WorldWideScience

Sample records for anastrepha fraterculus wiedemann

  1. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  2. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  3. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  4. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  5. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  6. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  7. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  8. Viability of Cabralea canjerana extracts to control the South American fruit fly, Anastrepha fraterculus.

    Science.gov (United States)

    Magrini, Flaviane Eva; Specht, Alexandre; Gaio, Juliano; Girelli, Cristiane Priscila; Migues, Ignacio; Heinzen, Horacio; Sartori, Valdirene Camatti; Cesio, Veronica

    2014-04-10

    Several representatives of Meliaceae contain biologically active compounds that are toxic to insects with few negative effects on the environment and humans. Our study evaluated the activity of ethyl acetate and ethanol extracts from the fruit and seeds of Cabralea canjerana (Vellozo) Mart (Sapindales: Meliaceae) on Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae). Limonoids and triterpenes were detected in fruit and seed extracts. Each extract was added to an artificial diet at three concentrations and tested after 24, 48, and 72 hr of extract application. Ethyl acetate extracts were the most active ones and showed the effect of both dose and time elapses after application on the insects. The highest toxic effect on A. fraterculus adults was from ethyl acetate extracts from fruit, followed by extracts from seeds. These extracts showed antifeedant activities. Extract solutions sprinkled on fruits of Carica papaya (L.) (Brassicales: Caricaceae) caused oviposition repellency and negatively affected the biological development of A. fraterculus. Ethyl acetate extracts highly hampered oviposition, but seed extracts showed lesser oviposition deterrence. The fruit and seed extracts diminished pupal viability. Particularly, the ethyl acetate fruit extract caused malformed adults. The sex ratio was also affected, resulting in female predominance for the fruit extract, while the seed extract showed a dose-dependent effect. Low doses caused male abundance, but at higher concentrations the effect was reversed. These encouraging results showed that the C. canjerana extracts have great potential as new tools to be used in integrated pest management programs to protect fruits against A. fraterculus.

  9. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  10. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-03-16

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap.

  11. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  12. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  13. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  14. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina.

    Science.gov (United States)

    Cladera, Jorge L; Vilardi, Juan C; Juri, Marianela; Paulin, Laura E; Giardini, M Cecilia; Gómez Cendra, Paula V; Segura, Diego F; Lanzavecchia, Silvia B

    2014-01-01

    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication.

  15. Morphological characterization of the reproductive system of irradiated Anastrepha fraterculus

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Andrea, E-mail: andreabartolucci@iscamen.com.a [Instituto de Sanidad y Calidad Agropecuaria de Mendoza (ISCAMEN), Mendoza (Argentina); Vera, M. Teresa [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), (Argentina); Yusef, Veronica [Comision Nacional de Energia Atomica (Argentina). Centro Atomico Ezeiza; Oviedo, Andrea [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Field identification of released sterile insects is a major issue for eradication and suppression programs. Irradiated flies are normally identified by the presence of a fluorescent dye. When a fly lacks fluorescent dye, determination of gonadal state is necessary to identified between sterile or fertile flies. This is particularly relevant when population levels have decreased. Animal and identification is required to be as unequivocal as possible. Here we describe the reproductive system of irradiated Anastrepha fraterculus of different ages and we compare it with that of fertile flies in order to provide a diagnosis tool. Fertile and irradiated A. fraterculus were dissected from the day of emergence and until 15 days of age. Gross morphology was described and the gonads were measured. Germ cells were visualized in the testis. The reproductive systems of both males and females contained the same structures as other Anastrepha species. From day 1 to day 3, there were no detectable differences between irradiated and fertile males. The growing region encompassed half the testis total length and there was no free sperm in the seminal vesicle. On day 4 the presence of free sperm was seen in the seminal vesicle. At this stage irradiated males started differentiating from fertile ones: the growing region reduced in size and totally disappeared by day 11; sperm bundle zones occupied most of the testis; spermatids lost their triangular shape and sperm remained in the seminal vesicle without moving into the apical region. Testis length and width of irradiated males did not differ from fertile males. In females, the maturation of the ovaries involved a change in size that was more pronounced in the length of the ovary. This became noticeable at day 3. At this stage, the formation of yolk and the basal follicle began in fertile females and the oocyte had the same size as the trophocytes. From this point, the oocyte started growing. After day 8, the maturing oocyte reached

  16. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate

  17. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  18. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae)

    Science.gov (United States)

    Costa, M. L. Z.; Pacheco, M. G.; Lopes, L. A.; Botteon, V. W.; Mastrangelo, T.

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata. Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata. The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. PMID:27638956

  19. Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype.

    Science.gov (United States)

    Hernández-Ortiz, V; Gómez-Anaya, J A; Sánchez, A; McPheron, B A; Aluja, M

    2004-12-01

    Discriminant function and cluster analyses were performed on 19 morphometric variables of the aculeus, wing and mesonotum to determine whether populations of Anastrepha fraterculus (Wiedemann) from different parts of Mexico could be distinguished from populations from South America. Samples were collected from seven localities across Mexico, two from Brazil, and one each from Colombia and Argentina. Results showed there were statistically significant differences between Mexican and South American populations with respect to the aculeus (tip length, length of serrated section, mean number of teeth) and wing (width of S-band and connection between S- and V-bands). The degree of morphological variation observed among Mexican populations was extremely low, and as a consequence, the Mexican populations were identified as a single morphotype by discriminant analysis. The 'Andean morphotype'consisting of the Colombian population, and the 'Brazilian morphotype'consisting of the two Brazilian populations plus the single Argentinian population were also distinguished. It was concluded that the macro-geographical morphotypes from Mexico, Colombia, and Brazil plus Argentina correspond to three distinct taxonomic entities. Comparisons of results with those obtained from behavioural, karyotypic, isozyme and DNA studies suggest that sufficient evidence now exists to name a new Mexican species from within the A. fraterculus complex. This will be done in a separate publication. A provisional key to the morphotypes of A. fraterculus studied is provided.

  20. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  1. Male sexual behavior and pheromone emission is enhanced by exposure to guava fruit volatiles in Anastrepha fraterculus

    Science.gov (United States)

    Host plant chemicals can influence sex pheromone communication of tephritid fruit flies, and affect strategies optimizing mating and reproduction. Previous studies suggest that females of the South American fruit fly, Anastrepha fraterculus, prefer to mate with laboratory males previously exposed to...

  2. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape.

    Science.gov (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D

    2016-08-01

    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  3. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    E. Foelkel

    Full Text Available Abstract Entomopathogenic nematodes (EPNs are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  4. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  5. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  6. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  7. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  8. Mass production in liquid diet and radiosterilization of South American fruit fly Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae); Criacao massal em dieta liquida e radioesterilizacao da mosca-sulamericana Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Kamiya, Aline Cristiane

    2010-07-01

    Both the biological control techniques as the Sterile Insect Technique (SIT), are used in many countries to control, suppress and even eradicate fruit flies and other pests in agriculture and public health. The use of such techniques minimizes the continuous employment of insecticides, protects the environment and conforms to standards for food safety. However, it is necessary to implement such programs, technology to produce millions of parasitoids and the pest in its own laboratory with biological quality similar to the insects found in nature and cost competitive with chemical control. The objectives of this study was to establish protocols for artificial rearing of A. sp. 1 aff. fraterculus in liquid larval diet that will achieve levels of mass production for a possible reduction in the cost of establishing and determining the dose of radiation sterilization of adult A. sp. 1 aff. fraterculus meeting the quality parameters required by the Sterile Insect Technique with insects from the creation of Radioentomology Laboratory of CENA/USP. Seven experimental diets compared to the conventional diet used in Radioentomology Lab. of CENA/USP, which was used as control. All seven diets have in common the exclusion of agar in its formulation. Only two of the diets tested were suitable for larval development of the fly, they compared with the standard diet, showed inferior results with respect to the volume of recovered larvae, pupae and weight of emergency, however, no significant differences regarding the periods of development , pupal recovery, sex ratio and longevity under stress. It is possible to replace the diet with agar for liquid diets for artificial creation of A. sp. 1 aff. fraterculus, reduced cost and greater convenience of handling, but due to their quality standards lower than the standard diet, more tests are needed especially regarding the adaptability of the insect to the new environment. To determine the sterilizing dose this study examined the

  9. Long aculeus and behavior of Anastrepha ludens render gibberellic acid ineffective as an agent to reduce 'ruby red' grapefruit susceptibility to the attack of this pestiferous fruit fly in commercial groves.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martín; Greany, Patrick; Bigurra, Everardo; Pérez-Staples, Diana; McDonald, Roy

    2006-08-01

    Treating Mexican grapefruit with gibberellic acid (GA3) before color break, significantly delayed peel color change and increased peel puncture resistance, but it did not reduce grapefruit susceptibility to Mexican fruit fly, Anastrepha ludens (Loew) attack under natural conditions. Despite GA3 treatments, larval infestation levels increased with higher fruit fly populations, which also increased as the season progressed. Late in the season, infestation levels were even higher in GA3-treated fruit compared with untreated fruit, possibly because treated fruit were in better condition at that stage. Egg clutch size was significantly greater in very unripe, hard, GA3-treated fruit at the beginning of the harvest season and in December, compared with control fruit. Under laboratory conditions, egg injection into different regions of the fruit suggested that A. ludens eggs are intoxicated by peel oil content in the flavedo region. However, A. ludens' long aculeus allows females to oviposit eggs deeper into the peel (i.e., albedo), avoiding toxic essential oils in the flavedo. This makes A. ludens a particularly difficult species to control compared with other citrus-infesting species such as Anastrepha suspensa (Loew), Anastrepha fraterculus (Wiedemann), and Ceratitis capitata (Wiedemann) (fly species with significantly shorter aculei), which can be effectively managed with GA3 sprays. We discuss our findings in light of their practical implications and with respect to the oviposition behavior of various fruit flies attacking citrus.

  10. Limits to the host range of the highly polyphagous tephritid fruit fly Anastrepha ludens in its natural habitat.

    Science.gov (United States)

    Birke, A; Acosta, E; Aluja, M

    2015-12-01

    Anastepha ludens (Diptera: Tephritidae) is a highly polyphagous fruit fly that is able to develop in a wide range of hosts. Understanding the limits of this pest's host range could provide valuable information for pest management and plant breeding for pest resistance. Previous studies have shown that guavas (Psidium guajava (Myrtaceae) L.), are not attacked under natural conditions by A. ludens. To understand this phenomenon, guavas were exposed to natural infestation by A. ludens and to other fruit fly species that infest guavas in nature (Anastrepha striata Schiner, Anastepha fraterculus (Wiedemann), Anastepha obliqua (Macquart)). Once the susceptible phenological stage of guavas was determined, fruit infestation levels were compared between A. ludens and A. striata. Choice and non-choice tests were performed under field-cage conditions. Under field conditions, guavas were susceptible to A. striata and A. fraterculus attack all the way from when fruit was undeveloped to when fruit began to ripen. No infestation by A. ludens was recorded under natural conditions. Similar results were obtained when forced exposures were performed, indicating that unripe guavas were preferred by A. striata over ripe fruit, and that infestation rates were higher at early fruit maturity stages. Under forced oviposition conditions, A. ludens larvae were unable to develop in unripe guavas but did so in fully ripe fruit. However, A. ludens fitness parameters were dramatically affected, exhibiting reduced survival and reduced pupal weight compared to conspecifics that developed in a natural host, grapefruit. We confirm that P. guajava should not be treated as a natural host of this pestiferous species, and suggest that both behavioral aspects and the fact that larvae are unable to adequately develop in this fruit, indeed represent clear limits to A. ludens's broad host range.

  11. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  12. Beckwith-Wiedemann syndrome

    Science.gov (United States)

    ... Wiedemann syndrome References Jones KL, Jones M, Del Campo M, eds. Smith's Recognizable Patterns of Human Malformation . ... Ogilvie, PhD, and the A.D.A.M. Editorial team. Related MedlinePlus Health Topics Growth Disorders Browse ...

  13. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  14. Wiedemann: color y exilio

    Directory of Open Access Journals (Sweden)

    Juan Gustavo Cobo Borda

    1995-01-01

    Full Text Available El exiliado mantiene viva, en la retina de la memoria, los colores de su inicial contacto con el mundo. Al nacer en Munich en 1905 e interesarse por las artes plásticas, las primeras visiones de Guillermo Wiedemann bien pudieran fijarse en los caballos azules de Franz Marc o en las remotas tierras vírgenes de ese adánico primitivismo con que los expresionistas alemanes de la nueva sensibilidad huían hacia la naturaleza, trátese del bosque verde o las cumbres recubiertas de nieve. La choza africana o lo~ archipiélagos del Pacífico donde los tótems de Gauguin todavía arden, con sensualidad ancestral, en la penumbra salvaje.

  15. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  16. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    Full Text Available 1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponderante. 3. Las moscas Anastrephas constituyen la plaga más importante de la fruticultura nacional, y por esta razón, un estudio sobre estos insectos es un tema de importancia. 4. Las principales "moscas de las frutas" pertenecen dentro de la familia Trypetidae, a los géneros: Dacus, Rhaglethis, Ceratitis, Dactrocera y Anastrepha. 5. Los nombres comunes con que se conocen las moscas Anastrephas varían de un país a otro y se relacionan particularmente con el lugar de origen de las distintas especies o la fruta determinada como preterida por la mosca en una localidad. En Colombia la denominación vernácula más difundida es la de "gusano de las frutas". También se nombra el insecto como "mosca o gusano del mango" o "gusano de la guayaba". 6. Los nombres científicos de las moscas distinguen a una, gran cantidad de especies. En Colombia, varios autores han reportado la existencia de las especies A.fraterculus, A. ludens, A. mombinpracoptans, A. pikeli y A. serpentina. Todas estas especies inciden en las regiones colombianas comprendidas entre 0 y 2000 metros de altura, es decir, en casi todas las regiones agrícolas importantes (frutales, café, cacao de temperaturas entre 14° y 30° C. 7. Las moscas Anastrephas están confinadas casi exclusivamente al continente americano entre las latitudes 27° N. y 35° S. Particularmente, la especie A. fraterculus, una de las más difundidas en Colombia, fué determinada por Wiedemann (1830

  17. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  18. Genetics Home Reference: Beckwith-Wiedemann syndrome

    Science.gov (United States)

    ... of origin is marked during the formation of egg and sperm cells. Beckwith-Wiedemann syndrome is often associated with ... random events during the formation of reproductive cells (eggs and sperm) or in the earliest stages of development before ...

  19. Beckwith-Wiedemann syndrome: dental management.

    LENUS (Irish Health Repository)

    Garvey, M T

    1997-06-01

    Beckwith-Wiedemann syndrome (BWS) comprises multiple congenital anomalies with a risk of childhood tumours. Macroglossia is the most common manifestation. Two cases are presented to illustrate the importance of early referral and the role of preventive dentistry.

  20. CASE REPORT OF BECKWITH-WIEDEMANN SYNDROME

    Directory of Open Access Journals (Sweden)

    Ravikanth

    2014-06-01

    Full Text Available In 1963 Beckwith presented a report on the first patient with extreme cytomegaly of adrenal cortex, hyperplasia of kidneys as well as pancreas and Leydig cell hyperplasia. Wiedemann completed description of the new syndrome by adding umbilical hernia and macroglossia. The diagnosis is made based on the clinical signs of omphalocele. [7] or some other umbilical deformity, macroglossia. [8] congenital asymmetry, visceromegaly (liver, pancreas, and kidneys. Newborn with macrosomia, macroglossia first differential diagnosis are infant of diabetic mother, congenital hypothyroidism etc. IDM can be identified easily with history of maternal diabetes. So congenital hypothyroidism is next common diagnosis and will be treated as hypothyroidism. If TSH, T3 and T4 are not clearly indicative of congenital hypothyroidism next consider the Beckwith Wiedemann syndrome in differential diagnosis of large for gestational age.

  1. Síndrome de Beckwith Wiedemann

    Directory of Open Access Journals (Sweden)

    Dania Faxas Rodríguez

    2015-12-01

    Full Text Available Se presenta el caso de un paciente, atendido en el Servicio de Pediatría del Hospital General Docente “14 de Junio” del municipio de Jobabo, provincia de Las Tunas. El paciente es portador de un síndrome de Beckwith Wiedemann, enfermedad de posible origen genético autosómico dominante, cuyo diagnóstico se fundamenta en criterios clínicos mayores y menores. Se expusieron los resultados del examen clínico y de las investigaciones complementarias. Se realizó una revisión de la literatura médica sobre el tema.

  2. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2016-07-01

    Full Text Available ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae is recorded for the first time parasitizing Anastrepha obliqua (Macquart (Diptera: Tephritidae in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae in Brazil.

  3. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    OpenAIRE

    Almerinda Amélia Rodrigues Araújo; Paulo Roberto Ramalho Silva; Ranyse Barbosa Querino Silva; Elizangela Pereira da Silva Sousa

    2016-01-01

    ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae) is recorded for the first time parasitizing Anastrepha obliqua (Macquart) (Diptera: Tephritidae ) in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae) in Brazil.

  4. Macroglossia and Beckwith-Wiedemann syndrome

    Directory of Open Access Journals (Sweden)

    Krasić Dragan

    2011-01-01

    Full Text Available Introduction. In 1963 Beckwith presented a report on the first patient with extreme cytomegaly of adrenal cortex, hyperplasia of kidneys and pancreas and Leydig cell hyperplasia. Wiedemann completed description of the new syndrome by adding umbilical hernia and macroglossia. The diagnosis is made based on the clinical signs of omphalocele or some other umbilical deformity, macroglossia, congenital asymmetry, visceromegaly (liver, pancreas, and kidneys. Case Outline. A 16-month-old male child was admitted for examination because of macroglossia. He underwent examination on several occasions by an endocrinologist due to recurrent hypoglycaemic crisis. The patient was observed by a paediatric neurophysicatrist for disorders of mental development. Hypoglycaemia, muscular hypotonia of the anterior abdominal wall with umbilical hernia and macroglossia were observed by clinical examination. Inratraoral examination revealed macroglossia with microstomia, suckling and swallowing difficulties, hypotonia of the perioral muscles with increased salivation. It was therefore decided to perform surgical reduction of the prominent tongue and develop good condition for nutrition, speech function and the development of orofacial system. Conclusion. The diagnosis of macroglossia is based on subjective clinical criteria such as the morphology and amount of protrusion of the tongue, difficulty in articulating sounds, breathing, and hypersalivation. Some authors have suggested that the tongue size may be analyzed radiographically with a cephalogram. Treatment of macroglossia is controversial because of the absence of objective clinical criteria.

  5. Isolation, identification and determination of the biological activity of candidate fruit volatile components from Argania spinosa L. (Sapotacea)

    Energy Technology Data Exchange (ETDEWEB)

    Bakri, A., E-mail: bakri@ucam.ac.m [University Cadi Ayyad, Marrakech (Morocco). Fac. of Science Semlalia. Insect Biological Control Unit; Dueben, B.D.; Proveaux, A.T.; Heath, R.R., E-mail: rheath@saa.ars.usda.go [U.S. Department of Agriculture (USDA/REE-ARS), Miami, FL (United States). Agricultural Research Service

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  6. Wiedemann effect of Fe-Ga based magnetostrictive wires

    Institute of Scientific and Technical Information of China (English)

    Li Ji-Heng; Gao Xue-Xu; Zhu Jie; Bao Xiao-Qian; Cheng Liang; Xie Jian-Xin

    2012-01-01

    (Fe83Gal7)gsCr2 wires each with a diameter of 0.7 mm are prepared by hot swaging and warm drawing from the casting rods directly,because the ductility of Fe83Ga17alloy is improved by adding Cr element.The Wiedemann twists and dependences on magnetostrictions of Fes3Ga17 and (Fes3Ga17)98Cr2 wires are investigated.The largest observed Wiedemann twists of 245 s.cm-1 and 182 s.cm-1 are detected in the annealed Fe83Ga17 and (Fe83Ga17)98Cr2 wires,respectively.The magnetostrictions of the annealed Fes3Ga17 and (FesaGa17)98Cr2 wires are 160 ppm and 107 ppm,respectively.The maximum of the Wiedemann twist increases with magnetostriction increasing.However the magnetostriction is just one important factor that affects the Wiedemann effect of alloy wire,and the relationship between magnetostriction and Wiedemann effect is a complex function rather than a simple function.

  7. Nasal encephalocele in a child with Beckwith-Wiedemann syndrome

    NARCIS (Netherlands)

    Broekman, Marike L. D.; Hoving, Eelco W.; Kho, Kuan H.; Speleman, Lucienne; Sen Han, K.; Hanlo, Patrick W.

    2008-01-01

    Beckwith-Wiedemann syndrome (BWS) is a rare congenital syndrome characterized by gigantism, macroglossia, exophthalmos, postpartum hypoglycemia, and multiple midline defects such as omphalocele. The authors describe, to the best of their knowledge, the first case of a child in whom BWS was diagnosed

  8. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  9. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  10. Biology of Fopius arisanus (Hymenoptera: Braconidae) in Two Species of Fruit Flies

    Science.gov (United States)

    Groth, M. Z.; Loeck, A. E.; Nörnberg, S. D.; Bernardi, D.; Nava, D. E.

    2016-01-01

    Fopius arisanus (Sonan, 1932) (Hymenoptera: Braconidae) is an egg–larval parasitoid used in control programs of Bactrocera dorsalis (Hendel) and Ceratitis capitata (Wiedemann). In Brazil, C. capitata and Anastrepha fraterculus (Wiedemann) are considered the main tephritid pests of exotic and indigenous fruits. The objective of this study was to study the biology of F. arisanus in C. capitata and A. fraterculus. Eggs of the two fruit fly species were used to determine the parasitism rate, number of offspring, emergence rate, sex ratio, adult weight and longevity of male and female F. arisanus. These biological parameters were used to develop a fertility life table. We observed higher parasitism and emergence rates of adults, a shorter duration of the egg–adult period and a sex ratio biased to females when F. arisanus was reared in eggs of C. capitata than in those of A. fraterculus. However, adults of F. arisanus from eggs of A. fraterculus were heavier and had greater longevity than those obtained from C. capitata eggs. The fertility life table showed better biological and reproductive performance for F. arisanus reared in eggs of C. capitata, although eggs of A. fraterculus also provided positive values for population increase. PMID:27638954

  11. Distribution of Anastrepha spp. in carambola orchards: Evidence for migration

    Science.gov (United States)

    Carambola orchards in Juana Diaz, Corozal, and Isabela, PR, were monitored for Anastrepha spp. fruit flies using Multi-lure traps baited with putrescine and ammonium acetate. The number of flies at various locations within the orchards were statistically compared with the expected distribution if fl...

  12. Ammonia Formulations and Capture of Anastrepha Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted in numbers to protein baits. Synthetic lures based on the principle components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important ...

  13. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch

    2012-10-01

    Full Text Available Apesar do incentivo e do investimento na produção de frutas no estado do Paraná, pouca informação está disponível sobre as moscas-das-frutas, uma das principais pragas da fruticultura. O presente trabalho teve os objetivos de registrar pela primeira vez a fauna de tefritídeos, na região de Ponta Grossa, e caracterizar a sua comunidade por meio de diferentes índices faunísticos. Adultos de tefritídeos foram coletados por meio de frascos caça-moscas com atrativos alimentares em quatro pomares de agosto a dezembro de 2009. Foi coletado um total de 2.428 tefritídeos distribuídos em sete espécies: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann, Rhagoletis sp. Loew e Hexachaeta sp. Loew. A. fraterculus foi a única espécie comum aos quatro pomares, ocorrendo com frequência acima de 80%. Este é o primeiro registro de A. montei no Paraná. A. fraterculus, A. sororcula e C. capitata apresentaram os maiores índices de frequência, abundância, dominância e constância, sendo, portanto, consideradas espécies predominantes. O maior índice de diversidade (H'=0,4360 ocorreu no pomar 2, diferindo significativamente dos demais pomares (teste t, PIn spite of encouragement and investment in fruit production in the state of Paraná, little information is available on the fruit flies, a major pest in fruit growing. The present study had the objective of recording for the first time the tephritid fauna in the region of Ponta Grossa, and characterize the insect community through different faunal indices. Adult tephritids were collected by means of flapper bottles with food baits in four orchards from August to December 2009. A total of 2,428 tephritids distributed in seven species were collected: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann

  14. OCORRÊNCIA E ÍNDICE DE INFESTAÇÃO DE Anastrepha spp. (DIP., TEPHRITIADE EM Pouteria gardneriana Radlk. E Pouteria ramiflora (Mart. Radlk. (SAPOTACEAE, NOS CERRADOS DE GOIÁS OCCURENCE AND INFESTATION INDEXES OF Anastrepha spp. (DIP., TEPHIRITIDAE IN Pouteria gardneriana RADLK AND Pouteria ramjflora (MART. RADLK. (SAPOTACEAE IN “CERRADOS” OF THE STATE OF GOIÁS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Nelson Augusto Canal Daza

    2007-09-01

    Full Text Available

    Dentre as frutíferas nativas dos cerrados goianos destacam-se as do gênero Pouteria, com ampla distribuição nas regiões tropicais e subtropicais de todo o mundo, sendo a P. ramiflora (curriola a mais comum. Pouteria gardneriana (guapeva ocorre geralmente nos solos mais úmidos, sempre agrupada na faixa de separação cerrados-veredas. Dos 25 municípios do Estado de Goiás amostrados, em nove foi registrada a ocorrência dessas duas espécies de Pouteria, cujos frutos são bastante suscetíveis ao ataque de moscas-das-frutas. Dos frutos de guapeva e curriola, emergiram adultos de Anastrepha (99,82% e apenas alguns exemplares de Ceratitis capitata (0,18%. As espécies coletadas em P. gardneriana foram: Anastrepha bistrigata, A. fraterculus, A. leptozona, A. serpentina, A. zenildae, A. zernyi e C. capitata. De P. ramiflora foram obtidas: A. fraterculus, A. leptozona, A. serpentina e A. zernyi. Dos pupários de Anastrepha

  15. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  16. Ammonium Acetate and Ammonium Bicarbonate in Traps for Anastrepha Fruit Flies

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Anastrepha s...

