and Spalangia cameroni to parasitize house fly (Diptera: Muscidae) puparia (United States)

    The pteromalid pupal parasitoids Muscidifurax raptor Girault and Sanders and Spalangia cameroni Perkins (Hymenoptera: Pteromalidae) are commonly released on livestock farms for management of house flies (Diptera: Muscidae). To be effective, parasitoids must be able to locate live host puparia in co...

  2. A Guide to Basic Taxonomic Literature for the Genera of North American Chironomidae (Diptera) - Adults, Pupae, and Larvae. Bulletin No. 447. (United States)

    Simpson, Karl W.

    A generic list of North American Chironomidae (Diptera) is presented to help aquatic biologists quickly locate important taxonomic references for the adults, larvae, and pupae of each genus. The list (in chart format) includes literature published through 1981. When recent literature is available, older references are omitted, since the purpose of…

  3. A catalogue of the types of Stratiomyidae (Diptera: Brachycera) in the collection of the Museu de Zoologia da Universidade de São Paulo, Brazil. (United States)

    Fachin, Diego Aguilar; Lamas, Carlos José Einicker


    Following a recommendation of the International Code of Zoological Nomenclature, a catalogue of the type specimens of Stratiomyidae (Diptera: Brachycera) held in the collection of the Museu de Zoologia da Universidade de São Paulo, Brazil (MZUSP) is provided, with information on 30 type specimens (including 14 primary types) of 17 Neotropical species.

  4. Towards the PCR-based identification of Palaearctic Culicoides biting midges (Diptera: Ceratopogonidae): results from an international ring trial targeting fourspecies of the subgenus Avaritia.

    NARCIS (Netherlands)

    Garros, C.; Balenghien, T.; Carpenter, S.; Delécolle, J.C.; Meiswinkel, R.; Pédarrieu, A.; Rakotoarivony, I.; Gardès, L.; Golding, N.; Barber, J.; Miranda, M.; Borràs Borràs, D.; Goffredo, M.; Monaco, F.; Pagès, N.; Sghaier, S.; Hammami, S.; Calvo, J.H.; Lucientes, J.; Geysen, D.; Deken, de G.; Sarto i Monteys, V.; Schwenkenbecher, J.; Kampen, H.; Hoffmann, B.; Lehman, K.; Werner, D.; Baldet, T.; Lancelot, R.; Cêtre-Sossah, C.


    Background Biting midges of the genus Culicoides (Diptera: Ceratopogonidae) are biological vectors of internationally important arboviruses. To understand the role of Culicoides in the transmission of these viruses, it is essential to correctly identify the species involved. Within the western Palae

  5. Impact of planting dates on a seed maggot, Neotephritis finalis (Diptera: Tephritidae), and sunflower bud moth (Lepidoptera: Tortricidae) damage in cultivated sunflower (United States)

    Neotephritis finalis (Loew) (Diptera: Tephritidae), and sunflower bud moth, Suleima helianthana (Riley) (Lepidoptera: Tortricidae) are major head-infesting insect pests of cultivated sunflower (Helianthus annuus L.). Planting date was evaluated as a cultural pest management strategy for control of N...

  6. Larvicidal efficacy of different plant parts of railway creeper, Ipomoea cairica Extract Against Dengue Vector Mosquitoes, Aedes albopictus (Diptera: Culicidae) and Aedes aegypti (Diptera: Culicidae). (United States)

    AhbiRami, Rattanam; Zuharah, Wan Fatma; Thiagaletchumi, Maniam; Subramaniam, Sreeramanan; Sundarasekar, Jeevandran


    Natural insecticides from plant origin against mosquito vectors have been the main concern for research due to their high level of eco-safety. Control of mosquitoes in their larval stages are an ideal method since Aedes larvae are aquatic, thus it is easier to deal with them in this habitat. The present study was specifically conducted to explore the larvicidal efficacy of different plant parts of Ipomoea cairica (L.) or railway creeper crude extract obtained using two different solvents; methanol and acetone against late third-stage larvae of Aedes albopictus (Skuse) and Aedes aegypti (L.) (Diptera: Culicidae). Plant materials of I. cairica leaf, flower, and stem were segregated, airdried, powdered, and extracted using Soxhlet apparatus. Larvicidal bioassays were performed by using World Health Organization standard larval susceptibility test method for each species which were conducted separately for different concentration ranging from 10 to 450 ppm. Both acetone and methanol extracts showed 100% mortality at highest concentration tested (450 ppm) after 24 h of exposure. Results from factorial ANOVA indicated that there were significant differences in larvicidal effects between mosquito species, solvent used and plant parts (F=5.71, df=2, Paegypti with LC50 of 101.94 ppm followed by Ae. albopictus with LC50 of 105.59 ppm compared with other fractions of I. cairica extract obtained from flower, stem, and when methanol are used as solvent. The larvae of Ae. aegypti appeared to be more susceptible to I. cairica extract with lower LC50 value compared with Ae. albopictus (F=8.83, df=1, Pinsecticide for the control of Aedes mosquitoes. This study quantified the larvicidal property of I. cairica extract, providing information on lethal concentration that may have potential for a more eco-friendly Aedes mosquito control program.

  7. Parasitóides de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) collected in Caldas Novas, Goiás, Brasil


    Carlos Henrique Marchiori; Otacílio Moreira Silva Filho; Francilene Cardoso Alves Fortes; Rélia Rodrigues Brunes; Rauer Ferreira Borges; Patricia Luzia Pereira Gonçalves; Juliana Fischer Laurindo


    Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae)em Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoi...

  8. Spalangia drosophilae (Ashmead (Hymenoptera: Pteromalidae como inimigo natural de Archisepsis scabra (Loew (Diptera: Sepsidae em fezes bovinas Spalangia drosophilae (Ashmead (Hymenoptera: Pteromalidae as natural enemy of Archisepsis scabra (Loew (Diptera: Sepsidae in catlle dung

    Directory of Open Access Journals (Sweden)

    C.H. Marchiori


    Full Text Available This paper reports, for the first time, the occurrence of the parasite Spalangia drosophilae (Hymenoptera: Pteromalidae in pupae of Archisepsis scabra (Diptera: Sespsidae found in cow manure in the municipality of Cachoeira Dourada, GO, Brazil (18º29´S and 49º´W. Manure samples, collected at two-week intervals, were taken to the laboratory, and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of adult flies or their parasites. The parasitism prevalence was 5.7%.

  9. Aedes aegypti (Diptera: Culicidae) in Mauritania: First Report on the Presence of the Arbovirus Mosquito Vector in Nouakchott. (United States)

    Mint Lekweiry, Khadijetou; Ould Ahmedou Salem, Mohamed Salem; Ould Brahim, Khyarhoum; Ould Lemrabott, Mohamed Aly; Brengues, Cécile; Faye, Ousmane; Simard, Frédéric; Ould Mohamed Salem Boukhary, Ali


    Aedes aegypti L. (Diptera: Culicidae) is a major vector of yellow fever, dengue, and chikungunya viruses throughout tropical and subtropical areas of the world. Although the southernmost part of Mauritania along the Senegal river has long been recognized at risk of yellow fever transmission, Aedes spp. mosquitoes had never been reported northwards in Mauritania. Here, we report the first observation of Aedes aegypti aegypti (L.) and Aedes (Ochlerotatus) caspius (Pallas, 1771) in the capital city, Nouakchott. We describe the development sites in which larvae of the two species were found, drawing attention to the risk for emergence of arbovirus transmission in the city.

  10. Catalogue of the type-specimens of Bolitophilidae, Diadocidiidae and Ditomyiidae (Diptera, Bibionomorpha in the Natural History Museum, London

    Directory of Open Access Journals (Sweden)

    Rafaela Lopes Falaschi


    Full Text Available Catalogue of the type-specimens of Bolitophilidae, Diadocidiidae and Ditomyiidae (Diptera, Bibionomorpha in the Natural History Museum, London. A commented list of the types of three families of Bibionomorpha - Bolitophilidae, Diadocidiidae and Ditomyiidae - housed at the Natural History Museum (London is provided. This includes four holotypes and one paratype of five species of Bolitophilidae; one paratype and three syntypes of two species of Diadocidiidae; and 17 holotypes, 91 paratypes, four lectotypes, and fourteen paralectotypes of 38 species of Ditomyiidae. Lectotypes are designated for the Neotropical species of the ditomyiids Australosymmerus (Melosymmerus bisetosus Edwards, 1940 and A. (M. pediferus Edwards, 1940.

  11. New species and records of Pseudacteon Coquillett, 1907 (Diptera, Phoridae), parasitoids of the fire ant Solenopsis geminata group (Hymenoptera, Formicidae). (United States)

    Pereira, Thalles Platiny Lavinscky; Delabie, Jacques Hubert Charles; Bravo, Freddy


    The genus Pseudacteon Coquillett (Diptera, Phoridae) has a worldwide distribution and comprises parasitic myrmecophilous species that decapitate host ants. Seventy one species are known in the genus, 41 of them occur in the Neotropical Region and are 25 from Brazil. In northeastern Brazil, there are only records for two species, Pseudacteon dentiger Borgmeier and Pseudacteon antiguensis Malloch. In this paper, two new species of the genus are described from female specimens, Pseudacteon pesqueroi new spec. and Pseudacteon plowesi new spec., and also, new records of three Pseudacteon species for the Brazilian Northeast are given.

  12. Linnaeomyia hortensis gen. et spec. nov. (Diptera: Cecidomyiidae, Porricondylinae) from a backyard site in Öland, Sweden. (United States)

    Jaschhof, Mathias; Jaschhof, Catrin


    A new genus containing a single new species of Porricondylinae (Diptera: Cecidomyiidae) is described and named Linnaeomyia hortensis gen. nov., spec. nov. The sole known specimen of L. hortensis, a male, was Malaise trapped in a backyard site on the Baltic island of Öland, southeast Sweden, in summer 2014. Morphological evidence supports our hypothesis that Linnaeomyia is most closely related to Neurepidosis Spungis, 1987. Several male genital characters, notably the spine-bearing gonostyli and the vestigial ejaculatory apodeme, substantiate the generic distinctiveness of L. hortensis. Although a backyard discovery, L. hortensis is unlikely to be a synanthropic species.

  13. Research on blood- sucking blackflies (Diptera: Simuliidae) in China%中国吸血蚋类研究回眸

    Institute of Scientific and Technical Information of China (English)



    @@ 蚋类,俗呼黑蝇(blackfly),隶属于昆虫纲、双翅目(Diptera)、蚋科(Simuliidae),是医学昆虫中的一个世界性分布的重要类群,不但骚扰吸血,侵袭人畜,并且是多种人类和禽畜疾病的传播媒介,其中包括人畜盘尾丝虫病、欧氏曼森线虫病和禽鸟住白虫病等.

  14. The impact of industrial anthropization on mosquito (Diptera, Culicidae) communities in mangrove areas of Guanabara Bay (Rio de Janeiro, Brazil). (United States)

    de Souza, A S; Couri, M S; Florindo, L


    The effects of industrial anthropization on species composition and community diversity of Culicidae (Diptera) were studied in a mangrove area impacted by industrial activities as compared to a preserved area, both around Guanabara Bay in the state of Rio de Janeiro, Brazil. Diversity, equitability, and species richness in Culicidae community differed between the studied areas. Indicator species analysis and correspondence analysis were carried out and indicated that the Sabethini, especially Wyeomyia (Phoniomyia) theobaldi Lane, Wyeomyia (Phoniomyia) fuscipes (Edwards), and a non-identified species of Wyeomyia sp. were associated to the preserved area, whereas Aedes taeniorhynchus Wiedemann and Aedes scapularis (Rondani) to the impacted area.

  15. Leaf extracts of Melia azedarach Linnaeus (Sapindales: Meliaceae) act as larvicide against Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae). (United States)

    Prophiro, Josiane Somariva; Rossi, Juliana Chedid Nogared; Pedroso, Murilo Fernandes; Kanis, Luiz Alberto; Silva, Onilda Santos


    The objective of this study was to compare the larvicidal effect of hydroethanolic extracts of fresh and dry leaves of Melia azedarach Linnaeus (Sapindales: Meliaceae) on Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae). All the extracts evaluated induced mortality among the third and fourth instar larvae of Aedes aegypti after 24 and 48 hours of exposure to the products. Although previous studies had demonstrated the action of seeds and fruits of Melia azedarach against the larvae of different Aedes aegypti populations, the present report is the first to show the larvicidal effect of the fresh and dry leaves of this plant.

  16. The type specimens of Tachinidae (Diptera) housed in the Museo Argentino de Ciencias Naturales "Bernardino Rivadavia", Buenos Aires. (United States)

    Mulieri, Pablo Ricardo; Patitucci, Luciano Damián; Bachmann, Axel Oscar; O'Hara, James E


    The type material of species of Tachinidae (Diptera) housed in the collection of the Entomology Division of the Museo Argentino de Ciencias Naturales "Bernardino Rivadavia" were examined and are herein documented. The collection contains 202 type specimens consisting of 54 species described by E.E. Blanchard and 12 described by J. Brèthes. Comparison of their original descriptions with the label information reveals the existence of 24 holotypes, 1 lectotype, 141 syntypes and 36 paratypes. Complete information is given for each type, including reference to the original description, label data, and preservation condition.

  17. A review of the genus Minthodes Brauer & Bergenstamm (Diptera: Tachinidae) in Iran, with the description of a new species. (United States)

    Gilasian, Ebrahim; Ziegler, Joachim; Parchami-Araghi, Mehrdad


    Minthodes susae Gilasian & Ziegler sp. nov. (Diptera: Tachinidae), from southwestern Iran, is described and illustrated, and compared with M. brevipennis (Brauer & Bergenstamm) from Turkey. A lectotype is recognised for Pseudomintho brevipennis Brauer & Bergenstamm (currently a species of Minthodes) and its designation is attributed to Mesnil. Minthodes pictipennis Brauer & Bergenstamm is newly recorded from Iran and Turkey, and M. latifacies Herting is reported from Iran for the first time. An identification key to the four Minthodes Brauer & Bergenstamm species known to occur in Iran is provided. Finally, new data are given on the intraspecific variation of Minthodes atra (Kugler).

  18. Fluctuaciones poblacionales del insecto Dasiops inedulis (Diptera: Lonchaeidae) en cultivos de granadilla en Boyacá, Colombia


    Carrero Sarmiento, Diego Armando


    Resumen: Los cultivos de granadilla en Colombia y en particular en la zona de estudio, son frecuentemente afectados por el insecto plaga Dasiops inedulis (Diptera: Lonchaeidae). El daño consiste principalmente en la caída de botones, flores y frutos, afectando significativamente la producción y generando importantes pérdidas económicas. En el presente trabajo se realizó un estudio para estimar las fluctuaciones poblaciones de la plaga en cultivos de granadilla, en el departamento de Boyacá. A...

  19. Pseudolynchia canariensis (Diptera: Hippoboscidae em Buteogallus aequinoctialis (Ciconiiformes: Accipitridae no estado do Rio de Janeiro, Brasil Pseudolynchia canariensis (Diptera:Hippoboscidae on Buteogallus aequinoctialis (Ciconiiformes: Accipitridae in the State of Rio de Janeiro, Brasil

    Directory of Open Access Journals (Sweden)

    Rodrigo Gredilha


    Full Text Available Registro de Pseudolynchia canariensis em dois gaviões caranguejeiros de vida livre atendidos no Hospital Veterinário da Fundação RioZoo. Os dezenoves exemplares coletados foram identificados no Laboratório de Diptera da Fundação Instituto Oswaldo Cruz. O encontro de P. canariensis fora do hospedeiro natural (Columba livia, representa uma contribuição aos estudos da família Hippoboscidae, visto que não há registros sobre aves nativas do continente americano parasitadas por P. canariensis.The record of Pseudolynchia canariensis on two Rufous Crab-Hawk in situ taken care of the Hospital Veterinarian of the RioZoo Foundation. The nineteen collected specimens had been identified in the Laboratory of Diptera, Fundação Instituto Oswaldo Cruz. The findings of P canariensis out natural hosty (Columba livia it represents a contribution to the studies of the family Hippoboscidae considering that it does not have records about native birds of the american continent parasitized by P canariensis.

  20. Parasitoid wasps (Hymenoptera from puparia of sarcosaprophagous flies (Diptera: Calliphoridae; Sarcophagidae in Buenos Aires, Argentina Avispas parasitoides (Hymenoptera a partir de puparios de moscas sarcosaprófagas (Diptera: Calliphoridae; Sarcophagidae en Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    Adriana Oliva


    Full Text Available Emergence of parasitoid Hymenoptera from experimental rearings of sarcosaprophagous Diptera (Calliphoridae, Sarcophagidae attracted to beef baits were recorded in Buenos Aires (Argentina from 1998 to 2003. Four taxa were identified: Tachinaephagus zealandicus Ashmead (Encyrtidae, Brachymeria podagrica (Fabricius (Chalcididae, Nasonia vitripennis (Walker (Pteromaliidae and Alysia sp. (Braconidae: Alysiinae. Only the first two species were abundant in all years. The number of added monthly emergences of each species is presented and correlated with monthly mean maximum-minimum temperatures.Se registró la emergencia de parasitoides (Hymenoptera de crías experimentales de Diptera sarcosaprófagas (Calliphoridae, Sarcophagidae, atraídas a cebos de carne bovina, en Buenos Aires (Argentina durante 1998-2003. Se determinaron cuatro taxones: Tachinaephagus zealandicus Ashmead (Encyrtidae, Brachymeria podagrica (Fabricius (Chalcididae, Nasonia vitripennis (Walker (Pteromaliidae y Alysia sp. (Braconidae: Alysiinae. Sólo las dos primeras especies resultaron abundantes en todos los años. Se ha graficado el número total de emergencias de cada especie para cada mes, junto con las temperaturas promedio máxima y mínima.

  1. Leaf extracts of Melia azedarach Linnaeus (Sapindales: Meliaceae act as larvicide against Aedes aegypti (Linnaeus, 1762 (Diptera: Culicidae Extratos de folhas de Melia azedarach Linnaeus (Sapindales: Meliaceae atuam como larvicida de Aedes aegypti (Linnaeus, 1762 (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Josiane Somariva Prophiro


    Full Text Available The objective of this study was to compare the larvicidal effect of hydroethanolic extracts of fresh and dry leaves of Melia azedarach Linnaeus (Sapindales: Meliaceae on Aedes aegypti (Linnaeus, 1762 (Diptera: Culicidae. All the extracts evaluated induced mortality among the third and fourth instar larvae of Aedes aegypti after 24 and 48 hours of exposure to the products. Although previous studies had demonstrated the action of seeds and fruits of Melia azedarach against the larvae of different Aedes aegypti populations, the present report is the first to show the larvicidal effect of the fresh and dry leaves of this plant.O objetivo deste trabalho foi comparar o efeito larvicida de extratos hidro-etanólicos de folhas verdes e secas de Melia azedarach Linnaeus (Sapindales: Meliaceae em Aedes aegypti (Linnaeus, 1762 (Diptera: Culicidae. Todos os extratos avaliados induziram mortalidade em larvas de 3º e 4º estágios de Aedes aegypti, após 24 e 48 horas de exposição aos produtos. Embora estudos prévios tenham demonstrado a ação de sementes e frutos de Melia azedarach em larvas de diferentes populações de Aedes aegypti, o presente estudo é o primeiro a reportar o efeito larvicida de folhas verdes e secas desta planta.

  2. Distribucion geografica de Lutzomyia verrucarum (Townsend, 1913 (Diptera, Psychodidae, Phlebotominae, vector de la batonellosis humana en el Peru Geographical distribution of Lutzomyia verrucarum (Townsend, 1913 (Diptera, Psychodidae, Phlebotominae vector of human bartonellosis in Peru

    Directory of Open Access Journals (Sweden)

    Abraham G. Caceres


    Full Text Available Lutzomyia verrucarum (Townsend, 1913 (Diptera: Psychodidae, vector natural de la verruga peruana o enfermedad de Carrión es una especie propia del Perú. Su distribución geográfica esta entre los paralelos 5º y 13º25' de latitud Sur, se encuentra en los valles Occidentales e Interandinos de los Andes. La distribución altitudinal de Lu. verrucarum en los diversos valles es variable; asi: Occidentales, desde 1100 hasta 2980 msnm e Interandinos, de 1200 a 3200 msnm. En ciertas áreas verrucógenas no hay correlación entre la presencia de Lu. verrucarum y la enfermedad de Carrión lo que suguiere la existencia de vectores secundarios.Lutzomyia verrucarum (Townsend, 1913 (Diptera: Psychodidae; the natural vector of Bartonella bacilliformis, agent of human bartonellosis (peruvian verruga or Carrion's disease, is a native specie of Peru; its geographic distribution occurres between latitudes 5º and 13º 25' South: in the Occidental and Interandean valleys of the Andean. The altitudinal distribution of Lu. verrucarum in the different valleys is as follows: Occidental between 1100 and 2980 m sea level and Interandean from 1200 to 3200 m sea level. Some discrepancies between the distribution of Carrion's disease and Lu. verrucarum suggest the existence of secondary vectors in certain areas where Lu. verrucarum is not present

  3. Influência de diversos derivados de vegetais na sobrevida das larvas de Aedes fluviatilis(Lutz (Diptera: Culicidade em laboratorio Larvicidal properties of plant extracts against Aedes fluviatilis (Lutz (Diptera: Culicidae in the laboratory

    Directory of Open Access Journals (Sweden)

    Rotraut A. G. B. Consoli


    Full Text Available As propriedades larvicidas de 34 extratos, provenientes de 29 vegetais, foram testados em larvas de Aedes fluviatilis (Lutz (Diptera: Culicidae nas concentrações de 100, 10 e 1 ppm. 26,5% dos exames utilizados, reduziram significamente a sobrevida larvária (alfa = 0,05, quando empregados na concentração de 100 ppm (Anacardium occidentale, Agave americana, Allium sativum, Coriandrum sativum, Nerium oleander, Spatodea campanulata, Tibouchina scrobiculata e Vernonia salzmanni. O ácido anacárdio (A. occidentale mostrou-se larvicida na concentração de 10 ppm e o extrato bruto de A. sativum foi eficaz contra as larvas na concentração de 1 ppm.The larvicidal properties of 34 plant extracts were tested against Aedes fluviatilis (Lutz (Diptera: Culicidae larvae, at 100, 10 and 1 ppm concentrations; 26,6% of the extracts enhanced larval mortality (x = 0,05 at 100 ppm (Anacardium occidentale, Agave americana, Allium sativum, Coriandrum sativum, Nerium oleander, Spatodea campanulata, Tibouchina serobiculata and Vernonia salzmanni. Anacardic acid (A. occidentale was effective at 10 ppm and A. sativum (crude extract at 1 ppm.

  4. Morphometric Analysis of Longipalpis (Diptera: Psychodidae) Complex Populations in Mato Grosso do Sul, Brazil. (United States)

    Santos, Mirella F C; Andrade Filho, José D; Fernandes, Carlos E S; Mateus, Nathália L F; Eguchi, Gabriel U; Fernandes, Wedson D; Brazil, Reginaldo P; Oliveira, Everton F; Oliveira, Alessandra G


    Owing to the existence of cryptic species that are difficult to distinguish morphologically, the search for new taxonomic characters and methods for identifying and classifying sand flies continues. Lutzomyia longipalpis (Lutz & Neiva, 1912) and Lutzomyia cruzi (Mangabeira, 1938) (Diptera: Psychodidae) are two such species that occur in sympatry in some regions of Mato Grosso do Sul State (MS). Twenty females and twenty males from each of the five populations of Lu. longipalpis and one population of Lu. cruzi from MS were examined. An outlying population of Lu. longipalpis from Estrela de Alagoas, State of Alagoas, was used to compare the degree of divergence among the groups in MS. Specimens were cleared, mounted on slides, identified, and measured using LAS-Leica. The principal component analysis of morphometric characters showed a high degree of variation among females, while males varied to a lower degree. The populations of Alagoas and Miranda demonstrated the greatest variation. The first region, Alagoas, is geographically distant from the others and occurs under distinctly different ecological conditions, which likely accounts for the variation. Further studies should be made to elucidate the factors that contribute to the differences found between the populations of MS.

  5. Chemotaxonomic Profile and Intraspecific Variation in the Blow Fly of Forensic Interest Chrysomya megacephala (Diptera: Calliphoridae). (United States)

    Paula, Michele C; Antonialli-Junior, William F; Mendonça, Angélica; Michelutti, Kamylla B; Eulalio, Aylson D M M; Cardoso, Claudia A L; de Lima, Thiago; Von Zuben, Cláudio J


    Necrophagous insects such as blow flies (Diptera: Calliphoridae) are considered crucial in forensic entomology. Identification at species level and determination of larval stage are the basis for estimation of postmortem interval (PMI). Insect evidence can also be used in the determination of crime scenes, since body displacement is common. The aim of this study was to determine the chemotaxonomic profile and intraspecific variability of the forensically important blow fly Chrysomya megacephala (F. 1794). Adults were collected in the municipalities of Dourados-MS (Brazil) and Rio Claro-SP (Brazil), and then transferred to the laboratory for oviposition and development of the immature stages. Chemical analysis of cuticular compounds was performed by gas chromatography. Cuticular chemical profiles varied significantly between the two populations, as well as between developmental stages, supporting the use of these compounds as a complementary tool to help identify the species and its stages, along with geographical variability. This could greatly accelerate forensic investigations, eliminating the need to allow the fly larvae to develop until adult stage in order to confirm the species identity and sample origin.

  6. Large-scale mitogenomics enables insights into Schizophora (Diptera) radiation and population diversity (United States)

    Junqueira, Ana Carolina M.; Azeredo-Espin, Ana Maria L.; Paulo, Daniel F.; Marinho, Marco Antonio T.; Tomsho, Lynn P.; Drautz-Moses, Daniela I.; Purbojati, Rikky W.; Ratan, Aakrosh; Schuster, Stephan C.


    True flies are insects of the order Diptera and encompass one of the most diverse groups of animals on Earth. Within dipterans, Schizophora represents a recent radiation of insects that was used as a model to develop a pipeline for generating complete mitogenomes using various sequencing platforms and strategies. 91 mitogenomes from 32 different species were sequenced and assembled with high fidelity, using amplicon, whole genome shotgun or single molecule sequencing approaches. Based on the novel mitogenomes, we estimate the origin of Schizophora within the Cretaceous-Paleogene (K-Pg) boundary, about 68.3 Ma. Detailed analyses of the blowfly family (Calliphoridae) place its origin at 22 Ma, concomitant with the radiation of grazing mammals. The emergence of ectoparasitism within calliphorids was dated 6.95 Ma for the screwworm fly and 2.3 Ma for the Australian sheep blowfly. Varying population histories were observed for the blowfly Chrysomya megacephala and the housefly Musca domestica samples in our dataset. Whereas blowflies (n = 50) appear to have undergone selective sweeps and/or severe bottlenecks in the New World, houseflies (n = 14) display variation among populations from different zoogeographical zones and low levels of gene flow. The reported high-throughput mitogenomics approach for insects enables new insights into schizophoran diversity and population history of flies. PMID:26912394

  7. Occurrence of blow fly species (Diptera: calliphoridae) in Phitsanulok Province, Northern Thailand. (United States)

    Bunchu, Nophawan; Sukontason, Kom; Sanit, Sangob; Chidburee, Polprecha; Kurahashi, Hiromu; Sukontason, Kabkaew L


    Based on the current forensic importance of blow flies (Diptera: Calliphoridae), their biological aspects have been studied increasingly worldwide. The blow fly fauna in Phitsanulok Province, Northern Thailand was studied from May 2009 to April 2010 in the residential, agricultural, mountainous and forested areas of Muang, Wat Bot, Nakhon Thai and Wang Thong districts, respectively, in order to know the occurrence of blow flies in this province. Collections were carried out monthly using commercial funnel fly traps and sweeping methods, with 1-day tainted pork viscera as bait. Identification of adult blow flies exhibited 14 634 specimens, comprising of 5 subfamilies, 14 genera and 36 species. Chrysomya megacephala (Fabricius, 1794) and Achoetandrus rufifacies (Macquart, 1843) were the most and second most abundant species trapped, respectively. These two species of carrion flies prevailed in all the types of land investigated. We calculated and compared the diversity indices, species evenness and richness, and similarity coefficients of the blow fly species in various areas. The data from this study may be used to identify the potential of forensicallyimportant fly species within Phitsanulok Province and fulfill the information on blow fly fauna in Thailand.

  8. Occurrence of Zaprionus indianus (Diptera: Drosophilidae in Agudo, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Mauricio Batistella Pasini


    Resumo. Este trabalho faz menção ao primeiro registro de Zaprionus indianus Gupta (Diptera: Drosophilidae encontrado na zona rural do município de Agudo, no estado do Rio Grande do Sul, Brasil. Os adultos da mosca foram encontrados primeiramente em frutos de ameixa (Prunus salicina Lindl posteriormente em figos maduros (Ficus carica L. em dois pomares. No primeiro pomar cerca de 80% dos figos coletados apresentaram ataque de Z. indianus e, no segundo pomar 50% dos figos da cv. “Pingo de mel” e 80% da variedade “Roxo de Valinhos” foram infestados. No período correspondente a emergência dos adultos, coletou-se um total de 1364 indivíduos. Os figos da cv “Roxo de Valinhos” apresentaram maior emergência de adultos. Além de estar presente em restos culturais de figo, Z. indianus foi visualizada sobrevoando restos culturais de Syagrus romanzoffiana (Cham., Cucumis melo L., Citrullus vulgaris Schrad. e Vitis vinifera L., associada a outros drosofilídeos. Ressalta-se que medidas de monitoramento e controle da praga deverão ser adotadas no município para garantir figos de alta qualidade e sadios.

  9. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park


    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  10. Blaesoxipha plinthopyga (Diptera: Sarcophagidae como responsable de miasis nosocomiales en Costa Rica

    Directory of Open Access Journals (Sweden)

    Ólger Calderón-Arguedas


    Full Text Available Se presentan dos casos de miasis nosocomiales, ocurridos en hospitales costarricenses, cuyo agente etiológico identificado fue Blaesoxipha plinthopyga (Diptera: Sarcophagidae. El primero tuvo lugar como infestación de una herida quirúrgica secundaria a una cirugía de abdomen, en la cual se observaron larvas de mosca asociadas con una secreción purulenta. Dicho cuadro conllevó la ejecución de una laparotomía exploratoria para descartar la presencia de más larvas, y el lavado de la cavidad peritoneal. El segundo caso se asoció con una paciente que estuvo en una unidad de Cuidados Intensivos, sospechosa de una intoxicación con salicilatos, quien fue sometida a intubación para brindarle respiración mecánica asistida. La paciente expulsó varias larvas de mosca por su cavidad oral, lo que ameritó una aspiración orotraqueal, de la cual se obtuvo más larvas. En ambos casos se trató de larvas maduras de tercer estadio, que se evidenciaron en un periodo mayor o igual a cinco días a partir del internamiento en el nosocomio, lo que tipifica ambos casos como miasis nosocomiales.

  11. Dominant fitness costs of resistance to fipronil in Musca domestica Linnaeus (Diptera: Muscidae). (United States)

    Abbas, Naeem; Shah, Rizwan Mustafa; Shad, Sarfraz Ali; Azher, Faheem


    House fly, Musca domestica L., (Diptera: Muscidae) a common pest of poultry, has developed resistance to the commonly used insecticide fipronil. The life history traits were examined in the fipronil-selected (Fipro-SEL), susceptible counterpart (UNSEL), and their hybrid progeny strains in order to design an effective resistant management strategy. Compared to the UNSEL strain, the Fipro-SEL was 181.94-fold resistant to fipronil. This resistance was unstable after five generations without selection. The Fipro-SEL had a significantly longer larval duration, lower pupal weight, lower fecundity, lower hatchability, lower number of next generation larvae, lower intrinsic rate of population increase and lower biotic potential than the UNSEL strain. Most fitness parameters of the hybrid progeny were similar and significantly lower than that in the UNSEL strain, suggesting autosomal and dominant fitness costs. Compared to the UNSEL strain, relative the fitness of the Fipro-SEL, Hybrid1 and Hybrid2 was 0.13, 0.33 and 0.30, respectively. Fipronil resistance resulted in high fitness costs and these fitness costs were dominant and autosomal in the Fipro-SEL strain of M. domestica. Rotation of fipronil with other insecticides having no cross resistance should be useful for delaying the development of resistance in M. domestica.

  12. Prediction of current species distribution of Cheilosia proxima group (Diptera: Syrphidae on the Balkan peninsula

    Directory of Open Access Journals (Sweden)

    Milić Dubravka M.


    Full Text Available Predicting species distribution in different climates is most often made by climate models (“climate envelope models” - CEM which are using the current geographical distribution of species and climate characteristics of the area. Hoverflies (Insecta: Diptera: Syrphidae can act as bioindicators and monitors of climate change and habitat quality. Cheilosia Meigen, 1822 is one of the largest hoverflies genera, with about 450 described species. The aim of this study was to model the current potential distribution of six species from Cheilosia proxima group on the Balkan Peninsula (Cheilosia aerea Dufour, 1848, C. balkana Vujić, 1994, C. gigantea Zetterstedt, 1838, C. pascuorum Becker, 1894, C. proxima Zetterstedt, 1843 and C. rufimana Becker, 1894 using maximum entropy modeling (Maxent. It is observed that parameters with highest influence on the analyzed species are Altitude and BIO 15 (Precipitation Seasonality for all species, except C. rufimana. Parameter that also substantially influenced for all species, except C. pascuorum, is BIO 18 (Precipitation of Warmest Quarter. The models of current distribution have shown that the most important area of the Balkan Peninsula, for species from Cheilosia proxima group, is Dinaric mountains. Information obtained in this paper can help in future monitoring of species, as well as for the conservation measures, especially for endemics and rare species. [Projekat Ministarstva nauke Republike Srbije, br. 173002 i br. 43002

  13. Assessing Insecticide Susceptibility of Laboratory Lutzomyia longipalpis and Phlebotomus papatasi Sand Flies (Diptera: Psychodidae: Phlebotominae). (United States)

    Denlinger, David S; Lozano-Fuentes, Saul; Lawyer, Phillip G; Black, William C; Bernhardt, Scott A


    Chemical insecticides are effective for controlling Lutzomyia and Phlebotomus sand fly (Diptera: Psychodidae) vectors of Leishmania parasites. However, repeated use of certain insecticides has led to tolerance and resistance. The objective of this study was to determine lethal concentrations (LCs) and lethal exposure times (LTs) to assess levels of susceptibility of laboratory Lutzomyia longipalpis (Lutz and Nieva) and Phlebotomus papatasi (Scopoli) to 10 insecticides using a modified version of the World Health Organization (WHO) exposure kit assay and Centers for Disease Control and Prevention (CDC) bottle bioassay. Sand flies were exposed to insecticides coated on the interior of 0.5-gallon and 1,000-ml glass bottles. Following exposure, the flies were allowed to recover for 24 h, after which mortality was recorded. From dose-response survival curves for L. longipalpis and P. papatasi generated with the QCal software, LCs causing 50, 90, and 95% mortality were determined for each insecticide. The LCs and LTs from this study will be useful as baseline reference points for future studies using the CDC bottle bioassays to assess insecticide susceptibility of sand fly populations in the field. There is a need for a larger repository of sand fly insecticide susceptibility data from the CDC bottle bioassays, including a range of LCs and LTs for more sand fly species with more insecticides. Such a repository would be a valuable tool for vector management.

  14. Small-Scale Spatio-Temporal Distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) Using Probability Kriging. (United States)

    Wang, S Q; Zhang, H Y; Li, Z L


    Understanding spatio-temporal distribution of pest in orchards can provide important information that could be used to design monitoring schemes and establish better means for pest control. In this study, the spatial and temporal distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) was assessed, and activity trends were evaluated by using probability kriging. Adults of B. minax were captured in two successive occurrences in a small-scale citrus orchard by using food bait traps, which were placed both inside and outside the orchard. The weekly spatial distribution of B. minax within the orchard and adjacent woods was examined using semivariogram parameters. The edge concentration was discovered during the most weeks in adult occurrence, and the population of the adults aggregated with high probability within a less-than-100-m-wide band on both of the sides of the orchard and the woods. The sequential probability kriged maps showed that the adults were estimated in the marginal zone with higher probability, especially in the early and peak stages. The feeding, ovipositing, and mating behaviors of B. minax are possible explanations for these spatio-temporal patterns. Therefore, spatial arrangement and distance to the forest edge of traps or spraying spot should be considered to enhance pest control on B. minax in small-scale orchards.

  15. Online database for mosquito (Diptera, Culicidae) occurrence records in French Guiana. (United States)

    Talaga, Stanislas; Murienne, Jérôme; Dejean, Alain; Leroy, Céline


    A database providing information on mosquito specimens (Arthropoda: Diptera: Culicidae) collected in French Guiana is presented. Field collections were initiated in 2013 under the auspices of the CEnter for the study of Biodiversity in Amazonia (CEBA: This study is part of an ongoing process aiming to understand the distribution of mosquitoes, including vector species, across French Guiana. Occurrences are recorded after each collecting trip in a database managed by the laboratory Evolution et Diversité Biologique (EDB), Toulouse, France. The dataset is updated monthly and is available online. Voucher specimens and their associated DNA are stored at the laboratory Ecologie des Forêts de Guyane (Ecofog), Kourou, French Guiana. The latest version of the dataset is accessible through EDB's Integrated Publication Toolkit at or through the Global Biodiversity Information Facility data portal at It can also be viewed through the Guyanensis platform at

  16. Liriomyza Leafminer (Diptera: Agromyzidae) Parasitoid Complex in Different Agroecological Zones, Seasons, and Host Plants in Kenya. (United States)

    Foba, C N; Salifu, D; Lagat, Z O; Gitonga, L M; Akutse, K S; Fiaboe, K K M


    Liriomyza leafminers (Diptera: Agromyzidae) are severe pests of vegetables and ornamentals worldwide. Previous studies revealed low leafminer parasitism across different agroecological zones in Kenya. The present paper reports on the composition of leafminer parasitoids at different elevations, in different seasons, and on different host crops. Surveys were conducted monthly from January to November 2012, and nine parasitoid species were recovered. Total mean parasitism in the study sites was 31.23 ± 1.03% from a total of 20 different vegetable Liriomyza-infested crops belonging to seven families. Diglyphus isaea (Walker) (Hymenoptera: Eulophidae), Phaedrotoma scabriventris, a newly released parasitoid, and Opius dissitus Muesebeck (Hymenoptera: Braconidae) were the most abundant at all elevations, accounting for 67.3, 18.6, and 9.2% of total parasitoids, respectively. Elevation, season, and host crop significantly affected the parasitoid species present and their abundance. Diglyphus isaea was more abundant at the high- and mid-elevations at all seasons compared with the low-elevation, whereas the lower-elevation favored higher abundance of P. scabriventris and O. dissitus during the long rainy season compared with the high- and mid-elevations at all seasons. Of all the host crops surveyed, parasitoids were more abundant on tomato, local kidney bean, snow pea and French bean than other crops. The total parasitism rate observed in this study suggests a considerable improvement in leafminer parasitism compared with previous surveys in Kenya. The implications of these findings for leafminer management in vegetable and ornamental production in Kenya are discussed.

  17. New Records of Agromyzidae (Diptera from the Afrotropical Region, with a Checklist

    Directory of Open Access Journals (Sweden)

    Černý Miloš


    Full Text Available New faunistic data on the distribution of 50 species of the family Agromyzidae from the Afrotropical Region are given. Chromatomyia syngenesiae Hardy, 1849 and Phytomyza ranunculi (Schrank, 1803 are firstly recorded for the Afrotropics and 47 species are firstly recorded for the following countries: Angola, Cameroon, Cape Verde Islands, Central African Republic, Ethiopia, Kenya, Madagascar, Malawi, Namibia, Nigeria, Sierra Leone, Somalia, Tanzania, Uganda, Zambia, Zimbabwe. For each country the number of known species are put together in a table. An updated Afrotropical checklist is added. The most peculiar genitalia of the redetected Ophiomyia dhofarensis are discussed in connection with other species, among them: Ophiomyia yunnanensis comb. nov. [= Ophiomyia dumosa syn. nov.]. Ophiomyia nigrimaculata comb. nov. is treated taxomically, too. The type-species of the Pseudonapomyza acanthacearum-group is re-defined. Ranunculus was firstly confirmed as host plant genus of Phytomyza subeximia which develops between its seeds, a rare substrate in the genus. Napomyza strana stat. rev. was redetected in an altitude of 3353 m a.s.l. An eclector collecting method is described which lets estimate the natural proportional abundance of Agromyzidae compared with all other Diptera in the groundlevel vegetation of a country.

  18. Toxicity and Larvicidal Activity of Podophyllum-Based Lignans Against Aedes aegypti (Diptera: Culicidae). (United States)

    Maleck, Marise; Hollanda, Priscila de Oliveira; Serdeiro, Michele Teixeira; Soares, Renata Oliveira de Araújo; Honório, Nildimar Alves; Silva, Cláudia Gontijo


    Aedes aegypti L. (Diptera: Culicidae) is a mosquito species that has adapted to urban environments and is the main vector of dengue viruses. Because of the increasing incidence of dengue, a more environmentally acceptable insecticide needs to be found. Natural products have been and continue to be an important source of leading compounds that can be modified in order to develop new drugs. The lignan family of natural products includes compounds with a diverse spectrum of biological activity. Podophyllotoxin and its related lignans represent an exciting class of natural products that can be targeted at different types of biological activity and are therefore worth exploring further. This study had the aim of evaluating the larvicidal activity of an ethanolic extract from the rhizomes and roots of Podophyllum hexandrum (PM-3) and its isolated lignans, podophyllotoxone (1) and desoxypodophyllotoxin (2), on the larvae of the mosquito vector Ae. aegypti. The PM-3 extract and the compounds (1) and (2) were dissolved in a mixture of acetone and dimethylsulfoxide at final concentrations of 1, 10, 30, 50, 100, and 200 μg/ml. After dilution, the solutions were applied (μg/ml) to the larvae-rearing medium. Overall, the ethanolic extract from the rhizomes and roots of P. hexandrum and the compounds (1) and (2) showed larvicidal activity against the larvae of Ae. aegypti According to the results from this study, it can be concluded that podophyllotoxone (1) and desoxypodophyllotoxin (2) exhibited significant toxicity toward Ae. aegypti larvae.

  19. Unveiling of a cryptic Dicranomyia (Idiopyga from northern Finland using integrative approach (Diptera, Limoniidae

    Directory of Open Access Journals (Sweden)

    Jukka Salmela


    Full Text Available The subgenus Idiopyga Savchenko, 1987 is a northern hemisphere group of short-palped crane flies (Diptera, Limoniidae. In the current article we describe a new species, Dicranomyia (I. boreobaltica Salmela sp.n., and redescribe the male and female post-abdomen of a closely related species, D. (I. intricata Alexander. A standard DNA barcoding fragment of 5′ region of the cytochrome c oxidase I (COI gene of the new species is presented, whilst the K2P minimum distances between the new species and 10 other species of the subgenus were found to range from 5.1 to 15.7 % (mean 11.2 %. Phylogenetic analyses (parsimony and maximum likelihood based on COI sequences support the identity of the new species and its close relationship with D. (I. intricata and D. (I. esbeni (Nielsen. The new species is known from the northern Baltic area of Finland. The new species has been mostly collected from Baltic coastal meadows but an additional relict population is known from a calcareous rich fen that was estimated to have been at sea level circa 600-700 years ago. Dicranomyia (I. intricata (syn. D. suecica Nielsen is a Holarctic species, occurring in the north boreal and subarctic vegetation zones in Fennoscandia.