  17. Neem derivatives are not effective as toxic bait for tephritid fruit flies.

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Mastrangelo, T; Forim, M R

    2013-08-01

    Neem derivatives have been widely touted as replacements for pesticides. A feasible replacement of synthetic insecticides in the management of fruit flies could be to use neem products in baits. This study evaluated the bioactivity of neem (Azadirachta indica A. Juss) derivatives in bait for adults of Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann). The estimated LCs50 values for A. fraterculus and C. capitata were 7,522 ppm (18.40 ppm of azadirachtin) and 1,368 ppm (3.35 ppm of azadirachtin), respectively, using an aqueous extract of neem seeds in bait after 10 d of experimentation. No significant differences in the mortality of A. fraterculus and C. capitata adults exposed to baits made from different extracts and neem oil were observed after 3 h or 2 or 6 d; differences among the treatments were observed only on the 10th day of the evaluation. We conclude that neem derivatives applied as a bait spray over citrus plants did not demonstrate a toxic effect on A. fraterculus and C. capitata. The reasons for the low efficacy of the neem bait on Tephritid fruit flies are discussed.

  18. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae).

    Science.gov (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A

    2016-09-15

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  19. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae)

    Science.gov (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  20. 78 FR 68021 - Notice of Affirmation of Addition of a Treatment Schedule for Methyl Bromide Fumigation of...

    Science.gov (United States)

    2013-11-13

    ... species, Ceratitis capitata (Mediterranean fruit fly) and Anastrepha fraterculus (South American fruit fly... bromide treatment schedule to mitigate risk from C. capitata and A. fraterculus, as described in the...

  1. Prenatal diagnosis of Beckwith-Wiedemann syndrome by two- and three-dimensional ultrasonography

    Directory of Open Access Journals (Sweden)

    Edward Araujo Junior

    2013-12-01

    Full Text Available Beckwith-Wiedemann syndrome is a genetic syndrome characterized by macroglossia, omphalocele, fetal gigantism and neonatal hypoglycemia. The authors report a case of Beckwith-Wiedemann syndrome diagnosed in a 32-year-old primigravida in whom two-dimensional ultrasonography revealed the presence of abdominal wall cyst, macroglossia and polycystic kidneys. Three-dimensional ultrasonography in rendering mode was of great importance to confirm the previous two-dimensional ultrasonography findings.

  2. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  3. Assessment of differences between X and gamma rays in order to validate a new generation of irradiators for insect sterilization

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago; Walder, Julio M.M., E-mail: piaui@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil); Parker, Andrew G.; Jessup, Andrew; Orozco-Davila, Dina; Islam, Amirul; Dammalage, Thilakasiri, E-mail: A.Jessup@iaea.or [Joint FAO/IAEA-UN A-2444, Seibersdorf (Austria). Insect Pest Control Subprogramme; Pereira, Rui, E-mail: R.Cardoso-Pereira@iaea.or [Joint FAO/IAEA-UN, Vienna (Austria). Insect Pest Control Subprogramme

    2009-07-01

    Recent fears of terrorism provoked an increase in delays and denials of transboundary shipments of radioisotopes. This represents a serious constraint to sterile insect technique (SIT) programs around the world as they rely on the use of ionizing energy from radioisotopes for insect sterilization. In order to validate a novel Xray irradiator, a series of studies on Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) were carried out, comparing the relative biological effectiveness (RBE) between X-rays and traditional gamma radiation from {sup 60}Co. Male C. capitata pupae and pupae of both sexes of A. fraterculus, both 24 to 48 h before adult emergence, were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Estimated mean doses of 91.2 Gy of X and 124.9 Gy of gamma radiation induced 99% sterility in C. capitata males. Irradiated A. fraterculus were 99% sterile at about 40-60 Gy for both radiation treatments. Standard quality control parameters were not significantly affected by the two types of radiation. There were no significant differences between X and gamma radiation regarding mating indices. The RBE did not differ significantly between the tested X and gamma radiation, and X-rays are as biologically effective for SIT purposes as gamma rays are. This work confirms the suitability of this new generation of X-ray irradiators for pest control programs in UN Member States. (author)

  4. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  5. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  6. Wiedemann-Steiner Syndrome With 2 Novel KMT2A Mutations.

    Science.gov (United States)

    Min Ko, Jung; Cho, Jae So; Yoo, Yongjin; Seo, Jieun; Choi, Murim; Chae, Jong-Hee; Lee, Hye-Ran; Cho, Tae-Joon

    2017-02-01

    Wiedemann-Steiner syndrome is a rare genetic disorder characterized by short stature, hairy elbows, facial dysmorphism, and developmental delay. It can also be accompanied by musculoskeletal anomalies such as muscular hypotonia and small hands and feet. Mutations in the KMT2A gene have only recently been identified as the cause of Wiedemann-Steiner syndrome; therefore, only 16 patients from 15 families have been described, and new phenotypic features continue to be added. In this report, we describe 2 newly identified patients with Wiedemann-Steiner syndrome who presented with variable severity. One girl exhibited developmental dysplasia of the hip and fibromatosis colli accompanied by other clinical features, including facial dysmorphism, hypertrichosis, patent ductus arteriosus, growth retardation, and borderline intellectual disability. The other patient, a boy, showed severe developmental retardation with automatic self-mutilation, facial dysmorphism, and hypertrichosis at a later age. Exome sequencing analysis of these patients and their parents revealed a de novo nonsense mutation, p.Gln1978*, of KMT2A in the former, and a missense mutation, p.Gly1168Asp, in the latter, which molecularly confirmed the diagnosis of Wiedemann-Steiner syndrome.

  7. Prenatal molecular testing for Beckwith-Wiedemann and Silver-Russell syndromes

    DEFF Research Database (Denmark)

    Eggermann, Thomas; Brioude, Frédéric; Russo, Silvia

    2016-01-01

    Beckwith-Wiedemann and Silver-Russell syndromes (BWS/SRS) are two imprinting disorders (IDs) associated with disturbances of the 11p15.5 chromosomal region. In BWS, epimutations and genomic alterations within 11p15.5 are observed in >70% of patients, whereas in SRS they are observed in about 60...

  8. Finding column depedencies in sparse matrices over $ F_ 2 $ by block Wiedemann

    NARCIS (Netherlands)

    Penninga, O.

    1998-01-01

    Large systems of linear equations over $mathbb{F_2$ with sparse coefficient matrices have to be solved as a part of integer factorization with sieve-based methods such as in the Number Field Sieve algorithm. In this report, we first discuss the Wiedemann algorithm to solve these systems and investig

  9. Beckwith-Wiedemann syndrome and bilateral adrenal pheochromocytoma: sonography and MRI findings

    Energy Technology Data Exchange (ETDEWEB)

    Baldisserotto, Matteo; Peletti, Adriana Barcellos; Araujo, Manoel Angelo de; Pertence, Ana Paula Cardoso; Dora, Marcelo Dourado; Maciel, Elines Oliva; Gaiger, Ana Maria [Hospital da Crianca Conceicao, Departamento de Radiologia, Porto Alegre, RS (Brazil)

    2005-11-01

    Beckwith-Wiedemann syndrome is characterized by a group of clinical abnormalities, the most frequent of which are omphalocele, macroglossia, gigantism, neonatal hypoglycemia and umbilical hernia. The association of this syndrome with malignant tumors is well documented. We report a child with this syndrome associated with bilateral adrenal pheochromocytoma. (orig.)

  10. SNP arrays in Beckwith-Wiedemann syndrome: an improved diagnostic strategy.

    Science.gov (United States)

    Keren, Boris; Chantot-Bastaraud, Sandra; Brioude, Frédéric; Mach, Corinne; Fonteneau, Eric; Azzi, Salah; Depienne, Christel; Brice, Alexis; Netchine, Irène; Le Bouc, Yves; Siffroi, Jean-Pierre; Rossignol, Sylvie

    2013-10-01

    Beckwith-Wiedemann syndrome is an overgrowth disorder with an increased risk of childhood tumors that results from a dysregulation of imprinted gene expression in the 11p15 region. Since epigenetic defects are the most frequent anomalies, first-line diagnostic methods involve methylation analysis. When paternal isodisomy is suspected, it should be confirmed by a second technique capable of distinguishing true 11p15 paternal disomy (patUPD) from paternal 11p15 duplication or 11p15 trisomy. We sought to evaluate the interest of using SNP arrays in the Beckwith-Wiedemann syndrome diagnostic strategy. We analyzed the SNP profiles of 25 Beckwith Wiedemann patients with previously determined methylation indexes. Among them, 3 had 11p15 trisomies, 13 had patUPD, 8 had an inconclusive methylation index and 1 had a normal result. All known trisomies and known patUPDs were detected. Moreover we found 7 low-rate mosaicisms 11p15 patUPDs among the 8 patients with an inconclusive methylation index. We were able to precisely characterize the sizes and mosaicism rates of the anomalies. We demonstrate that SNP arrays are of real diagnostic interest in Beckwith-Wiedemann syndrome: 1) they help to distinguish patUPDs from trisomies more precisely than karyotyping and FISH, 2) they help determine the size and mosaicism rate of patUPDs, 3) they provide complementary information in inconclusive cases, helping to distinguish low-rate patUPD mosaicism from other BWS-related molecular defects.

  11. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  12. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  13. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  14. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae)

    Science.gov (United States)

    Mascarenhas, Rodrigo O; Prezotto, Leandro F; Perondini, André Luiz P; Marino, Celso Luiz; Selivon, Denise

    2016-01-01

    Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids. PMID:27648768

  15. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae)

    Science.gov (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  16. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae and parasitoid wasps (Braconidae

    Directory of Open Access Journals (Sweden)

    Rodrigo O Mascarenhas

    Full Text Available Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

  17. Partial KCNQ1OT1 hypomethylation: A disguised familial Beckwith–Wiedemann syndrome as a sporadic adrenocortical tumor

    Directory of Open Access Journals (Sweden)

    Dorra H'mida Ben-Brahim

    2015-03-01

    Full Text Available Beckwith–Wiedemann syndrome has a wide spectrum of complications such as embryonal tumors, namely adrenocortical tumor. Tumor predisposition is one of the most challenging manifestations of this syndrome. A 45-day old female with a family history of adrenocortical tumor presented with adrenocortical tumor. The case raised suspicion of a hereditary Beckwith–Wiedemann syndrome, therefore molecular analysis was undertaken. The results revealed partial KCNQ1OT1 hypomethylation in the infant's blood DNA which was associated with a complete loss of methylation in the infant's adrenocortical tumor tissue. It is unique for familial Beckwith–Wiedemann syndrome caused by KCNQ1OT1 partial hypomethylation to manifest solely through adrenocortical tumor. Incomplete penetrance and specific tissue mosaicism could provide explanations to this novel hereditary Beckwith–Wiedemann syndrome presentation.

  18. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 3.0

    Science.gov (United States)

    The Mediterranean fruit fly (Medfly), Ceratitis capitata (Wiedemann), causes direct damage to fruits and vegetables through oviposition and larval feeding. Rigorous quarantine procedures are currently enforced to prevent domestic and transnational spread of Medfly. Accessible and reliable informatio...

  19. Evaluating mating compatibility within fruit fly cryptic species complexes and the potential role of sex pheromones in pre-mating isolation

    Science.gov (United States)

    Juárez, M. Laura; Devescovi, Francisco; Břízová, Radka; Bachmann, Guillermo; Segura, Diego F.; Kalinová, Blanka; Fernández, Patricia; Ruiz, M. Josefina; Yang, Jianquan; Teal, Peter E.A.; Cáceres, Carlos; Vreysen, Marc J.B.; Hendrichs, Jorge; Vera, M. Teresa

    2015-01-01

    Abstract The study of sexual behavior and the identification of the signals involved in mate recognition between con-specifics are key components that can shed some light, as part of an integrative taxonomic approach, in delimitating species within species complexes. In the Tephritidae family several species complexes have received particular attention as they include important agricultural pests such as the Ceratitis fasciventris (Bezzi), Ceratitis anonae (Graham) and Ceratitis rosa Karsch (FAR) complex, the Bactrocera dorsalis (Hendel) complex and the Anastrepha fraterculus (Wiedemann) complex. Here the value and usefulness of a methodology that uses walk-in field cages with host trees to assess, under semi-natural conditions, mating compatibility within these complexes is reviewed, and the same methodology to study the role of chemical communication in pre-mating isolation among Anastrepha fraterculus populations is used. Results showed that under the same experimental conditions it was possible to distinguish an entire range of different outcomes: from full mating compatibility among some populations to complete assortative mating among others. The effectiveness of the methodology in contributing to defining species limits was shown in two species complexes: Anastrepha fraterculus and Bactrocera dorsalis, and in the case of the latter the synonymization of several established species was published. We conclude that walk-in field cages constitute a powerful tool to measure mating compatibility, which is also useful to determine the role of chemical signals in species recognition. Overall, this experimental approach provides a good source of information about reproductive boundaries to delimit species. However, it needs to be applied as part of an integrative taxonomic approach that simultaneously assesses cytogenetic, molecular, physiological and morphological traits in order to reach more robust species delimitations. PMID:26798257

  20. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  1. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  2. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-01-10

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack.

  3. A new record of Fannia pusio (Wiedemann) (Diptera:Fanniidae) from Malaysia.

    Science.gov (United States)

    Omar, B; Kurahashi, H; Jeffery, J; Yasohdha, N; Lau, S Y; John, M C; Marwi, M A; Zuha, R M; Ahmad, M S

    2007-12-01

    Fannia pusio (Wiedemann) (Diptera: Fanniidae) is newly recorded from Malaysia. This record is based on 1male symbol 1female symbol from Sarawak, east Malaysia and 1male symbol 2female symbol from Selangor, peninsular Malaysia. It is included in the pusio group of Fannia wherein are included Fannia femoralis (Stein), Fannia howardi Malloch, Fannia trimaculata (Stein), Fannia leucosticta (Meigen) and Fannia punctiventris Malloch. The male of Fannia pusio is differentiated from other members of the group by the following features: hind femur with a swelling bearing a number of setae that are usually curled at tip; squamae creamy; tergite 1+2 broadly grey dusted at sides.

  4. Survival of Wild Adults of Ceratitis capitata (Wiedemann under Natural Winter Conditions in North East Spain

    Directory of Open Access Journals (Sweden)

    E. Peñarrubia-María

    2012-01-01

    Full Text Available The overwintering of the Mediterranean fruit fly (medfly, Ceratitis capitata (Wiedemann at the northern limits of its geographic distribution is not yet well known. With the aim of estimating the survival rate of medfly adults in northeast Spain under natural winter conditions, a two-winter-season trial was carried out. A control was carried out in a climatic chamber at 25°C. The results showed that medfly adults were unable to survive the entire winter season in the Girona area. Climatic conditions, including the daily minimum temperature, daily maximum temperature and the high rainfall, appeared to be involved in adult mortality in winter.

  5. Nonlinear heat transport in mesoscopic conductors: Rectification, Peltier effect, and Wiedemann-Franz law

    Science.gov (United States)

    López, Rosa; Sánchez, David

    2013-07-01

    We investigate nonlinear heat properties in mesoscopic conductors using a scattering theory of transport. Our approach is based on a leading-order expansion in both the electrical and thermal driving forces. Beyond linear response, the transport coefficients are functions of the nonequilibrium screening potential that builds up in the system due to interactions. Within a mean-field approximation, we self-consistently calculate the heat rectification properties of a quantum dot attached to two terminals. We discuss nonlinear contributions to the Peltier effect and find departures from the Wiedemann-Franz law in the nonlinear regime of transport.

  6. A new record for Lispe orientalis Wiedemann, 1824 (Diptera: Muscidae) from peninsular Malaysia.

    Science.gov (United States)

    Chew, W K; Kurahashi, H; Nazni, W A; Heo, C C; Heah, S K; Jeffery, J; Lee, H L

    2012-09-01

    Lispe orientalis Wiedemann, 1824 is recorded for the first time in peninsular Malaysia. Specimens were collected from a mushroom cultivation farm in Genting Highlands, Pahang (3°25'18"N 101°47'48"E). Previously, this species had been recorded from Azerbaijin, India, Russia, Tajikistan, Thailand, Turkey and South Korea. The male of Lispe orientalis can be determined by the following characteristics: body non-metallic, ashy gray, third antennal segment black, R5 cell not narrow apically, hind metatarsus normal, legs entirely black, femora with long bristle-like hairs on av and pv surfaces, hind tibia without av and pv seta and the palpi orangish in colour.

  7. Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae preying on Microtheca spp. (Coleoptera: Chrysomelidae larvae

    Directory of Open Access Journals (Sweden)

    VS Sturza

    Full Text Available Microtheca spp. (Coleoptera: Chrysomelidae are insect pests primarily related to Brassicaceae crops. In the State of Rio Grande do Sul (RS, southern Brazil, they are found on forage turnip, Raphanus sativus L. var. oleiferus Metzg., which is commonly grown during fall/winter seasons. This work reports the predation of Microtheca spp. larvae by Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae larvae, on forage turnip crop, in Santa Maria, RS. This register provides new information about Microtheca spp. natural enemies in Brazil, which might be a new option for integrate pest management of these species.

  8. A microdeletion at 12q24.31 can mimic beckwith-wiedemann syndrome neonatally.

    Science.gov (United States)

    Baple, E; Palmer, R; Hennekam, R C M

    2010-02-01

    We report on a patient who was initially suspected to have Beckwith-Wiedemann syndrome because of recurrent neonatal hypoglycaemias, macroglossia and overgrowth, but in whom no 11p15 abnormality could be found. Follow-up showed continued overgrowth and disturbed glucose homeostasis, a marked developmental delay, and severe behavioural problems especially caused by anxieties. Array comparative genomic hybridization analysis showed a de novo 12q24.31 interstitial deletion, which was confirmed by fluorescence in situ hybridization. The deleted region contains amongst others: HNF1 homeobox A (HNF1A) which is important for the regulation of gene expression in the liver and involved in maturity-onset diabetes of the young type 3 and insulin resistance; acyl-CoA dehydrogenase short chain (ACADS) which encodes an enzyme important in mitochondrial fatty acid beta-oxidation and can cause short-chain acyl-CoA dehydrogenese (SCAD) deficiency, and purinergic receptor P2X7 (P2RX7) which encodes a ligand-gated ion channel, and of which polymorphisms are found with increased frequency in patients with psychiatric disorders, especially anxieties. We conclude the present patient has a hitherto undescribed contiguous gene syndrome, which can initially resemble Beckwith-Wiedemann syndrome.

  9. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  10. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha

    2010-06-01

    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study

  11. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  12. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  13. Histological features of the pancreas in a patient with congenital hyperinsulinism due to Beckwith-Wiedemann syndrome

    DEFF Research Database (Denmark)

    Christensen, Lene; Christesen, Henrik Boye Thybo; Brusgaard, Klaus

    Introduction: Beckwith-Wiedemann syndrome (BWS) is a genetic disorder with typical features such as macroglossia, abdominal wall defects, macrosomia, visceromegaly and embryonal tumors. Hypoglycemia is reported in about half of all newborns with BWS, usually resolving spontaneously within the first...

  14. No evidence for pathogenic variants or maternal effect of ZFP57 as the cause of Beckwith-Wiedemann Syndrome

    DEFF Research Database (Denmark)

    Boonen, Susanne E; Hahnemann, Johanne M D; Mackay, Deborah

    2012-01-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome, which, in 50-60% of sporadic cases, is caused by hypomethylation of KCNQ1OT1 differentially methylated region (DMR) at chromosome 11p15.5. The underlying defect of this hypomethylation is largely unknown. Recently, recessive mutations...

  15. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults

    Science.gov (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  16. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua

    Science.gov (United States)

    Different lures based on hydrolyzed protein products were assayed in the field for their ability to attract Anastrepha suspensa and A. obliqua (Diptera: Tephritidae). Typically, ammonium acetate with putrescine and freeze-dried NuLure with ammonium acetate and putrescine attracted more flies than ot...

  17. Electroantennogram response and attraction of Anastrepha suspensa to volatiles of various sugar sources and aged sugar sollutions

    Science.gov (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  18. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures.

    Science.gov (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R

    2009-08-01

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  19. H19DMR methylation analysis in patients with Beckwith-Wiedemann syndrome and isolated hemihyperplasia

    Directory of Open Access Journals (Sweden)

    Marcus Vinícius de Matos Gomes

    2005-01-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a congenital overgrowth disorder of complex and heterogeneous etiology involving alterations in genomic imprinting. The cause of isolated hemihyperplasia (IHH is unknown but might be due to partial or incomplete expression of BWS because both these conditions share predisposition for the same types of neoplasias. We investigated the methylation pattern of the putative imprinting control region H19DMR using peripheral blood from 12 patients, six with clinical features of BWS and six with IHH. All the patients had normal karyotypes and paternal uniparental disomy (UPD was excluded in 10 informative cases. The normal H19DMR methylation pattern was found in eight informative patients, indicating that H19DMR methylation was not related to their condition. We suggest that the absence of neoplasias in the BWS and IHH patients studied might be related to the absence of UPD and to the presence of normal H19DMR methylation.

  20. Ovarian thecal metaplasia of the adrenal gland in association with Beckwith-Wiedemann syndrome

    Institute of Scientific and Technical Information of China (English)

    Eslam; Y; Wassal; Mouhammed; Amir; Habra; Rafael; Vicens; Priya; Rao; Khaled; M; Elsayes

    2014-01-01

    Beckwith-Wiedemann syndrome(BWS) is an overgrowth syndrome associated with increased risk to develop malignancies including adrenocortical carcinoma. Ovarian thecal metaplasia of the adrenal gland is a rare tumorlike mesenchymal lesion in BWS patients that lacks detailed radiological description. We report a 17-yearold female patient with BWS, associated with bilateral Wilms tumor, hepatic hemangiomatosis, pancreatic neuroendocrine tumor, and a phyllodes tumor of the right breast. Surveillance abdominal ultrasound identified a right adrenal mass that was further characterized by computed tomography and magnetic resonance imaging. Radiologically, this mass displayed features that overlap with adrenocortical carcinoma and pheochromocytoma but after pathological examination this proved to be an ovarian thecal metaplasia of the adrenal gland. Adrenal masses in BWS should raise the suspicion for adrenocortical carcinoma though other adrenal tumors including ovarian thecal metaplasia can be seen in these patients.

  1. A perplexing encounter (The poem “Ziemia” by Adam Wiedemann

    Directory of Open Access Journals (Sweden)

    Marcin Jaworski

    2012-01-01

    Full Text Available The poem is interpreted as an ironic self-thematic commentary. The poet’s attitude is critical towards different interpretations: conventional, i.e. based on ambiguity, colloquial or stereotypical and academic, inspired by increasingly new theories. The substantial element in the poem is the relation between the subject (persona and the protagonist that corresponds to and translates into a communicative situation between the author and the reader. The result is complex, intertwined styles and techniques combined with one another. Wiedemann engages in a play with different ways of writing, ironically challenges or undermines poetical strategies to underline the conventionality of literature and communication in general. By doing this, he disturbs the reader by challenging the reader’s reading habits and thus making an impression that the reader is sent away from the poem to a single and unique experience in reality.

  2. The Wiedemann-Franz law in a normal metal-superconductor junction

    Institute of Scientific and Technical Information of China (English)

    R Ghanbari; G Rashedi

    2011-01-01

    In this paper the influence of superconducting correlations on the thermal and charge conductances in a normal metal-superconductor (NS) junction in the clean limit is studied theoretically.First we solve the quasiclassical Eilenberger equations,and using the obtained density of states we can acquire the thermal and electrical conductances for the NS junction.Then we compare the conductance in a normal region of an NS junction with that in a single layer of normal metal (N).Moreover,we study the Wiedemann-Franz (WF) law for these two cases (N and NS).From our calculations we conclude that the behaviour of the NS junction does not conform to the WF law for all temperatures.The effect of the thickness of normal metal on the thermal conductivity is also theoretically investigated in the paper.

  3. Uma nova espécie de Strebla Wiedemann, 1824 (Diptera, Streblidae, Streblinae sobre Anoura caudifer (E. Geoffroy, 1818 (Chiroptera, Phyllostomidae, Glossophaginae

    Directory of Open Access Journals (Sweden)

    Graciolli Gustavo

    2003-01-01

    Full Text Available A new species of Strebla Wiedemann, S. carvalhoi sp. nov., collected, on Anoura caudifer (E. Geoffroy, 1818 from Southern of Brazil, is described. Drawings of the postvertex, occipital plates, gonopods and tergite VII are provided.

  4. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae em pupas de fannia pusio (Wiedemann, 1830 (Diptera: fanniidae no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori

    2008-10-01

    Full Text Available Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae em pupas de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae is reported. Pupae of F. pusio were collected in traps using human feces to attract the adults. Ten pupae were obtained, of which two were parasitized by S. nigroaenea, thus demonstrating a parasitism rate of 20.0%.

  5. Parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae coletados em pupários no substrato rim bovino Parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae collected in pupae in the bovine kidney

    Directory of Open Access Journals (Sweden)

    Jean Patrick Bonani

    2006-04-01

    Full Text Available Objetivou-se com este estudo, identificar as principais espécies de parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae, em Lavras, Minas Gerais, Brasil, cujas larvas foram alimentadas com rim bovino. As coletas foram realizadas durante o período de agosto de 2003 a março de 2004. Um total de 921 parasitóides foram coletados em 942 pupas dessa mosca. A prevalência natural de parasitismo foi de 97%.The study aimed at identifying the main parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae. The larvae were feed on bovine kidney. Samplings were conducted from August 2003 to March 2004, in Lavras, Minas Gerais State, Brazil. A total of 921 parasitoids in 942 pupae fly were collected. The prevalence natural parasitism was 97%.

  6. [Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856] / Paul Kaegbein

    Index Scriptorium Estoniae

    Kaegbein, Paul

    2008-01-01

    Arvustus: Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856. - Buch und Bildung im Baltikum. Münster : LIT, 2005. lk. 495-525. Kubermangugümnaasiumi vanemõpetaja Ferdinand Wiedemann kirjutas 1856. aastal kooli ajaloo, mis mingitel põhjustel jäi avaldamata. Tema tööd on kasutanud 1881. aastal Gotthard von Hansen

  7. Eurytoma sp. (Hymenoptera: Pteromalidae como parasitóide de Fannia pusio (Wiedemann (Diptera: Fanniidae no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae as a parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    C.H. Marchiori

    2007-08-01

    Full Text Available This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae as parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  8. Eurytoma sp. (Hymenoptera: Pteromalidae) como parasitóide de Fannia pusio (Wiedemann) (Diptera: Fanniidae) no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae) as a parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) in Brazil

    OpenAIRE

    C.H. Marchiori

    2007-01-01

    This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae) as parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  9. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae) em pupas de fannia pusio (Wiedemann, 1830) (Diptera: fanniidae) no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) in pupae of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) in Brazil

    OpenAIRE

    Carlos Henrique Marchiori; Vanessa Alves Alvarenga

    2008-01-01

    Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) em pupas de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae), no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Cur...

  10. Congenital immunodeficiency in an individual with Wiedemann-Steiner syndrome due to a novel missense mutation in KMT2A.

    Science.gov (United States)

    Stellacci, Emilia; Onesimo, Roberta; Bruselles, Alessandro; Pizzi, Simone; Battaglia, Domenica; Leoni, Chiara; Zampino, Giuseppe; Tartaglia, Marco

    2016-09-01

    Wiedemann-Steiner Syndrome (WSS) is an autosomal dominant disorder characterized by hypertrichosis, short stature, intellectual disability, developmental delay, and facial dysmorphism. Since the original reports by Wiedemann and co-workers, and Steiner and Marques, only a few cases have been described. Recently, the clinical variability of the disorder has more precisely been characterized by Jones and co-workers, who also identified heterozygous KMT2A mutations as the molecular defect underlying this condition. Here, we report on a boy with a complex phenotype overlapping WSS but exhibiting epilepsy, feeding difficulties, microcephaly, and congenital immunodeficiency with low levels of immunoglobulins as additional features. Whole exome sequencing allowed identifying a previously unreported de novo KMT2A missense mutation affecting the DNA binding domain of the methyltransferase. This finding expands the clinical phenotype associated with KMT2A mutations to include immunodeficiency and epilepsy as clinically relevant features for this disorder. © 2016 Wiley Periodicals, Inc.

  11. [Susceptibility of six Arabic coffee cultivars to fruit flies (Diptera: Tephritoidea) under shaded and unshaded organic management in Valença, State of Rio de Janeiro, Brazil].

    Science.gov (United States)

    Aguiar-Menezes, Elen L; Souza, Silvana A S; Santos, Carlos M A; Resende, André L S; Strikis, Pedro C; Costa, Janaína R; Ricci, Marta S F

    2007-01-01

    The infestation indices by fruit flies were determined for six cultivars of Coffea arabica L. in shaded and unshaded systems under organic management. The experiment was set in a completely randomized design with a split-split-plot arrangement and four replicates. A 250g-sample of maturing fruits per plot was harvested in May 2005. The cultivars Icatu Amarelo and Catucaí Amarelo were the least susceptible to attack by tephritids in both systems. As for lonchaeids, Oeiras, Catucaí Amarelo and Catuaí Vermelho were the least susceptible cultivars in the shaded system, and there was no difference among the cultivars in the unshaded system. The following tephritid species were obtained: Ceratitis capitata (Wiedemann), Anastrepha fraterculus (Wiedemann) and A. sororcula Zucchi (Tephritidae). Lonchaeids were represented by Neosilba bifida Strikis & Prado, N. certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. pseudopendula (Korytkowski and Ojeda), Dasiops rugifrons Hennig, Neosilba n.sp.10 and Neosilba n.sp.14.

  12. Quarantine treatment against mediterranean fruit fly (Ceratitis capitata Wiedemann) in mangoes haden variety (Mangifera indica) with gamma irradiation (Co 60)

    OpenAIRE

    Peña C., María E.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Guillen E., Rafael; Servicio Nacional de Sanidad Agraria - SENASA.; Arias A., Gladys C.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.

    2014-01-01

    Tephritidae fruit flies are among the most damaging pests of fruit crops worldwide Ceratitis capitata Wiedemann, for instance, can infest more than 250 fruit and vegetable crop species, and constitutes the main phytosanitary restrict for export purposes. The investigation was carried out in a SENASA’s Production Center of Sterile Fruit Flies and PIMU’s laboratory; it was supervised by an OIEA’s irradiation expert. This research comprised two stages: 1) Determine the minimum irradiation dose t...

  13. Sjögren, Wiedemann ja liivi keele sõnaraamat. Panus 19. sajandi teadusajalukku / Eberhard Winkler

    Index Scriptorium Estoniae

    Winkler, Eberhard, 1955-

    2009-01-01

    Uuritakse, milline võis olla kummagi teadlase osa esimese liivi keele sõnaraamatu koostamisel: Sjögren, Andreas Johan. Gesammelte Schriften. Band II. Theil I., Joh. Andreas Sjögren's Livische Grammatik nebst Sprachproben ; Band II. Theil II., Joh. Andreas Sjögren's livisch-deutsches und deutsch-livisches Wörterbuch / bearbeitet von Ferdinand Joh. Wiedemann. St. Petersburg, 1861

  14. Flutuação populacional de moscas-das-frutas em pomares de citros no oeste de Santa Catarina, Brasil Population fluctuation of fruit flies in citrus orchards in the West of Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Luís Antônio Chiaradia

    2004-04-01

    Full Text Available As moscas-das-frutas (Diptera, Tephritidae causam danos econômicos em muitas frutíferas. Para conhecer a flutuação populacional destas moscas em pomares de citros da região Oeste de Santa Catarina, Brasil, e estudar as interferências de fatores climáticos sobre estes insetos, cinco frascos "caça-mosca", tendo vinagre de vinho tinto a 25% como atrativo, foram semanalmente instalados em dois pomares de laranjeiras da variedade Valência, em Águas de Chapecó e Chapecó, no período de outubro de 1999 a setembro de 2001. As moscas capturadas nas armadilhas foram triadas no Laboratório de Fitossanidade da Epagri de Chapecó. Análises de correlação e regressão polinomial foram realizadas entre o número mensal de moscas do gênero Anastrepha e os dados mensais de precipitação pluviométrica, insolação, umidade relativa do ar, velocidade do vento e temperatura ambiente. Temperatura máxima e mínima mostraram interferir na população destas moscas mais do que os outros fatores climáticos. O número mensal acumulado de moscas capturadas foi submetido à análise de regressão não linear, que revelou picos de captura destes insetos de março a junho. Anastrepha fraterculus (Wiedemann, 1830 predominou sobre outras espécies de moscas-das-frutas.Fruit flies (Diptera, Tephritidae cause economic damages in many fruit orchards. To know the population fluctuation of these flies in Citrus orchards in the west of Santa Catarina, Brazil, and to study the environmental factor interferences on these insects, five traps with 25% vinegar were weekly installed in two orange Valência variety orchards, in Águas de Chapecó and Chapecó, from October of 1999 to September of 2001. The samples of flies trap captured were counted at Epagri Fitossanity Laboratory in Chapecó. A correlation and regression polynomial analyses between flies monthly captured of genus Anastrepha and monthly datas of rain precipitation, isolation, air humidity, wind speed

  15. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  16. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  17. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  18. Review of magnetostrictive transducers (MsT) utilizing reversed Wiedemann effect

    Science.gov (United States)

    Vinogradov, Sergey; Cobb, Adam; Light, Glenn

    2017-02-01

    Magnetostrictive transduction has been widely utilized in NDE applications, specifically for generation and reception of guided waves for long-range inspection of components such as pipes, vessels, and small tubes. Transverse-motion guided wave modes (e.g., torsional vibrations in pipes) are the most typical choice for long-range inspection applications because the wave motion is in the plane of the structure. Magnetostrictive-based sensors have been available for several years for these wave modes based on the Wiedemann effect. For these sensors, a permanent magnetic bias is applied that is perpendicular to the direction of the propagated guided wave. This bias field strains the material that the guided wave is generated in preferentially in the desired particle motion direction. A time-varying magnetic field oriented parallel to the direction of guided wave propagation is also induced in the material. This time-varying field is induced using an electric coil located near the material surface. The interaction of these two fields produces the guided waves; an inverse effect is used for the receive process. An alternative configuration of a sensor for generating and receiving these traverse-motion guided waves is to swap the biasing and time-varying magnetic fields directions. Since transverse-motion guided wave sensors are typically much longer in the particle motion direction than in the bias field direction, the net effect of this alternative design is that the magnetic biasing length is shorter and different coil designs can be used. Because of this, the alternative design, known as a magnetostrictive transducer (MsT), exhibits a number of unique features compared to the Wiedemann sensor described above, such as: 1) the ability to use smaller rare earth permanent magnets and achieve uniform and self-sustained bias field strengths, 2) the choice of more efficient electric coil arrangements to induce a stronger time-varying magnetic field for a given coil

  19. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  20. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  1. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  2. Germline mutation in NLRP2 (NALP2 in a familial imprinting disorder (Beckwith-Wiedemann Syndrome.

    Directory of Open Access Journals (Sweden)

    Esther Meyer

    2009-03-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a fetal overgrowth and human imprinting disorder resulting from the deregulation of a number of genes, including IGF2 and CDKN1C, in the imprinted gene cluster on chromosome 11p15.5. Most cases are sporadic and result from epimutations at either of the two 11p15.5 imprinting centres (IC1 and IC2. However, rare familial cases may be associated with germline 11p15.5 deletions causing abnormal imprinting in cis. We report a family with BWS and an IC2 epimutation in which affected siblings had inherited different parental 11p15.5 alleles excluding an in cis mechanism. Using a positional-candidate gene approach, we found that the mother was homozygous for a frameshift mutation in exon 6 of NLRP2. While germline mutations in NLRP7 have previously been associated with familial hydatidiform mole, this is the first description of NLRP2 mutation in human disease and the first report of a trans mechanism for disordered imprinting in BWS. These observations are consistent with the hypothesis that NLRP2 has a previously unrecognised role in establishing or maintaining genomic imprinting in humans.

  3. Selection of a Bacillus pumilus strain highly active against Ceratitis capitata (Wiedemann) larvae.

    Science.gov (United States)

    Molina, C Alfonso; Caña-Roca, Juan F; Osuna, Antonio; Vilchez, Susana

    2010-03-01

    Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the Mediterranean fruit fly (medfly), is one of the most important fruit pests worldwide. The medfly is a polyphagous species that causes losses in many crops, which leads to huge economic losses. Entomopathogenic bacteria belonging to the genus Bacillus have been proven to be safe, environmentally friendly, and cost-effective tools to control pest populations. As no control method for C. capitata based on these bacteria has been developed, isolation of novel strains is needed. Here, we report the isolation of 115 bacterial strains and the results of toxicity screening with adults and larvae of C. capitata. As a result of this analysis, we obtained a novel Bacillus pumilus strain, strain 15.1, that is highly toxic to C. capitata larvae. The toxicity of this strain for C. capitata was related to the sporulation process and was observed only when cultures were incubated at low temperatures before they were used in a bioassay. The mortality rate for C. capitata larvae ranged from 68 to 94% depending on the conditions under which the culture was kept before the bioassay. Toxicity was proven to be a special characteristic of the newly isolated strain, since other B. pumilus strains did not have a toxic effect on C. capitata larvae. The results of the present study suggest that B. pumilus 15.1 could be considered a strong candidate for developing strategies for biological control of C. capitata.

  4. Silver-Russell Syndrome and Beckwith-Wiedemann Syndrome: Opposite Phenotypes with Heterogeneous Molecular Etiology

    Science.gov (United States)

    Õunap, Katrin

    2016-01-01

    Silver-Russell syndrome (SRS) and Beckwith-Wiedemann syndrome (BWS) are 2 clinically opposite growth-affecting disorders belonging to the group of congenital imprinting disorders. The expression of both syndromes usually depends on the parental origin of the chromosome in which the imprinted genes reside. SRS is characterized by severe intrauterine and postnatal growth retardation with various additional clinical features such as hemihypertrophy, relative macrocephaly, fifth finger clinodactyly, and triangular facies. BWS is an overgrowth syndrome with many additional clinical features such as macroglossia, organomegaly, and an increased risk of childhood tumors. Both SRS and BWS are clinically and genetically heterogeneous, and for clinical diagnosis, different diagnostic scoring systems have been developed. Six diagnostic scoring systems for SRS and 4 for BWS have been previously published. However, neither syndrome has common consensus diagnostic criteria yet. Most cases of SRS and BWS are associated with opposite epigenetic or genetic abnormalities in the 11p15 chromosomal region leading to opposite imbalances in the expression of imprinted genes. SRS is also caused by maternal uniparental disomy 7, which is usually identified in 5-10% of the cases, and is therefore the first imprinting disorder that affects 2 different chromosomes. In this review, we describe in detail the clinical diagnostic criteria and scoring systems as well as molecular causes in both SRS and BWS. PMID:27587987

  5. Taste and speech following surgical tongue reduction in children with Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Maas, Saskia M; Kadouch, Daniel J; Masselink, Anne-Claire C M; Van Der Horst, Chantal M A M

    2016-06-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth disorder in which macroglossia is one of the main signs. We investigated the long-term outcome of tongue surgery reduction (TRS) on taste and speech in patients with BWS who were more than 5 years of age and had undergone surgical anterior wedge resection of the tongue. A questionnaire was used to assess medical history and to determine some aspects of speech, taste, psychological well-being, and degree of satisfaction with regard to TRS and tongue mobility. Speech sound error pattern and degree of intelligibility were measured by a speech therapist, and taste was assessed using a validated test. The degree of both intelligibility and satisfaction with the surgery was high. There were some speech errors; especially the interdental 's', addental 't', and addental 'd' were more noticed. We conclude that anterior wedge resection is an effective technique to treat macroglossia in children with BWS, and that it has no long-term consequences for intelligibility and taste perception and only limited consequences for speech.

  6. Introducción y producción en laboratorio de Diachasmimorpha tryon i y Diachasmimorpha longicaudata (Hymenoptera: Braconidae para el control biológico de Ceratitis capitata (Diptera: Tephritidae en la Argentina Introduction and laboratory production of Diachasmimorpha tryoni and Diachasmimorpha longicaudata (Hymenoptera: Braconidae for the biological control of Ceratitis capitata (Diptera: Tephritidae in Argentina

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2003-12-01

    Full Text Available Con el propósito de reanudar la utilización de enemigos naturales contra la especie exótica Ceratitis capitata (Wiedemann, fueron introducidos a la Argentina en 1999 los agentes de control biológico Diachasmimorpha tryoni (Cameron y Diachasmimorpha longicaudata (Ashmead, dos endoparasitoides de larvas de tefrítidos. Por este motivo, en este trabajo se describen los procedimientos de cría en laboratorio del huésped y de ambas especies de parasitoides y, se presentan y discuten los resultados de un año de producción de D. tryoni y D. longicaudata a mediana escala (enero-diciembre/2000. Se realizó un análisis comparativo de los datos obtenidos sobre la producción de descendientes, proporción sexual, porcentaje de parasitismo y viabilidad de puparios por jaula de cría durante 15 generaciones entre ambas especies de parasitoides exóticos, utilizando como huésped larvas de C. capitata del tercer estadio de siete días de edad. Además, se discuten las posibilidades para implementar el control biológico aumentativo contra C. capitata y Anastrepha fraterculus (Wiedemann en el país.The biocontrol agents Diachasmimorpha tryoni (Cameron and Diachasmimorpha longicaudata (Ashmead, two endoparasitoids of fruit fly larvae, were introduced to Argentina in 1999 with the purpose of renewing the employment of natural enemies against Ceratitis capitata (Wiedemann. For this reason, the general procedure and maintenance of the host and parasitoids rearing in the laboratory are described, and the results of one year insectary production (January-December/2000 of both D. tryoni and D. longicaudata are discussed. Data are presented of the progeny production, offpring sex ratio, host parasitism percentage, and pupal viability per parasitoid rearing cage during 15 generations of D. longicaudata and D. tryoni reared using late third instar larvae of C. capitata. New perspectives are discussed on the establishment of a biological control program for C

  7. Índice de infestação e diversidade de moscas-das-frutas em hospedeiros exóticos e nativos no pólo de fruticultura de Anagé, BA Index of infestation and diversity of fruit-flies in exotic hosts native to the fruitculture area in Anagé, Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2008-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são os principais entraves às exportações de manga nos pólos de fruticultura da Região Sudoeste da Bahia. O presente trabalho teve como objetivo estudar índices de infestação e a diversidade de moscas-das-frutas no pólo de fruticultura de Anagé, BA, visando obter subsídios para o manejo integrado dessas pragas na mangueira, na região. Os estudos foram realizados em 2004 e 2005, nos municípios de Anagé, Belo Campo e Caraíbas, BA, procedendo-se à coleta de frutos de 21 espécies vegetais, nativas e exóticas, e identificação das espécies de moscas associadas. Estimaram-se os índices de infestação em pupários/kg de fruto e pupários/fruto. Os maiores índices de infestação, em pupários/kg de fruto, ocorreram em serigüela (Spondias purpurea L. com 61,3, juá (Ziziphus joazeiro L., 38,3 e umbu (Spondias tuberosa L., 33,1, considerados hospedeiros primários de Anastrepha fraterculus (Wiedemann e A. obliqua (Macquart. As maiores infestações em pupários/fruto ocorreram em serigüela (0,9; umbu (0,7 e cajarana (Spondias sp. (0,2. Com base no monitoramento larval, registra-se, para as condições do pólo de fruticultura de Anagé, a ocorrência das espécies Anastrepha fraterculus, A. obliqua, A. dissimilis, A. amita, A. distincta, A. sororcula, A. zenildae e Ceratitis capitata. Registram-se, pela primeira vez, as seguintes associações bitróficas: juá com A. fraterculus, A. obliqua, A. dissimilis e A. distincta; e umbu com A. amita e A. sororcula.Fruit-flies (Diptera: Tephritidae are the main hindrance for mango exportation in the fruitculture areas of the Southwestern Region of Bahia. The purpose of the present work was to study the indexes of infestation and diversity of fruit-flies in the fruitculture area of Anagé, BA, in order to obtain subsidies to the integrated management of these pests in mango, in this region. Studies were carried out in 2004 and 2005 in the

  8. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain

  9. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato

    2015-10-01

    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  10. Parasitóides de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) collected in Caldas Novas, Goiás, Brasil

    OpenAIRE

    Carlos Henrique Marchiori; Otacílio Moreira Silva Filho; Francilene Cardoso Alves Fortes; Rélia Rodrigues Brunes; Rauer Ferreira Borges; Patricia Luzia Pereira Gonçalves; Juliana Fischer Laurindo

    2005-01-01

    Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae)em Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoi...

  11. Revision of the genus Macrostomus Wiedemann (Diptera: Empididae: Empidinae: II. The pictipennis species-group Revisão do gênero Macrostomus Wiedemann (Diptera: Empididae: Empidinae: II. O grupo de espécies pictipennis

    Directory of Open Access Journals (Sweden)

    José Albertino Rafael

    2010-09-01

    Full Text Available All species of Macrostomus Wiedemann allied with Macrostomus pictipennis (Bezzi, are treated in the pictipennis species-group. Three currently recognized species and four new species are included, namely M. cervicicauda Smith, M. cysticercus Smith, M. manauara, sp. nov. from Brazil (Amazonas and Pará states, M. pacaraima, sp. nov. from Brazil (Roraima, Amazonas and Pará states, M. pictipennis (Bezzi, M. smithi, sp. nov. from Guyana and Brazil (Roraima State and M. utinga, sp. nov. from Brazil (Pará State. All primary types were examined and a key to species is presented.As espécies de Macrostomus Wiedemann afins de Macrostomus pictipennis (Bezzi estão sendo tratadas no grupo M. pictipennis, o qual inclui três espécies já descritas e quarto espécies novas, a saber: M. cervicicauda Smith, M. cysticercus Smith, M. manauara, sp. nov. do Brasil (Amazonas e Pará, M. pictipennis (Bezzi, M. smithi, sp. nov. da Guiana e Brasil (Roraima, M. utinga, sp. nov. do Brasil (Pará e M. pacaraima, sp. nov. do Brasil (Roraima, Amazonas e Pará. Todos os tipos primários foram examinados e uma chave para espécie é apresentada.

  12. Hyperinsulinemic hypoglycemia in Beckwith-Wiedemann syndrome due to defects in the function of pancreatic beta-cell adenosine triphosphate-sensitive potassium channels

    DEFF Research Database (Denmark)

    Hussain, K; Cosgrove, K E; Shepherd, R M

    2005-01-01

    Beckwith-Wiedemann syndrome (BWS) is a congenital overgrowth syndrome that is clinically and genetically heterogeneous. Hyperinsulinemic hypoglycemia occurs in about 50% of children with BWS and, in the majority of infants, it resolves spontaneously. However, in a small group of patients the hypo......Beckwith-Wiedemann syndrome (BWS) is a congenital overgrowth syndrome that is clinically and genetically heterogeneous. Hyperinsulinemic hypoglycemia occurs in about 50% of children with BWS and, in the majority of infants, it resolves spontaneously. However, in a small group of patients...

  13. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L

    2015-08-01

    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus.

  14. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M

    2015-12-01

    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  15. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses.