    Directory of Open Access Journals (Sweden)

    J. S. Carneiro


    Full Text Available Chrysomya megacephala (Diptera: Calliphoridae, popularly known as blowfly, has a great capacity for dispersion and, due to factors such as food abundance and favorable climate, it colonizes Brazil completely in a short time. These insects are important to the sectors of epidemiology, public health and forensics, especially due to carrying microorganisms such as bacteria, viruses, protozoa and helminthes, which are responsible for the spread of diseases such as dysentery, cholera, botulism, typhoid fever, brucellosis, polio, smallpox and tuberculosis. The objective of this study was to verify the diversity of bacteria carried by this species in the Federal University of Mato Grosso – Campus of Sinop during the month of January of 2012. The flies were collected using two traps baited with 100 g of fresh sardines on each and maintained in the field for 24 hours. Twenty specimens of C. megacephala were placed in Petri dishes, to walk for two minutes upon Nutrient Agar (NA. After establishment of the colonies, isolation of the bacteria on the NA medium and their multiplication in test tubes containing the same culture medium was performed, and later sent to identification by gas chromatography. The bacteria encountered were Aquaspirillum polymorphum; Burkholderia ambifaria; Burkholderia anthina; Burkholderia cepacia; Burkholderia cenocepacia; Burkholderia pyrrocinia; Burkholderia stabilis; Paenibacillus macerans; Virgibacillus pantothenticus, Bacillus subtilis e Photorhabdus luminescens luminescens, with the last two species considered of importance in the plant protection sector.

  1. Larvicidal Effects of Four Citrus Peel Essential Oils Against the Arbovirus Vector Aedes albopictus (Diptera: Culicidae). (United States)

    Campolo, Orlando; Romeo, Flora V; Algeri, Giuseppe M; Laudani, Francesca; Malacrinò, Antonino; Timpanaro, Nicolina; Palmeri, Vincenzo


    In this study, we evaluated the larvicidal activity of four citrus essential oils (EOs; sweet orange, mandarin, bergamot, and lemon) against the arbovirus vector Aedes albopictus (Skuse) (Diptera: Culicidae) under laboratory conditions. Through gas chromatography-mass spectrometry (GC-MS) analyses, we found that in sweet orange, mandarin, and lemon EOs, limonene was the most abundant compound, whereas linalyl acetate was the most abundant in the bergamot EO. All tested EOs showed a marked larvicidal activity, in particular sweet orange, lemon, and bergamot that killed all treated larvae. After 24 h of exposure, the LC50 values of the tested citrus EOs ranged from 145.27 (lemon EO) to 318.07 mg liter(-1) (mandarin EO), while LC(95) ranged from 295.13 to 832.44 mg liter(-1). After 48 h of exposure, the estimated LC(50) values decreased to values ranging from 117.29 to 209.38 mg liter(-1), while LC(95) ranged from 231.85 to 537.36 mg liter(-1). The results obtained from these evaluations, together with the large availability at reasonable costs of citrus EOs, are promising for the potential development of a new botanical mosquitocide.

  2. Derris (Lonchocarpus urucu (Leguminosae Extract Modifies the Peritrophic Matrix Structure of Aedes aegypti (Diptera:Culicidae

    Directory of Open Access Journals (Sweden)

    Gusmão Desiely Silva


    Full Text Available Aqueous suspension of ethanol extracts of Derris (Lonchocarpus urucu (Leguminosae, collected in the state of Amazonas, Brazil, were tested for larvicidal activity against the mosquito Aedes aegypti (Diptera:Culicidae. The aim of this study was to observe the alterations of peritrophic matrix in Ae. aegypti larvae treated with an aqueous suspension of D. urucu extract. Different concentrations of D. urucu root extract were tested against fourth instar larvae. One hundred percent mortality was observed at 150 µg/ml (LC50 17.6 µg/ml 24 h following treatment. In response to D. urucu feeding, larvae excreted a large amount of amorphous feces, while control larvae did not produce feces during the assay period. Ultrastructural studies showed that larvae fed with 150 µg/ml of D. urucu extract for 4 h have an imperfect peritrophic matrix and extensive damage of the midgut epithelium. Data indicate a protective role for the peritrophic matrix. The structural modification of the peritrophic matrix is intrinsically associated with larval mortality.

  3. A new species of Machaeriobia Rübsaamen, 1915 (Diptera, Cecidomyiidae from Brazil

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia


    Full Text Available ABSTRACT A new species of Machaeriobia Rübsaamen, 1915 (Diptera: Cecidomyiidae from Brazil. Machaeriobia Rübsaamen, 1915 is a Neotropical genus, until now known from a single species, M. machaerii (Kieffer, 1913, described from Brazil (State of Santa Catarina. That species induces spherical leaf galls on Machaerium sp. (Fabaceae and its geographical distribution is still restricted to the type-locality. A new galling species, Machaeriobia gemmae, associated with Machaerium macaense (Fabaceae, is described and illustrated (larva, pupa, male, and female based on material collected in the Parque Nacional da Serra dos Órgãos (State of Rio de Janeiro, Brazil. The new species is unique for its one or two-segmented palpi, deeply notched aedeagus, pupa with free dorsal abdominal spines, larva with reduced spatula and two apically sclerotized terminal lobes. We synonymize Anadiplosis Tavares, 1916 under Machaeriobia Rübsaamen, 1915. Six wasp species (Hymenoptera are associated with the galler: Tanaostigmodes carinatus La Salle 1987 and Tanaostigmodes sp. (Tanaostigmatidae, Galeopsomyia sp. (Eulophidae, Calorylea sp. (Eurytomidae, and two undetermined species of Eurytomidae.

  4. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald


    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  5. Sperm-less males modulate female behaviour in Ceratitis capitata (Diptera: Tephritidae). (United States)

    Gabrieli, Paolo; Scolari, Francesca; Di Cosimo, Alessandro; Savini, Grazia; Fumagalli, Marco; Gomulski, Ludvik M; Malacrida, Anna R; Gasperi, Giuliano


    In the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)(Diptera: Tephritidae), mating has a strong impact on female biology, leading to a decrease in sexual receptivity and increased oviposition and fecundity. Previous studies suggest that sperm transfer may play a role in inducing these behavioural changes. Here we report the identification of a medfly innexin gene, Cc-inx5, whose expression is limited to the germ-line of both sexes. Through RNA interference of this gene, we generated males without testes and, consequently, sperm, but apparently retaining all the other reproductive organs intact. These sperm-less males were able to mate and, like their wild-type counterparts, to induce in their partners increased oviposition rates and refractoriness to remating. Interestingly, matings to sperm-less males results in oviposition rates higher than those induced by copulation with control males. In addition, the observed female post-mating behavioural changes were congruent with changes in transcript abundance of genes known to be regulated by mating in this species. Our results suggest that sperm transfer is not necessary to reduce female sexual receptivity and to increase oviposition and fecundity. These data pave the way to a better understanding of the role/s of seminal components in modulating female post-mating responses. In the long term, this knowledge will be the basis for the development of novel approaches for the manipulation of female fertility, and, consequently, innovative tools to be applied to medfly control strategies in the field.

  6. Description of Lutzomyia (Pifanomyia robusta n. sp. (Diptera, Psychodidae, Phlebotominae from Peruvian Equadorean interandean areas

    Directory of Open Access Journals (Sweden)

    Eunice A. Bianchi Galati


    Full Text Available Description of Lutzomyia robusta, n. sp. (Diptera, Psychodidae, Phlebotominae from interandean areas of Peru and Equador. Lutzomyia robusta, n. sp., probable vector of human bartonellosis and cutaneous leishmaniasis, is described and illustrated. This species presents strong affinity with L. serrana (Damasceno & Arouck, 1949 but they can be distinguished by variance analysis of four male characteristics and only one female characteristic. In the variance analysis, populations of L. serrana, of Amazonian areas of Brazil, Peru and Bolivia, the coast of Equador and other areas of Brazil were studied. The synonymy of Lutzomyia guayasi (Rodriguez and L. serrana was corroborated.Descreve-se Lutzomyia (Pifanomyia robusta, sp.n., provável vetora de bartonelose e leishmaniose tegumentar, de ocorrência em vales interandinos no Peru e Equador e que apresenta estreita afinidade com L. serrana (Damasceno e Arouck. A separação de ambas foi possível, por meio de análise de variância de alguns caracteres do macho e apenas um da fêmea. Na análise de variância, foram estudadas populações de L. serrana da região amazônica do Brasil, Peru e Bolívia; costa do Equador; região atlântica e outras áreas do Brasil. Corrobora-se a sinonímia de Phlebotomus guayasi Rodríguez com L. serrana.

  7. A new species of Giovanella Bonatto (Diptera, Calliphoridae, Mesembrinellinae from Colombia

    Directory of Open Access Journals (Sweden)

    Marta Wolff


    Full Text Available A new species of Giovanella Bonatto (Diptera, Calliphoridae, Mesembrinellinae from Colombia. The Mesembrinellinae are exclusively Neotropical, with 33 nominal species distributed in nine genera. Only the genera Mesembrinella, Eumesembrinella, Huascaromusca and Laneella had until now been recorded in Colombia. In this work we present a new species of Giovanella Bonatto, 2005, genus with only one species, G. bolivar Bonatto, differing from the new species G. carvalhoi sp. nov., in the characters: legs entirely dark chestnut; thorax with dorsocentrals setae 1:2; abdomen with T5 with discal bristles poorly differentiated; T6 symmetric and paraphallus not extended and with denticules. Giovanella carvalhoi sp. nov. is from Cordillera Oriental, from the Departments of Caquetá (Amazonian foothills and Santander, Colombia, collected between 22002400 m., and associated with decomposing organic matter. A key for the identification of males and females of the two species of Giovanella, illustrations of the genitalia and photographs of male and female of new species are also presented.

  8. Ventral polarization vision in tabanids: horseflies and deerflies (Diptera: Tabanidae) are attracted to horizontally polarized light (United States)

    Horváth, Gábor; Majer, József; Horváth, Loránd; Szivák, Ildikó; Kriska, György


    Adult tabanid flies (horseflies and deerflies) are terrestrial and lay their eggs onto marsh plants near bodies of fresh water because the larvae develop in water or mud. To know how tabanids locate their host animals, terrestrial rendezvous sites and egg-laying places would be very useful for control measures against them, because the hematophagous females are primary/secondary vectors of some severe animal/human diseases/parasites. Thus, in choice experiments performed in the field we studied the behavior of tabanids governed by linearly polarized light. We present here evidence for positive polarotaxis, i.e., attraction to horizontally polarized light stimulating the ventral eye region, in both males and females of 27 tabanid species. The novelty of our findings is that positive polarotaxis has been described earlier only in connection with the water detection of some aquatic insects ovipositing directly into water. A further particularity of our discovery is that in the order Diptera and among blood-sucking insects the studied tabanids are the first known species possessing ventral polarization vision and definite polarization-sensitive behavior with known functions. The polarotaxis in tabanid flies makes it possible to develop new optically luring traps being more efficient than the existing ones based on the attraction of tabanids by the intensity and/or color of reflected light.

  9. Haltere mediated flight stabilization in Diptera: Rate decoupling, sensory encoding, and control realization (United States)

    Thompson, Rhoe A.

    Insects of the order Diptera have a single pair of wings. The rear wings of Dipteran insects have evolved into organs that allow stabilizing control responses through sensing and encoding of body angular rate feedback. This dissertation documents research on the physical and physiological mechanisms that enable a pair of halteres to distinguish and encode three orthogonal components of the body rate vector. While the knowledge that the halteres play a role in flight stability has been accepted for centuries, the understanding of how insect's very simple sensory structures are able to encode and decouple the orthogonal components of the rate vector has been lacking. The work described in this report furthers this understanding through modeling and simulation. First, a natural decoupling of the observable rate components has been identified that asserts proportionality of body rate components to averaged strain characteristics near the center of the haltere stroke. Second, a means of encoding and decoding the necessary rate information in a manner compatible with the insect's sensory structures and flight motor physiology has been identified and demonstrated. Finally, the ability of the proposed haltere model to stabilize flight in a 6DOF environment with competing behavioural objectives and randomly generated obstructions has been demonstrated.

  10. Morphology, Ultrastructure and Possible Functions of Antennal Sensilla of Sitodiplosis mosellana Géhin (Diptera: Cecidomyiidae). (United States)

    Wang, Yue; Li, Dan; Liu, Yang; Li, Xue-Jiao; Cheng, Wei-Ning; Zhu-Salzman, Keyan


    To better understand the olfactory receptive mechanisms involved in host selection and courtship behavior of Sitodiplosis mosellana (Diptera: Cecidomyiidae), one of the most important pests of wheat, scanning and transmission electron microscopy were used to examine the external morphology and ultrastructure of the antennal sensilla. The moniliform antennae exhibit obvious sexual dimorphism: antennae of the males are markedly longer than those of the females. Furthermore, each male flagellomere consists of two globular nodes, whereas each female flagellomere is cylindrical. Seven types of sensilla were identified in both sexes. Two types of s. chaetica have a lumen without dendrites and thick walls, suggesting that they are mechanoreceptors. S. trichodea and s. circumfila are typical chemoreceptors, possessing thin multiporous walls encircling a lumen with multiple dendrites. There are significantly more s. trichodea in female than in male, which may be related to host plant localization. In contrast, male s. circumfila are highly elongated compared to those of females, perhaps for pheromone detection. Peg-shaped s. coeloconica are innervated with unbranched dendrites extending from the base to the distal tip. Type 1 s. coeloconica, which have deep longitudinal grooves and finger-like projections on the surface, may serve as olfactory or humidity receptors, whereas type 2 s. coeloconica, smooth with a terminal pore, may be contact chemoreceptors. Also, this is the first report of Böhm' bristles at proximal scape on antennae of Cecidomyiid species potentially functioning as mechanoreceptors.

  11. A review of Billaea Robineau-Desvoidy of the eastern Palearctic and Oriental regions (Diptera: Tachinidae). (United States)

    Zhang, Chun-Tian; Shima, Hiroshi; Wang, Qiang; Tschorsnig, Hans-Peter


    The species of Billaea Robineau-Desvoidy (Diptera, Tachinidae) from the eastern Palearctic and Oriental regions are revised. Ten described species are recognized, viz. B. atkinsoni (Baranov) (new records for Japan, Laos, Malaysia, Pakistan and Thailand), B. ficorum (Townsend), B. fortis (Rondani), B. impigra Kolomiets (new record for China), B. kolomyetzi Mesnil, B. malayana Malloch, B. morosa Mesnil, B. robusta Malloch, B. steini (Brauer et Bergenstamm) and B. triangulifera (Zetterstedt) and nine species are described as new to science, B. brevicauda Zhang et Shima sp. nov. (China), B. carinata Zhang et Shima sp. nov. (China), B. chinensis Zhang et Shima sp. nov. (China and Vietnam), B. flava Zhang et Wang sp. nov. (China), B. kurahashii Zhang et Shima sp. nov. (Laos and Thailand), B. micronychia Zhang et Shima sp. nov. (China and Japan; previously misidentified from China as B. irrorata (Meigen)), B. papei Zhang et Shima sp. nov. (Malaysia), B. setigera Zhang et Shima sp. nov. (China) and B. verticalis Shima et Zhang sp. nov. (China). Billaea fasciata (Townsend, 1928) is treated as a junior synonym of B. ficorum (Townsend, 1916), syn. nov. Billaea irrorata is no longer recorded from the eastern Palearctic. A key to 19 species of Billaea from the eastern Palearctic and Oriental regions and 101 figures of male terminalia, bodies, heads and abdomens are given.

  12. Streblidae (Diptera: Hippoboscoidea) from Yucatan and Updated Species List for Mexico. (United States)

    Cuxim-Koyoc, Alan; Reyes-Novelo, Enrique; Morales-Malacara, Juan B; Bolívar-Cimé, Beatriz; Laborde, Javier


    This study describes the diversity of ectoparasitic bat flies (Diptera: Streblidae) in the state of Yucatan, Mexico. Fieldwork was carried out from June 2010 to January 2012 in seven municipalities of Yucatan, where 13 sampling sites were selected to capture bats using mist nets. Over 156 sampling nights a total of 910 bats were captured; these belonged to 19 species in four families: Mormoopidae, Phyllostomidae, Natalidae, and Vespertilionidae. Phyllostomidae was the richest family (13 bat species), followed by Mormoopidae (3 spp.), Vespertilionidae (2 spp.), and Natalidae (1 spp.). After careful inspection of the bats, a total of 2,134 Streblid bat flies were collected, belonging to 17 species in six genera (Nycterophilia coxata Ferris, N. natali Wenzel, Trichobius diphyllae Wenzel, T. dugesii Townsend, T. galei Wenzel, T. hirsutulus Bequaert, T. intermedius Peterson and Hurka, T. parasiticus Gervais, T. uniformis Curran, T. yunkeri Wenzel, Megistopoda aranea Coquillett, M. proxima Séguy, Aspidoptera delatorrei Wenzel, Strebla alvarezi Wenzel, S. diphyllae Wenzel, S. wiedemanni Kolenati, and Metelasmus pseudopterus Coquillett). The richest and most diverse genus was Trichobius. Five species--N. natali, T. diphyllae, M. proxima, A. delatorrei, and M. pseudopterus, are new records for Yucatan, and T. galei is a new record for the country, increasing the total number of Streblidae species for Mexico to 49.

  13. The achaete-scute complex in Diptera: patterns of noncoding sequence evolution. (United States)

    Negre, B; Simpson, P


    The achaete-scute complex (AS-C) has been a useful paradigm for the study of pattern formation and its evolution. achaete-scute genes have duplicated and evolved distinct expression patterns during the evolution of cyclorraphous Diptera. Are the expression patterns in different species driven by conserved regulatory elements? If so, when did such regulatory elements arise? Here, we have sequenced most of the AS-C of the fly Calliphora vicina (including the genes achaete, scute and lethal of scute) to compare noncoding sequences with known cis-regulatory sequences in Drosophila. The organization of the complex is conserved with respect to Drosophila species. There are numerous small stretches of conserved noncoding sequence that, in spite of high sequence turnover, display binding sites for known transcription factors. Synteny of the blocks of conserved noncoding sequences is maintained suggesting not only conservation of the position of regulatory elements but also an origin prior to the divergence between these two species. We propose that some of these enhancers originated by duplication with their target genes.

  14. Development sites, feeding modes and early stages of seven European Palloptera species (Diptera, Pallopteridae). (United States)

    Rotheray, Graham E


    Two hundred and ninety-eight rearing records and 87 larvae and puparia were obtained of seven species of Palloptera Fallén (Diptera, Pallopteridae), mainly in Scotland during 2012-2013. The third stage larva and puparium of each species were assessed morphologically and development sites and feeding modes investigated by rearing, observation and feeding tests. Early stages appear to be distinguished by the swollen, apico-lateral margins of the prothorax which are coated in vestiture and a poorly developed anal lobe with few spicules. Individual pallopteran species are separated by features of the head skeleton, locomotory spicules and the posterior respiratory organs. Five species can be distinguished by unique character states. Observations and feeding tests suggest that the frequently cited attribute of zoophagy is accidental and that saprophagy is the primary larval feeding mode with autumn/winter as the main period of development. Food plants were confirmed for flowerhead and stem developing species and rain is important for maintaining biofilms on which larvae feed. Due to difficulties in capturing adults, especially males, the distribution and abundance of many pallopteran species is probably underestimated. Better informed estimates are possible if early stages are included in biodiversity assessments. To facilitate this for the species investigated, a key to the third stage larva and puparium along with details on finding them, is provided. 

  15. Descriptions of three new species of the genus Cheilosia Meigen from China (Diptera, Syrphidae). (United States)

    Barkalov, Anatolij V; Ståhls, Gunilla


    Three species of genus Cheilosia (Diptera, Syrphidae: Eristalinae) from China are described as new to science, Cheilosia bullabucca Barkalov & Ståhls sp. n., C. lamproptera Barkalov & Ståhls sp. n. and C. yunnanensis Barkalov & Ståhls sp. n. We provide species descriptions and keys for their identification. The phylogenetic placements of the taxa was estimated based on their morphological characteristics and by analysing the taxa under parsimony using a mtDNA COI sequence dataset including a comprehensive set of Palaearctic previously generated Cheilosia spp. sequences representing all major subgenera. Based on both their morphological affinities and the molecular data. The Chinese taxa were placed in the subgenera Eucartosyrphus (C. bullabucca), Cheilosia s. str. (C. oblonga), Floccocheila (C. versicolor) while C. yunnanensis was not resolved as member of Cheilosia s. str. based on DNA despite sharing morphological characteristics with the subgenus. As the name Cheilosia (Nephocheila) prima Barkalov & Cheng from China is a junior homonym of Cheilosia (Cartosyrphus) prima Hunter, 1896 from the Nearctic region, for the Chinese species the new name Cheilosia (Nephocheila) primaria Barkalov & Ståhls nomen nov. is proposed.

  16. Origin and development of the dorso-ventral flight muscles in Chironomus (Diptera; Nematocera). (United States)

    Lebart-Pedebas, M C


    The origin and development of the dorso-ventral flight muscles (DVM) was studied by light and electron microscopy in Chironomus (Diptera; Nematocera). Chironomus was chosen because unlike Drosophila, its flight muscles develop during the last larval instar, before the lytic process of metamorphosis. Ten fibrillar DVM were shown to develop from a larval muscle associated with myoblasts. This muscle is connected to the imaginal leg disc so that its cavity communicates with the adepithelial cells present in the disc; but no migration of myoblasts seems to take place from the imaginal leg disc towards the larval muscle or vice versa. At the beginning of the last larval instar, the myoblasts were always present together with the nerves in the larval muscle. In addition, large larval muscle cells incorporated to the imaginal discs were observed to border on the area occupied by adepithelial cells, and are probably involved in the formation of 4 other fibrillar DVM with adepithelial cells. Three factors seem to determine the number of DVM fibres: the initial number of larval fibres in the Anlage, the fusions of myoblasts with these larval fibres and the number of motor axons in the Anlage. The extrapolation of these observations to Drosophila, a higher dipteran, is discussed.