    Science.gov (United States)

    Orozco-Dávila, Dina; Adriano-Anaya, Maria de Lourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel

    2015-01-01

    A genetic sexing strain of Anastrepha ludens (Loew), Tapachula-7, was developed by the Mexican Program Against Fruit Flies to produce and release only males in programs where the sterile insect technique (SIT) is applied. Currently, breeding are found at a massive scale, and it is necessary to determine the optimum irradiation dose that releases sterile males with minimum damage to their sexual competitiveness. Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild females and offspring survivorship. The results of the study indicate that irradiation doses have a significant effect on the sexual behavior of males. A reduction of mating capacity was inversely proportional to the irradiation dose of males. It is estimated that a dose of 60 Gy can induce more than 99% sterility in wild females. In all treatments, the degree of offspring fertility was correlated with the irradiation dose of the parents. In conclusion, the results of the study indicate that a dose of 60 Gy can be applied in sterile insect technique release programs. The application of this dose in the new genetic sexing strain of A. ludens is discussed.

  16. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  17. Glosectomía parcial en paciente portador del síndrome de Beckwith-Wiedemann: relato del caso

    Directory of Open Access Journals (Sweden)

    Victor Diniz Borborema dos Santos

    2015-10-01

    Full Text Available El síndrome de Beckwith-Wiedemann es una alteración congénita con diversas manifestaciones clínicas, de entre las cuales las más prevalentes son la macroglosia (97%, el gigantismo (88% y los defectos de la pared abdominal (80%. Ortodónticamente, la mayoría de los pacientes presentan mordida abierta anterior y relación de clase III de Angle. La macroglosia puede causar problemas estéticos y anomalías funcionales relacionadas con el habla, la masticación, fonación, deglución y respiración, con potencial de obstrucción de las vías respiratorias superiores y disminución de la estabilidad del tratamiento ortoquirúrgico. Con el fin de evitar episodios como este, es necesaria la realización de una glosectomía parcial en algunos pacientes. El presente trabajo realiza consideraciones con relación al diagnóstico y tratamiento de la macroglosia y relata el caso clínico de un paciente portador del síndrome de Beckwith-Wiedemann que fue intervenido por medio de glosectomía parcial, utilizando la técnica preconizada por Obwergeser et al. (1964 y que en un postoperatorio de 3 años presentó resultados cosméticos y funcionales satisfactorios.

  18. Taxonomic revision and cladistic analysis of the Neotropical genus Acrochaeta Wiedemann, 1830 (Diptera: Stratiomyidae: Sarginae).

    Science.gov (United States)

    Fachin, Diego Aguilar; Amorim, Dalton De Souza

    2015-11-30

    The Neotropical genus Acrochaeta Wiedemann is revised and a cladistics analysis of the genus based on morphological characters is presented. This paper raises the total number of extant Acrochaeta species from 10 to 14 with the description of nine new species, the synonymy of one species, the transfer of five species to other genera and the transfer of one species of Merosargus to Acrochaeta. The new species described (of which eight are from Brazil and one from Bolivia and Peru) are Acrochaeta asapha nov. sp., A. balbii nov. sp., A. dichrostyla nov. sp., A. polychaeta nov. sp., A. pseudofasciata nov. sp., A. pseudopolychaeta nov. sp., A. rhombostyla nov. sp. A. ruschii nov. sp. and A. stigmata nov. sp. The primary types of all Acrochaeta species were studied at least from photos, when possible with the study of dissected male or female terminalia. A. mexicana Lindner is proposed as a junior synonym of A. flaveola Bigot. M. chalconota (Brauer) comb. nov., M. degenerata (Lindner) comb. nov., M. longiventris (Enderlein) comb. nov. and M. picta (Brauer) comb. nov. are herein transferred from Acrochaeta to Merosargus Loew, and Chrysochlorina elegans (Perty) comb. nov. is transferred from Acrochaeta to Chrysochlorina James. A. convexifrons (McFadden) comb. nov. is transferred from Merosargus to Acrochaeta. The limits of the genus and its insertion in the Sarginae are considered, and an updated generic diagnosis is provided. All species of the genus are redescribed and diagnosed, and illustrated with photos of the habitus, thorax, wing, and drawings of the antenna and male and female terminalia. Distribution maps are provided for the species, along with an identification key for adults of all species. Parsimony analyses were carried out under equal and implied weight. Our matrix includes 43 terminal taxa--of which 26 are outgroup species from four different sargine genera--and 59 adult morphological characters. The phylogenetic analysis supports the monophyly of

  19. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (Diptera;Tephritidae)

    Science.gov (United States)

    Lures based on odors released by hydrolyzed protein were assessed for their attractiveness to Anastrepha obliqua and A. suspensa at three locations in Puerto Rico in August through October 2009. Lures compared included ammonium acetate combined with putrescine, hydrolyzed corn protein (Nulure) with ...

  20. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico

    Science.gov (United States)

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua and A. suspensa at four sites in Guánica, Puerto Rico; one forest fragment in Ponce, Puerto Rico; in a commercial mango orchard in Guayanilla, PR; and an experimental carambola orcha...

  1. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    Science.gov (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  2. Response of Anastrepha suspensa (Diptera: Tepritidae) to white and brown cane, coconut, date, date jaggery and panela sugar solutions with varying degrees of fermentation

    Science.gov (United States)

    We measured the EAG response of Anastrepha suspensa (Loew), the Caribbean fruit fly to six different sugars (white and brown cane, coconut, date, date jaggery and panela sugars). Wild and lab female flies of different physiological states (immature and mature) were tested in dry crystals and 10% su...

  3. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    Science.gov (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  4. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann),Version 2.0

    Science.gov (United States)

    MEDHOST,Version 2.0 is the second revision of:"MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly,Ceratitis capitata(Wiedemann),Version 1.0," which was released in 1998 as a Windows-based executable database and listed all plant species reported as hosts of Medit...

  5. The temporal pattern of mating behavior of the fruit fly, Anastrepha zenildae in the laboratory.

    Science.gov (United States)

    Almeida, Lucia M de; Araújo, Arrilton; Mendes, Norma H D; Souza, João M G A de; Menezes, Alexandre A L

    2011-01-01

    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00-19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5-6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5-7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5-163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation.

  6. Parasitóides de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae collected in Caldas Novas, Goiás, Brasil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori

    2005-12-01

    Full Text Available Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidaeem Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae Paraganaspis egeria Díaz, Gallardo & Walsh., 1996 (Hymenoptera: Figitidae e Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae foram de 4,3, 1,5 0,9 e 0,6%, respectivamente. A porcentagem total de parasitismo observada foi de 7,4%. Relata-se a primeira ocorrência de S. nigra em pupas de F. pusio no Brasil.The aim of this study was to report the insect species parasitizing Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, in Caldas Novas, State of Goiás, between August 2003 and May 2004. Flies were attracted to baits consisting of human feces, bovine liver and fish, with the pupae being isolated by the flotation method, in water, and individually placed in gelatin capsules until the emergence of the flies and/or their parasitoids. The parasitism percentages presented by Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae, Paraganaspis egeria Díaz, Gallardo & Walsh, 1996 (Hymenoptera: Figitidae and Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae were 4.3, 1.5, 0.9 and 0.6%, respectively. The total percentage of parasitism was 7.4%. This study reports the first occurrence of S. nigra in pupae of F. pusio in Brazil.

  7. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  8. Persistent congenital hyperinsulinism in two patients with Beckwith-Wiedemann syndrome due to mosaic uniparental disomy 11p.

    Science.gov (United States)

    Zarate, Yuri A; Shur, Natasha; Robin, Andrew; Garnica, Adolfo D; Quintos, Jose Bernardo; Schaefer, G Bradley

    2014-09-01

    Congenital hyperinsulinism (CHI) is a rare metabolic disease characterized by inappropriate insulin secretion in the presence of hypoglycemia. We describe the clinical presentation and management of congenital hyperinsulinism and persistent hypoglycemia in two infants. Both patients had an initial clinical diagnosis of Beckwith-Wiedemann syndrome (BWS) but normal methylation analysis for LIT1 and H19 status. Both patients were eventually found to have mosaic uniparental disomy 11p diagnosed by single nucleotide polymorphism (SNP) array in DNA isolated from lymphoblasts and fibroblasts, respectively. We report that patients with mosaic BWS are at increased risk for both transient and refractory hypoglycemia that may need aggressive management with diazoxide, octreotide, high glucose infusion rates, and a frequent feeding regime. Our patient experience supports the case for pursuing further testing in patients with features of BWS with normal methylation studies, karyotype, and SNP arrays on blood. The next logical step is SNP array on skin biopsy to rule out mosaicism.

  9. Fibroadenoma in Beckwith-Wiedemann syndrome with paternal uniparental disomy of chromosome 11p15.5.

    Science.gov (United States)

    Takama, Yuichi; Kubota, Akio; Nakayama, Masahiro; Higashimoto, Ken; Jozaki, Kosuke; Soejima, Hidenobu

    2014-12-01

    Herein is described a case of breast fibroadenomas in a 16-year-old girl with Beckwith-Wiedemann syndrome (BWS) and uniparental disomy (UPD) of chromosome 11p15.5. She was clinically diagnosed with BWS and direct closure was performed for an omphalocele at birth. Subtotal and 90% pancreatectomy were performed for nesidioblastosis at the ages 2 months and 8 years, respectively. Bilateral multiple breast fibroadenomas were noted at the age of 16 and 17 years. In this case, paternal UPD of chromosome 11p15.5 was identified on microsatellite marker analysis. The relevant imprinted chromosomal region in BWS is 11p15.5, and UPD of chromosome 11p15 is a risk factor for BWS-associated tumorigenicity. Chromosome 11p15.5 consists of imprinting domains of IGF2, the expression of which is associated with the tumorigenesis of various breast cancers. This case suggests that fibroadenomas occurred in association with BWS.

  10. Brachymeria podagrica (Fabricius (Hymenoptera: Chalcididae as a parasitoid of Chrysomya albiceps (Wiedemann (Diptera: Calliphoridae: first report in Brazil

    Directory of Open Access Journals (Sweden)

    Marchiori C.H.

    2002-01-01

    Full Text Available Este trabalho relata a primeira ocorrência do parasitóide Brachymeria podagrica (Fabricius, 1787 parasitando estádios imaturos de Chrysomya albiceps (Wiedemann (Diptera: Calliphoridae no Brasil. Utilizaram-se armadilhas contendo como isca vísceras de galinha. As pupas foram obtidas pelo método de flutuação. Elas foram colocadas individualmente em cápsulas de gelatina e mantidas até a emergência das moscas e/ou dos parasitóides. Foram obtidas 29 pupas de C. albiceps, quatro das quais emergiram parasitóides. A prevalência de parasitismo foi de 13,7%.

  11. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards.

    Science.gov (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco

    2014-06-01

    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  12. Evaluating the quality of the Mexican fruit-fly, Anastrepha ludens, as host for the parasitoid Melittobia digitata

    Directory of Open Access Journals (Sweden)

    J.M. González

    2013-08-01

    Full Text Available We investigated the presence of Melittobia digitata (Hymenoptera: Eulophidae and its associations with its natural hosts in Veracruz, Mexico. The parasitoid was confirmed to be present and found to attack prepupae of Trypoxylon and Sceliphron (Hymenoptera: Crabronidae and Sphecidae, respectively mud daubers as well as pupae of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae. Since A. ludens is a very important pest of citrus and mango in Mexico and Central America, we evaluated, in laboratory experiments, the quality of A. ludens as host of M. digitata comparing the development of the parasitoid in another unrelated fly species (Sarcophaga [Neobellieria] bullata (Diptera: Sarcophagidae and in mud dauber wasps (Trypoxylon sp. and Sceliphron sp.. The Mexican fruit fly appears to be a good-quality host for M. digitata, and the results are discussed in the context of their possible interest as a natural enemy of A. ludens.

  13. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  14. Selection by mating competitiveness improves the performance of Anastrepha ludens males of the genetic sexing strain Tapachula-7.

    Science.gov (United States)

    Quintero-Fong, L; Toledo, J; Ruiz, L; Rendón, P; Orozco-Dávila, D; Cruz, L; Liedo, P

    2016-10-01

    The sexual performance of Anastrepha ludens males of the Tapachula-7 genetic sexing strain, produced via selection based on mating success, was compared with that of males produced without selection in competition with wild males. Mating competition, development time, survival, mass-rearing quality parameters and pheromone production were compared. The results showed that selection based on mating competitiveness significantly improved the sexual performance of offspring. Development time, survival of larvae, pupae and adults, and weights of larvae and pupae increased with each selection cycle. Differences in the relative quantity of the pheromone compounds (Z)-3-nonenol and anastrephin were observed when comparing the parental males with the F4 and wild males. The implications of this colony management method on the sterile insect technique are discussed.

  15. MONITORAMENTO POPULACIONAL DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE MANGA (Mangifera indica L. NO MUNICÍPIO DE JABOTICABAL – SP

    Directory of Open Access Journals (Sweden)

    Wilson Carlos Pazini

    2013-05-01

    Full Text Available The population monitoring of agricultural pests is an important tool to select the best control methodto be employed in a determined culture. Thus, the objective of this research was analyze the population fluctuation of Anastrepha spp. correlated with the mango tree phenology and the meteorological elements, temperature, relative humidity and pluviometric precipitation. The study was conducted between Mach 2009 to August 2010 in Jaboticabal, SP. For Anastrepha spp. monitoring, we randomly installed five yellow stick traps in an experimental orchard composed by a collection of mango varieties. These traps were replaced every fifteen days and carried to the Laboratory of Ecological Selectivity of the Department of Plant Protection (FCAV/UNESP to evaluate the sampled specimens. The meteorological data were recorded at the FCAV/UNESP Meteorological Station, located approximately 200 m from the study area. The results showed that the greater and more consistent Anastrepha spp. population density is between the spring and summer seasons, particularly related to the mature fruits. A weak positive correlation is observed between maximum temperature (°C and relative humitidy (% when compared with the Anastrepha spp. population density. There is moderate positive correlation between minimum and medium temperatures (°C and accumuluted pluviometric precipitation (mm when compared with the said agricultural pest.O monitoramento populacional de insetos considerados pragas agrícolas constitui uma importante ferramenta para a escolha do melhor método de controle a ser empregado em determinada cultura. Desta forma, o objetivo desta pesquisa foi analisar a flutuação populacional de Anastrepha spp. correlacionada com a fenologia da mangueira e com os elementos meteorológicos, temperatura, umidade relativa e precipitação pluviométrica. O estudo foi desenvolvido no período entre março de 2009 a agosto de 2010 no município de Jaboticabal, SP. Para o

  16. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  17. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  18. Análise de sobrevivência e estimativa de entropia para Sarconesia chlorogaster (Wiedemann (Diptera, Calliphoridae Survival analysis and estimation of entropy of Sarconesia chlorogaster (Wiedemann (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Maurício O. Moura

    1999-01-01

    Full Text Available The life expectancy of Sarconesia chlorogaster (Wiedemann, 1830 reared in artificial diet and controlled temperatures chamber set at 27±1oC, 70±10% RH and 12 hours of photophase was analysed using entropy (H. Entropy (H was used to quantify the distribuition of deaths between ages and then quantify the impact of mortality on life expectancy. The entropy values obtained for males (H=0,245 and females (H=0,299 were intermediary between the theoretical values of H=0,5 and H=0 suggesting a tendency toward rectangular distribuitions in both sexes. The effect of mortality across ali ages on expectation of life was different at each age. For males the highest values were found between days 10 and 20 and between days 15 and 25 for females. This íindings imply that small changes in female mortality will have a greater impact on female life expectancy than will have on male expectation of life.

  19. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  20. Excess functional copy of allele at chromosomal region 11p15 may cause Wiedemann-Beckwith (EMG) syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, T.; Saitoh, S.; Jinno, Y.; Niikawa, N.; Matsumoto, T. [Nagasaki Univ. School of Medicine (Japan); Narahara, K. [Okayama Univ. School of Medicine, Okayama (Japan); Fukushima, Y. [Saitama Children`s Hospital, Iwatsuki (Japan)

    1994-02-15

    Wiedemann-Beckwith syndrome (WBS) is a genetic disorder with overgrowth and predisposition to Wilms` tumor. The putative locus of the gene responsible for this syndrome is assigned to chromosome region 11p15.5, and genomic imprinting in this region has been proposed: the paternally derived gene(s) at 11p15.5 is selectively expressed, while the maternally transmitted gene(s) is inactive. The authors examined 18 patients for the parental origin of their 11p15 regions. DNA polymorphism analyses using 6 loci on chromosome 11 showed that 2 patients with duplications of 11p15 regions from their respective fathers and one from the mother, indicating the transmission of an excessive paternal gene at 11p15 to each patient. The result, together with the previous findings in karyotypically normal or abnormal patients and in overgrowth mouse experiments, are consistent with imprinting hypothesis that overexpression of paternally derived gene(s) at 11p15.5, probably the human insulin-like growth factor II (IFG-II) gene, may cause the phenotype. Total constitutional uniparental paternal disomy (UPD) or segmental UPD for the 6 loci examined of chromosome 11 was not observed in our 12 sporadic patients. In order to explain completely the inheritance of this syndrome in patients with various chromosomal constitutions, the authors propose an alternative imprinting mechanism involving the other locus that may be paternally imprinted and may suppress the expression of this gene. 28 refs., 3 figs., 1 tab.

  1. Genome-wide paternal uniparental disomy as a cause of Beckwith-Wiedemann syndrome associated with recurrent virilizing adrenocortical tumors.

    Science.gov (United States)

    Bertoin, F; Letouzé, E; Grignani, P; Patey, M; Rossignol, S; Libé, R; Pasqual, C; Lardière-Deguelte, S; Hoeffel-Fornes, C; Gaillard, D; Previderè, C; Delemer, B; Lalli, E

    2015-06-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome characterized by fetal macrosomia, macroglossia, and abdominal wall defects. BWS patients are at risk to develop Wilms tumor, neuroblastoma, hepatoblastoma, and adrenal tumors. A young woman with BWS features, but with inconclusive genetic evidence for the disease, came to clinical observation for signs of virilization at the age of 16 years. An adrenocortical tumor was diagnosed and surgically resected. The tumor underwent 2 local relapses that were also surgically treated. The patient was also operated to remove a breast fibroadenoma. SNP arrays were used to analyze chromosome abnormalities in normal and tumor samples from the patient and her parents. The patient presented genome-wide mosaic paternal uniparental disomy (patUPD) both in the adrenocortical and the breast tumors, with different degrees of loss of heterozygosity (LOH). The more recent relapses of the adrenocortical tumor showed a loss of part of chromosome 17p that was absent in the first tumor. Analysis of a skin biopsy sample also showed mosaic patUPD with partial LOH, while no LOH was detected in leukocyte DNA. This case shows that virilizing adrenocortical tumors may be a clinical feature of patients with BWS. The SNP array technology is useful to diagnose genome-wide patUPD mosaicism in BWS patients with an inconclusive molecular diagnosis and underlines the tumorigenic potential of the absence of the maternal genome combined with an excess of the paternal genome.

  2. Imprinted anomalies in fetal and childhood growth disorders: the model of Russell-Silver and Beckwith-Wiedemann syndromes.

    Science.gov (United States)

    Netchine, Irène; Rossignol, Sylvie; Azzi, Salah; Brioude, Fréderic; Le Bouc, Yves

    2012-01-01

    Fetal growth is a complex process. Its restriction is associated with morbidity and long term metabolic consequences. Imprinted genes have a critical role in mammalian fetal growth. The human chromosome 11p15 encompasses two imprinted domains regulated by their own differentially methylated region (DMR), also called Imprinted Control Region (ICR1 at the H19/IGF-2 domain, paternally methylated), and ICR2 at the KCNQ1/CDKN1C domain (maternally methylated). Loss of imprinting at these two domains is implicated in two growth disorders clinically opposite. A loss of DNA methylation (LOM) at ICR1 is identified in over 50% of patients with Russell-Silver syndrome (RSS), characterized by intrauterine and postnatal growth retardation, spared cranial growth, frequent body asymmetry and severe feeding difficulties. Inversely, a gain of methylation at ICR1 is found in 10% of patients with Beckwith-Wiedemann syndrome (BWS), an overgrowth syndrome with an enhanced childhood tumor risk. We have identified over 150 RSS patients with 11p15 LOM allowing long-term follow-up studies and proposal of clinical guidelines. We also found that ∼10% of RSS patients and ∼25% of BWS patients have multilocus LOM at imprinted regions other than ICR1 or ICR2 11p15, respectively. Recent studies have identified cis-acting regulatory elements and trans-acting factors involved in the regulation of 11p15 imprinting, establishing new potential mechanisms of RSS and BWS.

  3. Beckwith-Wiedemann syndrome and pseudohypoparathyroidism type Ib in a patient with multilocus imprinting disturbance: a female-dominant phenomenon?

    Science.gov (United States)

    Sano, Shinichiro; Matsubara, Keiko; Nagasaki, Keisuke; Kikuchi, Toru; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fukami, Maki; Kagami, Masayo; Ogata, Tsutomu

    2016-08-01

    Although recent studies have often revealed the presence of multilocus imprinting disturbance (MLID) at differentially methylated regions (DMRs) in patients with imprinting disorders (IDs), most patients exhibit clinical features of the original ID only. Here we report a Japanese female patient with Beckwith-Wiedemann syndrome and pseudohypoparathyroidism type Ib. Molecular studies revealed marked methylation defects (MDs) at the Kv-DMR and the GNAS-DMRs and variable MDs at four additional DMRs, in the absence of a mutation in ZFP57, NLRP2, NLRP7, KHDC3L and NLRP5. It is likely that the MDs at the Kv-DMR and the GNAS-DMRs were sufficient to cause clinically recognizable IDs, whereas the remaining MDs were insufficient to result in clinical consequences or took place at DMRs with no disease-causing imprinted gene(s). The development of MLID and the two IDs of this patient may be due to a mutation in a hitherto unknown gene for MLID, or to a reduced amount of DNA methyltransferase-1 (DNMT1) available for the methylation maintenance of DMRs because of the consumption of DNMT1 by the maintenance of X-inactivation. In support of the latter possibility, such co-existence of two IDs has primarily been identified in female patients, and MLID has predominantly been identified as loss of methylations.

  4. Hypopituitarism in a patient with Beckwith-Wiedemann syndrome due to hypomethylation of KvDMR1.

    Science.gov (United States)

    Baiocchi, Michela; Yousuf, Fatimah Sireen; Hussain, Khalid

    2014-04-01

    Beckwith-Wiedemann syndrome (BWS) is caused by dysregulation of imprinted genes on chromosome 11.p15.5. The syndrome includes overgrowth, macroglossia, organomegaly, abdominal wall defects, hypoglycemia, and long-term malignancy risk. No patient who has BWS has been reported with hypopituitarism. We describe a patient who presented at birth with macrosomia, macroglossia, respiratory distress, jaundice, and hypoglycemia, and who was followed for 4.5 years. Genetic test for BWS was performed, which detected loss of maternal methylation on region KvDMR1 (11p15.5). The hypoglycemia was attributable to hyperinsulinism and was treated with diazoxide and chlorothiazide. She responded well, but the hypoglycemia returned after reducing the diazoxide. It was possible to stop the diazoxide after 2.5 years. On routine follow-up she was noted to be developing short stature. Baseline pituitary and growth hormone (GH) stimulation tests detected GH deficiency and secondary hypothyroidism. A brain MRI showed a small anterior pituitary gland. Thereafter, thyroxine and replacement therapy with GH were started, which resulted in a remarkable improvement in growth velocity. This is the first patient to be reported as having hypopituitarism and BWS. It is unclear if the BWS and the hypopituitarism are somehow connected; however, further investigations are necessary. Hypopituitarism explains the protracted hypoglycemia and the short stature. In our patient, GH therapy seems to be safe, but strict follow-up is required given the increased cancer risk related to BWS.

  5. MACROGLOSSIA AS A CAUSE OF ATYPICAL SWALLOWING: COMPARISON OF EVALUATION AND LOGOPEDIC TREATMENT BETWEEN BECKWITH-WIEDEMANN AND DOWN PATIENTS

    Directory of Open Access Journals (Sweden)

    C. Anichini

    2013-12-01

    Full Text Available Atypical swallowing is the persistence of childlike deglutition at the end of dental eruption. One of the main causes is macroglossia, that is the abnormal enlargement of the tongue. The treatment is logopedic and/or surgical. Children with macroglossia have an increased incidence of respiratory diseases and infections, as well as malocclusions, articulatory defects and aesthetic damage. In this study we focused on two genetic syndromes with macroglossia: Beckwith-Wiedemann Syndrome (BWS and Down Syndrome (DS: 7 patients were evaluated for logopedic treatment: 3 are affected by BWS, 2 are affected by DS. In addition, 2 patients with isolated atypical swallowing were included in the study to emphasize problems connected with atypical swallowing. All the patients underwent a global examination and a personalized logopedic therapy scheme was planned. With the exception of one of them who was lost to follow up and who did not continue with the exercises the speech therapist had recommended, all the children showed good response and compliance with remarkable improvements, thus proving the importance of an early, constant and intensive logopedic treatment.

  6. Clinical and molecular analyses of Beckwith-Wiedemann syndrome: Comparison between spontaneous conception and assisted reproduction techniques.

    Science.gov (United States)

    Tenorio, Jair; Romanelli, Valeria; Martin-Trujillo, Alex; Fernández, García-Moya; Segovia, Mabel; Perandones, Claudia; Pérez Jurado, Luis A; Esteller, Manel; Fraga, Mario; Arias, Pedro; Gordo, Gema; Dapía, Irene; Mena, Rocío; Palomares, María; Pérez de Nanclares, Guiomar; Nevado, Julián; García-Miñaur, Sixto; Santos-Simarro, Fernando; Martinez-Glez, Víctor; Vallespín, Elena; Monk, David; Lapunzina, Pablo

    2016-10-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome characterized by an excessive prenatal and postnatal growth, macrosomia, macroglossia, and hemihyperplasia. The molecular basis of this syndrome is complex and heterogeneous, involving genes located at 11p15.5. BWS is correlated with assisted reproductive techniques. BWS in individuals born following assisted reproductive techniques has been found to occur four to nine times higher compared to children with to BWS born after spontaneous conception. Here, we report a series of 187 patients with to BWS born either after assisted reproductive techniques or conceived naturally. Eighty-eight percent of BWS patients born via assisted reproductive techniques had hypomethylation of KCNQ1OT1:TSS-DMR in comparison with 49% for patients with BWS conceived naturally. None of the patients with BWS born via assisted reproductive techniques had hypermethylation of H19/IGF2:IG-DMR, neither CDKN1 C mutations nor patUPD11. We did not find differences in the frequency of multi-locus imprinting disturbances between groups. Patients with BWS born via assisted reproductive techniques had an increased frequency of advanced bone age, congenital heart disease, and decreased frequency of earlobe anomalies but these differences may be explained by the different molecular background compared to those with BWS and spontaneous fertilization. We conclude there is a correlation of the molecular etiology of BWS with the type of conception. © 2016 Wiley Periodicals, Inc.

  7. Levantamento de moscas-das-frutas e seus parasitoides em citros, no município de Viçosa, Minas Gerais Survey of fruit-flies and their parasitoids in citrus in Viçosa, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Daniel Lucas Magalhães Machado

    2012-12-01

    Full Text Available As moscas-das-frutas são responsáveis por grandes perdas em fruteiras comerciais no Brasil, por isso é fundamental conhecer as espécies predominantes na região. Objetivou-se com este trabalho estudar a ocorrência de moscas-das-frutas (Diptera: Tephritidae e seus parasitoides em laranjas doces (Citrus sinensis L. Osbeck, tangerina Poncã (Citrus reticulata Blanco e mexerica Rio (Citrus deliciosa Ten, no município de Viçosa, Minas Gerais. Os frutos foram coletados em abril de 2008. No laboratório eles foram acondicionados em caixas plásticas contendo areia umedecida e em ambiente controlado para obtenção dos pupários, que foram contados, acondicionados em frascos de vidro com areia fina e mantidos em estufa até a emergência dos adultos. Somente uma espécie de mosca-das-frutas (Anastrepha fraterculus (Wiedemann, 1830 e uma de parasitoide (Doryctobracon brasiliensis Szépligeti foram identificadas. Dentre as variedades, a laranja doce Baianinha apresentou o maior índice de infestação, e os menores foram atribuídos à mexerica Rio e à tangerina Poncã.Fruit flies are responsible for large losses in commercial orchards in Brazil, thus, it is important to know the predominant species in the region. The objective of this study was to study the occurrence of fruit flies (Diptera: Tephritoidae and of their parasitoids in sweet orange (Citrus sinensis L. Osbeck, 'Poncã' mandarin (Citrus reticulate Blanco and 'Rio' tangerine (Citrus deliciosa Ten, in Viçosa, Minas Gerais. The fruits were collected in April 2008. In the laboratory, the fruits were stored in plastic boxes containing moist sand in a controlled environment, to obtain pupae. Then, the pupae were counted, placed in glass bottles with fine sand and kept in an oven until adult emergence. Only one species of fruit fly (Anastrepha fraterculus (Wiedemann, 1830 and one species of parasitoid (Doryctobracon brasiliensis Szépligeti were identified. Among the varieties, the sweet

  8. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira

    2006-03-01

    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  9. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  10. Study of some biological aspects of the blowfly Chrysomya albiceps (Wiedemann 1819 (Diptera: Calliphoridae in Jeddah, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Layla A.H. Al-Shareef

    2016-03-01

    Full Text Available We reared Chrysomya albiceps (Wiedemann 1819 unadult stages (first larval instar, second larval instar, third larval instar and pupal stage under four constant temperatures. Results proved that increasing temperature from 20 to 25, 30 and 35 °C reduced total larval stage duration (9–6, 4.83 and 4.75 days, respectively and pupal duration (7, 5.5, 4 and 1.5 days, respectively. C. albiceps larvae at first instar reached adult stage in the longest time at 20 °C (16 days, and in the shortest time at 35 °C (6.25 days. The accumulation degree-day (ADD at 20, 25, 30, 35 °C for first larval instar were 8.86, 13.86, 18.86, 23.86 DD, for second larval instar were 10.5, 12, 17, 22 DD and for third larval instar were 35.88, 42.08, 43.97, 56.43 DD. Heat requirements for larval stage at different temperatures; 20, 25, 30 and 35 °C (49.68, 63.12, 75.01 and 97.47 DD were more than the pupal requirements at the same temperatures (39.78, 58.76, 62.73 and 31.02 DD. Total heat requirements for C. albiceps to develop from the first larval instar to adult eclosion were the lowest at 20 °C (89.46 DD and the highest at 30 °C (129.138 DD. Decreasing of temperature increased larval body length at the same age. The development curves for C. albiceps were established at four constant temperatures using larval length and the time since egg hatching.

  11. Beckwith–Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques

    Science.gov (United States)

    Romanelli, Valeria; Meneses, Heloisa N M; Fernández, Luis; Martínez-Glez, Victor; Gracia-Bouthelier, Ricardo; F Fraga, Mario; Guillén, Encarna; Nevado, Julián; Gean, Esther; Martorell, Loreto; Marfil, Victoria Esteban; García-Miñaur, Sixto; Lapunzina, Pablo

    2011-01-01

    Beckwith–Wiedemann syndrome (BWS) is a phenotypically and genotypically heterogeneous overgrowth syndrome characterized by somatic overgrowth, macroglossia and abdominal wall defects. Other usual findings are hemihyperplasia, embryonal tumours, adrenocortical cytomegaly, ear anomalies, visceromegaly, renal abnormalities, neonatal hypoglycaemia, cleft palate, polydactyly and a positive family history. BWS is a complex, multigenic disorder associated, in up to 90% of patients, with alteration in the expression or function of one or more genes in the 11p15.5 imprinted gene cluster. There are several molecular anomalies associated with BWS and the large proportion of cases, about 85%, is sporadic and karyotypically normal. One of the major categories of BWS molecular alteration (10–20% of cases) is represented by mosaic paternal uniparental disomy (pUPD), namely patients with two paternally derived copies of chromosome 11p15 and no maternal contribution for that. In these patients, in addition to the effects of IGF2 overexpression, a decreased level of the maternally expressed gene CDKN1C may contribute to the BWS phenotype. In this paper, we reviewed a series of nine patients with BWS because of pUPD using several methods with the aim to evaluate the percentage of mosaicism, the methylation status at both loci, the extension of the pUPD at the short arm and the breakpoints of recombination. Fine mapping of mitotic recombination breakpoints by single-nucleotide polymorphism-array in individuals with UPD and fine estimation of epigenetic defects will provide a basis for understanding the aetiology of BWS, allowing more accurate prognostic predictions and facilitating management and surveillance of individuals with this disorder. PMID:21248736

  12. Genome-wide paternal uniparental disomy mosaicism in a woman with Beckwith-Wiedemann syndrome and ovarian steroid cell tumour.

    Science.gov (United States)

    Gogiel, Magdalena; Begemann, Matthias; Spengler, Sabrina; Soellner, Lukas; Göretzlehner, Ulf; Eggermann, Thomas; Strobl-Wildemann, Gertrud

    2013-07-01

    Uniparental disomy (UPD) of single chromosomes is a well-known molecular aberration in a group of congenital diseases commonly known as imprinting disorders (IDs). Whereas maternal and/or paternal UPD of chromosomes 6, 7, 11, 14 and 15 are associated with specific IDs (Transient neonatal diabetes mellitus, Silver-Russell syndrome, Beckwith-Wiedemann syndrome (BWS), upd(14)-syndromes, Prader-Willi syndrome, Angelman Syndrome), the other autosomes are not. UPD of the whole genome is not consistent with life, in case of non-mosaic genome-wide paternal UPD (patUPD) it leads to hydatidiform mole. In contrast, mosaic genome-wide patUPD might be compatible with life. Here we present a 19-year-old woman with BWS features and initially diagnosed to be carrier of a mosaic patUPD of chromosome 11p15. However, the patient presented further clinical findings not typically associated with BWS, including nesidioblastosis, fibroadenoma, hamartoma of the liver, hypoglycaemia and ovarian steroid cell tumour. Additional molecular investigations revealed a mosaic genome-wide patUPD. So far, only nine cases with mosaic genome-wide patUPD and similar clinical findings have been reported, but these patients were nearly almost diagnosed in early childhood. Summarising the data from the literature and those from our patient, it can be concluded that the mosaic genome-wide patUPD (also known as androgenic/biparental mosaicism) might explain unusual BWS phenotypes. Thus, these findings emphasise the need for multilocus testing in IDs to efficiently detect cases with disturbances affecting more than one chromosome.

  13. Beckwith-Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques.

    Science.gov (United States)

    Romanelli, Valeria; Meneses, Heloisa N M; Fernández, Luis; Martínez-Glez, Victor; Gracia-Bouthelier, Ricardo; F Fraga, Mario; Guillén, Encarna; Nevado, Julián; Gean, Esther; Martorell, Loreto; Marfil, Victoria Esteban; García-Miñaur, Sixto; Lapunzina, Pablo

    2011-04-01

    Beckwith-Wiedemann syndrome (BWS) is a phenotypically and genotypically heterogeneous overgrowth syndrome characterized by somatic overgrowth, macroglossia and abdominal wall defects. Other usual findings are hemihyperplasia, embryonal tumours, adrenocortical cytomegaly, ear anomalies, visceromegaly, renal abnormalities, neonatal hypoglycaemia, cleft palate, polydactyly and a positive family history. BWS is a complex, multigenic disorder associated, in up to 90% of patients, with alteration in the expression or function of one or more genes in the 11p15.5 imprinted gene cluster. There are several molecular anomalies associated with BWS and the large proportion of cases, about 85%, is sporadic and karyotypically normal. One of the major categories of BWS molecular alteration (10-20% of cases) is represented by mosaic paternal uniparental disomy (pUPD), namely patients with two paternally derived copies of chromosome 11p15 and no maternal contribution for that. In these patients, in addition to the effects of IGF2 overexpression, a decreased level of the maternally expressed gene CDKN1C may contribute to the BWS phenotype. In this paper, we reviewed a series of nine patients with BWS because of pUPD using several methods with the aim to evaluate the percentage of mosaicism, the methylation status at both loci, the extension of the pUPD at the short arm and the breakpoints of recombination. Fine mapping of mitotic recombination breakpoints by single-nucleotide polymorphism-array in individuals with UPD and fine estimation of epigenetic defects will provide a basis for understanding the aetiology of BWS, allowing more accurate prognostic predictions and facilitating management and surveillance of individuals with this disorder.

  14. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  15. Single cell analysis demonstrating somatic mosaicism involving 11p in a patient with paternal isodisomy and Beckwith-Wiedemann Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Bischoff, F.Z.; McCaskill, C.; Subramanian, S. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Beckwith-Wiedemann Syndrome (BWS) is characterized by numerous growth abnormalities including exomphalos, macroglossia, gigantism, and hemihypertrophy or hemihyperplasia. The {open_quotes}BWS gene{close_quotes} appears to be maternally repressed and is suspected to function as a growth factor or regulator of somatic growth, since activation of this gene through a variety of mechanisms appears to result in somatic overgrowth and tumor development. Mosaic paternal isodisomy of 11p has been observed previously by others in patients with BWS by Southern blot analysis of genomic DNA. The interpretation of these results was primarily based on the intensities of the hybridization signals for the different alleles. In our study, we demonstrate somatic mosaicism directly through PCR and single cell analysis. Peripheral blood was obtained from a patient with BWS and initial genomic DNA analysis by PCR was suggestive of somatic mosaicism for paternal isodisomy of 11p. Through micromanipulation, single cells were isolated and subjected to primer extention preamplification. Locus-specific microsatellite marker analyses by PCR were performed to determine the chromosome 11 origins in the preamplified individual cells. Two populations of cells were detected, a population of cells with normal biparental inheritance and a population of cells with paternal isodisomy of 11p and biparental disomy of 11q. Using the powerful approach of single cell analysis, the detected somatic mosaicism provides evidence for a mitotic recombinational event that has resulted in loss of the maternal 11p region and gain of a second copy of paternal 11p in some cells. The direct demonstration of mosaicism may explain the variable phenotypes and hemihypertrophy often observed in BWS.

  16. Prenatal molecular testing for Beckwith-Wiedemann and Silver-Russell syndromes: a challenge for molecular analysis and genetic counseling.

    Science.gov (United States)

    Eggermann, Thomas; Brioude, Frédéric; Russo, Silvia; Lombardi, Maria P; Bliek, Jet; Maher, Eamonn R; Larizza, Lidia; Prawitt, Dirk; Netchine, Irène; Gonzales, Marie; Grønskov, Karen; Tümer, Zeynep; Monk, David; Mannens, Marcel; Chrzanowska, Krystyna; Walasek, Malgorzata K; Begemann, Matthias; Soellner, Lukas; Eggermann, Katja; Tenorio, Jair; Nevado, Julián; Moore, Gudrun E; Mackay, Deborah Jg; Temple, Karen; Gillessen-Kaesbach, Gabriele; Ogata, Tsutomu; Weksberg, Rosanna; Algar, Elizabeth; Lapunzina, Pablo

    2016-06-01

    Beckwith-Wiedemann and Silver-Russell syndromes (BWS/SRS) are two imprinting disorders (IDs) associated with disturbances of the 11p15.5 chromosomal region. In BWS, epimutations and genomic alterations within 11p15.5 are observed in >70% of patients, whereas in SRS they are observed in about 60% of the cases. In addition, 10% of the SRS patients carry a maternal uniparental disomy of chromosome 7 11p15.5. There is an increasing demand for prenatal testing of these disorders owing to family history, indicative prenatal ultrasound findings or aberrations involving chromosomes 7 and 11. The complex molecular findings underlying these disorders are a challenge not only for laboratories offering these tests but also for geneticists counseling affected families. The scope of counseling must consider the range of detectable disturbances and their origin, the lack of precise quantitative knowledge concerning the inheritance and recurrence risks for the epigenetic abnormalities, which are hallmarks of these developmental disorders. In this paper, experts in the field of BWS and SRS, including members of the European network of congenital IDs (EUCID.net; www.imprinting-disorders.eu), put together their experience and work in the field of 11p15.5-associated IDs with a focus on prenatal testing. Altogether, prenatal tests of 160 fetuses (122 referred for BWS, 38 for SRS testing) from 5 centers were analyzed and reviewed. We summarize the current knowledge on BWS and SRS with respect to diagnostic testing, the consequences for prenatal genetic testing and counseling and our cumulative experience in dealing with these disorders.

  17. Multiple genetic loci within 11p15 defined by Beckwith-Wiedemann syndrome rearrangement breakpoints and subchromosomal transferable fragments.

    Science.gov (United States)

    Hoovers, J M; Kalikin, L M; Johnson, L A; Alders, M; Redeker, B; Law, D J; Bliek, J; Steenman, M; Benedict, M; Wiegant, J

    1995-01-01

    Beckwith-Wiedemann syndrome (BWS) involves fetal overgrowth and predisposition to a wide variety of embryonal tumors of childhood. We have previously found that BWS is genetically linked to 11p15 and that this same band shows loss of heterozygosity in the types of tumors to which children with BWS are susceptible. However, 11p15 contains > 20 megabases, and therefore, the BWS and tumor suppressor genes could be distinct. To determine the precise physical relationship between these loci, we isolated yeast artificial chromosomes, and cosmid libraries from them, within the region of loss of heterozygosity in embryonal tumors. Five germ-line balanced chromosomal rearrangement breakpoint sites from BWS patients, as well as a balanced chromosomal translocation breakpoint from a rhabdoid tumor, were isolated within a 295- to 320-kb cluster defined by a complete cosmid contig crossing these breakpoints. This breakpoint cluster terminated approximately 100 kb centromeric to the imprinted gene IGF2 and 100 kb telomeric to p57KIP2, an inhibitor of cyclin-dependent kinases, and was located within subchromosomal transferable fragments that suppressed the growth of embryonal tumor cells in genetic complementation experiments. We have identified 11 transcribed sequences in this BWS/tumor suppressor coincident region, one of which corresponded to p57KIP2. However, three additional BWS breakpoints were > 4 megabases centromeric to the other five breakpoints and were excluded from the tumor suppressor region defined by subchromosomal transferable fragments. Thus, multiple genetic loci define BWS and tumor suppression on 11p15. Images Fig. 1 Fig. 3 PMID:8618920

  18. Desenvolvimento Pós-embrionário de Ophyra aenescens (Wiedemann, 1830 (Diptera: Muscidae em Diferentes Dietas, sob Condições de Laboratório

    Directory of Open Access Journals (Sweden)

    José Mario d'Almeida

    1999-01-01

    Full Text Available Post-embryonic Development of Ophyra aenescens (Wiedemann, 1830 (Diptera: Muscidae, in Different Diets, under Laboratory Conditions - The performance of various diets (bovine meat, fish- sardine, shrimp, dog faeces, and banana in Ophyra aenescens development was evaluated. The biology was studied in an incubator (BOD at 27±1oC and 80±10% of RH. The developmental time from larvae to adult, the developmental time and viability of larvae and pupae, the weight of pupae as well as the sex ratio of the emerging adults were also determined. Beef and shrimp were the more efficient diets for rearing O. aenescens.

  19. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  20. O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o País e novos registros para o grupo holosericeus (Diptera, Asilidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2011-12-01

    Full Text Available O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o país e novos registros para o grupo holosericeus (Diptera, Asilidae. Neste trabalho é descrita uma nova espécie de Ommatius Wiedemann, 1821 para o estado do Amazonas, pertencente ao grupo ampliatus. Além disso, são fornecidos novos registros, variações taxonômicas, ilustrações e descrição das estruturas das terminálias masculina e feminina para as espécies do grupo holosericeus.

  1. Beckwith-Wiedemann综合征九例及随访%Nine Cases of Beckwith-Wiedemann Syndrome and Their Follow-up

    Institute of Scientific and Technical Information of China (English)

    宋家其; 佘亚雄

    1993-01-01

    收治Beckwith-Wiedemann综合征9例,其中7例为新生儿,男7例,女2例.脐膨出为其最突出的畸形.分析其诊断特点及合并畸形,治疗方法首先解决危及生命的病症:低血糖和脐膨出.强调术前认真检查,术后定期随访,以防合并恶性肿瘤.%Nine cases (male 7,female 2) of Beckwith-Wiedemann syndrome included 7 neonates and 2 of five years old.The most common deformity was omphalocele (9 cases).Besides there were PDA (1),prominent malrotation (1),umbilical hernia(2),and Wilms'tumor(1) etc.The treatment of this syndrome is mainly controlling hypoglycemia and repairing omphalocele.Because there is a tendency of malignant change in Beckwith-Wiedemann syndrome,therefore a long-term followed-up should be emphasized.

  2. Chrysomya albiceps (Wiedemann and Hemilucilia segmentaria (Fabricius (Diptera, Calliphoridae used to estimate the postmortem interval in a forensic case in Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Cecília Kosmann

    2011-12-01

    Full Text Available ABSTRACT. Chrysomya albiceps (Wiedemann and Hemilucilia segmentaria (Fabricius (Diptera, Calliphoridae used to estimate the postmortem interval in a forensic case in Minas Gerais, Brazil. The corpse of a man was found in a Brazilian highland savanna (cerrado in the state of Minas Gerais. Fly larvae were collected at the crime scene and arrived at the laboratory three days afterwards. From the eight pre-pupae, seven adults of Chrysomya albiceps (Wiedemann, 1819 emerged and, from the two larvae, two adults of Hemilucilia segmentaria (Fabricius, 1805 were obtained. As necrophagous insects use corpses as a feeding resource, their development rate can be used as a tool to estimate the postmortem interval. The post-embryonary development stage of the immature collected on the body was estimated as the difference between the total development time and the time required for them to become adults in the lab. The estimated age of the maggots from both species and the minimum postmortem interval were four days. This is the first time that H. segmentaria is used to estimate the postmortem interval in a forensic case.

  3. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Calore

    2013-03-01

    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..

  4. Moscas frugívoras e seus parasitoides nos municípios de Pelotas e Capão do Leão, Rio Grande do Sul, Brasil Frugivorous flies and their parasitoids in the cities of Pelotas and Capão do Leão, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2012-01-01

    Full Text Available As moscas frugívoras (Tephritoidea são as principais pragas da fruticultura de clima temperado no Brasil. O objetivo do presente trabalho foi avaliar a infestação desses dípteros e a ocorrência de seus parasitoides em frutíferas nos municípios de Pelotas e Capão do Leão, localizados na região Sul, nas safras agrícolas de 2007/08 e 2008/09. Foram coletados frutos de araçazeiro-amarelo e vermelho (Psidium cattleianum Sabine, 1821, butiazeiro [Butia capitata (Mart. Becc., 1916], caquizeiro (Diospyros kaki Linnaeus, 1753, cerejeira-do-mato (Eugenia involucrata DC., 1828, goiabeira [Psidium guajava (Linnaeus, 1753], goiabeira-serrana [Acca sellowiana (Berg. Burret, 1941], nespereira [Eriobotrya japonica (Thunb. Lindley, 1822], pessegueiro [Prunus persicae (L. Batsch, 1801], pitangueira (Eugenia uniflora Linnaeus,1753 e uvalheira (Eugenia pyriformis Cambessèdes, 1832. Os frutos foram coletados e transportados para o laboratório, onde foram individualizados e determinados os seguintes parâmetros: índice de infestação das moscas, índice de parasitismo e frequência de indivíduos por espécie de parasitoide. Foram constatadas duas espécies de Tephritidae, Anastrepha fraterculus (Wiedemann, 1830 (90,5% e Ceratitis capitata (Wiedemann, 1824 (9,5% e duas de Lonchaeidae, Neosilba zadolicha McAlpine & Steyskal, 1982 (87,8% e uma espécie ainda não descrita, referida como Neosilba n. sp. 3 (12,2%. Anastrepha fraterculus é a espécie mais abundante nos dois municípios, sendo constatada na maioria das frutíferas coletadas. Caquizeiro e goiabeira foram os hospedeiros que apresentaram o maior índice de infestação por C. capitata. Quanto às espécies de Neosilba, a maior infestação ocorreu em frutos de goiabeira-serrana. Dos parasitoides emergidos, foram identificadas três espécies, sendo duas de Braconidae, Doryctobracon areolatus (Szépligeti, 1911 (52,6% e Opius bellus (Gahan, 1930 (27,5% e uma espécie de Figitidae, Aganaspis

  5. IMPROVING MASS REARING TECHNOLOGY FOR SOUTH AMERICAN FRUIT FLY (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-01-01

    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  6. Levantamento de moscas-das-frutas e seus parasitoides em citros, no município de Viçosa, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Daniel Lucas Magalhães Machado

    2012-12-01

    Full Text Available As moscas-das-frutas são responsáveis por grandes perdas em fruteiras comerciais no Brasil, por isso é fundamental conhecer as espécies predominantes na região. Objetivou-se com este trabalho estudar a ocorrência de moscas-das-frutas (Diptera: Tephritidae e seus parasitoides em laranjas doces (Citrus sinensis L. Osbeck, tangerina Poncã (Citrus reticulata Blanco e mexerica Rio (Citrus deliciosa Ten, no município de Viçosa, Minas Gerais. Os frutos foram coletados em abril de 2008. No laboratório eles foram acondicionados em caixas plásticas contendo areia umedecida e em ambiente controlado para obtenção dos pupários, que foram contados, acondicionados em frascos de vidro com areia fina e mantidos em estufa até a emergência dos adultos. Somente uma espécie de mosca-das-frutas (Anastrepha fraterculus (Wiedemann, 1830 e uma de parasitoide (Doryctobracon brasiliensis Szépligeti foram identificadas. Dentre as variedades, a laranja doce Baianinha apresentou o maior índice de infestação, e os menores foram atribuídos à mexerica Rio e à tangerina Poncã.