  17. Distributional patterns of the Neotropical genus Thecomyia Perty (Diptera, Sciomyzidae and phylogenetic support

    Directory of Open Access Journals (Sweden)

    Amanda Ciprandi Pires


    Full Text Available Distributional patterns of the Neotropical genus Thecomyia Perty (Diptera, Sciomyzidae and phylogenetic support. The distributional pattern of the genus Thecomyia Perty, 1833 was defined using panbiogeographic tools, and analyzed based on the phylogeny of the group. This study sought to establish biogeographical homologies in the Neotropical region between different species of the genus, based on their distribution pattern and later corroboration through its phylogeny. Eight individual tracks and 16 generalized tracks were identified, established along nearly the entire swath of the Neotropics. Individual tracks are the basic units of a panbiogeographic study, and correspond to the hypothesis of minimum distribution of the organisms involved. The generalized tracks, obtained from the spatial congruence between two or more individual tracks, are important in the identification of smaller areas of endemism. Thus, we found evidence from the generalized tracks in support of previous classification for the Neotropical region. The Amazon domain is indicated as an area of outstanding importance in the diversification of the group, by the confluence of generalized tracks and biogeographic nodes in the region. Most of the generalized tracks and biogeographical nodes were congruent with the phylogenetic hypothesis of the genus, indicating support of the primary biogeographical homologies originally defined by the track analysis.

  18. Puncture resistance in 'Sharwil' avocado to oriental fruit fly and Mediterranean fruit fly (Diptera: Tephritidae) oviposition. (United States)

    Follett, Peter A


    The physiological basis for host antibiosis or nonpreference to a quarantine pest is often not understood. Studies are needed on the mechanisms that impart resistance to better understand how resistance might fail. Experiments were conducted to examine the infestability of 'Sharwil' avocados by oriental fruit fly, Bactrocera dorsalis (Hendel), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), after harvest and to quantify the effect of avocado skin hardness on resistance to infestation by oriental fruit fly. Infestation rate increased with decreasing fruit firmness, but fruit were generally poor hosts. Fruit with a patch of skin removed produced more flies than intact fruit, suggesting that skin puncture resistance was an important deterrent to oviposition. This study showed that fruit can be infested within 1 d after harvest, suggesting that fruit should be transferred to fruit fly-proof containers as they are harvested to minimize the risk of attack. Although risk of infestation is negatively correlated with fruit firmness, even some hard fruit may become infested. Therefore, fruit firmness cannot be used alone as an indicator to ensure fruit fly-free 'Sharwil' avocados. Measuring fruit firmness may be a useful component of a multiple component systems approach as an additional safeguard to reduce risk of infestation.

  19. Genetic relationship of the melon fly, Bactrocera cucurbitae (Diptera: Tephritidae) inferred from mitochondrial DNA

    Institute of Scientific and Technical Information of China (English)

    Yi Wu; Bruce A. McPheron; Jia-Jiao Wu; Zhi-Hong Li


    The melon fruit fly,Bactrocera cucurbitae (Coquillett) (Diptera:Tephritidae),has been the subject of worldwide quarantine and management efforts due to its widespread agricultural impact and potential for rapid range expansion.From its presumed native distribution in India,this species has spread throughout the hot-humid regions of the world.We provide information that reveals population structure,invasion history and population connectivity from 23 locations covering nine countries based on DNA sequences of the mitochondrial cytochrome oxidase I (COI) gene.Forty-two polymorphic sites were described among 38 haplotypes.The most common haplotype,H1,was observed in 73% of the samples distributed among all populations.Highest genetic diversity was seen within populations,and no isolation-by-distance was detected.The western regions (Nepal,Bangladesh,Thailand,Burma and China-west) showed higher haplotype diversity than eastern regions (Chins-east).China-Yunnan showed highest levels of genetic diversity in China.Haplotype diversity decreased with longitude from west to east.Together,these analyses suggest that B.cucurbitae has expanded from west to east within a limited geographic scale and recently invaded China through Yunnan Province.

  20. Sampling methods for assessing syrphid biodiversity (Diptera: Syrphidae) in tropical forests. (United States)

    Marcos-García, M A; García-López, A; Zumbado, M A; Rotheray, G E


    When assessing the species richness of a taxonomic group in a specific area, the choice of sampling method is critical. In this study, the effectiveness of three methods for sampling syrphids (Diptera: Syrphidae) in tropical forests is compared: Malaise trapping, collecting adults with an entomological net, and collecting and rearing immatures. Surveys were made from 2008 to 2011 in six tropical forest sites in Costa Rica. The results revealed significant differences in the composition and richness of syrphid faunas obtained by each method. Collecting immatures was the most successful method based on numbers of species and individuals, whereas Malaise trapping was the least effective. This pattern of sampling effectiveness was independent of syrphid trophic or functional group and annual season. An advantage of collecting immatures over collecting adults is the quality and quantity of associated biological data obtained by the former method. However, complementarity between results of collecting adults and collecting immatures, showed that a combined sampling regime obtained the most complete inventory. Differences between these results and similar studies in more open Mediterranean habitats, suggest that for effective inventory, it is important to consider the effects of environmental characteristics on the catchability of syrphids as much as the costs and benefits of different sampling techniques.

  1. Ultrastructure of antennal sensory organs of horse nasal-myiasis fly, Rhinoestrus purpureus (Diptera: Oestridae). (United States)

    Liu, X H; Li, X Y; Li, K; Zhang, D


    Rhinoestrus purpureus (Brauer, 1858) (Diptera: Oestridae) is an economically important parasite that can cause severe nasal myiasis in equids or even attacking humans. The antennae of R. purpureus were examined using stereoscopic microscopy and scanning electron microscopy. The general morphology was provided detailedly, together with distribution, type, size, and ultrastructure of antennal sensilla. All the three antennal segments, antennal scape, pedicel, and funiculus, are interspersed by microtrichiae. Only mechanoreceptors are detected on antennal scape and pedicel. On antennal funiculus, three types of sensilla were observed, including basiconic sensilla, coeloconic sensilla and clavate sensilla. Two features are characterized of this host-specific bot fly: (1) numerous sensory pits with branched basiconic sensilla on antennal funiculus and (2) the absence of trichoid sensilla. The function of these distinctive traits are discussed in association with the life history. We suggest that more sensory pits with branched sensilla could increase the sensitivity of olfactory system for host orientation, while the capability of pheromone identification might be reduced due to the absence of trichoid sensilla. Besides, we support both thermo- and chemo-functions of coeloconic sensilla.

  2. Scanning electron microscopy of antennal sensory organs of the cattle grub, Hypoderma lineatum (Diptera: Oestridae). (United States)

    Li, X Y; Liu, X H; Ge, Y Q; Zhang, D


    Hypoderma lineatum (Villers, 1789) (Diptera: Oestridae) is a hypodermosis fly that has resulted in great economic losses worldwide. The antennae of cattle grub males and females were examined through stereoscopic microscopy and scanning electron microscopy to reveal the general morphology, combined with distribution, type, size, and ultrastructure of the antennal sensilla. All of the three antennal segments (antennal scape, pedicel, and funiculus) possess microtrichiae on their surface. Mechanoreceptors only exist on the antennal scape and pedicel. The antennal funiculus presents four types of antennal sensilla: trichoid, basiconic, coeloconic, and clavate sensilla. Three distinctive characters of H. lineatum are obvious: (1) the relatively slender, flexible, and equal-height mechanoreceptors; (2) the enlarged antennal pedicel, and numerous antennal sensory pits and pit sensilla on the antennal funiculus; and (3) all types of antennal sensilla clustered in sensory pits, respectively. Additionally, the enlarged antennal pedicel and abundant sensory pits and pit sensilla might facilitate odor detection, enhance olfactory sensitivity and accuracy, and also protect the fragile antennal sensilla from mechanical irritation or damage.

  3. Worthy of their name: how floods drive outbreaks of two major floodwater mosquitoes (Diptera: Culicidae). (United States)

    Berec, Ludĕk; Gelbic, Ivan; Sebesta, Oldrich


    An understanding of how climate variables drive seasonal dynamics of mosquito populations is critical to mitigating negative impacts of potential outbreaks, including both nuisance effects and risk of mosquito-borne infectious disease. Here, we identify climate variables most affecting seasonal dynamics of two major floodwater mosquitoes, Aedes vexans (Meigen, 1830) and Aedes sticticus (Meigen, 1838) (Diptera: Culicidae), along the lower courses of the Dyje River, at the border between the Czech Republic and Austria. Monthly trap counts of both floodwater mosquitoes varied both across sites and years. Despite this variability, both models used to fit the observed data at all sites (and especially that for Ae. sticticus) and site-specific models fitted the observed data quite well. The most important climate variables we identified-temperature and especially flooding-were driving seasonal dynamics of both Aedes species. We suggest that flooding determines seasonal peaks in the monthly mosquito trap counts while temperature modulates seasonality in these counts. Hence, floodwater mosquitoes indeed appear worthy of their name. Moreover, the climate variables we considered for modeling were able reasonably to predict mosquito trap counts in the month ahead. Our study can help in planning flood management; timely notification of people, given that these mosquitoes are a real nuisance in this region; public health policy management to mitigate risk from such mosquito-borne diseases as that caused in humans by the Tahyna virus; and anticipating negative consequences of climate change, which are expected only to worsen unless floods, or the mosquitoes themselves, are satisfactorily managed.

  4. Effect of age on cuticular hydrocarbon profiles in adult Chrysomya putoria (Diptera: Calliphoridae). (United States)

    Braga, Marina Vianna; Pinto, Zeneida Teixeira; Queiroz, Margareth Maria de Carvalho; Blomquist, Gary James


    A species-specific complex mixture of highly stable cuticular hydrocarbons (CHCs) covers the external surface of all insects. Components can be readily analyzed by gas chromatography coupled to mass spectrometry (GC-MS) to obtain a cuticular hydrocarbon profile, which may be used as an additional tool for the taxonomic differentiation of insect species and also for the determination of the age and sex of adult and immature forms. We used GC-MS to identify and quantify the CHCs of female and male Chrysomya putoria (Wiedemann, 1818) (Diptera: Calliphoridae) from one to five days old. CHCs ranged from C21 to C35 for females and from C21 to C37 in males. Major compounds were the same for both sexes and were 2-MeC28, C29:1, n-C29, 15-,13-MeC29, 2-MeC30, C31:1, n-C31 and 15-,13-MeC31. The relative abundance of each component, however, varied with age. Cluster Analysis using Bray-Curtis measure for abundance showed that cuticular hydrocarbon profiles are a strong and useful tool for the determination of age in adult C. putoria.

  5. Effects of foliar surfactants on host plant selection behavior of Liriomyza huidobrensis (Diptera: Agromyzidae). (United States)

    McKee, Fraser R; Levac, Joshua; Hallett, Rebecca H


    The pea leafminer, Liriomyza huidobrensis (Diptera: Agromyzidae), is a highly polyphagous insect pest of global distribution. L. huidobrensis feeds and lays its eggs on leaf tissue and reduces crop marketability because of stippling and mining damage. In field insecticide trials, it was observed that stippling was reduced on plants treated with surfactant alone. The objectives of this study were to determine the effect of surfactants on host selection behaviors of female L. huidobrensis and to assess the phytotoxicity of two common surfactants to test plants. The application of the surfactant Sylgard 309 to celery (Apium graveolens) caused a significant reduction in stippling rates. The application of Agral 90 to cucumber leaves (Cucumis sativus) resulted in changes to the amount of effort invested by females in specific host plant selection behaviors, as well as causing a significant reduction in the amount of stippling damage. The recommended dose of Sylgard 309 does not induce phytotoxicity on celery over a range of age classes nor does Agral 90 cause a phytotoxic effect in 35-d-old cucumber. Thus, reductions in observed stippling and changes to host selection behaviors were caused by an antixenotic effect of the surfactant on L. huidobrensis rather than a toxic effect of the surfactant on the plant. The presence of surfactant on an otherwise acceptable host plant seems to have masked host plant cues and prevented host plant recognition. Results indicate that surfactants may be used to reduce leafminer damage to vegetable crops, potentially reducing the use of insecticides.

  6. Phylogeography of the Asian rice gall midge Orseolia oryzae (Wood Mason) (Diptera: Cecidomyiidae) in Thailand. (United States)

    Janique, Solene; Sriratanasak, Wantana; Ketsuwan, Kulchana; Jairin, Jirapong; Jeratthitikul, Ekgachai


    The Asian rice gall midge (RGM) Orseolia oryzae (Wood Mason) (Diptera: Cecidomyiidae) is a major pest of rice, leading to yield losses in Thailand and many Asian countries. Despite an increasing number of reported midge outbreaks and the presence of many susceptible rice varieties, only a few studies have focused on the genetic variation of the midges. Therefore, we analyzed the phylogeography among Thai RGM populations covering north, northeast and central Thailand. Two mitochondrial DNA genes, cytochrome C oxidase I (COI) and 12S, and a non-coding repeat region (RR) situated just before COI were amplified. Overall, the haplotype diversity for COI and 12S genes of the Thai population was high, but the nucleotide diversity was quite low. Altogether, the phylogenetic tree and pairwise F st values indicated that Thai RGM populations recently expanded and were homogeneously distributed throughout the country, except for some populations in the north, which most likely became recently isolated from the main population. Two non-coding repeat motifs, that were recently observed in the mitogenome of RGM in India, were absent in Thai populations and replaced by an 89 bp non-coding sequence. Tandem nucleotide repeats of the sequence TA were also observed. The repeat copy number varied from 2 to 11 and was not correlated with geographical repartition of the midge. Finally, COI barcoding divergence between Indian and Thai populations was high (6.3% in average), giving insights into the potential existence of an RGM species complex in Asia.

  7. Artificial activation of mature unfertilized eggs in the malaria vector mosquito, Anopheles stephensi (Diptera, Culicidae). (United States)

    Yamamoto, Daisuke S; Hatakeyama, Masatsugu; Matsuoka, Hiroyuki


    In the past decade, many transgenic lines of mosquitoes have been generated and analyzed, whereas the maintenance of a large number of transgenic lines requires a great deal of effort and cost. In vitro fertilization by an injection of cryopreserved sperm into eggs has been proven to be effective for the maintenance of strains in mammals. The technique of artificial egg activation is a prerequisite for the establishment of in vitro fertilization by sperm injection. We demonstrated that artificial egg activation is feasible in the malaria vector mosquito, Anopheles stephensi (Diptera, Culicidae). Nearly 100% of eggs dissected from virgin females immersed in distilled water darkened, similar to normally oviposited fertilized eggs. It was revealed by the cytological examination of chromosomes that meiotic arrest was relieved in these eggs approximately 20 min after incubation in water. Biochemical examinations revealed that MAPK (mitogen-activated protein kinase)/ERK (extracellular signal-regulated protein kinase) and MEK (MAPK/ERK kinase) were dephosphorylated similar to that in fertilized eggs. These results indicate that dissected unfertilized eggs were activated in distilled water and started development. Injection of distilled water into body cavity of the virgin blood-fed females also induced activation of a portion of eggs in the ovaries. The technique of artificial egg activation is expected to contribute to the success of in vitro fertilization in A. stephensi.

  8. New Records of Phlebotomine Sandflies (Diptera: Psychodidae at Sierra Nevada de Santa Marta, Colombia

    Directory of Open Access Journals (Sweden)

    Eduar Elías BEJARANO


    Full Text Available NUEVOS HALLAZGOS DE FLEBOTOMÍNEOS (DIPTERA: PSYCHODIDAE EN LA SIERRA NEVADA DE SANTA MARTA, COLOMBIAEl componente entomológico de la leishmaniasis ha sido poco estudiado en la Sierra Nevada de Santa Marta, Colombia, incluido el departamento del Magdalena, donde a la fecha están registradas trece especies de Lutzomyia. En la presente nota se informa el hallazgo de tres especies y un subgénero más en la región. Se recolectaron 885 flebotomíneos en Seywiaka y las veredas Las Tinajas y Calabazo, estribaciones de la Sierra Nevada de Santa Marta (117-130 m.s.n.m.. El 84% de los ejemplares se obtuvieron con trampa CDC, el 11% con trampa Shannon y el 5% fueron capturados, en reposo, con un dispositivo eléctrico de succión.  Se identificaron nueve especies, Lu. gomezi, Lu. panamensis, Lu. trinidadensis, Lu. carpenteri, Lu. evansi, Lu. dysponeta, Lu. dubitans, Lu. shannoni, y Lu. micropyga, la más abundante fue Lu. gomezi (69%, seguida por Lu. panamensis (14%. También se recolectaron ejemplares de la serie Lu. osornoi del subgénero Helcocyrtomyia. Entre el material hallado sobresalen Lu. carpenteri, Lu. dubitans y Lu. dysponeta como primeros registros para el departamento del Magdalena, además de Lu. (Helcocyrtomyia sp., que representa el primer hallazgo del subgénero en el Caribe colombiano.

  9. Low malathion concentrations influence metabolism in Chironomus sancticaroli (Diptera, Chironomidae in acute and chronic toxicity tests

    Directory of Open Access Journals (Sweden)

    Débora Rebechi


    Full Text Available Low malathion concentrations influence metabolism in Chironomus sancticaroli (Diptera, Chironomidae in acute and chronic toxicity tests. Organophosphate compounds are used in agro-systems, and in programs to control pathogen vectors. Because they are continuously applied, organophosphates often reach water sources and may have an impact on aquatic life. The effects of acute and chronic exposure to the organophosphate insecticide malathion on the midge Chironomus sancticaroli are evaluated. To that end, three biochemical biomarkers, acetylcholinesterase (AChE, alpha (EST-α and beta (EST-β esterase were used. Acute bioassays with five concentrations of malathion, and chronic bioassays with two concentrations of malathion were carried out. In the acute exposure test, AChE, EST-α and EST-β activities declined by 66, 40 and 37%, respectively, at 0.251 µg L-1 and more than 80% at 1.37, 1.96 and 2.51 µg L-1. In chronic exposure tests, AChE and EST-α activities declined by 28 and 15% at 0.251 µg L-1. Results of the present study show that low concentrations of malathion can influence larval metabolism, indicating high toxicity for Chironomus sancticaroli and environmental risk associated with the use of organophosphates.

  10. Spatial distributions of the leafminer Ophiomyia maura (Diptera: Agromyzidae) in host plant Aster ageratoides

    Institute of Scientific and Technical Information of China (English)

    Yoshiko Ayabe; Ei'ichi Shibata


    The seasonal occurrence and among-plant and within-plant spatial distribution of the multivoltine leafminer Ophiomyia maura Meigen (Diptera: Agromyzidae) on the herbaceous plant Aster ageratoides Turcz. subsp, ovatus (Asteraceae) were investigated in the field. O. maura has at least four generations a year and mines per leaf fluctuate with a mean of 0.007 throughout the occurrence period. Seasonal occurrence is associated with abundance of new host leaves, suggesting O. maura females prefer to oviposit in newly emerged leaves. The among-plant distribution of O. maura is described by a Poisson distribution early in the season but tends to be weakly clumped later. The within-plant vertical distribution of larval mines increased from middle to upper leaves during plantdevelopment, because mined leaves in the middle position early in the season move downward with the emergence of new leaves, shifting mined leaves from the position where O. maura oviposits eggs. Later in the season, mined leaves remain where they are deposited because few new leaves emerge. The spatial distribution of O. rnaura, resource utilization patterns, and host plant characteristics are discussed.

  11. Neotropical Copestylum Macquart (Diptera: Syrphidae Breeding in Fruits and Flowers, Including 7 New Species.

    Directory of Open Access Journals (Sweden)

    Antonio Ricarte

    Full Text Available Ten species of Copestylum (Diptera: Syrphidae were reared from fruits and flowers in Costa Rica, Ecuador and Trinidad. Seven were new and in this paper, we describe them, their development sites and the third stage larva and/or the puparium of all ten species. One new synonym is proposed, Copestylum pinkusi (Curran [= Copestylum cinctiventre (Curran]. Similarities and differences between these new and other Copestylum species, suggest they separate into two groups, referred to as the Vagum and Cinctiventre species groups. Features characterising these groups for both adult and early stages are assessed. Each species was also distinguished using adult and early stage characters. Within the Vagum group, adults were more disparate morphologically than the larval stage; this was reversed in the Cinctiventre group. Adult colour patterns are probably cryptic in function and for disguise. Vagum species have disruptive marks, while the Cinctiventre species have reflective colours. Biologically, the groups are almost distinguished by larval development sites. Vagum species use predominantly fruits and have a larval stage that is relatively generalised in form and habit. Cinctiventre species are confined to developing in flowers and the larva is more specialised. A key to both adult and early stages of all ten species is provided.