  7. Assessing the Risk of Invasion by Tephritid Fruit Flies: Intraspecific Divergence Matters.

    Science.gov (United States)

    Godefroid, Martin; Cruaud, Astrid; Rossi, Jean-Pierre; Rasplus, Jean-Yves

    2015-01-01

    Widely distributed species often show strong phylogeographic structure, with lineages potentially adapted to different biotic and abiotic conditions. The success of an invasion process may thus depend on the intraspecific identity of the introduced propagules. However, pest risk analyses are usually performed without accounting for intraspecific diversity. In this study, we developed bioclimatic models using MaxEnt and boosted regression trees approaches, to predict the potential distribution in Europe of six economically important Tephritid pests (Ceratitis fasciventris (Bezzi), Bactrocera oleae (Rossi), Anastrepha obliqua (Macquart), Anastrepha fraterculus (Wiedemann), Rhagoletis pomonella (Walsh) and Bactrocera cucurbitae (Coquillet)). We considered intraspecific diversity in our risk analyses by independently modeling the distributions of conspecific lineages. The six species displayed different potential distributions in Europe. A strong signal of intraspecific climate envelope divergence was observed in most species. In some cases, conspecific lineages differed strongly in potential distributions suggesting that taxonomic resolution should be accounted for in pest risk analyses. No models (lineage- and species-based approaches) predicted high climatic suitability in the entire invaded range of B. oleae-the only species whose intraspecific identity of invading populations has been elucidated-in California. Host availability appears to play the most important role in shaping the geographic range of this specialist pest. However, climatic suitability values predicted by species-based models are correlated with population densities of B. oleae globally reported in California. Our study highlights how classical taxonomic boundaries may lead to under- or overestimation of the potential pest distributions and encourages accounting for intraspecific diversity when assessing the risk of biological invasion.

  8. Assessing the Risk of Invasion by Tephritid Fruit Flies: Intraspecific Divergence Matters.

    Directory of Open Access Journals (Sweden)

    Martin Godefroid

    Full Text Available Widely distributed species often show strong phylogeographic structure, with lineages potentially adapted to different biotic and abiotic conditions. The success of an invasion process may thus depend on the intraspecific identity of the introduced propagules. However, pest risk analyses are usually performed without accounting for intraspecific diversity. In this study, we developed bioclimatic models using MaxEnt and boosted regression trees approaches, to predict the potential distribution in Europe of six economically important Tephritid pests (Ceratitis fasciventris (Bezzi, Bactrocera oleae (Rossi, Anastrepha obliqua (Macquart, Anastrepha fraterculus (Wiedemann, Rhagoletis pomonella (Walsh and Bactrocera cucurbitae (Coquillet. We considered intraspecific diversity in our risk analyses by independently modeling the distributions of conspecific lineages. The six species displayed different potential distributions in Europe. A strong signal of intraspecific climate envelope divergence was observed in most species. In some cases, conspecific lineages differed strongly in potential distributions suggesting that taxonomic resolution should be accounted for in pest risk analyses. No models (lineage- and species-based approaches predicted high climatic suitability in the entire invaded range of B. oleae-the only species whose intraspecific identity of invading populations has been elucidated-in California. Host availability appears to play the most important role in shaping the geographic range of this specialist pest. However, climatic suitability values predicted by species-based models are correlated with population densities of B. oleae globally reported in California. Our study highlights how classical taxonomic boundaries may lead to under- or overestimation of the potential pest distributions and encourages accounting for intraspecific diversity when assessing the risk of biological invasion.

  9. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com

  10. Himenópteros parasitóides de larvas de Anastrepha spp. em frutos de carambola (Averrhoa carambola L. na região de Divinópolis, Minas Gerais, Brasil Himenopterous parasitoids of Anastrepha spp. larvae, in star fruit (Averrhoa carambola L. In divinópolis region, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Cláudio Gonçalves Silva

    2003-12-01

    Full Text Available Este trabalho foi conduzido com o objetivo de conhecer os parasitóides de moscas-da-fruta na região de Divinópolis-MG. As pupas foram obtidas pelo método de flutuação, sendo individualizadas em cápsulas de gelatina até a emergência das moscas adultas ou de seus parasitóides. A prevalência total de parasitismo foi de 14,8%. Trichopria anastrepha foi a espécie mais comum, com 44,5%.The objective of this work was to identify the parasitoids of fruit flies in Divinópolis-MG region. The pupae were obtained by the flotation method. They were individually placed in gelatin capsules until the emergency of the adult flies or their parasitoids. The overall prevalence of parasitism was 14,8%. Trichopria anastrepha was the most common specie with a frequency of 44,5%.

  11. Associação entre larvas de Chrysomya megacephala (Fabricius e Chrysomya albiceps (Wiedemann, Chrysomya megacephala (Fabricius e Cochliomyia macellaria (Fabricius (Calliphoridae, Diptera sob condições de laboratório Association between Chrysomya megacephala (Fabricius and Chrysomya albiceps (Wiedemann, Chrysomya megacephala (Fabricius and Cochliomyia macellaria (Fabricius larvae (Calliphoridae, Diptera, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Valéria Magalhães Aguiar-Coelho

    1995-01-01

    Full Text Available This paper intends to recognize some aspects of interspecific relationships between Chrysomya megacephala (Fabricius and C. albiceps (Wiedemann and between C. megacephala and Cochliomyia macellaria (Fabricius larvae in laboratory. A diet consisting of decomposing horse flesh was used, and the relation of 1 larva/g diet was established. The development of the two species was done in pure and associated cultures. The association with Chrysomya albiceps influenced the post-embrionary development period and the weight of mature larvae of the C. megacephala, reducing their. Such weight decrease, along with the predation of larvae of C. megacephala larvae, yelded a decrease in survival in all of the stages. Larvae of this species showed an increase in its weight when associated with Cochliomyia macellaria. The native species responded to the association by reducing its body weigth and its viability. This association doesnt influence the duration of post-embrionary development.

  12. Composition and anti-insect activity of essential oils from Tagetes L. species (Asteraceae, Helenieae) on Ceratitis capitata Wiedemann and Triatoma infestans Klug.

    Science.gov (United States)

    López, Sandra B; López, María L; Aragón, Liliana M; Tereschuk, María L; Slanis, Alberto C; Feresin, Gabriela E; Zygadlo, Julio A; Tapia, Alejandro A

    2011-05-25

    Essential oils from four species of the genus Tagetes L. (Asteraceae, Helenieae) collected in Tucumán province, Argentina, were evaluated for their chemical composition, toxicity, and olfactory activity on Mediterranean fruit fly Ceratitis capitata Wiedemann adults and for repellent properties on Triatoma infestans (Klug) (Chagas disease vector). Yields of essential oils range from 0.2 to 0.8% (v/w). The same main constituents among Tagetes minuta L., Tagestes rupestris Cabrera, and Tagetes terniflora Kunth, (cis-trans)-ocimenes, (cis-trans)-tagetones, and (cis-trans)-ocimenones showed important differences in their relative compositions. Tagetes filifolia Lag. was characterized by the recognized phenylpropanoids methylchavicol and trans-anethole as the main components. LD(50) was ≤20 μg/insect in topical bioassays. T. rupestris was the most toxic to C. capitata females, whereas the other oils presented similar toxicities against males and females. Tagetes rupestris oil attracted both sexes of C. capitata at 5 μg, whereas T. minuta showed opposite activities between males (attractant) and females (repellent). Oils from T. minuta and T. filifolia were the most repellent to T. infestans. The results suggest that compositions of essential oils influence their insecticidal and olfactory properties. The essential oils from Tagetes species show an important potential as infochemical agents on insects' behaviors. This study highlights the chemical variability of essential oils as a source of variation of anti-insect properties.

  13. Congenital hyperinsulinism in an infant with paternal uniparental disomy on chromosome 11p15: few clinical features suggestive of Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Adachi, Hiroyuki; Takahashi, Ikuko; Higashimoto, Ken; Tsuchida, Satoko; Noguchi, Atsuko; Tamura, Hiroaki; Arai, Hirokazu; Ito, Tomoo; Masue, Michiya; Nishibori, Hironori; Takahashi, Tsutomu; Soejima, Hidenobu

    2013-01-01

    Beckwith-Wiedemann syndrome (BWS) is the most common congenital overgrowth syndrome involving tumor predisposition. BWS is caused by various epigenetic or genetic alterations that disrupt the imprinted genes on chromosome 11p15.5 and the clinical findings of BWS are highly variable. Hyperinsulinemic hypoglycemia is reported in about half of all babies with BWS. We identified an infant with diazoxide-unresponsive congenital hyperinsulinism (HI) without any apparent clinical features suggestive of BWS, but diagnosed BWS by molecular testing. The patient developed severe hyperinsulinemic hypoglycemia within a few hours after birth, with macrosomia and mild hydronephrosis. We excluded mutations in the K(ATP) channel genes on chromosome 11p15.1, but found a rare homozygous single nucleotide polymorphism (SNP) of ABCC8. Parental SNP pattern suggested paternal uniparetal disomy in this region. By microsatellite marker analysis on chromosome 11p15, we could diagnose BWS due to the mosaic of paternal uniparental disomy. Our case suggests that some HI of unknown genetic etiology could involve undiagnosed BWS with no apparent clinical features, which might be diagnosed only by molecular testing.

  14. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders: Silver–Russell and Beckwith–Wiedemann syndrome

    Science.gov (United States)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric; Algar, Elizabeth; Buiting, Karin; Russo, Silvia; Tümer, Zeynep; Monk, David; Moore, Gudrun; Antoniadi, Thalia; Macdonald, Fiona; Netchine, Irène; Lombardi, Paolo; Soellner, Lukas; Begemann, Matthias; Prawitt, Dirk; Maher, Eamonn R; Mannens, Marcel; Riccio, Andrea; Weksberg, Rosanna; Lapunzina, Pablo; Grønskov, Karen; Mackay, Deborah JG; Eggermann, Thomas

    2016-01-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver–Russell and Beckwith–Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these disorders and the demand for molecular testing, it turned out that there is an urgent need for a standardized molecular diagnostic testing and reporting strategy. Based on the results from the first external pilot quality assessment schemes organized by the European Molecular Quality Network (EMQN) in 2014 and in context with activities of the European Network of Imprinting Disorders (EUCID.net) towards a consensus in diagnostics and management of SRS and BWS, best practice guidelines have now been developed. Members of institutions working in the field of SRS and BWS diagnostics were invited to comment, and in the light of their feedback amendments were made. The final document was ratified in the course of an EMQN best practice guideline meeting and is in accordance with the general SRS and BWS consensus guidelines, which are in preparation. These guidelines are based on the knowledge acquired from peer-reviewed and published data, as well as observations of the authors in their practice. However, these guidelines can only provide a snapshot of current knowledge at the time of manuscript submission and readers are advised to keep up with the literature. PMID:27165005

  15. Mutations of the Imprinted CDKN1C Gene as a Cause of the Overgrowth Beckwith-Wiedemann Syndrome: Clinical Spectrum and Functional Characterization.

    Science.gov (United States)

    Brioude, Frederic; Netchine, Irène; Praz, Francoise; Le Jule, Marilyne; Calmel, Claire; Lacombe, Didier; Edery, Patrick; Catala, Martin; Odent, Sylvie; Isidor, Bertrand; Lyonnet, Stanislas; Sigaudy, Sabine; Leheup, Bruno; Audebert-Bellanger, Séverine; Burglen, Lydie; Giuliano, Fabienne; Alessandri, Jean-Luc; Cormier-Daire, Valérie; Laffargue, Fanny; Blesson, Sophie; Coupier, Isabelle; Lespinasse, James; Blanchet, Patricia; Boute, Odile; Baumann, Clarisse; Polak, Michel; Doray, Berenice; Verloes, Alain; Viot, Géraldine; Le Bouc, Yves; Rossignol, Sylvie

    2015-09-01

    Beckwith-Wiedemann syndrome (BWS) is an imprinting disorder associating macroglossia, abdominal wall defects, visceromegaly, and a high risk of childhood tumor. Molecular anomalies are mostly epigenetic; however, mutations of CDKN1C are implicated in 8% of cases, including both sporadic and familial forms. We aimed to describe the phenotype of BWS patients with CDKN1C mutations and develop a functional test for CDKN1C mutations. For each propositus, we sequenced the three exons and intron-exon boundaries of CDKN1C in patients presenting a BWS phenotype, including abdominal wall defects, without 11p15 methylation defects. We developed a functional test based on flow cytometry. We identified 37 mutations in 38 pedigrees (50 patients and seven fetuses). Analysis of parental samples when available showed that all mutations tested but one was inherited from the mother. The four missense mutations led to a less severe phenotype (lower frequency of exomphalos) than the other 33 mutations. The following four tumors occurred: one neuroblastoma, one ganglioneuroblastoma, one melanoma, and one acute lymphoid leukemia. Cases of BWS caused by CDKN1C mutations are not rare. CDKN1C sequencing should be performed for BWS patients presenting with abdominal wall defects or cleft palate without 11p15 methylation defects or body asymmetry, or in familial cases of BWS.

  16. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders: Silver-Russell and Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric; Algar, Elizabeth; Buiting, Karin; Russo, Silvia; Tümer, Zeynep; Monk, David; Moore, Gudrun; Antoniadi, Thalia; Macdonald, Fiona; Netchine, Irène; Lombardi, Paolo; Soellner, Lukas; Begemann, Matthias; Prawitt, Dirk; Maher, Eamonn R; Mannens, Marcel; Riccio, Andrea; Weksberg, Rosanna; Lapunzina, Pablo; Grønskov, Karen; Mackay, Deborah Jg; Eggermann, Thomas

    2016-10-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver-Russell and Beckwith-Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these disorders and the demand for molecular testing, it turned out that there is an urgent need for a standardized molecular diagnostic testing and reporting strategy. Based on the results from the first external pilot quality assessment schemes organized by the European Molecular Quality Network (EMQN) in 2014 and in context with activities of the European Network of Imprinting Disorders (EUCID.net) towards a consensus in diagnostics and management of SRS and BWS, best practice guidelines have now been developed. Members of institutions working in the field of SRS and BWS diagnostics were invited to comment, and in the light of their feedback amendments were made. The final document was ratified in the course of an EMQN best practice guideline meeting and is in accordance with the general SRS and BWS consensus guidelines, which are in preparation. These guidelines are based on the knowledge acquired from peer-reviewed and published data, as well as observations of the authors in their practice. However, these guidelines can only provide a snapshot of current knowledge at the time of manuscript submission and readers are advised to keep up with the literature.

  17. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder

    1993-09-01

    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  18. Immatures of Lutzia fuscanus (Wiedemann,1820)(Dipter-a:Culicidae)in ricefields:implications for biological con-trol of vector mosquitoes

    Institute of Scientific and Technical Information of China (English)

    Mihir Kumar Pramanik; Gautam Aditya

    2009-01-01

    Objective:Rice fields are dynamic mosquito larval habitats with assemblage of different predator taxa,inclu-ding the larva of the mosquitoes Lutzia.Entomological surveillance in the ricefields is essential to evaluate the potential of these predators as biological resource to regulate vector mosquito population.In view of this,a sur-vey of ricefields for immatures of different mosquito species including Lutzia was conducted.Methods:Survey of selected ricefields was carried out to evaluate the species composition of mosquitoes.Laboratory evaluation of the immatures of Lutzia mosquitoes was carried out to assess its predation potential using mosquitoes and chi-ronomid as preys.Results:The survey revealed the presence of five mosquito species belonging to the genera Anopheles and Culex and the predatory immatures of the mosquito Lutzia fuscana (Wiedemann,1820).The ra-tio of prey and predatory larva ranged between 1.46 and 4.78 during the study period,with a significant corre-lation on the relative abundance of the larval stages of Lt.fuscanus and Anopheles and Culex larvae.Under la-boratory conditions,a single IV instar larvae of Lt.fuscanus was found to consume on an average 5 to 15 equiv-alent instars of Anopheles sp.and Culex sp.larvae per day depending on its age.The prey consumption re-duced with the larval stage approaching pupation.When provided with equal numbers of chironomid and A-nopheles or Culex larvae,larva of Lt.fuscanus consumed mosquito larvae significantly more compared to chi-ronomids.Conclusion:The survey results and the preliminary study on predation are suggestive of the role of Lt.fuscanus in the regulation of vector mosquito populations naturally in the ricefields.Since Lt.fuscanus is common in many Asian countries,further studies on bioecology will be helpful to justify their use in mosquito control programme.

  19. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae: Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    Directory of Open Access Journals (Sweden)

    Alberto Silva Neto

    2012-11-01

    Abstract. This work evaluated the influence of size on the copula success in Ceratitis capitata (Wiedemann. To assure the production of different adult sizes (big and small, two groups of larvae had been fed with different protein concentrations. Subsequently, adult males of both groups had been compared in terms of copula success and amount of males who showed the first step of courtship (emission of sexual pheromone. The copula success in laboratory was evaluated with males in some ratios, which the number of big males with five days of life (an unique male in relation to a gradual increase of small males with same age kept constant. The tested ratios had been 1:1, 1:2, 1:3, 1:4, 1:5, and 1:10. In the experiments of copula success in the 1:1 ratio and the ones of pheromone emission, they had been tested small male of different ages (five, nine or 13 days, whereas the age of the big males kept constant (five days. Experiments of copula success in the 1:1 ratio had been also carried through in field cage. It was prove that the big males had taken advantage in all the parameters analyzed in laboratory, emitting pheromone and having a bigger copula success, exactly when the age of the small males was varied. The size effect was so significant, that in the ratio of 1 big male for 10 small males, the females had still chosen the big males. In field cage, the results had been similar to the ones of laboratory.

  20. Toward the gene(s) for Wiedemann-Beckwith syndrome and associated tumors in two different regions of 11p15

    Energy Technology Data Exchange (ETDEWEB)

    Henry, J.; Chehenase, V.; Boulevin, C. [INSERM, Paris (France)] [and others

    1994-09-01

    Wiedemann-Beckwith syndrome (WBS) is a malformation syndrome associated with predisposition to different types of tumors (WT, ADCC). Cytogenetic and familial studies mapped the WBS locus to 11p15.5. Genomic imprinting has been implicated in the expression of the syndrome. Using 11p15 specific markers we have determined the parental origin of both chromosomes 11 in sporadic WBS cases. Probands in 5 out of 26 informative families (25%) displayed uniparental disomy (UPD) corresponding to a paternal isodisomy for region 11p15.5. Mosaic phenotypes reflect the timing of their origin and the fate of cells involved as well as the cell-specific pattern of imprinting. Somatic mosaicism for UPD may thus explain the incomplete forms of WBS, the association of hemihypertrophy in sporadic WBS and even some cases of isolated hemihypertrophy. Moreover, the risk (60%) of developing a tumor seems higher for patients with paternal 11p UPD than for WBS patients in general (7.5%). Two different genomic libraries specific for region 11p15.5 were constructed and screened to isolate and characterize the gene(s) responsible for WBS and/or tumor progression. The characterization and and the localization of these cDNAs are in progress. 5 CA repeats genetically mapped in 11p15 were used to isolate YACs (CEPH). These CA repeats are now physically mapped using a panel of hybrids specific for the 11p15 region, and the contigs of YACs mapping in the regions of interest will be used to isolate coding sequences.

  1. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel

    2015-08-01

    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  2. Can consumption of antioxidant rich mushrooms extend longevity?: antioxidant activity of Pleurotus spp. and its effects on Mexican fruit flies' (Anastrepha ludens) longevity.

    Science.gov (United States)

    Sánchez, José E; Jiménez-Pérez, Gabriela; Liedo, Pablo

    2015-12-01

    The variability of antioxidant capacity of 14 strains of the edible oyster mushroom Pleurotus spp. was determined, and the effect of selected mushroom supplements on the longevity of the Mexican fruit fly, Anastrepha ludens, was evaluated. The antioxidant capacity of the fruiting bodies was determined by three different methods, measuring the free radical scavenging activity of methanolic extracts, the OH radical scavenging capacity, and the total phenol content. The inhibition percentage of the DPPH radical varied between 32.6 and 85.7% and total phenols varied between 30.6 and 143.3 mg/g. The strains with the highest (Pleurotus djamor ECS-0142) and lowest (Pleurotus ostreatus ECS-1123) antioxidant capacity were selected to study their effect on the survival, life expectancy, and mortality of the Mexican fruit fly A. ludens. The results demonstrated differing responses between male and female flies. High concentrations of mushrooms (5 and 20%) in the diet resulted in a decrease in life expectancy. However, flies on the diet with 1% P. djamor ECS-0142 showed slightly but significantly greater survival than those on the control diet. The possible adverse effect of protein content in mushroom extracts is discussed.

  3. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  4. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  5. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  6. Long-term impact of tongue reduction on speech intelligibility, articulation and oromyofunctional behaviour in a child with Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Van Lierde, K M; Mortier, G; Huysman, E; Vermeersch, H

    2010-03-01

    The purpose of the present case study was to determine the long-term impact of partial glossectomy (using the keyhole technique) on overall speech intelligibility and articulation in a Dutch-speaking child with Beckwith-Wiedemann syndrome (BWS). Furthermore the present study is meant as a contribution to the further delineation of the phonation, resonance, articulation and language characteristics and oral behaviour in a child with BWS. Detailed information on the speech and language characteristics of children with BWS may lead to better guidance of pediatric management programs. The child's speech was assessed 9 years after partial glossectomy with regard to ENT characteristics, overall intelligibility (perceptual consensus evaluation), articulation (phonetic and phonological errors), voice (videostroboscopy, vocal quality), resonance (perceptual, nasometric assessment), language (expressive and receptive) and oral behaviour. A class III malocclusion, an anterior open bite, diastema, overangulation of lower incisors and an enlarged but normal symmetric shaped tongue were present. The overall speech intelligibility improved from severely impaired (presurgical) to slightly impaired (5 months post-glossectomy) to normal (9 years postoperative). Comparative phonetic inventory showed a remarkable improvement of articulation. Nine years post-glossectomy three types of distortions seemed to predominate: a rhotacism and sigmatism and the substitution of the alveolar /z/. Oral behaviour, vocal characteristics and resonance were normal, but problems with expressive syntactic abilities were present. The long-term impact of partial glossectomy, using the keyhole technique (preserving the vascularity and the nervous input of the remaining intrinsic tongue muscles), on speech intelligibility, articulation, and oral behaviour in this Dutch-speaking child with congenital macroglossia can be regarded as successful. It is not clear how these expressive syntactical problems

  7. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  8. Selection of artificial hosts for oviposition by wild Anastrepha obliqua (Macquart (Diptera, Tephritidae: influence of adult food and effect of experience Seleção de hospedeiros artificiais para oviposição por Anastrepha obliqua (Macquart (Diptera, Tephritidae selvagem: influência do alimento do adulto e efeito da experiência

    Directory of Open Access Journals (Sweden)

    Thamara A. B. S. Leal

    2008-09-01

    Full Text Available Several factors influence the selection of oviposition substrates by insects. The aim of the present work was to find answers to the following questions related to the oviposition behavior of Anastrepha obliqua. Can carbohydrates (glucose or sucrose present in the adult diet have influence on the female preference for an oviposition substrate with similar composition? Can the previous experience with a host containing one of mentioned carbohydrates interfere in further selection of oviposition substrates? The results showed that the kind of carbohydrate present in the adult diet did not affect the female preference for an artificial oviposition substrate, neither when it was presented by itself nor in combination with brewer's yeast. The effect of experience in the oviposition behavior was observed when there was a previous contact with artificial oviposition substrates containing yeast and sucrose. The data are discussed in terms of the behavioral plasticity presented by this species in relation to feeding and oviposition behaviors.Vários fatores podem atuar durante a seleção de substratos para oviposição por insetos. O presente estudo teve por objetivo responder às seguintes questões relacionadas ao comportamento de oviposição de Anastrepha obliqua. O carboidrato presente na dieta do adulto (glicose ou sacarose pode influenciar a preferência da fêmea por um substrato para oviposição com composição semelhante? A experiência prévia com um hospedeiro que possui um dos dois carboidratos citados pode interferir em escolhas futuras entre substratos para oviposição? Os resultados indicaram que o tipo de carboidrato presente na dieta do adulto não exerceu influência sobre a preferência das fêmeas por um substrato artificial para oviposição, tanto quando em combinação com lêvedo de cerveja ou quando sozinho. O efeito da experiência no comportamento de oviposição foi notado quando o contato prévio foi com substratos

  9. Virulence of nematodes against larvae of the south-American fruit fly in laboratory using soil from Porto Amazonas, Paraná, Brazil, as substrate

    Directory of Open Access Journals (Sweden)

    Ester Foelkel

    2015-01-01

    Full Text Available ABSTRACT: Anastrepha fraterculus is an important orchard pest. Its management has been based in chemical sprays, but biological control is a growing demand. The objective of this work was to evaluate, under laboratory conditions, the virulence of eight nematode isolates to A. fraterculus in a soil collected in Porto Amazonas, Paraná, Brazil, and to estimate lethal doses (LD50 and LD90 for the more virulent isolate. Steinernema carpocapsae CB 02, three Heterorhabditis sp., two H. amazonensis and two Oscheius sp. isolates were tested in laboratory against A. fraterculus third-instar larvae using as substrate a loam Cambisol collected in an apple orchard. S. carpocapsae CB 02 isolate caused the higher percent mortality of A. fraterculus. Heterorhabditis sp. isolates and LAMIP 9 ( Oscheius sp. isolates were intermediate, while LAMIP 92 (Oscheius sp. didn't differ from the control. S. carpocapsae CB 02 is able to kill 50% and 90% of A. fraterculus population with 96.3 and 314.7 infective juveniles per larva, respectively, in that soil. As a conclusion, CB 02 is the most virulent to A. fraterculus when the substrate is Porto Amazonas' apple orchard soil and it is able to kill 50 and 90% larval population with 96.3 and 314.7 infective juveniles per larva, respectively.