  12. Morphology, Ultrastructure and Possible Functions of Antennal Sensilla of Sitodiplosis mosellana Géhin (Diptera: Cecidomyiidae) (United States)

    Wang, Yue; Li, Dan; Liu, Yang; Li, Xue-Jiao; Cheng, Wei-Ning; Zhu-Salzman, Keyan


    To better understand the olfactory receptive mechanisms involved in host selection and courtship behavior of Sitodiplosis mosellana (Diptera: Cecidomyiidae), one of the most important pests of wheat, scanning and transmission electron microscopy were used to examine the external morphology and ultrastructure of the antennal sensilla. The moniliform antennae exhibit obvious sexual dimorphism: antennae of the males are markedly longer than those of the females. Furthermore, each male flagellomere consists of two globular nodes, whereas each female flagellomere is cylindrical. Seven types of sensilla were identified in both sexes. Two types of s. chaetica have a lumen without dendrites and thick walls, suggesting that they are mechanoreceptors. S. trichodea and s. circumfila are typical chemoreceptors, possessing thin multiporous walls encircling a lumen with multiple dendrites. There are significantly more s. trichodea in female than in male, which may be related to host plant localization. In contrast, male s. circumfila are highly elongated compared to those of females, perhaps for pheromone detection. Peg-shaped s. coeloconica are innervated with unbranched dendrites extending from the base to the distal tip. Type 1 s. coeloconica, which have deep longitudinal grooves and finger-like projections on the surface, may serve as olfactory or humidity receptors, whereas type 2 s. coeloconica, smooth with a terminal pore, may be contact chemoreceptors. Also, this is the first report of Böhm’ bristles at proximal scape on antennae of Cecidomyiid species potentially functioning as mechanoreceptors. PMID:27623751


    Directory of Open Access Journals (Sweden)



    Full Text Available The Bactrocera dorsalis complex (Diptera: Tephritidae used in this study included B. dorsalis, B. arecae, B. propinqua, B. pyrifoliae, B. verbascifoliae, and three new species complexes are species E, species K and species P. Bactrocera tau was used as an out-group. A total of 424 adults, which emerged from pupae collected from natural populations in Thai land, were prepared for wing measurements. Morphometric analysis was performed on measurements of wing vein characters. Wing images were captured in digital format and taken through digital image processing to calculate the Euclidean distance between wing vein junctions. Discriminant and cluster analyses were used for dichotomy of classification processes. All 424 wing specimens were classified to species in terms of the percentage of "grouped" cases which yielded about 89.6% accurate identificati on compared with the formal description of these species. After clustering, the percentage of "grouped"cases yielded 100.0%, 98.9%, 98.1%, 95.2% and 84.6% accurate identification between the B. dorsalis complex and B. tau; B. arecae and Species E; B. dorsalis and B. verbascifoliae; B. propinqua and B. pyrifoliae; and species K and species P, respectively. This method of numerical taxonomy may be useful for practical identification of other groups of agricultural pests.

  14. Cold tolerance and disinfestation of Bactrocera invadens (Diptera: Tephritidae) in 'Hass' avocado. (United States)

    Ware, A B; Du Toit, C L N; Mohamed, S A; Nderitu, P W; Ekasi, S


    Bactrocera invadens (Diptera: Tephritidae) has spread rapidly across Africa and currently poses a phytosanitary threat to the fruit industry of South Africa. In reaction a cold mitigating treatment to provide phytosanitary security to importing countries was developed in Nairobi, Kenya. Using laboratory reared fruit flies, the rate of development in 'Hass' avocado (Persea americana Miller) was determined at 28 degrees C. Fruit ripeness or softness was found to be a factor improving larval fruit fly survival. Using this information the egg and larval developmental stages were subjected to 2 degrees C cold treatment and it was found that the third instars were the most cold tolerant life stage and that it was expected that between 16 and 17 d treatment would provide phytosanitary security. There were no survivors in the treatment of an estimated 153,001 individuals in four replicates at an average fruit pulp temperature of 2 degrees C satisfying the Probit 9 level of efficiency at a confidence of >95%. These data provide evidence that a continuous cold treatment of 1.5 degrees C or lower for 18 d would provide phytosanitary security in that any consignment entering an importing country poses no risk of accidental importation of B. invadens.

  15. Forensically important calliphoridae (diptera) associated with pig carrion in rural north-central Florida (United States)

    Gruner, Susan V.; Slone, D.H.; Capinera, J.L.


    A study to determine the relative abundance and seasonality of forensically important blow flies (Diptera: Calliphoridae) in rural north-central Florida was conducted using pig carcasses (Sus scrofa L.) as models for human bodies. Seven species of Calliphoridae were collected: Lucilia coeruleiviridis (=Phoenicia) (Macquart), Cochliomyia macellaria (F.), Chrysomya rufifaces (Macquart), Phormia regina (Meigen), Chrysomya megacephala (F.), and a few specimens of Calliphora livida Hall, and Calliphora vicina Robineau-Desvoidy. Species composition in aerial collections of adult flies, preserved larval collections, and samples of larvae reared to the adult stage were all highly correlated. Relative abundance of the species found was significantly different, with L. coeruleiviridis the most abundant species year-round. The relative abundance of the collected species varied significantly by day of decomposition and by season, with significant interactions between season and day, season and species, and day and species. L. coeruleiviridis, C. macellaria, C. rufifaces, and P. regina were found during the entire year, two C. vicina specimens and 11 C. livida specimens were collected from December to March, whereas C. megacephala was collected only from June through September. ?? 2007 Entomological Society of America.

  16. Diversity and synanthropy of Calliphoridae (Diptera) in the region of Rio Claro, SP, Brazil. (United States)

    De Souza, C R; Zuben, C J V


    Dipteran blowflies (Calliphoridae) are of great medical and hygienic importance as vectors of pathogens and as parasites of living and dead tissue, and their association with carrion allows their use in forensic entomology. The objective of this study was to determine the synanthropic index of adult Calliphoridae (Diptera) collected in Rio Claro, São Paulo. Sampling occurred between September 2009 and August 2010. Traps baited with sardines, beef liver, and minced meat were assessed for five consecutive days per month in three distinct ecological areas representing urban, rural, and forest environments. The most abundant species was Lucilia eximia (Wiedemann), followed by Chrysomya albiceps (Wiedemann) and Chrysomya megacephala (Fabricius). Lucilia eximia was the only species present in all seasons and the only species collected during the winter. The season with the lowest abundance was winter, with 69 (5.5%) specimens, and spring was the season with the greatest number of specimens collected (774-61.8%). The only species found outside inhabited areas (synanthropic) was Lucilia cuprina (Wiedemann), with a synanthropy index (SI) value of +5.7. The SI values for the other species were negative, showing a preference for uninhabited areas. The rural and urban areas were most similar in terms of species composition as were the beef and sardine baits. Among the baits used, liver attracted the greatest abundance of calliphorids, whereas minced meat attracted the greatest diversity.

  17. Large-scale mitogenomics enables insights into Schizophora (Diptera) radiation and population diversity. (United States)

    Junqueira, Ana Carolina M; Azeredo-Espin, Ana Maria L; Paulo, Daniel F; Marinho, Marco Antonio T; Tomsho, Lynn P; Drautz-Moses, Daniela I; Purbojati, Rikky W; Ratan, Aakrosh; Schuster, Stephan C


    True flies are insects of the order Diptera and encompass one of the most diverse groups of animals on Earth. Within dipterans, Schizophora represents a recent radiation of insects that was used as a model to develop a pipeline for generating complete mitogenomes using various sequencing platforms and strategies. 91 mitogenomes from 32 different species were sequenced and assembled with high fidelity, using amplicon, whole genome shotgun or single molecule sequencing approaches. Based on the novel mitogenomes, we estimate the origin of Schizophora within the Cretaceous-Paleogene (K-Pg) boundary, about 68.3 Ma. Detailed analyses of the blowfly family (Calliphoridae) place its origin at 22 Ma, concomitant with the radiation of grazing mammals. The emergence of ectoparasitism within calliphorids was dated 6.95 Ma for the screwworm fly and 2.3 Ma for the Australian sheep blowfly. Varying population histories were observed for the blowfly Chrysomya megacephala and the housefly Musca domestica samples in our dataset. Whereas blowflies (n = 50) appear to have undergone selective sweeps and/or severe bottlenecks in the New World, houseflies (n = 14) display variation among populations from different zoogeographical zones and low levels of gene flow. The reported high-throughput mitogenomics approach for insects enables new insights into schizophoran diversity and population history of flies.

  18. Screening of Asteraceae (Compositae Plant Extracts for Larvicidal Activity against Aedes fluviatilis (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Macêdo Maria E


    Full Text Available Ethanol extracts of 83 plants species belonging to the Asteraceae (Compositae family, collected in the State of Minas Gerais, Brazil, were tested for larvicidal activity against the mosquito Aedes fluviatilis - Diptera: Culicidae. The extract from Tagetes minuta was the most active with a LC90 of 1.5 mg/l and LC50 of 1.0 mg/l. This plant has been the object of several studies by other groups and its active components have already been identified as thiophene derivatives, a class of compounds present in many Asteraceae species. The extract of Eclipta paniculata was also significantly active, with a LC90 of 17.2 mg/l and LC50 of 3.3 mg/l and no previous studies on its larvicidal activity or chemical composition could be found in the literature. Extracts of Achryrocline satureoides, Gnaphalium spicatum, Senecio brasiliensis, Trixis vauthieri, Tagetes patula and Vernonia ammophila were less active, killing more than 50% of the larvae only at the higher dose tested (100 mg/l.

  19. Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae). (United States)

    Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge


    Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT.

  20. Development of the immature stages of Culex (Culex saltanensis Dyar (Diptera, Culicidae under laboratory conditions

    Directory of Open Access Journals (Sweden)

    João Antonio C. Zequi


    Full Text Available Development of the immature stages of Culex (Culex saltanensis Dyar (Diptera, Culicidae under laboratory conditions. Culex (Culex saltanensis Dyar, 1928 is becoming frequent and abundant in natural and artificial breeding sites in urban and rural areas of Brazil. This study contributes to the knowledge of the biology of a Brazilian strain of C. saltanensis. The development of specimens reared individually or grouped was observed. The study was conducted at a constant temperature of 27 ± 2°C, 14L:10D photoperiod and 80 ± 5% relative humidity. The immature stages were observed every 6 hours until adult emergence, which occurred in 12.29 days among individually reared specimens and in 13.12 days among group-reared specimens. Egg rafts for the experiment were obtained from the laboratory and field. Eggs hatched at a rate of 97.48 ± 2.32%. More eggs per egg raft were obtained from the field than from the laboratory. Males from individually reared specimens emerged in 12.29 ± 1.11 days and females in 13.12 ± 1.58 days. The male-female ratio was 1:1. Larval survival rate was higher than 85% for larvae reared isolated and higher than 95% for group-reared larvae. The Culex saltanensis life cycle was completed within 12 to 14 days, where larval instars I and IV took the most time to develop and the pupae, the shortest.

  1. Culicinae (Diptera: Culicidae Mosquitoes in Chabahar County, Sistan and Baluchistan Province, Southeastern Iran

    Directory of Open Access Journals (Sweden)

    SH Moosa-Kazemi


    Full Text Available  Background: Mosquito-borne diseases are a major public health threat in Iran. The objective of this study was to de­ter­mine the fauna of culicinae mosquitoes for future mosquito control programs.Methods: Three genera and eleven species of the subfamily Culicinae (Diptera: Culicidae were collected by dipping tech­nique and identified in Chabahar County, Sistan and Baluchistan Province, southeastern Iran, during January, Feb­ru­ary, and March 2007.Results: The collected species included:  Aedes vexans (new occurrence record for the province, Culex  arbieeni, Cx. bitaeniorhynchus, Cx. deserticola, Cx. hortensis, Cx. perexiguus, Cx. pipiens, Cx.  pseudovishnui, Cx. pusillus, Cx. quinquefasciatus, Cx. sinaiticus, Cx. theileri, Cx. tritaeniorhynchus, Culiseta longiareolata, Ochlerotatus cabal­lus, Oc. caspius, and Uranotaenia unguiculata.Conclusion: Our observations indicate that, in South of Iran hot and wet climatic conditions support the persistence of culicinae mosquitoes. As our study, regular monitoring of culicinae mosquitoes in this area could be the most use­ful for mosquito control and mosquito-borne disease prevention.

  2. Culicinae (Diptera: Culicidae Mosquitoes in Chabahar County, Sistan and Baluchistan Province, Southeastern Iran

    Directory of Open Access Journals (Sweden)

    SH Moosa-Kazemi


    Full Text Available   Abstract Background: Mosquito-borne diseases are a major public health threat in Iran. The objective of this study was to de­ter­mine the fauna of culicinae mosquitoes for future mosquito control programs."nMethods: Three genera and eleven species of the subfamily Culicinae (Diptera: Culicidae were collected by dipping tech­nique and identified in Chabahar County, Sistan and Baluchistan Province, southeastern Iran, during January, Feb­ru­ary, and March 2007."nResults: The collected species included:  Aedes vexans (new occurrence record for the province, Culex  arbieeni, Cx. bitaeniorhynchus, Cx. deserticola, Cx. hortensis, Cx. perexiguus, Cx. pipiens, Cx.  pseudovishnui, Cx. pusillus, Cx. quinquefasciatus, Cx. sinaiticus, Cx. theileri, Cx. tritaeniorhynchus, Culiseta longiareolata, Ochlerotatus cabal­lus, Oc. caspius, and Uranotaenia unguiculata."nConclusion: Our observations indicate that, in South of Iran hot and wet climatic conditions support the persistence of culicinae mosquitoes. As our study, regular monitoring of culicinae mosquitoes in this area could be the most use­ful for mosquito control and mosquito-borne disease prevention.

  3. Effect of abiotic factors on seasonal population dynamics of Lutzomyia longipalpis (Diptera: Psychodidae) in northeastern Brazil. (United States)

    Ximenes, Maria de Fátima Freire de Melo; Castellón, Eloy G; De Souza, Maria de Fátima; Menezes, Alexandre A Lara; Queiroz, José Wilton; Macedo e Silva, Virgínia Penéllope; Jerônimo, Selma M B


    The resurgence of visceral leishmaniasis in Brazil increases the need for studies to elucidate the spatial and temporal dynamics of Lutzomyia longipalpis (Lutz and Neiva) (Diptera: Psychodidae), the vector of Leishmania infantum, the causative agent of visceral leishmaniasis in Brazil. Sand flies were captured in peridomestic habitats biweekly for 3 yr. Cross-correlation tests and spectral analysis were used to analyze the simultaneous and lag-time correlations between Lu. longipalpis population densities and abiotic factors of temperature, relative humidity, wind velocity, and rainfall. Distinct seasonal patterns were observed for males and females, with intervals of 6 mo between population peaks for males and 12 mo for females. Peak female population densities lagged 3 mo behind the maximum annual temperature. Female population density was negatively correlated with relative humidity. An increase in average wind velocity was followed by a decrease in the number of females for 2 wk. Understanding the relationship between the seasonal population dynamics of Lu. longipalpis and abiotic factors will contribute to the design of better control measures to decrease transmission of L. infantum and consequently the incidence of leishmaniasis.

  4. Infectivity of Metarhizium anisopliae (Hypocreales: Clavicipitaceae) to Phlebotomus papatasi (Diptera: Psychodidae) under laboratory conditions. (United States)

    Zayed, Alia; Soliman, Mustafa M; El-Shazly, Mohamed M


    Susceptibility of Phlebotomus papatasi Scopoli (Diptera: Psychodidae) larvae to the entomopathogenic fungus Metarhizium anisopliae (Metschinkoff) Sorokin (Ma79) (Hypocreales: Clavicipitaceae) was evaluated at two different temperatures. The ability of the fungus to reinfect healthy sand flies was followed up for approximately 20 wk and the effect of in vivo repassage on the enhancement of its virulence was assessed. The fungus reduced the adult emergence at 26 +/- 1 degrees C when applied to larval diet. Six spore concentrations were used in the bioassays ranging from 1 x 10(6) to 5 x 10(8) spores/ml. Mortality decreased significantly when the temperature was raised to 31 +/- 1 degrees C at all tested concentrations. Fungus-treated vials were assayed against sand fly larvae at different time lapses without additional reapplication of the fungus in the media to determine whether the level of inocula persisting in the media was sufficient to reinfect healthy sand flies. Twenty weeks postapplication, there were still enough infectious propagules of Ma79 to infect 40% of P. papatasi larvae. A comparison between the infectivity of 10 subsequent in vitro cultures and the host-passed inocula of the fungus against sand fly larvae was conducted. Mortalities of P. papatasi larvae changed significantly when exposed to inocula passed through different insects. Presented data can provide vector control decision makers and end users with fundamental information for the introduction and application of M. anisopliae as an effective control agent against the main cutaneous leishmaniasis old-world vector P. papatasi.

  5. Determination of Calliphoridae (Diptera) fauna and seasonal distribution on carrion in Ankara province. (United States)

    Sabanoğlu, Burcu; Sert, Osman


    This study was conducted from March 2006 to 2007. The aim of the study was to determine the forensically significant Calliphoridae (Diptera) species and their seasonal distribution in Ankara province at Beytepe Campus. Pig carcasses were killed by a veterinary using pentobarbital sodium with intervals from 2 to 3 weeks to a month. Samples were collected from the carcass everyday in the morning, in the afternoon, and at sunset. Temperature and parameters of weather, such as cloudy, sunny, rainy, and snowy, were recorded at each visit. Phaenicia sericata (Meigen), Chrysomya albiceps (Wiedemann), Calliphora vomitoria (Linnaeus), and Calliphora vicina (Robineau-Desvoidy) species, which belong to Calliphoridae family, were collected. It was shown that the seasonal distribution of the collected species was different from each other. The species were determined on carcass between the following times; P. sericata, from April to November; C. albiceps, from May to November; Ca. vomitoria, from February to June and from September to December; and Ca. vicina, from February to May and in June and September. Calliphoridae fauna and its annual seasonal distribution in Turkey on 12 pig carcasses were reported for the first time in this study.

  6. Ultrastructure of immature stages of Cochliomyia macellaria (Diptera: Calliphoridae), a fly of medical and veterinary importance. (United States)

    Mendonça, Paloma Martins; Barbosa, Rodrigo Rocha; Cortinhas, Lucas Barbosa; dos Santos-Mallet, Jacenir Reis; de Carvalho Queiroz, Margareth Maria


    Cochliomyia macellaria (Diptera: Calliphoridae) is known as the secondary screwworm because it causes secondary or facultative myiasis when the larvae feed on necrotic tissues. This fly has a significant medical and veterinary importance since it has been reported to transport eggs of Dermatobia hominis (human botfly), which can cause significant economic losses to livestock. Since this screwworm has been collected colonizing both pig carcasses and human cadavers, it is considered one of the most important species for forensic entomology studies. Scanning electron microscopy (SEM) gives detailed information on the morphological characteristics which can help identify the immature forms of the flies. The aim of this study was to describe and analyze the morphological characteristics of the eggs, all the larval instars, and the puparia of Cochliomyia macellaria using SEM. The egg is ellipsoid and the dorsal surface is concave. The islands inside the median area had no anastomosis, but some perforations could be observed. From the second larval instar onwards, besides the intersegmental spines, other bands of spines were observed at the abdominal segments. Two spiracular openings were visible on the first and second larval instars, which were not expected. These characteristics are specific to Cochliomyia genus. The number and the general aspect of the spine tips in the cephalic region, the intersegmental bands on the abdomen, and the number of the spiracular openings could together help identify C. macellaria.

  7. Toxicity of eight metals to Malaysian freshwater midge larvae Chironomus javanus (Diptera, Chironomidae). (United States)

    Shuhaimi-Othman, Mohammad; Yakub, Nadzifah; Umirah, Nur Shahirul; Abas, Ahmad


    Fourth instars larvae of freshwater midge Chironomus javanus (Diptera, Chironomidae) were exposed for a 4-day period in laboratory conditions to a range of copper (Cu), cadmium (Cd), zinc (Zn), lead (Pb), nickel (Ni), iron (Fe), aluminium (Al) and manganese (Mn) concentrations. Mortality was assessed and median lethal concentrations (LC(50)) were calculated. LC(50) increased with the decrease in mean exposure times, for all metals. LC(50)s for 96 hours for Cu, Cd, Zn, Pb, Ni, Fe, Al and Mn were 0.17, 0.06, 5.57, 0.72, 5.32, 0.62, 1.43 and 5.27 mg/L, respectively. Metals bioconcentration in C. javanus increases with exposure to increasing concentrations and Cd was the most toxic to C. javanus, followed by Cu, Fe, Pb, Al, Mn, Zn and Ni (Cd > Cu > Fe > Pb > Al > Mn > Zn > Ni). Comparison of LC(50) values for metals for this species with those for other freshwater midges reveals that C. javanus is equally or more sensitive to metals than most other tested dipteran.

  8. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control. (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M


    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  9. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo


    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  10. Novel arrangement and comparative analysis of hsp90 family genes in three thermotolerant species of Stratiomyidae (Diptera). (United States)

    Astakhova, L N; Zatsepina, O G; Przhiboro, A A; Evgen'ev, M B; Garbuz, D G


    The heat shock proteins belonging to the Hsp90 family (Hsp83 in Diptera) play a crucial role in the protection of cells due to their chaperoning functions. We sequenced hsp90 genes from three species of the family Stratiomyidae (Diptera) living in thermally different habitats and characterized by extraordinarily high thermotolerance. The sequence variation and structure of the hsp90 family genes were compared with previously described features of hsp70 copies isolated from the same species. Two functional hsp83 genes were found in the species studied, that are arranged in tandem orientation at least in one of them. This organization was not previously described. Stratiomyidae hsp83 genes share a high level of identity with hsp83 of Drosophila, and the deduced protein possesses five conserved amino acid sequence motifs characteristic of the Hsp90 family as well as the C-terminus MEEVD sequence characteristic of the cytosolic isoform. A comparison of the hsp83 promoters of two Stratiomyidae species from thermally contrasting habitats demonstrated that while both species contain canonical heat shock elements in the same position, only one of the species contains functional GAF-binding elements. Our data indicate that in the same species, hsp83 family genes show a higher evolution rate than the hsp70 family.

  11. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie


    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  12. Impact of abiotic factor changes in blowfly, Achoetandrus rufifacies (Diptera: Calliphoridae), in northern Thailand. (United States)

    Klong-Klaew, Tunwadee; Sukontason, Kom; Ngoen-klan, Ratchadawan; Moophayak, Kittikhun; Irvine, Kim N; Kurahashi, Hiromu; Prangkio, Chira; Sanit, Sangob; Sukontason, Kabkaew L


    Understanding how medically important flies respond to abiotic factor changes is necessary for predicting their population dynamics. In this study, we investigated the geographical distribution of the medically important blowfly, Achoetandrus rufifacies (Macquart) (Diptera: Calliphoridae), and ascertained the response to climatic and physio-environmental factors in Chiang Mai, northern Thailand. Adult fly surveys were carried out every 2 weeks from May 2009 to May 2010 at 18 systematically randomized study sites in three districts of Chiang Mai province (Mueang Chiang Mai, Mae Rim, and Hang Dong), using reconstructable funnel traps with 1-day tainted beef offal as bait. During the study period, 8,861 adult A. rufifacies were captured, with peak densities being observed at the end of winter (i.e., late February) and throughout most of the summer (May to March). Population density had a weak but significant (α = 0.05) positive correlation with temperature (r = 0.329) and light intensity (r = 0.231), and a weak but significant (α = 0.05) negative correlation with relative humidity (r = -0.236). From the six ecological land use types (disturbed mixed deciduous forest, mixed deciduous forest, mixed orchard, lowland village, city town, and paddy field), greater fly densities were observed generally in the disturbed mixed deciduous forest and lowland village, but not in the paddy fields. In conclusion, A. rufifacies are abundant from the end of winter and throughout most of the summer in northern Thailand, with population density being weakly positively correlated with temperature and light intensity, but weakly negatively correlated with relative humidity. The greatest densities of this fly species were collected in disturbed mixed deciduous forest and lowland village land uses. The prediction of annual and season specific distributions of A. rufifacies were provided in each season and all-year patterns using a co-kriging approach (ArcGIS9.2).

  13. Efficacy of commercial mosquito traps in capturing phlebotomine sand flies (Diptera: Psychodidae) in Egypt. (United States)

    Hoel, D F; Kline, D L; Hogsette, J A; Bernier, U R; El-Hossary, S S; Hanafi, H A; Watany, N; Fawaz, E Y; Furman, B D; Obenauer, P J; Szumlas, D E


    Four types of commercial mosquito control traps, the Mosquito Magnet Pro (MMP), the Sentinel 360 (S360), the BG-Sentinel (BGS), and the Mega-Catch Ultra (MCU), were compared with a standard Centers for Disease Control and Prevention (CDC) light trap for efficacy in collecting phlebotomine sand flies (Diptera: Psychodidae) in a small farming village in the Nile River Valley 10 km north of Aswan, Egypt. Each trap was baited with either carbon dioxide (CO2) from combustion of butane gas (MMP), dry ice (CDC and BGS traps), light (MCU and S360), or dry ice and light (CDC). Traps were rotated through five sites in a5 x 5 Latin square design, repeated four times during the height of the sand fly season (June, August, and September 2007) at a site where 94% of sand flies in past collections were Phlebotomus papatasi (Scopoli). A total of 6,440 sand flies was collected, of which 6,037 (93.7%) were P. papatasi. Of the CO2-baited traps, the BGS trap collected twice as many P. papatasi as the MMP and CDC light traps, and at least three times more P. papatasi than the light-only MCU and S360 traps (P MMP 56.8 (+/- 9.0) > CDC 52.3 (+/- 6.1) > MCU 38.2 (+/- 6.4) > S360 12.6 (+/- 1.8). Results indicate that several types of commercial traps are suitable substitutes for the CDC light trap in sand fly surveillance programs.

  14. Diversity of phlebotomine sand flies (Diptera: Psychodidae) in Ibitipoca State Park, Minas Gerais, Brazil. (United States)

    Carvalho, Gustavo Mayr de Lima; De Vasconcelos, Fernanda Bernardes; Da Silva, Daniela Gonçalves; Botelho, Helbert Antônio; Filho, José Dilermando Andrade


    Leishmaniasis is a complex of zoonotic diseases that are endemic to many Brazilian states. They are transmitted to the vertebrates by the bite of the hematophagous female sand fly (Diptera: Psychodidae) vectors. Despite the increasing occurrence of visceral and cutaneous leishmaniasis cases in large urban centers, their transmission continues to occur primarily in a wild environment and may be associated with professional activities, ecotourism activities, or both. This study investigates the ecological parameters of the sand flies present in Ibitipoca State Park, Minas Gerais, Brazil. During 2009, systematic collections of sand flies were made monthly using HP light traps installed at five sites, including three natural settings (a cave, riparian vegetation, and a rain forest), the tourist and researchers' accommodations, and a surrounding domestic livestock area. In total, 161 sand flies (seven species) were collected, the most abundant, particularly in the surrounding domestic livestock area, being Lutzomyia (Psychodopygus) lloydi (Antunes, 1937). Furthermore, a previously unidentified Lutzomyia (Sciopemyia) sp. was prevalent in the cave environment. There are no existing records of the occurrence of leishmaniasis in Ibitipoca State Park; however, the some species of the subgenus Psychodopygus are known vectors of Leishmania spp in Brazil. Hence, the presence of a species of this genus in areas surrounding the park may represent a risk to ecotourism and the local inhabitants. Our study shows the importance of regular monitoring of the various areas used by humans to determine the distribution and spread of sand fly vectors for preventive management to forestall potential risk to health and consequent effect on ecotourists.

  15. Comparative efficacy of three suction traps for collecting phlebotomine sand flies (Diptera: Psychodidae) in open habitats. (United States)

    Faiman, Roy; Cuño, Ruben; Warburg, Alon


    The efficacy of three suction traps for trapping phlebotomine sand flies (Diptera: Psychodidae) was compared. Traps were baited with Co(2) and used without any light source. CO(2)-baited CDC traps were evaluated either in their standard downdraft orientation or inverted (iCDC traps). Mosquito Magnet-X (MMX) counterflow geometry traps were tested in the updraft orientation only. Both updraft traps (iCDC and MMX) were deployed with their opening ∼10 cm from the ground while the opening of the downdraft (CDC) trap was ∼40 cm above ground. Comparisons were conducted in two arid locations where different sand fly species prevail. In the Jordan Valley, 3,367 sand flies were caught, 2,370 of which were females. The predominant species was Phlebotomus (Phlebotomus) papatasi, Scopoli 1786 (>99%). The updraft-type traps iCDC and MMX caught an average of 118 and 67.1 sand flies per trap night, respectively. The CDC trap caught 32.9 sand flies on average per night, significantly less than the iCDC traps. In the Judean desert, traps were arranged in a 3 × 3 Latin square design. A total of 565 sand flies were caught, 345 of which were females. The predominant species was P. (Paraphlebotomus) sergenti Parrot 1917 (87%). The updraft traps iCDC and MMX caught an average of 25.6 and 17.9 sand flies per trap per night, respectively. The CDC trap caught 7.8 sand flies on average per night, significantly less than the iCDC traps. The female to male ratio was 1.7 on average for all trap types. In conclusion, updraft traps deployed with their opening close to the ground are clearly more effective for trapping sand flies than downdraft CDC traps in open habitats.

  16. Multilocus molecular and phylogenetic analysis of phlebotomine sand flies (Diptera: Psychodidae) from southern Italy. (United States)

    Latrofa, Maria Stefania; Dantas-Torres, Filipe; Weigl, Stefania; Tarallo, Viviana Domenica; Parisi, Antonio; Traversa, Donato; Otranto, Domenico


    This study reports a combined analysis of mitochondrial and ribosomal DNA target regions of phlebotomine sand flies (Diptera: Psychodidae) from the Mediterranean region. A ∼900 bp long fragment of the mitochondrial DNA encompassing regions within cytb and nd1 gene and the complete ITS2 ribosomal region (∼500 bp) were sequenced and characterized for Phlebotomus perniciosus, Phlebotomus perfiliewi, Phlebotomus neglectus, Phlebotomus papatasi, and Sergentomyia minuta, captured in two sites of southern Italy. From one to eight mitochondrial haplotypes and from one to three ITS2 sequence types were found for the examined specimens according to the different sand fly species. The mean interspecific difference in the mitochondrial sequences was of 16.1%, with an overall intraspecific nucleotide variation from 0.1 to 2.8%. A higher interspecific difference (mean 25.1%) was recorded for the ITS2 sequence, with an overall intraspecific nucleotide variation up to 4.9%. The sequence types alignment of ITS2 region showed that all phlebotomine specimens possessed a split 5.8S rRNA, consisting of a mature 5.8S rRNA and a 2S rRNA separated by a short transcribed spacer. Phylogenetic analysis of the Phlebotomus spp. sequences, herein determined and of those available in GenBank™ were concordant in clustering P. neglectus, P. perfiliewi and P. papatasi with the same species collected from different geographic areas of the Mediterranean basin in four main clades for mtDNA and ITS2, respectively. This study demonstrates the utility of multilocus sequencing, provides a dataset for the molecular identification of the most prevalent phlebotomine sand flies in southern Europe and defines the phylogenetic relationships among species examined.

  17. First colony of Stomoxys calcitrans (Diptera: Muscidae successfully established under laboratory conditions in Argentina

    Directory of Open Access Journals (Sweden)



    Full Text Available Las moscas de los establos, Stomoxys calcitrans (L. (Diptera:Muscidae son insectos hematófagos que representan un problema, no solo por su hemato - fagia y transmisión de patógenos, sino además, porque su impacto económico en las producciones pecuarias es relevante. En Argentina aún no existe una cría de la plaga. El objetivo de este trabajo es establecer y describir la primera cría de Stomoxys calcitrans en el país y registrar la duración de cada estadio bajo condi - ciones controladas de laboratorio. Los adultos fueron exitosamente criados en una cámara de cría (28 ± 1 ºC y 47 ± 1 %RH bajo un fotoperiodo de 14 h: 10 h (Luz: Oscuridad, mientras que los estadios inmaduros se criaron a 25 ± 2 ºC y luz na - tural. El ciclo desde los huevos hasta la emergencia de adultos duró 16,75 ± 2,9 días. El tiempo de desarrollo requerido para alcanzar el nuevo estado fue de: 2,0 ± 0,8, 6,75 ± 1,3 y 7,75 ± 1,7 días para huevos, larvas y pupas; respectivamente. Los adultos vivieron 16,5 ± 1,91 días. El período de preoviposición fue de 5,0 ± 0,8 días. La supervivencia de larvas y pupas fue de 93,28% y 70,25%, respectivamen - te. Estos resultados pueden ser usados como referencia por otras colonias que se establecieren en un futuro en el país.

  18. Description of a Neotropical New Species of OxysarcodexiaTownsend, 1917 (Diptera: Sarcophagidae

    Directory of Open Access Journals (Sweden)

    Carina Souza


    Resumo. Uma nova espécie de Oxysarcodexia Townsend, 1917 (Diptera: Sarcophagidae é descrita com base em espécimes machos. As espécies deste gênero de sarcofagídeos apresentam distribuição majoritariamente Neotropical, com algumas espécies ocorrendo também nas regiões Neártica, Australásia e Oceânica. As espécies deste gênero podem ser encontradas associadas à matéria orgânica em decomposição (fezes de mamíferos ou aves – espécies coprófilas e podem apresentar importância forense quando associadas a carcaças (fauna atraída e, em alguns casos, espécies que se criam. Fotografias digitais do hábito em vista lateral e da terminália em vistas lateral, posterior e ventral são apresentadas. Oxysarcodexia mineirensis sp. n. pertence ao “grupo Xarcophaga” (i.e. possui o falo alargado postero-distalmente e contém similaridades com Oxysarcodexia favorabilis (Lopes, 1935 devido à conformação da terminália, especialmente o formato do falo, semelhante a uma flor.

  19. Estudo taxonômico de Leschenaultia Robineau-Desvoidy (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    Ronaldo Toma


    Full Text Available Taxonomic study of Leschenaultia Robineau-Desvoidy (Diptera, Tachinidae. The genus Leschenaultia Robineau-Desvoidy, 1830 is redescribed. Two genera are considered as its junior synonyms: Echinomasicera Townsend, 1915 syn. nov. and Parachaetopsis Blanchard, 1959 syn. nov. Thirty two especies are treated, as follows: 18 described as new, Leschenaultia aldrichi, sp. nov. (Brazil, Santa Catarina, L. arnaudi sp. nov. (Haiti, La Salle, L. bergenstammi sp. nov. (Peru, San Martin, L. bessi sp. nov. (Brazil, Santa Catarina, L. bigoti sp. nov. (Peru, Huanuco, L. blanchardi sp. nov. (Equador, Cuenca, L. braueri sp. nov. (Brazil, Mato Grosso, L. brooksi sp. nov. (Brazil, Rio de Janeiro, L. coquilletti sp. nov. (Brazil, Santa Catarina; L. cortesi sp. nov. (Venezuela, Maracay, L. currani sp. nov. (Brazil, São Paulo, L. loewi sp. nov. (Mexico, Vera Cruz, L. macquarti sp. nov. (U. S. A., Arizona, L. reinhardi sp. nov. (Canada, Quebec, L. sabroskyi sp. nov. from (U. S. A., California, L. schineri sp. nov. (U. S. A., California, L. thompsoni sp. nov. (Mexico, Mexico City, L. townsendi sp. nov. (Mexico, Puebla, and 14 known species, for these, diagnoses are given: L. adusta (Loew, 1872; L. americana (Brauer & Bergenstamm, 1893; L. bicolor (Macquart, 1846 = L. fusca (Townsend, 1916 syn. nov.; = Parachaetopsis proseni Blanchard, 1959 syn. nov.; L. ciliata (Macquart, 1848; L. exul (Townsend, 1892; L. fulvipes (Bigot, 1887; L. grossa Brooks, 1947; L. halisidotae Brooks, 1947; L. hospita Reinhard, 1952; L. hystrix (Townsend, 1915 comb. nov., L. jurinioides (Townsend, 1895; L. leucophrys (Wiedemann, 1830 = Leschenaultia latifrons (Walker, 1852 syn. nov. = Parachaeta nigricalyptrata (Macquart, 1855 syn. nov.; L. montagna (Townsend, 1912; L. nuda Thompson, 1963. One species was not examined, Leschenaultia nigrisquamis (Townsend, 1892, and two were not recognized, L. trichopsis (Bigot, 1887 and L. hirta Robineau-Desvoidy, 1830. Keys for Nearctic and Neotropical species

  20. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae). (United States)

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E


    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract.

  1. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation. (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter


    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  2. Genome Instability of Chironomus riparius Mg. (Diptera, Chironomidae from Polluted Water Basins in Bulgaria

    Directory of Open Access Journals (Sweden)

    Julia Ilkova


    Full Text Available Larvae of Chironomus riparius Mg. (Chironomidae, Diptera collected from two polluted water basins in Bulgaria, the Maritsa and Chaya Rivers (adjacent to Plovdiv and Asenovgrad respectively, a small pool (near Plovdiv plus controls reared in the laboratory were studied. High concentrations of the heavy metals Pb, Cu and Cd were recorded in the sediments of the polluted stations. Marked somatic structural chromosome aberrations were found in C. riparius salivary polytene chromosomes from the field stations and their frequency was significantly higher (p<0.01 compared to the control. The observed somatic chromosome changes are discussed as a response of the chironomid genome to aquatic pollution. A new cytogenetic index based on the number of aberrations found in larvae from polluted regions in comparison with the control was applied to the data to more easily evaluate the degree of heavy metal pollution in aquatic ecosystems. Our study of a polluted site near the River Chaya showed that the somatic index was very high at 3.35 for 2010 and 11.66 for 2013 compared to 0.5 in the control. The cytogenetic index was effective in showing that all studied sites were highly polluted in comparison with the control. To determine the mechanism involved in the concentration of aberration breakpoints within specific regions of the chironomid polytene chromosome the FISH method was applied. The localization of a transposable element TFB1 along the polytene chromosomes of C. riparius was analyzed and the sites of localization were compared with breakpoints of chromosome aberrations. A significant correlation (p<0.05 was found which shows that most of the aberrations do not appear randomly but are concentrated in sites rich in transposable elements.

  3. A metagenomic assessment of the bacteria associated with Lucilia sericata and Lucilia cuprina (Diptera: Calliphoridae). (United States)

    Singh, Baneshwar; Crippen, Tawni L; Zheng, Longyu; Fields, Andrew T; Yu, Ziniu; Ma, Qun; Wood, Thomas K; Dowd, Scot E; Flores, Micah; Tomberlin, Jeffery K; Tarone, Aaron M


    Lucilia Robineau-Desvoidy (Diptera: Calliphoridae) is a blow fly genus of forensic, medical, veterinary, and agricultural importance. This genus is also famous because of its beneficial uses in maggot debridement therapy (MDT). Although the genus is of considerable economic importance, our knowledge about microbes associated with these flies and how these bacteria are horizontally and trans-generationally transmitted is limited. In this study, we characterized bacteria associated with different life stages of Lucilia sericata (Meigen) and Lucilia cuprina (Wiedemann) and in the salivary gland of L. sericata by using 16S rDNA 454 pyrosequencing. Bacteria associated with the salivary gland of L. sericata were also characterized using light and transmission electron microscopy (TEM). Results from this study suggest that the majority of bacteria associated with these flies belong to phyla Proteobacteria, Firmicutes, and Bacteroidetes, and most bacteria are maintained intragenerationally, with a considerable degree of turnover from generation to generation. In both species, second-generation eggs exhibited the highest bacterial phylum diversity (20 % genetic distance) than other life stages. The Lucilia sister species shared the majority of their classified genera. Of the shared bacterial genera, Providencia, Ignatzschineria, Lactobacillus, Lactococcus, Vagococcus, Morganella, and Myroides were present at relatively high abundances. Lactobacillus, Proteus, Diaphorobacter, and Morganella were the dominant bacterial genera associated with a survey of the salivary gland of L. sericata. TEM analysis showed a sparse distribution of both Gram-positive and Gram-negative bacteria in the salivary gland of L. sericata. There was more evidence for horizontal transmission of bacteria than there was for trans-generational inheritance. Several pathogenic genera were either amplified or reduced by the larval feeding on decomposing liver as a resource. Overall, this study provides

  4. Dispersal of Culex quinquefasciatus (Diptera: Culicidae) in a Hawaiian rain forest (United States)

    Lapointe, D.A.


    Introduced mosquito-borne pathogens avian malaria (Plasmodium relictum Grassi and Feletti) and avian pox virus (Avipoxvirus) have been implicated in the past extinctions and declines of Hawaiian avifauna and remain significant obstacles to the recovery and restoration of endemic Hawaiian birds. Effective management of avian disease will require extensive mosquito control efforts that are guided by the local ecology of the vector Culex quinquefasciatus Say (Diptera: Culicidae). During October and November 1997 and September through November 1998 five mark-release-recapture experiments with laboratory-reared Cx. quinquefasciatus were conducted in a native rain forest on Hawaii Island. Of the overall 66,047 fluorescent dye-marked and released females, 1,192 (1.8%) were recaptured in 43-52 CO2-baited traps operated for 10-12-d trapping periods. Recaptured mosquitoes were trapped in all directions and at distances up to 3 km from the release site. The cumulative mean distance traveled (MDTs) over the trapping period ranged from a high of 1.89 km after 11 d (September 1998) to a low of 0.81 km after 11 d (November 1998). Released mosquitoes moved predominately in a downwind direction and they seemed to use forestry roads as dispersal corridors. Applying an estimated MDT of 1.6 km to a geographical information system-generated map of the Hakalau Forest National Wildlife Refuge clearly demonstrated that the effective refuge area could be reduced 60% by mosquitoes infiltrating into managed refuge lands. These findings should have significant implications for the design of future refuges and development of effective mosquito-borne avian disease control strategies.

  5. Automated Kinematic Extraction of Wing and Body Motions of Free Flying Diptera (United States)

    Kostreski, Nicholas I.

    In the quest to understand the forces generated by micro aerial systems powered by oscillating appendages, it is necessary to study the kinematics that generate those forces. Automated and manual tracking techniques were developed to extract the complex wing and body motions of dipteran insects, ideal micro aerial systems, in free flight. Video sequences were captured by three high speed cameras (7500 fps) oriented orthogonally around a clear flight test chamber. Synchronization and image-based triggering were made possible by an automated triggering circuit. A multi-camera calibration was implemented using image-based tracking techniques. Three-dimensional reconstructions of the insect were generated from the 2-D images by shape from silhouette (SFS) methods. An intensity based segmentation of the wings and body was performed using a mixture of Gaussians. In addition to geometric and cost based filtering, spectral clustering was also used to refine the reconstruction and Principal Component Analysis (PCA) was performed to find the body roll axis and wing-span axes. The unobservable roll state of the cylindrically shaped body was successfully estimated by combining observations of the wing kinematics with a wing symmetry assumption. Wing pitch was determined by a ray tracing technique to compute and minimize a point-to-line cost function. Linear estimation with assumed motion models was accomplished by discrete Kalman filtering the measured body states. Generative models were developed for different species of diptera for model based tracking, simulation, and extraction of inertial properties. Manual and automated tracking results were analyzed and insect flight simulation videos were developed to quantify ground truth errors for an assumed model. The results demonstrated the automated tracker to have comparable performance to a human digitizer, though manual techniques displayed superiority during aggressive maneuvers and image blur. Both techniques demonstrated

  6. Survey of the Genetic Diversity of Forensically Important Chrysomya (Diptera: Calliphoridae) from Egypt. (United States)

    Salem, Abeer M; Adham, Fatma K; Picard, Christine J


    Minimum postmortem interval estimations of a corpse using blow fly larvae in medicolegal investigations require correct identification and the application of appropriate developmental data of the identified fly species. Species identification of forensically relevant blow flies could be very difficult and time consuming when specimens are damaged or in the event of morphologically indistinguishable immature stages, which are most common at crime scenes. In response to this, an alternative, accurate determination of species may depend on sequencing and molecular techniques for identification. Chrysomyinae specimens (n = 158) belonging to three forensically important species [Chrysomya albiceps (Wiedemann), Chrysomya megacephala (F.), and Chrysomya marginalis (Wiedemann)] (Diptera: Calliphoridae) were collected from four locations in Egypt (Giza, Dayrout, Minya, and North Sinai) and sequenced across the mitochondrial cytochrome oxidase subunit I (COI) gene. Phylogenetic analyses using neighbor-joining, maximum likelihood and maximum parsimony methods resulted in the same topological structure and confirmed DNA based identification of all specimens. Interspecific divergence between pairs of species was 5.3% (C. marginalis-C. megacephala), 7% (C. albiceps-C. megacephala), and 8% (C. albiceps-C. marginalis). These divergences are sufficient to confirm the utility of cytochrome oxidase subunit I gene in the molecular identification of these flies in Egypt. Importantly, the maximum intraspecific divergence among individuals within a species was <1% and the least nucleotide divergence between species used for phylogenetic analysis was 3.6%. This study highlights the need for thorough and diverse sampling to capture all of the possible genetic diversity if DNA barcoding is to be used for molecular identification.