  10. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  11. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  12. Biologia da mosca‑das‑frutas sul‑americana em frutos de mirtilo, amoreira‑preta, araçazeiro e pitangueira Biology of South American fruit fly in blueberry, blackberry, strawberry guava, and Surinam cherry crops

    Directory of Open Access Journals (Sweden)

    Maicon Bisognin

    2013-02-01

    Full Text Available O objetivo deste trabalho foi descrever a biologia de Anastrepha fraterculus em frutos de mirtilo (Vaccinium ashei, amoreira‑preta (Rubus spp., araçazeiro (Psidium cattleyanum e pitangueira (Eugenia uniflora. O experimento foi realizado em laboratório, em condições controladas de temperatura (25±2ºC, umidade relativa (70±10% e fotófase (12 horas, para determinação dos parâmetros biológicos do inseto nos estágios de desenvolvimento imaturos e adultos. Anastrepha fraterculus completa o ciclo biológico em todos hospedeiros estudados, embora os frutos nativos (pitanga e araçá ofereçam melhores condições para seu desenvolvimento. Os parâmetros biológicos determinados para as fases imaturas foram semelhantes nos quatro hospedeiros. Insetos criados em pitanga e araçá apresentam, na fase adulta, maior período de oviposição, fecundidade e longevidade de fêmeas, em comparação aos criados em mirtilo e amora‑preta. O ritmo diário de oviposição é mais prolongado e uniforme nos insetos criados em araçá e pitanga, o que mostra que A. fraterculus está mais bem adaptada a estas frutas, nativas da região Sul.The objective of this work was to describe the biology of Anastrepha fraterculus in blueberry (Vaccinium ashei, blackberry (Rubus spp., strawberry guava (Psidium cattleyanum and Surinam cherry (Eugenia uniflora fruits. The experiment was carried out in laboratory under controlled conditions of temperature (25±2ºC, relative humidity (70±10%, and photophase (12 hours to determine insect biological parameters in immature and adult development stages. Anastrepha fraterculus finishes its biological cycle in all studied hosts; however, the Brazilian native fruits (strawberry guava and Surinam cherry provide better conditions for development of the insect. Biological parameters determined for immature development stadium were similar in the four hosts. Insects reared in Surinam cherry and strawberry guava showed, in the

  13. Species of fruit flies (Tephritidae obtained of McPhail trap in the Bahia State, Brazil/ Espécies de moscas-das-frutas (Tephritidae obtidas em armadilhas McPhail no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Miguel Francisco de Souza Filho

    2006-07-01

    Full Text Available The objective of this study was to provide knowledge on the species of fruit flies in commercial orchards in counties of the southern and extreme southern regions of the State of Bahia, Brazil. Flies were captured weekly by McPhail traps, using a hydrolyzed corn protein at 5%, as attractant. A total of 257 female was collected, and the species were identified as: Anastrepha fraterculus (77.4%, A. sororcula (4.7%, A. obliqua (2.7%, A. zenildae (0.8%, A. distincta (0.4%, A. consobrina (0.4%, Anastrepha sp.1 (5.1% and Ceratitis capitata (8.5%.O objetivo deste trabalho foi conhecer as espécies de moscas-das-frutas que ocorrem em pomares comerciais em alguns municípios da região sul e extremo-sul do estado da Bahia, Brasil. As moscas-dasfrutas foram capturadas, semanalmente, utilizando-se armadilhas McPhail, tendo como atrativo proteína hidrolisada de milho a 5%. Foi obtido um total de 257 espécimes fêmeas, pertencentes às espécies: Anastrepha fraterculus (77,4%, A. sororcula (4,7%, A. obliqua (2,7%, A. zenildae (0,8%, A. distincta (0,4%, A. consobrina (0,4%, Anastrepha sp.1 (5,1% e Ceratitis capitata (8,5%.

  14. Wiedemann un itinerario plástico

    Directory of Open Access Journals (Sweden)

    Mario Rivero

    1969-03-01

    Full Text Available La conquista del espacio y la conquista del plancton, del mundo estelar y el microbiano y la conquista del propio mundo subjetivo expresivo, se constituyen, hoy por hoy, en argumento de asombrosa objetividad dentro de la más radical concepción de la pintura moderna: la no figurativa.

  15. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros

    OpenAIRE

    Raga, Adalton; Machado,Rogério Amaro; Dinardo,Welci; Strikis,Pedro Carlos

    2006-01-01

    As moscas-das-frutas (Diptera: Tephritoidea) são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied.) e Ceratitis capitata (Wied.). O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atra...

  16. Larval endoparasitoids (Hymenoptera of frugivorous flies (Diptera, Tephritoidea reared from fruits of the cerrado of the State of Mato Grosso do Sul , Brazil

    Directory of Open Access Journals (Sweden)

    Manoel A. Uchôa-Fernandes

    2003-01-01

    Full Text Available This paper presents a five years survey of endoparasitoids obtained from the larvae of frugivorous Tephritidae and Lonchaeidae flies. The insects were reared from cultivated and wild fruits collected in areas of the cerrado in the State of Mato Grosso do Sul, Brazil. The flies obtained from 14 host fruit species were eight Anastrepha species, Ceratitis capitata (Wiedemann, 1824 (Tephritidae; Dasiops sp. and Neosilba spp. (Lonchaeidae. Eleven parasitoid species were collected: Braconidae - Asobara anastrephae (Muesebek, 1958, Doryctobracon areolatus (Szépligeti, 1911, D. fluminensis (Costa Lima, 1938, Opius bellus Gahan, 1930 and Utetes anastrephae (Viereck, 1913; Figitidae - Aganaspis nordlanderi Wharton, 1998, Lopheucoila anastrephae (Rhower, 1919, Odontosema anastrephae (Borgmeier, 1935 and Trybliographa infuscata Gallardo, Díaz & Uchôa-Fernandes, 2000 and, Pteromalidae - Spalangia gemina Boucek, 1963 and S. endius Walker, 1839. In all cases only one parasitoid emerged per puparium. D. areolatus was the most abundant and frequent parasitoid of fruit fly species, as was L. anastrephae in Neosilba spp. larvae. This is the first record of A. nordlanderi in the midwestern Brazilian region.

  17. ESPÉCIES E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS EM UM POMAR COMERCIAL DE MANGUEIRA, NO LITORAL DO ESTADO DO CEARÁ

    Directory of Open Access Journals (Sweden)

    Joseph Jonathan Dantas de Oliveira

    2009-01-01

    Full Text Available The objective of this research was to know the species and the population fluctuation of fruit flies (Diptera: Tephritidae in a commercial mango (Mangifera indica L. orchard in the coast of Ceará State. The study was developed from July of 2005 to July of 2007, in the municipality of Beberibe (CE. The capture of the fruit flies was performed using McPhail traps with 5% corn protein hydrolyzed solution as attractant. Weekly, the captured insects were sorted, the fruit flies were maintained in 70% alcohol solution and subsequently identified. The population fluctuation was estimated using the FTD (Fly/Trap/Day index. During the research, six fruit flies species were captured: Anastrepha obliqua (Macquart (63%, A. zenildae Zucchi (7%, A. sororcula Zucchi (5%, A. fraterculus (Wied. (2%, A. distincta Greene (2% and Ceratitis capitata (Wied. (21%. The Anastrepha spp. and C. capitata population peaked was between April and July, in both years of study.

  18. Oogênese em Fannia pusio (Wiedemann, 1830 e Fannia heydenni (Wiedemann, 1830 (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1990-01-01

    Full Text Available Oogenesis in Fannia pusio and Fannia heydenii was divided into a series of eight stages (stage I - germarium; stage VIII - mature egg, which are characterized and illustrated. Comments on similar researches and a comparison with related data in literature are also included.

  19. Oogênese em Fannia pusio (Wiedemann, 1830) e Fannia heydenni (Wiedemann, 1830) (Diptera, Fanniidae)

    OpenAIRE

    Márcia Souto Couri

    1990-01-01

    Oogenesis in Fannia pusio and Fannia heydenii was divided into a series of eight stages (stage I - germarium; stage VIII - mature egg), which are characterized and illustrated. Comments on similar researches and a comparison with related data in literature are also included.

  20. Moscas-das-frutas em pomares de pessegueiro e maracujazeiro, no Município de Iraceminha, Santa Catarina, Brasil Fruit flies in peach and passion fruit orchards in Iraceminha, Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2009-08-01

    Full Text Available Este estudo teve o objetivo de caracterizar a comunidade de moscas-das-frutas de ocorrência em pomares de pessegueiro e maracujazeiro, no Município de Iraceminha, Santa Catarina (SC, por meio da análise faunística. Os adultos de moscas-das-frutas foram capturados semanalmente, em armadilhas McPhail, contendo glicose invertida a 10%, no período de abril de 2006 a março de 2007. Na caracterização, foram calculados os índices de abundância, constância, dominância, frequência e diversidade. Foram coletados 697 adultos de moscas-das-frutas. Anastrepha grandis e Anastrepha fraterculus foram as espécies mais abundantes, frequentes, constantes e dominantes nos pomares estudados, predominando sobre as outras espécies de moscas-das-frutas. Ceratitis capitata foi caracterizada como dispersa e pouco frequente. O maior índice de diversidade encontrado foi de 1,99 no pomar de maracujazeiro.This research had the objective to characterize the community of fruit flies in peach and passion fruit orchards in Iraceminha, Santa Catarina, Brazil, through faunistic analyses. The adults fruit flies were weekly captured in McPhail traps with 10% inverted glucose, from April 2006 to March 2007. In the characterization, the indices for abundance, constancy, dominance, frequency and diversity were calculated. A total of 697 adults fruit flies were collected. Anastrepha grandis and Anastrepha fraterculus species were the most abundant, frequent, constant and dominant in orchards studied, predominating upon other fruit flies species. Ceratitis capitata was dispersed and not very frequent. The biggest index of diversity of 1.99 was in passion fruit orchard.

  1. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  2. Ocorrência precoce da mosca das frutas em ameixas Incidence of the southamerican fruit fly on plums

    Directory of Open Access Journals (Sweden)

    Luiz Antonio Salles

    1999-06-01

    Full Text Available O objetivo deste estudo foi verificar qual o estágio fenológico mais precoce da fruta de ameixeira em que ocorreria o ataque de mosca das frutas Anastrepha fraterculus. Os estudos foram conduzidos em plantas adultas de ameixeira, expondo-se fêmeas grávidas da mosca das frutas, confinadas em gaiolas com frutos protegidos do ataque natural. Cinco cultivares de ameixeira foram estudados (Amarelinha, Pluma 7, Reubennel, Santa Rosa e Wade. Essa praga ataca frutos de qualquer um dos cultivares logo nos primeiros estádios do desenvolvimento, quando os mesmos têm somente cerca de 2 a 3cm de diâmetro.The incidence of the southamerican fruit fly, Anastrepha fraterculus, on plum cultivars is reported. The objective of this study was to know the earliest fruit phase that fly attack could occur. Fertilized females were confined with fruits in plum trees in an orchard. Five plums cultivars were studied: Amarelinha; Pluma 7; Reubennel; Santa Rosa and Wade. This pest attack fruits during first stages of their development, mainly they have only from 2 to 3 centimeters of diameter.

  3. Paternal uniparental disomy 11p15.5 in the pancreatic nodule of an infant with Costello syndrome: Shared mechanism for hyperinsulinemic hypoglycemia in neonates with Costello and Beckwith-Wiedemann syndrome and somatic loss of heterozygosity in Costello syndrome driving clonal expansion.

    Science.gov (United States)

    Gripp, Karen W; Robbins, Katherine M; Sheffield, Brandon S; Lee, Anna F; Patel, Millan S; Yip, Stephen; Doyle, Daniel; Stabley, Deborah; Sol-Church, Katia

    2016-03-01

    Costello syndrome (CS) entails a cancer predisposition and is caused by activating HRAS mutations, typically arising de novo in the paternal germline. Hypoglycemia is common in CS neonates. A previously reported individual with the rare HRAS p.Gln22Lys had hyperinsulinemic hypoglycemia. Autopsy showed a discrete pancreatic nodule. The morphologic and immunohistochemistry findings, including loss of p57(Kip2) protein, were identical to a focal lesion of congenital hyperinsulinism, however, no KCNJ11 or ABCC8 mutation was identified and germline derived DNA showed no alternation of the maternal or paternal 11p15 alleles. Here we report paternal uniparental disomy (pUPD) within the lesion, similar to the pUPD11p15.5 in Beckwith-Wiedemann syndrome (BWS). The similar extent of the pUPD suggests a similar mechanism driving hyperinsulinemia in both conditions. After coincidental somatic LOH and pUPD, the growth promoting effects of the paternally derived HRAS mutation, in combination with the increased function of the adjacent paternally expressed IGF2, may together result in clonal expansion. Although this somatic LOH within pancreatic tissue resulted in hyperinsulinism, similar LOH in mesenchymal cells may drive embryonal rhabdomyosarcoma (ERMS). Interestingly, biallelic IGF2 expression has been linked to rhabdomyosarcoma tumorigenesis and pUPD11 occurred in all 8 ERMS samples from CS individuals. Somatic KRAS and HRAS mutations occur with comparable frequency in isolated malignancies. Yet, the malignancy risk in CS is notably higher than in Noonan syndrome with a KRAS mutation. It is conceivable that HRAS co-localization with IGF2 and the combined effect of pUPD 11p15.5 on both genes contributes to the oncogenic potential.

  4. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros Attractiveness of food baits to the fruit flies in citrus orchard

    Directory of Open Access Journals (Sweden)

    Adalton Raga

    2006-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritoidea são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied. e Ceratitis capitata (Wied.. O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atrativos testados foram: proteínas hidrolisadas comerciais Bio Anastrepha, Isca Mosca e Aumax®, todas diluídas em água a 5%; melaço a 7% isoladamente e melaço a 7% em mistura com suco de laranja a 10%. Foram utilizados semanalmente, 400mL da solução atrativa por frasco plástico McPhail instalado na copa de laranjeiras da variedade 'Pêra Rio'. As soluções eram renovadas semanalmente, ocasião em que os adultos eram coletados e çevados ao laboratório para contagem, sexagem e identificação. Foram capturados 1.821 adultos de Tephritoidea, sendo 892 de Anastrepha spp., 731 de C. capitata e 198 de Neosilba spp. Para essas espécies, as proteínas Bio Anastrepha e Isca Mosca foram altamente eficientes e semelhantes entre si, capturando 44,5% e 41,3% dos adultos de Tephritidae respectivamente. Não houve diferença entre as espécies de Tephritidae analisadas por sexo capturadas em Bio Anastrepha, Aumax® e melaço. Aumax®, melaço isoladamente e melaço + suco de laranja atraíram apenas 4,6%, 1,3% e 1,2% do total de adultos de Tephritidae, respectivamente. Melaço isoladamente e melaço com suco de laranja foram mais eficazes na atratividade de Zaprionus indianus (Gupta (Diptera: Drosophilidae.Fruit flies (Diptera: Tephritoidea are key pests in citrus production in the State of São Paulo, Brazil, mainly Anastrepha fraterculus (Wied. and Ceratitis capitata (Wied.. The objective of this study was to evaluate food baits to monitor fruit fly

  5. Hymenopteran parasitoids associated with frugivorous larvae in a Brazilian caatinga-cerrado ecotone.

    Science.gov (United States)

    De Souza, A R; Lopes-Mielezrski, G N; Lopes, E N; Querino, R B; Corsato, C D A; Giustolin, T A; Zucchi, R A

    2012-04-01

    The purpose of this study was to investigate native species of parasitoids of frugivorous larvae and their associations with host plants in commercial guava orchards and in typical native dry forests of a caatinga-cerrado ecotone in the State of Minas Gerais, Brazil. Nine species of parasitoids were associated with larvae of Anastrepha (Tephritidae) and Neosilba (Lonchaeidae) in fruit of Psidium guajava L. (Myrtaceae), Ziziphus joazeiro Mart. (Rhamnaceae), Spondias tuberosa Arruda (Anacardiaceae), Spondias dulcis Forst. (Anacardiaceae), Syzygium cumini (L.) Skeels (Myrtaceae), and Randia armata (Sw.) DC. (Rubiaceae). Doryctobracon areolatus was the most abundant species, obtained from puparia of Anastrepha zenildae, An. sororcula, An. fraterculus, An. obliqua, and An. turpiniae. This is the first report of Asobara obliqua in Brazil and of As. anastrephae and Tropideucoila weldi in dry forests of Minas Gerais State. The number of species of parasitoids was higher in areas with greater diversity of cultivated species and lower pesticide use. The forest fragments adjacent to the orchards served as shelter for parasitoids of frugivorous larvae.

  6. Population fluctuation of fruit flies (Diptera, Tephritidae in peach and passion fruit orchards in Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2012-06-01

    Full Text Available The objective of this study was learn more about the population fluctuation of fruit flies in peach and passion fruit orchards in the municipality of Iraceminha, Santa Catarina. In order to carry out the survey, McPhail traps were set up with 10% inverted glucose from April 2006 to March 2007. Captured flies were identified at the Laboratório de Entomologia at UNOCHAPECÓ. The collected females belonged to twelve species and four genera. The adults of Anastrepha fraterculus were trapped during all seasons, with a population peak in October 2006 in the peach orchards. The population levels of Anastrepha grandis remained higher during the first five months in the passion fruit orchard. There were low infestation rates by flies of the genera Ceratitis, Blepharoneura and Tomoplagia when compared to flies of the genus Anastrepha. The results showed that the presence of flies in the orchards was associated with the availability of host fruit and not with climatic conditions.

  7. DEZ ANOS DE PESQUISAS SOBRE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO ESTADO DO AMAPÁ: AVANÇOS OBTIDOS E DESAFIOS FUTUROS.

    Directory of Open Access Journals (Sweden)

    Ezequiel da Glória de Deus

    2013-12-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae estão entre as principais pragas da agricultura mundial, sendo motivo de preocupação especialmente para países tropicais em desenvolvimento, os quais têm na fruticultura um importante componente de sua balança comercial. Esta revisão tem por objetivo compilar informações geradas nos últimos 10 anos sobre moscas-das-frutasno estado do Amapá, com ênfase em distribuição, hospedeiros e parasitoides. Além disso, visa indicar as prioridades de pesquisa para os próximos anos.No estado do Amapá, os estudos com moscas-das-frutas e seus inimigos naturais apresentaram, nos últimos anos, significativo crescimento. Atualmente, além Bactrocera carambolae, estão assinaladas para o Estado 34 espécies de Anastrepha. Anastrepha distincta, Anastrepha coronilli, Anastrepha fraterculus e Anastrepha striata são as espécies mais amplamente distribuídas. Estão assinaladas para o estado 37 espécies vegetais hospedeiras (pertencentes a 19 famílias botânicas de moscas-das-frutas. Anastrepha striata é espécie mais polífaga, estando associada a 25 hospedeiros. Nove espécies de parasitoides específicos de moscas-das-frutas estão registrados, sendo Doryctobracon areolatuso mais abundante. Apesar do significativo avanço, novos estudos sobre biologia, genética, ecologia, distribuição e dispersão populacional, bem como fatores reguladores dos níveis populacionais são necessários, com vista a desenvolver estratégias de controle menos onerosas com efeitos não nocivos ao ambiente. Palavras-chave: Anastrepha, Bactrocera carambolae, parasitoides, Amazônia. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v3n3p157-168

  8. Incidence of fruit flies on coffee and citrus and quarantine treatment of citrus fruits by gamma radiation; Incidencia de moscas-das-frutas em cafe e citros e tratamento quarentenario de frutos citricos com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Raga, Adalton

    1996-12-31

    The objective of this study was to evaluate the fruit fly infestation on coffee and citrus, and also to determine gamma radiation doses for immature stages of Ceratitis capitata and Anastrepha fraterculus, in order to satisfy quarantine regulations. Coffee arabica varieties Icatu Vermelho, Catuai Amarelo, Mundo Novo and Sarchimor showed the highest infestation indices (pupa/berry): 0.53; 0,41; 0.33 and 0.36. respectively Icatu Vermelho and Catuai Vermelho showed the highest values of pupa/berry weight (0.49 and 0.39, respectively), and Robusta (Coffea canephora) presented the lowest index (0.01). The following fruit flies were found in coffee berries: C. capitata (76.6%) Anastrepha spp. (7.4%) and Lonchaeidae (17.0%). In area near coffee plantation, fruit fly infestation indices in sweet oranges were of 4.77 larvae/kg and 0.55 larva/fruit. The infestation indices for sweet orange, collected from five regions of the State of Sao Paulo ranged from 0.73 to 7.60 pupa/kg and 0.12 to 1.27 pupa/fruit. The same species of fruit flies were found in oranges. In the case of C. capitata eggs with 24-48 hours old, 20 Gy prevented completely adult emergence (artificial diet and orange). No emergence of adult occurred when C. capitata larvae of third instar were irradiated at 20 Gy in their rearing medium. But at 25 Gy, the number of adults was reduced by 54% and 97% from larval infestation in oranges and grapefruit, respectively. A dose of 30 Gy was required to prevent medfly emergence from third instar larvae in grapefruit. A dose of 15 Gy was required for third instar, to prevent adult emergence of A. fraterculus. No adult emerged from C third instar, to prevent adult emergence of A. fraterculus. No adult emerged from C capitata pre-pupa irradiated at 30 Gy. One medfly adult emerged from pupa (3-4 days after pupating) irradiated at 120 Gy. At the same dose, sixteen A. fraterculus adults emergency from irradiated pupa with 5-6 days old. (author) 85 refs., 2 figs., 13 tabs.

  9. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  10. Tephritid Integrative Taxonomy: Where We Are Now, with a Focus on the Resolution of Three Tropical Fruit Fly Species Complexes.

    Science.gov (United States)

    Schutze, Mark K; Virgilio, Massimiliano; Norrbom, Allen; Clarke, Anthony R

    2017-01-31

    Accurate species delimitation underpins good taxonomy. Formalization of integrative taxonomy in the past decade has provided a framework for using multidisciplinary data to make species delimitation hypotheses more rigorous. We address the current state of integrative taxonomy by using as a case study an international project targeted at resolving three important tephritid species complexes: Bactrocera dorsalis complex, Anastrepha fraterculus complex, and Ceratitis FAR (C. fasciventris, C. anonae, C. rosa) complex. The integrative taxonomic approach has helped deliver significant advances in resolving these complexes: It has been used to identify some taxa as belonging to the same biological species as well as to confirm hidden cryptic diversity under a single taxonomic name. Nevertheless, the general application of integrative taxonomy has not been without issue, revealing challenges that must be considered when undertaking an integrative taxonomy project. Scrutiny of this international case study provides a unique opportunity to document lessons learned for the benefit of not only tephritid taxonomists, but also the wider taxonomic community.