  7. [A case of urogenital myiasis caused by Psychoda albipennis (Diptera: Nematocera)]. (United States)

    Yenice, Mustafa Gürkan; Demir, Tülin; Babür, Cahit; Nalbantoğlu, Serpil; Kılıç, Selçuk


    Myiasis which is a parasitic disease of humans and vertebrates, is caused by dipterous fly larvae feeding on the host's necrotic or living tissue. Although infestation by fly larvae is much more prevalent in animals, it occurs relatively frequently in humans in rural, tropical and subtropical regions of Africa and America. Myiasis is usually associated with poor general health and hygiene, restricted mobility and ulcerating lesions. The pathophysiology of the human infection differs depending on the fly species and where the larvae are located. It could be external or internal, and the invasion by the maggot could be obligatory, facultative and sometimes acci-dental. Myiasis is a self-limiting infestation with minimal morbidity in the vast majority of cases. Urogenital myiasis, associated with urinary obstruction, poor hygiene of the local site and ulcerating lesions has been infrequently reported. In this report, a case of 29 year-old male patient who presented with genitourinary myiasis caused by Psychoda albipennis (Diptera: Nematocera), was presented. The patient was admitted to the hospital with the complaints of urinary incontinence of one week duration and presence of small, thin, motile, grayishwhite objects in his urine. Physical examination, blood and urine examination and stool microscopy revealed no pathology. No growth was detected in his urine culture. The examination of discharged larva in urine sample at Refik Saydam National Public Health Agency, Parasitology Laboratory led to the diagnosis of urogenital myiasis. No risk factor was identified in the patient who had proper hygienic conditions, was living in urban area and was of high socioeconomic status. This case was presented to withdraw attention to myiasis which is frequent in Turkey, however, is usually overlooked.

  8. Seasonal distributions of the western cherry fruit fly (Diptera: Tephritidae) among host and nonhost fruit trees. (United States)

    Yee, Wee L


    Seasonal distributions of the western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), in sweet cherry (Prunus avium (L.) L.) (major host), black hawthorn (occasional developmental host) (Crataegus douglasii Lindley), and other trees were determined in a ponderosa pine ecosystem in Washington state, USA. The hypothesis that most fly dispersal from cherry trees occurs after fruit senesce or drop was tested, with emphasis on movement to black hawthorn trees. Sweet cherry fruit developed earlier than black hawthorn, bitter cherry (common host), choke cherry, and apple fruit. Flies were usually captured first in sweet cherry trees but were caught in bitter cherry and other trees throughout the season. Peak fly capture periods in sweet cherry began around the same time or slightly earlier than in other trees. However, peak fly capture periods in black hawthorn and other nonsweet cherry trees continued after peak periods in sweet cherry ended, or relative fly numbers within sweet cherry declined more quickly than those within other trees. Larvae were reared from sweet and bitter cherry but not black hawthorn fruit. Results provide partial support for the hypothesis in that although R. indifferens commonly disperses from sweet cherry trees with fruit, it could disperse more, or more flies are retained in nonsweet cherry trees after than before sweet cherries drop. This could allow opportunities for the flies to use other fruit for larval development. Although R. indifferens infestation in black hawthorn was not detected, early season fly dispersal to this and other trees and fly presence in bitter cherry could make fly management in sweet cherry difficult.

  9. Half of the European fruit fly species barcoded (Diptera, Tephritidae; a feasibility test for molecular identification

    Directory of Open Access Journals (Sweden)

    John Smit


    Full Text Available A feasibility test of molecular identification of European fruit flies (Diptera: Tephritidae based on COI barcode sequences has been executed. A dataset containing 555 sequences of 135 ingroup species from three subfamilies and 42 genera and one single outgroup species has been analysed. 73.3% of all included species could be identified based on their COI barcode gene, based on similarity and distances. The low success rate is caused by singletons as well as some problematic groups: several species groups within the genus Terellia and especially the genus Urophora. With slightly more than 100 sequences - almost 20% of the total - this genus alone constitutes the larger part of the failure for molecular identification for this dataset. Deleting the singletons and Urophora results in a success-rate of 87.1% of all queries and 93.23% of the not discarded queries as correctly identified. Urophora is of special interest due to its economic importance as beneficial species for weed control, therefore it is desirable to have alternative markers for molecular identification.We demonstrate that the success of DNA barcoding for identification purposes strongly depends on the contents of the database used to blast against. Especially the necessity of including multiple specimens per species of geographically distinct populations and different ecologies for the understanding of the intra- versus interspecific variation is demonstrated. Furthermore thresholds and the distinction between true and false positives and negatives should not only be used to increase the reliability of the success of molecular identification but also to point out problematic groups, which should then be flagged in the reference database suggesting alternative methods for identification.

  10. Comparison of a synthetic chemical lure and standard fermented baits for trapping Drosophila suzukii (Diptera: Drosophilidae). (United States)

    Cha, Dong H; Hesler, Stephen P; Cowles, Richard S; Vogt, Heidrun; Loeb, Gregory M; Landolt, Peter J


    We determined the attractiveness of a new chemical lure compared with fermented food baits in use for trapping Drosophila suzukii Matsumura, spotted wing drosophila (Diptera: Drosophilidae), in Connecticut, New York, and Washington in the United States and at Dossenheim in Germany. The chemical lure (SWD lure) and food baits were compared in two types of traps: the dome trap and a cup trap. Regardless of trap type, numbers of male and female D. suzukii trapped were greater with the SWD lure compared with apple cider vinegar (ACV) baits at the Washington and New York sites, and were comparable with numbers of D. suzukii captured with a wine plus vinegar bait (W + V) at Germany site and a combination bait meant to mimic W + V at the Connecticut site. Averaged over both types of attractants, the numbers of D. suzukii captured were greater in dome traps than in cup traps in New York and Connecticut for both male and female D. suzukii and in Washington for male D. suzukii. No such differences were found between trap types at the Washington site for female and Germany for male and female D. suzukii. Assessments were also made of the number of large (>0.5 cm) and small (<0.5 cm) nontarget flies trapped. The SWD lure captured fewer nontarget small flies and more large flies compared with ACV bait in New York and fewer nontarget small flies compared with W + V in Germany, although no such differences were found in Washington for the SWD lure versus ACV bait and in Connecticut for the SWD lure versus the combination bait, indicating that these effects are likely influenced by the local nontarget insect community active at the time of trapping. In New York, Connecticut, and Germany, dome traps caught more nontarget flies compared with cup traps. Our results suggest that the four-component SWD chemical lure is an effective attractant for D. suzukii and could be used in place of fermented food-type baits.

  11. Attractiveness of fermentation and related products to spotted wing Drosophila (Diptera: drosophilidae). (United States)

    Kleiber, Joseph R; Unelius, C Rikard; Lee, Jana C; Suckling, David Maxwell; Qian, Michael C; Bruck, Denny J


    Laboratory screening bioassays and field trapping experiments of spotted wing drosophila flies, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae), were conducted to determine the attractiveness of 17 compounds as well as to compare attractant efficiency during peak fruit ripeness and postharvest captures late in the season. Compounds structurally related to each of the fermentation products acetic acid, ethanol, ethyl acetate, and 2-phenethyl alcohol were screened for attractiveness compared with a soap water control in greenhouse cage bioassays. The compounds determined to be attractive in the greenhouse bioassay (methanol, ethanol, propanol, formic acid, acetic acid, ethyl acetate, propyl acetate, phenethyl acetate, phenethyl propionate, and phenethyl butyrate) were individually tested in the field added to apple cider vinegar (ACV). The acids were also tested individually in neutralized ACV (NACV; pH ≍7). Combinations of the compounds were tested in NACV. The capture numbers in ACV traps were not significantly increased by the addition of any of the compounds tested, although significant deterrent effects of some of the compounds allowed differences between treatments to be observed. Compounds that are most prevalent in wine and vinegar (methanol, ethanol, acetic acid, and ethyl acetate) as well as phenethyl propionate and phenethyl butyrate were less deterrent than the other compounds tested in the field. Captures during peak fruit ripeness were compared with the postharvest period when fruit hosts were not available or were overripe. Although the total number of flies captured late in the season was lower, the trends in treatment performance were similar, indicating a consistent performance of these baits from peak fruit ripeness through postharvest.


    Belien, T; Thys, T; Fassotte, C; Walrant, C; Tomme, M; Bolen, M; Bylemans, D


    The vinegar fly Drosophila suzukii (Matsumura) (Diptera Drosophilidae), spotted wing drosophila, is a new invasive fruit pest that recently became established in Europe. Unlike other fruit flies that typically only infest overripe and rotten fruit, D. suzukii females oviposit in ripe fruit leading to considerable economic losses of fruit during production. In 2011 and 2012 D. suzukii was detected at several places in Belgium. In 2013, a large-scale monitoring in frame of the project "FLY ALERT" (FOD) was executed using traps with liquid attractant (apple cider vinegar) at more than 100 locations across Belgium during the whole fruit growing season. At 16 locations we also compared the efficacy of a 'bottle type' trap with a 'cup type' trap. The results show that D. suzukii has expanded its distribution in Belgium. Remarkably, in 2013 as well as in 2012 the first detections were made only in the second part of the growing season (August) and the populations reached their peak only at the very end of the season (November). In the bottle type trap the first flies were caught 2-3 weeks earlier than in the cup type trap. In addition, also the population peaks were on average 1 week earlier when monitored with the bottle trap compared to when monitored with the cup trap. In 2014, after an exceptional mild winter adult D. suzukii flies were continuously detected throughout the winter and early spring. The implications of these findings for the phenology of D. suzukii in the Northwest climate region of Europe are discussed.

  13. Mosquitoes (Diptera: Culicidae) and their relevance as disease vectors in the city of Vienna, Austria. (United States)

    Lebl, Karin; Zittra, Carina; Silbermayr, Katja; Obwaller, Adelheid; Berer, Dominik; Brugger, Katharina; Walter, Melanie; Pinior, Beate; Fuehrer, Hans-Peter; Rubel, Franz


    Mosquitoes (Diptera: Culicidae) are important vectors for a wide range of pathogenic organisms. As large parts of the human population in developed countries live in cities, the occurrence of vector-borne diseases in urban areas is of particular interest for epidemiologists and public health authorities. In this study, we investigated the mosquito occurrence in the city of Vienna, Austria, in order to estimate the risk of transmission of mosquito-borne diseases. Mosquitoes were captured using different sampling techniques at 17 sites in the city of Vienna. Species belonging to the Culex pipiens complex (78.8 %) were most abundant, followed by Coquillettidia richiardii (10.2 %), Anopheles plumbeus (5.4 %), Aedes vexans (3.8 %), and Ochlerotatus sticticus (0.7 %). Individuals of the Cx. pipiens complex were found at 80.2 % of the trap sites, while 58.8 % of the trap sites were positive for Cq. richiardii and Ae. vexans. Oc. sticticus was captured at 35.3 % of the sites, and An. plumbeus only at 23.5 % of the trap sites. Cx. pipiens complex is known to be a potent vector and pathogens like West Nile virus (WNV), Usutu virus (USUV), Tahyna virus (TAHV), Sindbis virus (SINV), Plasmodium sp., and Dirofilaria repens can be transmitted by this species. Cq. richiardii is a known vector species for Batai virus (BATV), SINV, TAHV, and WNV, while Ae. vexans can transmit TAHV, USUV, WNV, and Dirofilaria repens. An. plumbeus and Oc. sticticus seem to play only a minor role in the transmission of vector-borne diseases in Vienna. WNV, which is already wide-spread in Europe, is likely to be the highest threat in Vienna as it can be transmitted by several of the most common species, has already been shown to pose a higher risk in cities, and has the possibility to cause severe illness.

  14. Rhagoletis cerasi Loew (Diptera: Tephritidae – Biological Characteristics, Harmfulness, and Control

    Directory of Open Access Journals (Sweden)

    Svetomir Stamenković


    Full Text Available The European cherry fruit fly, Rhagoletis cerasi Loew (Diptera: Tephritidae, is a highlydestructive pest in sweet and sour cherry orchards with a distribution area throughoutEurope and the temperate regions of Asia. It occurs regularly in all production regions ofthese fruit species in Serbia, damaging up to 10% of cherries in commercial production,while damage can go up to 100% in orchards and on solitary threes unprotected by controlmeasures.In Serbia, European cherry fruit fly most often attacks and damages fruits of the lateripeningcultivars of sweet cherry (Van, Stela, Hedelfinger, Bing, Lambert, Drogan’s Yellow.After a sweet cherry harvest, adults migrate to sour cherry where they continue feedingand ovipositing in half-mature sour cherries (prevailingly the domestic ecotype Oblačinska.During their activity period, larvae damage the fruits, so that they can no longer be consumedeither fresh or processed. The high percentage of sour cherries damaged by R. cerasihas become a factor limiting exports because the intensity of infestation of this fruitexceeds permissible limits. Pesticide use for controlling this pest, especially in integratedproduction, is based on a very poor selection of insecticides which cause problems withresidual ecotoxicity. Consequently, alternative measures for controlling European cherryfruit fly have been intensively studied over the past few years.This work surveys up-to-date results of various studies on the European cherry fruit flyas a very important pest in Serbia and other South and Mid-European countries. The workcontains detailed descriptions of its biological characteristics, flight phenology, infestationintensity and possibilities of fly control in sweet and sour cherry production areas.

  15. Insecticidal effect of plant extracts on Phlebotomus argentipes (Diptera: Psychodidae in Bihar, India

    Directory of Open Access Journals (Sweden)

    Diwakar Singh Dinesh


    Full Text Available Background & objectives: Phlebotomus argentipes (Diptera: Psychodidae, the established vector for kala-azar is presently being controlled by indoor residual spray of DDT in kala-azar endemic areas in India. Search for non-hazardous and non-toxic biodegradable active molecules from botanicals may provide cost-effective and eco-friendly alternatives to synthetic insecticides. The present study was aimed at evaluating various plant extracts from endemic and non-endemic areas of Bihar for their insecticidal activity against sandfly to identify the most effective plant extract. Methods: Bio-assay test was conducted with larvae and adult of P. argentipes with different plant extracts collected in distilled water, hexane, ethyl acetate, acetone and methanol. Thin layer chromatography (TLC, column chromatography and high performance liquid chromatography (HPLC were conducted for detection of active molecules. Results: Adults and larvae of sandflies exposed to the aqueous extract of Nicotiana tabacum resulted in 100 per cent mortality. The hexane extract of Clerodendrum infortunatum was found to kill 77 per cent adults but was ineffective against larvae. Bio-assay test of the ninth fraction (hexane extract-methanol phase separated by column chromatography was found to be 63 per cent effective. The purple spot on the TLC of this fraction indicated the presence of a diterpenoid. HPLC of this fraction detected nine compounds with two peaks covering 20.44 and 56.52 per cent areas with retention time of 2.439 and 5.182 min, respectively supporting the TLC results. Interpretation & conclusions: The column separated 9 [th] fraction of C. infortunatum extract was found to be effective in killing 63 per cent of adult P. argentipes. Compounds of this fraction need to be evaluated further for identification and characterization of the active molecule by conducting individual bio-assay tests followed by further fractionation and HPLC. Once the structure of the

  16. Laboratory evaluation of entomopathogenic fungi against larvae and adults of onion maggot (Diptera: Anthomyiidae). (United States)

    Davidson, G; Chandler, D


    Laboratory experiments were done to measure the susceptibility of larvae and adults of the onion maggot, Delia antiqua (Meigen) (Diptera: Muscidae: Anthomyiidae) to 27 isolates of entomopathogenic fungi from four genera [Beauveria Vuillemin, Lecanicillium (Petch) Zare & W. Gams, Metarhizium Sorokin, and Paecilomyces Bainier]. A novel bioassay was developed for D. antiqua larvae by using a diet based on mixed vegetable powder. When evaluated in a virulence screen, the fungal isolates caused less mortality of D. antiqua larvae than adults. Only three isolates caused > 50% mortality of larvae, whereas 12 isolates caused > 50% mortality of adults. Fungal species was a statistically significant factor affecting the mortality of larvae but not of adults. The fungal isolates causing the most mortality of larvae tended to belong to Metarhizium anisopliae (Metschnikoff) Sorokin. Two M. anisopliae isolates (389.93 and 392.93) were evaluated in dose-response bioassays. The median lethal concentrations of the isolates against larvae were 6.1 x 10(7) conidia ml(-1) for isolate 389.93 and 7.6 x 10(7) conidia ml(-1) for isolate 392.93. The emergence of adult flies from pupae was reduced at high concentrations of conidia (3.0 x 10(8) and 1.0 x 10(8) conidia ml(-1)). The median lethal concentrations of the isolates against adults were 1.7 x 10(7) and 4.0 x 10(7) conidia ml(-1), respectively. Some of the fungal isolates examined may have potential as biological control agents of larvae of D. antiqua and related species.

  17. The tympanal hearing organ of the parasitoid fly Ormia ochracea (Diptera, Tachinidae, Ormiini). (United States)

    Robert, D; Read, M P; Hoy, R R


    Tympanate hearing has evolved in at least 6 different orders of insects, but had not been reported until recently in the Diptera. This study presents a newly discovered tympanal hearing organ, in the parasitoid tachinid fly, Ormia ochracea. The hearing organ is described in terms of external and internal morphology, cellular organization of the sensory organ and preliminary neuroanatomy of the primary auditory afferents. The ear is located on the frontal face of the prothorax, directly behind the head capsule. Conspicuously visible are a pair of thin cuticular membranes specialized for audition, the prosternal tympanal membranes. Directly attached to these membranes, within the enlarged prosternal chamber, are a pair of auditory sensory organs, the bulbae acusticae. These sensory organs are unique among all auditory organs known so far because both are contained within an unpartitioned acoustic chamber. The prosternal chamber is connected to the outside by a pair of tracheae. The cellular anatomy of the fly's scolopophorous organ was investigated by light and electron microscopy. The bulba acustica is a typical chordotonal organ and it contains approximately 70 receptor cells. It is similar to other insect sensory organs associated with tympanal ears. The similarity of the cellular organization and tympanal morphology of the ormiine ear to the ears of other tympanate insects suggests that there are potent constraints in the design features of tympanal hearing organs, which must function to detect high frequency auditory signals over long distances. Each sensory organ is innervated by a branch of the frontal nerve of the fused thoracic ganglia. The primary auditory afferents project to each of the pro-, meso-, and metathoracic neuropils. The fly's hearing organ is sexually dimorphic, whereby the tympanal membranes are larger in females and the spiracles larger in males. The dimorphism presumably reflects differences in the acoustic behavior in the two sexes.

  18. Thermoregulation in larval aggregations of carrion-feeding blow flies (Diptera: Calliphoridae) (United States)

    Slone, D.H.; Gruner, Susan V.


    The growth and development of carrion-feeding calliphorid (Diptera Calliphoridae) larvae, or maggots, is of great interest to forensic sciences, especially for estimation of a postmortem interval (PMI). The development rate of calliphorid larvae is influenced by the temperature of their immediate environment. Heat generation in larval feeding aggregations (=maggot masses) is a well-known phenomenon, but it has not been quantitatively described. Calculated development rates that do not include internally generated temperatures will result in overestimation of PMI. Over a period of 2.5 yr, 80 pig, Sus scrofa L., carcasses were placed out at study sites in north central Florida and northwestern Indiana. Once larval aggregations started to form, multiple internal and external temperatures, and weather observations were taken daily or every few days between 1400 and 1800 hours until pupation of the larvae. Volume of each aggregation was determined by measuring surface area and average depth. Live and preserved samples of larvae were taken for species identification. The four most common species collected were Lucilia coeruleiviridis (=Phaenicia) (Macquart) (77%), Cochliomyia macellaria (F.) (8.3%), Chrysomya rufifaces (Macquart) (7.7%), and Phormia regina (Meigen) (5.5%). Statistical analyses showed that 1) volume of a larval mass had a strong influence on its temperature, 2) internal temperatures of masses on the ground were influenced by soil temperature and mass volume, 3) internal temperatures of masses smaller than 20 cm3 were influenced by ambient air temperature and mass volume, and 4) masses larger than 20 cm3 on the carcass had strongly regulated internal temperatures determined only by the volume of the mass, with larger volumes associated with higher temperatures. Nonsignificant factors included presence of rain or clouds, shape of the aggregation, weight of the carcass, species composition of the aggregation, time since death, or season.

  19. Hymenopterous parasitoids attacking Acanthiophilus helianthi Rossi (Diptera: Tephritidae pupae in Kohgiluyeh Safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi


    Full Text Available The Safflower capsule fly (SCF, Acanthiophilus helianthi Rossi (Diptera: Tephritidae is the most destructive insect pest attacking the Safflower Carthamus tinctorius L. plant which are cultivated as an oil crop. It is mainly controlled through application of broad-spectrum insecticides, which can adversely affect safflower farms ecosystem and consequently human health. Since a first step in setting up an integrated pest management program is to assess the biological control agents within the ecosystem. Therefore, in this research work the pupal parasitoids of Safflower capsule fly a main insect pest attacking Safflower plants were identified. The impact of these parasitoids against this pest was evaluated on the varying pest generations and within different locations in Kohgiluyeh province during 2008-2009 seasons. Pupal parasitoid adults of SCF were recorded from fieldreared pupae, which had been collected from heavily infested small flower heads of the first generation as well from large flower heads of the second and third generations. Rate of parasitism on A. helianthi pupae was estimated as the number of parasitoids over the total count of parasitoids and flies. Ten hymenopterous species belonging to different families parasitizing insect pupae were screened as follows: Bracon hebetor (Spinola, 1808 and Bracon luteator (Spinola, 1808 (Braconidae; Isocolus tinctorious (Melika and Gharaei, 2006 (Cynipidae; Pronotalia carlinarum (Szelenyi and Erdos, 1951 (Eulophidae; Eurytoma acroptilae (Zerova, 1986 (Eurytomidae; Ormyrus orientalis (Walker, 1871 (Ormyridae; Colotrechnus viridis (Masi, 1921 and Pteromalus sp. (Walker, 1976 (Pteromalidae; and Antistrophoplex conthurnatus (Zerova, 2000 and Microdontomenus annulatus (Masi, 1899 (Torymidae. The average parasitization rate was 23±1 as revealed through the present study. The highest parasitization rate occurred during the first generation in all localities tested, as well as in years. Statistical

  20. Scuttle Flies (Diptera: Phoridae) Inhabiting Rabbit Carcasses Confined to Plastic Waste Bins in Malaysia Include New Records and an Undescribed Species (United States)

    Zuha, Raja M.; Huong-Wen, See; Disney, R. Henry L.; Omar, Baharudin


    Scuttle flies (Diptera: Phoridae) are small-sized insects of forensic importance. They are well known for diversified species and habitats, but in the context of forensic entomology, scuttle flies’ inhabitance of corpses remains inadequately explored. With recent reports indicating the existence of more scuttle fly species possibly inhabiting these environments, a decomposition study using animal carcasses in enclosed environments was conducted. The aim was to record the occurrence of scuttle flies on rabbit carcasses placed in sealed plastic waste bins for a 40-day period. The study was conducted as two replicates in Bangi, Selangor. Sampling was carried out at different time intervals inside a modified mosquito net as a trap. Inside the trap, adult scuttle flies were aspirated and preserved in 70% ethanol. The fly larvae and pupae were reared until their adult stage to facilitate identification. From this study, six scuttle fly species were collected, i.e., Dahliphora sigmoides (Schmitz) ♂, Gymnoptera simplex (Brues) ♀, Megaselia scalaris (Loew) ♂♀, Puliciphora borinquenensis (Wheeler) ♂, Puliciphora obtecta Meijere ♀ and Spiniphora sp. ♀. Both D. sigmoides and P. obtecta were newly recorded in Malaysia, whilst the Spiniphora sp. was considered an unknown species until it was linked to its male counterpart. The sealed waste bins were found to be accessible for the scuttle flies with delayed arrival (day 4–5). Megaselia scalaris was the primary scuttle fly species attracted to the carcass, and its occurrence could be observed between days 4–7 (replicate 1) and days 5–33 (replicate 2). This study also revealed Sarcophaga spp. (Diptera: Sarcophagidae) as the earliest species to colonize the remains and the longest to inhabit them (days 2–40). The larvae of Hermetia illucens (Linneaus) (Diptera: Stratiomyidae) and Fannia sp. (Diptera: Fanniidae) were found on the carcasses during the mid-advanced decay period. These findings expand the

  1. A New Species of Culex (Eumelanomyia) from India with Descriptions of Pupae and Larvae of Cx. pluvialis Barraud and Cx. iphis Barraud (Diptera: Culicidae) (United States)


    Barraud and Cx. <@is Barraud (Diptera: Culicidae)l Sunthorn Sirivanakarn 2 ABSTRACT. All known stages of CuZex Nilgiri Hills, Madras, India and the...specimens collected by Be N. Mohan in the Nilgiri Hills, Madras, India in 1974 and by Eb L. Peyton and Y,-M. Huang in Sri Lanka in 1975% These collec...of topotypic specimens of CUZSX in the Nilgiri Hills have been a valuable contribution to the taxonomic knowledge of several Indian species. The

  2. Flies from L.A., The Sequel: A further twelve new species of Megaselia (Diptera: Phoridae) from the BioSCAN Project in Los Angeles (California, USA)


    Hartop, Emily; Brown, Brian; Disney,R. Henry


    Presented are continued results from the BioSCAN Project, an urban biodiversity study sampling primarily from private backyards in Los Angeles, California (USA). Presented are continued results from the BioSCAN Project, an urban biodiversity study sampling primarily from private backyards in Los Angeles, California (USA). Twelve new species of Megaselia (Diptera: Phoridae) are described: M. baileyae, M. friedrichae, M. gonzalezorum, M. joanneae, M. losangelensis, M. phyllissunae, M. p...

  3. Exploring New Thermal Fog and Ultra-Low Volume Technologies to Improve Indoor Control of the Dengue Vector, Aedes aegypti (Diptera: Culicidae) (United States)


    Dengue Vector, Aedes aegypti (Diptera: Culicidae) JAMES F. HARWOOD,1,2 MUHAMMAD FAROOQ,1 ALEC G. RICHARDSON,1 CARL W. DOUD,1 JOHN L. PUTNAM,3 DANIEL E...vector, Aedes aegypti (L.), inside human habitations must be performed quickly and efÞciently to reduce the risk of transmission during dengue...ULV]and thermal fog)wereevaluated for their ability toprovide immediate control of Ae. aegypti mosquitoes with a contact insecticide inside simulated

  4. A Laboratory-Based Study for First Documented Case of Urinary Myiasis Caused by Larvae of Megaselia scalaris (Diptera: Phoridae) in Saudi Arabia


    Wakid, Majed H.


    Megaselia scalaris (Diptera: Phoridae) is one of the medically important insects. Maggots from a urine sample of a 5-year-old Saudi girl were examined microscopically for identification. These maggots were cultured to become adult flies. Larvae and adults were identified using standard keys. Protozoan flagellates were obtained from the gut of the larvae. This is the first report of M. scalaris as a causative agent of urinary human myiasis in Saudi Arabia.

  5. The moose throat bot fly Cephenemyia ulrichii larvae (Diptera: Oestridae found developing in roe deer (Capreolus capreolus for the first time

    Directory of Open Access Journals (Sweden)

    Oksanen Antti


    Full Text Available Abstract About fifty larvae of Cephenemyia ulrichii Brauer (Diptera: Oestridae, some of them nearly full-grown third instars, were found in the throat of a roe deer (Capreolus capreolus in June 2007 near Helsinki in Finland. The parasite is considered to be host specific, occurring only in the moose (Alces alces, and this paper is apparently the first report of a successful infestation in an aberrant host.

  6. The ability of insecticidal ear-tags, collar, and pour-ons to control flies (Diptera; Musci¬dae) and to prevent Summer Mastitis in heifers

    DEFF Research Database (Denmark)

    Jespersen, Jørgen Brøchner; Jensen, Karl-Martin Vagn


    Jespersen, J.B. and K.-M. Vagn Jensen, 1987. The ability of insectici¬dal ear-tags, collar, and pour-ons to control flies (Diptera; Musci¬dae) and to prevent Summer Mastitis in heifers. In Thomas, G., H. J. Over, U. Vecht and P. Nansen (Editor): Summer Masitits (ISBN O-89838-982-8) pp. 166-172....

  7. A revision of the genus Pelecocera Meigen with the description of the male of pelecocera persiana Kuznetzov from Iran (Diptera: Syrphidae). (United States)

    Mengual, Ximo; Kazerani, Farzaneh; Talebi, Ali Asghar; Gilasian, Ebrahim


    The genus Pelecocera Meigen (Diptera: Syrphidae) is revised. Type material of most species was studied to describe, illustrate and delimit the male of Pelecocera persiana Kuznetzov, recently discovered from Iran. This is the first known specimen of this species since 1914, when the type female was collected. The diagnostic characters of P. persiana are provided, along with an identification key for Pelecocera species. The lectotype of Pelecocera latifrons Loew is designated.

  8. Morphometric and Molecular Analyses of the Sand Fly Species Lutzomyia shannoni (Dyar 1929) (Diptera:Psychodidae:Phlebotiminae) Collected from Seven Different Geographical Areas in the Southeastern United States (United States)


    179 by month with breakdown by gender. Figure 4. Graphical representation of temperature , dew point,….. 180 relative humidity (RH), and...M. Provoa, R. A. de Freitas, C. B. Biancardi, and E. L. Castellan. 1985. Flagellate infections of Brazilian sandflies (Diptera: Psychodidae...Psychodidae: Phlebotominae) in Brazil. Memorias do Instituto Oswaldo Cruz. 95 (3): 305 – 322. Azevedo, A. C. and E. F. Rangel. 1991. A study of sandfly

  9. Guide to the Identification and Geographic Distribution of Lutzomyia Sand Flies in Mexico, the West Indies, Central and South America (Diptera:Psychodidae) (United States)


    26. Antunes, P. C. A. & J. 0. Coutinho. 1939. Notas sObre fleb6tomos sul-americanos. H. Descri&Io de Flebotomus whiOmani n. sp. e de armadura bucal de...pupas de Phlebotom•una (Diptera, Psychodidae). Rev. Brasil. Malariol. Doenc. Trop. 16:311-329. Camnevali, M. 1978. Infeccion experimental de Lutzomyia...J. V. Scorza. 1976. Infeccion experimental de Lurzomyia townsendi (Ortiz, 1959) con una cepa Venezolana de Leishmania braziliensis. Bol. Dir

  10. Field Responses of Anopheles gambiae Complex (Diptera: Culicidae) in Liberia using Yeast-Generated Carbon Dioxide and Synthetic Lure-Baited Light Traps (United States)


    VECTOR-BORNE DISEASES, SURVEILLANCE, PREVENTION Field Responses of Anopheles gambiae Complex (Diptera: Culicidae) in Liberia using Yeast-Generated...and light, bed-net, tent, andodor-baited traps (Mboera 2005). TheCenters forDiseaseControl and Prevention (CDC) light trap with its typical 4Ð6 W...using paper- clips. Although primarily developed and used to attract day ßying Stegomyia ( Aedes ) mosquitoes, blends of this lureÕs primary ingredients

  11. [Effect of several extracts derived from plants on the survival of larvae of Aedes fluviatilis (Lutz) (Diptera: Culicidae) in the laboratory]. (United States)

    Consoli, R A; Mendes, N M; Pereira, J P; Santos, B de S; Lamounier, M A


    The larvicidal properties of 34 plant extracts were tested against Aedes fluviatilis (Lutz) (Diptera: Culicidae) larvae, at 100, 10 and 1 ppm concentrations; 26.6% of the extracts enhanced larval mortality (alpha = 0.05) at 100 ppm (Anacardium occidentale, Agave americana, Allium sativum, Coriandrum sativum, Nerium oleander, Spatodea campanulata, Tibouchina scrobiculata and Vernonia salzmanni). Anacardic acid (A. occidentale) was effective at 10 ppm and A. sativum (crude extract) at 1 ppm.

  12. Estado actual del conocimiento de la familia Ceratopogonidae en la Patagonia (Diptera: Nematocera Current knowledge of the family Ceratopogonidae in Patagonia (Diptera: Nematocera

    Directory of Open Access Journals (Sweden)

    Gustavo R. Spinelli


    Full Text Available Ceratopogonidae incluye pequeños dípteros nematoceros que crían en hábitats acuáticos o semiacuáticos. Hasta los '80, el conocimiento de su taxonomía en la Patagonia se hallaba limitado a la contribución de los comienzos de los '30 de Ingram y Macfie, sobre la base de material capturado en 1926-27, en el área del Parque Nacional Nahuel Huapi y zonas vecinas de Chile. En los últimos 25 años, se pusieron en marcha diferentes proyectos, resultando la descripción o registro de numerosos taxones para la región. Si se contabilizan los datos publicados, 102 especies habitan en la Patagonia, de las cuales 86 (84,31% son endémicas para la región. Este alto porcentaje es evidente en los bosques de Nothofagus, con 71 especies endémicas de este bioma, nueve lo son de la estepa y seis presentan registros en bosque y estepa. Datos aún no publicados concuerdan con este esquema. Diecinueve géneros están representados en la Patagonia, diez de ellos con amplia distribución, tres de distribución transantártica y seis son endémicos para el área. Para la misma, se hallan publicadas las revisiones de Forcipomyia, Atrichopogon, Borkenthelea, Macrurohelea y Paradasyhelea; se han finalizado y aún no publicado aquellas de Dasyhelea y Palpomyia, está muy avanzada la de Stilobezzia y se prevé comenzar con las de Austrohelea, Austrosphaeromias, Physohelea y Bezzia. Se calcula que estos datos no divulgados contienen al menos 55 especies todavía no descriptas. Con respecto a los aspectos biogeográficos se pueden destacar estudios que tienden a establecer relaciones entre las áreas reconocidas en esquemas biogeográficos propuestos para la región andina.Ceratopogonidae includes small nematoceran Diptera which breed in aquatic and semiaquatic habitats. Until the 80´s its taxonomic knowledge in Patagonia was limited to the early 30´s contribution of Ingram and Macfie, from material collected in 1926-27 in the area of the Nahuel Huapi National

  13. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão


    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  14. Parasitóides de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae collected in Caldas Novas, Goiás, Brasil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori


    Full Text Available Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidaeem Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae Paraganaspis egeria Díaz, Gallardo & Walsh., 1996 (Hymenoptera: Figitidae e Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae foram de 4,3, 1,5 0,9 e 0,6%, respectivamente. A porcentagem total de parasitismo observada foi de 7,4%. Relata-se a primeira ocorrência de S. nigra em pupas de F. pusio no Brasil.The aim of this study was to report the insect species parasitizing Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, in Caldas Novas, State of Goiás, between August 2003 and May 2004. Flies were attracted to baits consisting of human feces, bovine liver and fish, with the pupae being isolated by the flotation method, in water, and individually placed in gelatin capsules until the emergence of the flies and/or their parasitoids. The parasitism percentages presented by Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae, Paraganaspis egeria Díaz, Gallardo & Walsh, 1996 (Hymenoptera: Figitidae and Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae were 4.3, 1.5, 0.9 and 0.6%, respectively. The total percentage of parasitism was 7.4%. This study reports the first occurrence of S. nigra in pupae of F. pusio in Brazil.

  15. Historical biogeography of the Fanniidae (Insecta, Diptera: A commentary on the age of the family Biogeografia histórica de Fanniidae (Insecta, Diptera: Un comentario sobre la edad de la familia

    Directory of Open Access Journals (Sweden)



    Full Text Available In a study on Fanniidae biogeography, Dominguez & Roig-Juñent (2011 argued that the family had a Pangeic origin, Late Jurassic/early Cretaceous (~146 Ma. However, recent literature on Diptera supports that Schizophora radiation occurred during Cenozoic. Fanniidae is a widespread taxon and it was interpreted under the maximum vicariance paradigm; the consequence was an analysis with no alternative hypothesis, but Pangeic origin. We verified that Fanniidae historical narrative was incongruent with the Gondwana sequential break-up. A second analysis, assuming the Fanniidae origin during early Paleocene (65 Ma, showed congruence with recent geological events and with the Muscidae diversification, a closely related Muscoidea family. Our hypothesis suggests that the Fanniidae originated in Paleogene and they were affected by few events of vicariance and several expansions during Cenozoic.En un estudio sobre biogeografía de Fanniidae, Domínguez & Roig-Juñent (2011 argumentaron que la familia era de origen Pangeico, Jurásico superior/Cretáceo inferior (~146 Ma. Sin embargo, literatura reciente sobre Diptera, confirma que la radiación de Schizophora ocurrió durante el Cenozoico. Fanniidae es un taxón ampliamente distribuido y fue interpretado bajo el paradigma de máxima vicarianza; la consecuencia, fue un análisis sin hipótesis alternativas, pero de origen pangeico. Nosotros verificamos que la narrativa histórica de Fanniidae es incongruente con la quiebra secuencial de Gondwana. Un segundo análisis, asumiendo el origen de Fanniidae durante el Paleoceno inferior (65 Ma, mostró congruencia con eventos geológicos recientes y con la diversificación de Muscidae, una familia de Muscoidea próximamente relacionada. Nuestra hipótesis sugiere que Fanniidae se originó en el Paleógeno y fueron afectados por pocos eventos de vicarianza y muchas expansiones durante el Cenozoico.

  16. Disinfestation of mangoes by irradiation; Desinfestacion de mango por irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E


    The mango is a fruit-bearing very important in the mexican economy. Mexico is between the first positions of the world like country producing with an average export volume of 40,000 annual tons in the last years. For this reason it was decided to make this investigation, which was developed according to the investigation protocols proposed by the Agricultural Research Service of the USA (ARS - US DOA). The objective is to account with the technical and scientific necessary bases to propose to the US DOA the regulation of the irradiation process like quarantine treatment for Mexican export mango. The goals are: to determine in the laboratory the minimum dose (Dmin.) to inhibit the emergency of adults of the species of the fruit flies of more importance for Mexico. To confirm the least radiation dose Dmin. for quarantine treatment based on the safety value Probit-9. To evaluate the mango quality irradiated to 2 and 2.5 times the Dmin. proposal for quarantine treatment. According to information provided by the General Direction of Vegetable Sanity, it was determined that the fly species of the fruit of more economic importance for Mexico are of the genus Anastrepha ludens, Anastrepha serpentina, Anastrepha obliqua and Ceratitis capitata. (Author)

  17. Phlebotomine sand flies (Diptera, Psychodidae from Rio de Janeiro State, Brazil: species distribution and potential vectors of leishmaniases

    Directory of Open Access Journals (Sweden)

    Bruno Moreira Carvalho


    Full Text Available Phlebotomine sand flies (Diptera, Psychodidae from Rio de Janeiro State, Brazil: Species distribution and potential vectors of leishmaniases. Rio de Janeiro State, in Brazil, has endemic areas of both cutaneous and visceral leishmaniases. In these areas, entomologic surveillance actions are highly recommended by Brazil's Ministry of Health. The present work describes the results of sand fly captures performed by the Health Department of Rio de Janeiro State between 2009 and 2011 in several municipalities. An updated species list and distribution of phlebotomine sand flies in the state are provided based on an extensive literature review. Currently, the sand fly fauna of Rio de Janeiro State has 65 species, belonging to the genera Brumptomyia (8 spp. and Lutzomyia (57 spp.. Distribution maps of potential leishmaniases vector species Lutzomyia (Nyssomyia intermedia, L. migonei, L. (N. whitmani, L. (N. flaviscutellata and L. (Lutzomyia longipalpis are provided and their epidemiological importance is discussed.

  18. Phlebotomine sand flies (Diptera: Psychodidae) associated with changing patterns in the transmission of the human cutaneous leishmaniasis in French Guiana. (United States)

    Fouque, Florence; Gaborit, Pascal; Issaly, Jean; Carinci, Romuald; Gantier, Jean-Charles; Ravel, Christophe; Dedet, Jean-Pierre


    Between March 2000 and December 2001 a survey of the sand flies (Diptera: Phlebotominae) of French Guiana was carried out during 14 nights of captures with CDC light-traps and Malaise traps, and resulted in the collection of 2245 individuals of 38 species. The most abundant species were Lutzomyia (Trichophoromyia) ininii Floch & Abonnenc, Lu.(Psychodopygus) squamiventris maripaensis Floch & Abonnenc, and Lu .(Nyssomyia) flaviscutellata Mangabeira. Half of the collected sand flies females were dissected under field conditions and five species were found harboring Leishmania-like parasites. The Leishmania (Kinetoplastidae: Trypanosomatidae) species were identified by molecular typing, and for the first time Lu. (Nys.) flaviscutellata was found harboring Leishmania (Viannia) guyanensis and Lu. (Tri) ininii harboring unknown Leishmania. The first record for French Guiana of Lu. (Psy.) squamiventris maripaensis harboring L. (V.) naiffi, was also reported. The patterns of diversification of the human cutaneous leishmaniasis transmission in French Guiana are discussed.

  19. Phlebotomine sand flies (Diptera: Psychodidae associated with changing patterns in the transmission of the human cutaneous leishmaniasis in French Guiana

    Directory of Open Access Journals (Sweden)

    Florence Fouque


    Full Text Available Between March 2000 and December 2001 a survey of the sand flies (Diptera: Phlebotominae of French Guiana was carried out during 14 nights of captures with CDC light-traps and Malaise traps, and resulted in the collection of 2245 individuals of 38 species. The most abundant species were Lutzomyia (Trichophoromyia ininii Floch & Abonnenc, Lu.(Psychodopygus squamiventris maripaensis Floch & Abonnenc, and Lu .(Nyssomyia flaviscutellata Mangabeira. Half of the collected sand flies females were dissected under field conditions and five species were found harboring Leishmania-like parasites. The Leishmania (Kinetoplastidae: Trypanosomatidae species were identified by molecular typing, and for the first time Lu. (Nys. flaviscutellata was found harboring Leishmania (Viannia guyanensis and Lu. (Tri ininii harboring unknown Leishmania. The first record for French Guiana of Lu. (Psy. squamiventris maripaensis harboring L. (V. naiffi, was also reported. The patterns of diversification of the human cutaneous leishmaniasis transmission in French Guiana are discussed.

  20. Muscidae (Insecta: Diptera) of Latin America and the Caribbean: geographic distribution and check-list by country. (United States)

    Löwenberg-Neto, Peter; De Carvalho, Claudio J B


    Here we provide a geographic database for the Muscidae (Insecta: Diptera) that are endemic to Latin America and the Caribbean and non-synanthropic. We summarize the geographic information provided by specimens from three entomological collections in Brazil (DZUP, MNRJ, and MZUEFS) as well as geographic information we compiled in the literature. The resulting 817 species were linked to their geographic records by country, state/province/department, locality, latitude and longitude, including source reference. When coordinates were not provided in specimens' labels, we used the locality information to search geographic coordinates in online gazetteers. We also separated the species by country for a country-species list. These data comprise 250 years of collections and taxonomic studies of Neotropical Muscidae and we expect that it provides a foundation and serves as guide for future studies of systematics and biogeography of the family.