  11. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  12. SELETIVIDADE DE INSETICIDAS A Neoseiulus californicus MCGREGOR (ACARI: PHYTOSEIIDAE EM MACIEIRA, NO RIO GRANDE DO SUL AGROCHEMICAL SELECTIVITY TO Neoseiulus californicus MCGREGOR (ACARI: PHYTOSEIIDAE ON APPLE IN RIO GRANDE DO SUL

    Directory of Open Access Journals (Sweden)

    LINO BITTENCOURT MONTEIRO

    2001-12-01

    Full Text Available Testes para determinar os efeitos de agroquímicos homologados para macieira foram realizados em laboratório sobre Neoseiulus californicus (Acari: Phytoseiidae. Os indivíduos testados foram coletados de um pomar comercial da Agriflor Ltda, em Vacaria, Rio Grande do Sul, após várias liberações inoculativas. Os inseticidas utilizados foram os tradicionalmente recomendados para o controle de pragas, principalmente mosca-das-frutas Anastrepha fraterculus (Diptera: Tephritidae. A oviposição e a mortalidade dos ácaros foram avaliadas 12; 24; 48 e 96 horas após a pulverização, cujos produtos foram classificados em quatro classes de toxicidade (IOBC/WPRS. Azinphos ethyl, deltametrina e fenthion provocaram 100% de mortalidade, sendo que dimethoate, fenitrotion, paration, phosmet e triclorfon foram levemente nocivos (classe 2. Malation foi considerado neutro para esta população.The side-effects of agrochemical to Neoseiulus californicus (Acari: Phytoseiidae were studied in laboratory. The mites were collected in commercial apple orchard of Agropastoril Rincão das Flores, in Vacaria, Rio Grande do Sul, Brazil, after successive inoculative releases. The insecticids used were recommended to control of same pest, as Anastrepha fraterculus (Diptera: Tephritidae. The reproduction effect and mortality were evalued 12, 24, 48 and 96 hours after pulverization, while the agrochemical were ranked in toxicity classes, according to IOBC/WPRS. Azinphos ethyl, deltametrina e fenthion were harmful with ca. 100% of mortality in 24 hours, dimethoate, fenitrotion, paration, phosmet e triclorfon were slightly harmful (class 2. Malation was harmless.

  13. EMBALAGENS NA PROTEÇÃO CONTRA PRAGAS DE FRUTOS DE CAQUIZEIRO

    Directory of Open Access Journals (Sweden)

    Carine Rusin

    2015-12-01

    Full Text Available The persimmon culture can be attacked by several pests and diseases, however, there are few studies related to the control. In addition, there is a lack of pesticides registered in the Ministry of Agriculture, Livestock and Supply (MAPA, in Portuguese “Ministério da Agricultura, Pecuária e Abastecimento”, emerging the fruit bagging as an alternative. The aim of this study was to evaluate different kinds of protective packs for bagging persimmon fruits, in order to control pests and diseases and, consequently, improve the fruit quality. The experiment was conducted in a persimmon orchard on the experimental station of the Instituto Federal de Educação, Ciência e Tecnologia do Rio Grande do Sul (IFRS, located in the Tuiuty District, in Bento Gonçalves, RS. Were performed four treatments: control (not bagged fruits, perforated polypropylene packaging, white TNT (non woven tissue packing, and kraft brown paper packing. The harvested fruits were evaluated for weight, symptoms of caterpillars damage, presence of mealybug (Pseudococcus sp. and symptoms of Schyzothyrium pomi. The fluctuation population of Anastrepha fraterculus was performed using McPhail trap with hydrolyzed protein. Among the treatments, only the fruits protected with perforated polypropylene differ significantly from the control on the evaluations of weight and Schyzothyrium pomi symptoms. However, there was no significant difference on the damage caused by caterpillars and presence of mealybugs. The use of perforated polypropylene has demonstrated efficiency on the control of Anastrepha fraterculus, and it can be used to reduce the damage in the fruits.

  14. Hole diameters in pet bottles used for fruit fly capture

    Directory of Open Access Journals (Sweden)

    Maurico Paulo Batistella Pasini

    2015-05-01

    Full Text Available Two experiments were conducted during the period from 31 January to 6 March 2012 in Santa Maria, Rio Grande do Sul State, Brazil to determine the efficiency of different hole diameters in PET trap bottles on pests in guava and persimmon orchards. In a randomised block design in a factorial scheme, we assessed the average number adults of Anastrepha fraterculus, Ceratitis capitata (Diptera: Tephitidae and Zaprionus indianus (Diptera: Drosophilidae infruits thatemerged in two situations (in the plant and on the soil; we also assessed the number of captured adults in trap bottlesunder two conditions, different hole diameters and different days after placement of the attractive solution. Smaller diameter sizescaptured more A. fraterculus, C. capitata and Z. indianusadults. The 1.0 cm diameter was the most efficient hole size in reducing the adult emergence of Tephritidae to Z. indianus, whereas the smallest diameter hole sizes, 0.6 and 0.8 cm, showed the highest efficiencies in controlling adult emergence in persimmon fruit and guava fruit.

  15. Biological Control of Tephritid Fruit Flies in Argentina: Historical Review, Current Status, and Future Trends for Developing a Parasitoid Mass-Release Program

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2012-09-01

    Full Text Available In Argentina there are two tephritid fruit fly species of major economic and quarantine importance: the exotic Ceratitis capitata that originated from Southeast Africa and the native Anastrepha fraterculus. In recent years, the use of fruit fly parasitoids as biocontrol agents has received renewed attention. This increasing interest has recently led to the establishment of a program for the mass rearing of five million Diachasmimorpha longicaudata parasitoids per week in the BioPlanta San Juan facility, San Juan, Argentina. The first augmentative releases of D. longicaudata in Argentina are currently occurring on commercial fig crops in rural areas of San Juan as part of an integrated fruit fly management program on an area-wide basis. In this context, research is ongoing to assess the suitability of indigenous parasitoid species for successful mass rearing on larvae of either C. capitata or A. fraterculus. The purpose of this article is to provide a historical overview of the biological control of the fruit fly in Argentina, report on the strategies currently used in Argentina, present information on native parasitoids as potential biocontrol agents, and discuss the establishment of a long-term fruit fly biological control program, including augmentative and conservation modalities, in Argentina’s various fruit growing regions.

  16. Conditional lethality strains for the biological control of Anastrepha species

    Science.gov (United States)

    Pro-apoptotic cell death genes are promising candidates for biologically-based autocidal control of pest insects as demonstrated by tetracycline (tet)-suppressible systems for conditional embryonic lethality in Drosophila melanogaster (Dm) and the medfly, Ceratitis capitata (Cc). However, for medfly...

  17. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  18. First register of fruit flies (Diptera: Tephritidae in star fruit in Teresina, Altos and Parnaiba, state of Piaui, Brazil/ Primeiro registro de moscas-das-frutas (Diptera: Tephritidae em carambola nos municípios de Teresina, Altos e Parnaíba no estado do Piauí

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo Soares

    2007-08-01

    Full Text Available The present work aims to register the occurrence of the fruit flies associated to star fruit (Averrhoa carambola L. in three counties of the state of Piaui, as well as to determine the frequency and the index of infestation of these insects. The fruits had been collected during the months of August and September 2005, and had been placed in plastic trays with sterilized soil, stored in metal cages, and left in environmental temperature at the laboratory. Until emergency, the adults had been kept in bottles with alcohol 70% and later identified in the species level. The biggest index of infestation (flies/fruit of C. capitata has occurred in the county of Altos (3.66, followed by Teresina and Parnaiba that had presented index of infestation of 2.18 and 0.016, respectively. C. capitata was the most frequent species in all the counties, presenting frequencies of 100%, 96.5%, and 100% in Teresina, Altos and Parnaiba, respectively. Ceratitis capitata is registered for the first time in star fruit in Teresina, Altos and Parnaiba, state of the Piaui. Anastrepha fraterculus is registered for the first time in the county of Altos. A. fraterculus and C. capitata occur simultaneously in star fruits.O presente trabalho visou conhecer as espécies de moscas-das-frutas associadas à carambola (Averrhoa carambola L. em três municípios do Estado do Piauí, bem como determinar a freqüência e o índice de infestação desses insetos. Os frutos foram coletados durante os meses de agosto e setembro de 2005, colocados em bandejas plásticas com solo esterilizado, armazenados em gaiolas metálicas e deixados em temperatura ambiente no laboratório. Até a emergência dos adultos, estes foram acondicionados em frascos contendo álcool 70% e posteriormente identificados em nível de espécie. O maior índice de infestação (moscas/fruto de C. capitata ocorreu no município de Altos (3,66, seguido pelos municípios de Teresina e Parnaíba que apresentaram

  19. Nível de infestação de moscas-das-frutas em faixa de fronteira, no Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Naymã Pinto Dias

    2013-08-01

    Full Text Available As moscas-das-frutas são as principais pragas da fruticultura mundial, destacando-se os tefritídeos e os lonqueídeos, sendo que, sobre este último grupo de insetos, existem poucas informações a respeito do seu potencial de danos. O objetivo deste trabalho foi identificar os níveis de infestação de moscas-das-frutas, em municípios da faixa de fronteira do Rio Grande do Sul com a Argentina e o Uruguai. O estudo foi realizado em 2011 e 2012, nos municípios de Itaqui, Quaraí, Santana do Livramento e Uruguaiana, RS. Foram realizadas coletas de frutos de 19 espécies vegetais exóticas e nativas, calculando-se os índices de infestação em pupários/kg de fruto e pupários/fruto. O maior índice de infestação de Ceratitis capitata ocorreu em nectarineira, com 72,01 pupários/kg e 2,51 pupários/fruto. Anastrepha fraterculus apresentou índices elevados em cerejeira, correspondendo a 57,57 pupários/kg e 0,23 pupários/fruto. Os lonqueídeos foram representados pelos gêneros Neosilba e Lonchaea, infestando frutos de mamoeiro e caramboleira, respectivamente. Registra-se para os municípios estudados do Rio Grande do Sul a ocorrência das seguintes espécies de moscas-das-frutas: C. capitata, A. fraterculus, Neosilba zadolicha e Lonchaea sp.

  20. Diversidade de moscas-das-frutas em pomares de citros no município de Araruama, RJ Diversity of fruit flies in citrus groves in the municipality of Araruama, RJ

    Directory of Open Access Journals (Sweden)

    Jorge Ferreira de Souza

    2008-04-01

    Full Text Available O objetivo deste estudo foi determinar as espécies de Tephritidae e Lonchaeidae (Diptera: Tephritoidea de ocorrência em pomares de laranja doce (Citrus sinensis Osbeck e tangerina (Citrus reticulata Blanco, no município de Araruama, RJ, durante o período de dezembro de 2002 a novembro de 2003. Os espécimes foram coletados em armadilhas McPhail contendo solução aquosa de proteína hidrolisada a 5% e em amostras de frutos de seis variedades de citros. Nas armadilhas, o total de 2.543 adultos de Tephritoidea (1.430 fêmeas e 1.023 machos foi capturado, sendo dez espécies de Tephritidae, quatro espécies e dois morfotipos de Lonchaeidae. Dos Tephritidae e capturados nas McPhail, quatro espécies (Anastrepha fraterculus, A. obliqua, A. sororcula e Ceratitis capitata infestaram frutos cítricos, enquanto que, dos Lonchaeidae, somente os morfotipos não infestaram as amostras de citros. Os resultados demonstram que a densidade populacional das moscas-das-frutas pode ser superestimada, quando baseada no número de moscas por armadilha, devido à captura de espécies que não infestam os frutos de interesse comercial.This study was aimed at determining the species of Tephritidae and Lonchaeidae (Diptera: Tephritoidea that occur on groves of sweet orange (Citrus sinensis Osbeck and tangerine (Citrus reticulata Blanco in the municipality of Araruama, state of Rio de Janeiro, Brazil, from December, 2002 to November, 2003. The specimens were collected by McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruits samples of six varieties of citrus. In the traps the total of 2,543 adults of Tephritoidea (1,430 females and 1,023 males was captured, being ten species of Tephritidae, four species and two morphotypes of Lonchaeidae. From the Tephritidae caught by the McPhail, four species (Anastrepha fraterculus, A. obliqua, A. sororcula and Ceratitis capitata infested citric fruits while the Lonchaeidae, the morphotypes did not infest

  1. Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espírito Santo, Brazil.

    Science.gov (United States)

    Uramoto, K; Martins, D S; Zucchi, R A

    2008-10-01

    The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-July 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espírito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

  2. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão

    2008-09-01

    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  3. Diversidade de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides nas regiões Norte e Noroeste do Estado do Rio de Janeiro, Brasil Fruit fly diversity, their host plants and their parasitoids in the northern and northwestern regions of Rio de Janeiro State, Brazil

    Directory of Open Access Journals (Sweden)

    Michela Rocha Leal

    2009-06-01

    Full Text Available Em razão da exploração crescente da fruticultura nas regiões Norte e Noroeste do Estado do Rio de Janeiro e da importância econômica e quarentenária das moscas-das-frutas para essa atividade agrícola no mundo, este estudo foi conduzido em cinco municípios dessas regiões: Cambuci, Campos dos Goytacazes, Itaocara, São Francisco do Itabapoana e São João da Barra, com objetivo de registrar as espécies de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides. Os espécimes foram coletados por meio de armadilhas McPhail com solução aquosa de proteína hidrolisada a 5% e em amostras de frutos. Nas armadilhas, 4% do total de moscas-das-frutas capturadas foram Ceratitis capitata e 96% eram do gênero Anastrepha, num total de 15 espécies. Das moscas capturadas nas armadilhas, apenas seis espécies infestaram frutos entre as 12 espécies de fruteiras amostradas. Fruteiras das famílias Anacardiaceae, Malpighiaceae, Myrtaceae, Oxalidaceae, Passifloraceae e Sapotaceae foram plantas hospedeiras de moscas-das-frutas. Apenas três espécies de Anastrepha (A. fraterculus, A. sororcula e A. zenildae infestaram goiabas da variedade comercial Paluma. Os parasitóides de larvas de moscas-das-frutas encontrados foram Doryctobracon areolatus e Aganaspis pelleranoi, parasitando-as em frutos de goiabeira e de outras fruteiras nessas regiões.Due to the increase in fruit crops acreage in the northern and northwestern regions of Rio de Janeiro State and to the economic and quarantine importance of the fruit flies to this agricultural activity in the world, this study was carried out in five municipalities of these regions: Cambuci, Campos dos Goytacazes, Itaocara, São Francisco do Itabapoana, and São João da Barra, aiming to study the fruit fly species, their host plants and their parasitoids. The specimens were collected using McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruit samples. In the traps, 4% of the total

  4. Morphology of immature stages of Hemipyrellia ligurriens (Wiedemann) (Diptera: Calliphoridae) for use in forensic entomology applications.

    Science.gov (United States)

    Sukontason, Kabkaew L; Sribanditmongkol, Pongruk; Chaiwong, Tarinee; Vogtsberger, Roy C; Piangjai, Somsak; Sukontason, Kom

    2008-09-01

    In forensic investigations, all immature stages of flies (egg, larvae, and puparium) can serve as entomological evidence at death scenes. These insects are primarily used to estimate the post mortem interval (PMI), but can also be involved in the analysis of toxic substances, determining manner of death, and in indicating relocation of a corpse in homicide cases. In this study, we present the morphology of the egg, larvae, and puparium of Hemipyrellia ligurriens, a blow fly species of forensic importance in Thailand. Examination was conducted using scanning electron microscopy (SEM). The egg stage was found to display a relatively wide plastron region (or median hatch line area) that spans almost the entire length of the egg. The median hatch line is oriented in an upright position. External chorionic sculpture of the egg is present in a hexagonal pattern whose reticular boundaries are slightly elevated. In the larval stages, the most prominent morphological changes were detected upon comparison of the first to the second instar; whereas, the differences between second and third instar larvae were less obvious outside of the increase in number of posterior spiracular slits. Most of the major differences involve body size and structure of the anterior and posterior spiracles. Each anterior spiracle in both the second and third instars projects five to seven papillae apically. Each posterior spiracular disc of a third instar exhibits a complete peritreme, three spiracular slits, and a prominent button that is ventromedially located. The puparium is coarctate and features a clustered bubble membrane comprised of approximately 57 mammillate structures positioned dorsolaterally on each side of the first abdominal segment in young puparia. This feature is replaced by short, tubular respiratory horns in aged puparia. This study provides more detailed exposure of important morphological features that can be used for accurate identification of immature stages of H. ligurriens. Information presented can aid in forensic investigations involving this fly species.

  5. Ultrastructure of immature stages of the black dump fly: Ophyra aenescens (Wiedemann, 1830) (Diptera: Muscidae: Azeliinae).

    Science.gov (United States)

    Cortinhas, Lucas Barbosa; Mendonça, Paloma Martins; Barbosa, Rodrigo Rocha; Queiroz, Margareth Maria de Carvalho

    2016-06-01

    Ophyra aenescens (black dump fly) originally belonged to the New World, however, now it is spread worldwide. This fly is a mechanical vector of some pathogenic microorganisms and eggs of the human botfly (Dermatobia hominis). The adults are associated with decaying matter and the immature stages colonize animal and human corpses. It is considered an important muscid species for forensic entomology. The aim of this study was to describe the morphology of the eggs, the three larval instars and the puparia of O. aenescens using scanning electron microscopy (SEM). The spiracular opening of the first instar has an interruption in the middle of its length. Comparing to the other instar, the ventral tubercles are only developed in the first instar. The anterior spiracles have a variation in the numbers of spiracular ramification. The puparia morphology is similar to the third instar larvae, however the cephalic region is retracted and on the third thoracic segment, a respiratory structure is present. In conclusion, the SEM technique used and the results obtained are helpful to describe and differentiate the immature stages of O. aenescens and consequently support forensic and medical entomology.

  6. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  7. Nonlinear heat transport in mesoscopic conductors: Rectification, Peltier effect, and Wiedemann-Franz law

    OpenAIRE

    López, Rosa; Sánchez, David

    2013-01-01

    We investigate nonlinear heat properties in mesoscopic conductors using a scattering theory of transport. Our approach is based on a leading-order expansion in both the electrical and thermal driving forces. Beyond linear response, the transport coefficients are functions of the nonequilibrium screening potential that builds up in the system due to interactions. Within a mean-field approximation, we self-consistently calculate the heat rectification properties of a quantum dot attached to two...

  8. Mälestused minu elust / Ferdinand Johann Wiedemann ; tõlk. Kalev Jaago

    Index Scriptorium Estoniae

    Wiedemann, Ferdinand Johann

    2000-01-01

    Järg Sep/21;23;26;28;30 Oct/3;5;7;10;12;14 Ferdinand Johann Wiedemanni (1805-1887) mälestuste saksakeelne algkäsikiri aastast 1878 asub Eesti Ajaloomuuseumis Otto Greifenhageni fondis nr. 65, säilik 6. Kommentaar: Kalev Jaago

  9. Rescue of placental phenotype in a mechanistic model of Beckwith-Wiedemann syndrome

    Directory of Open Access Journals (Sweden)

    Higgins Michael J

    2010-05-01

    Full Text Available Abstract Background Several imprinted genes have been implicated in the process of placentation. The distal region of mouse chromosome 7 (Chr 7 contains at least ten imprinted genes, several of which are expressed from the maternal homologue in the placenta. The corresponding paternal alleles of these genes are silenced in cis by an incompletely understood mechanism involving the formation of a repressive nuclear compartment mediated by the long non-coding RNA Kcnq1ot1 initiated from imprinting centre 2 (IC2. However, it is unknown whether some maternally expressed genes are silenced on the paternal homologue via a Kcnq1ot1-independent mechanism. We have previously reported that maternal inheritance of a large truncation of Chr7 encompassing the entire IC2-regulated domain (DelTel7 allele leads to embryonic lethality at mid-gestation accompanied by severe placental abnormalities. Kcnq1ot1 expression can be abolished on the paternal chromosome by deleting IC2 (IC2KO allele. When the IC2KO mutation is paternally inherited, epigenetic silencing is lost in the region and the DelTel7 lethality is rescued in compound heterozygotes, leading to viable DelTel7/IC2KO mice. Results Considering the important functions of several IC2-regulated genes in placentation, we set out to determine whether these DelTel7/IC2KO rescued conceptuses develop normal placentae. We report no abnormalities with respect to the architecture and vasculature of the DelTel7/IC2KO rescued placentae. Imprinted expression of several of the IC2-regulated genes critical to placentation is also faithfully recapitulated in DelTel7/IC2KO placentae. Conclusion Taken together, our results demonstrate that all the distal chromosome 7 imprinted genes implicated in placental function are silenced by IC2 and Kcnq1ot1 on the paternal allele. Furthermore, our results demonstrate that the methylated maternal IC2 is not required for the regulation of nearby genes. The results show the potential for fully rescuing LQ trans placental abnormalities that are caused by imprinting defects.

  10. The Preimaginal Stages of Cryptotylus unicolor (Wiedemann and Tabanus nebulosus ornativentris Kroeber (Tabanidae-Diptera-Insecta

    Directory of Open Access Journals (Sweden)

    Coscarón S

    1998-01-01

    Full Text Available A larva with peculiar very long pubescence on the integument, the pupa of Cryptotylus unicolor, and the larva and pupa of Tabanus nebulosus ornativentris are described and illustrated

  11. Solar sterilization of abscised fruit: a cultural practice to reduce infestations of Anastrepha obliqua around orchards

    Science.gov (United States)

    Abscised mangoes, Mangifera indica L., of several varieties were stored under varying conditions of insolation, including no sun (stored in a laboratory), shade (stored under the shade of a mango tree), full sun (stored in direct view of the sun), and covered in a black plastic bag and stored in dir...

  12. Contribución al estudio de las moscas anastrephas en colombia.

    OpenAIRE

    González Mendoza, Rafael

    2012-01-01

    1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponder...

  13. Response of Anastrepha suspensa to liquid protein baits and synthetic lure formulations

    Energy Technology Data Exchange (ETDEWEB)

    Epsky, Nancy D.; Kendra, Paul E.; Heath, Robert R., E-mail: Nancy.Epsky@ars.usda.go, E-mail: Paul.Kendra@ars.usda.go, E-mail: Bob.Heath@ars.usda.go [U.S. Department of Agriculture (USDA/ARS/SHRS), Miami, FL (United States). Agricultural Research Service. Subtropical Horticulture Research Station

    2006-07-01

    Traps baited with AAPt captured more A. suspensa than traps baited with ABPt even when the ammonia release rates were similar. Reducing dosage of ammonia by 50% of the commercially available AA lure slightly increased female capture, but reducing dosage to 25% tended to decrease female capture. The 5% CPH/3% borax bait captured the same number of flies as TYB, and was more effective than 10% CPH/3% borax. Further decreasing the amount of borax added to CPH may improve its effectiveness. As has been observed in field tests, fresh TYB captures more A. suspensa than fresh Nulure/borax but this difference decreases as the bait solutions age. EAG analysis indicates that volatiles from fresh Nulure/ borax elicit a higher antennal response than TYB, but this difference decreases as the TYB solution ages. Chemical analysis will be needed to determine the nature of reduced capture by fresh Nulure/borax and to identify additional attractive chemicals emitted by these protein baits. (author)

  14. Pro-apoptotic gene regulation in the Caribbean fruit fly, Anastrepha suspensa

    Science.gov (United States)

    Transcriptional activation of pro-apoptotic genes in response to cytotoxic stimuli is a conserved feature of the cell death pathway proposed for metazoans. However, understanding the extent of this conservation in insects, as well as other organisms, has been limited by the lack of known pro-apoptot...

  15. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  16. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  17. Dietas naturais na criação de Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae): estudo comparado Natural diets to rear Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae): a comparative study

    OpenAIRE

    Rosemary Cardoso Ribeiro; Eliane Maria Vieira Milward-de-Azevedo

    1997-01-01

    Procurou-se observar o desenvolvimento pós-embrionário de Chrysomya albiceps, testando-se, comparativamente, dietas à base de sardinha e carne eqüina. Os substratos frescos foram previamente mantidos a 30°C de temperatura durante duas horas. Foram inoculadas 50 neolarvas em 100g de dieta por repetição. Utilizaram-se quatro repetições por tratamento. O experimento foi conduzido em condições de laboratório. O peso médio das larvas após o abandono espontâneo das dietas foi de 91,19mg, no sub...

  18. Dietas naturais na criação de Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae: estudo comparado Natural diets to rear Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae: a comparative study

    Directory of Open Access Journals (Sweden)

    Rosemary Cardoso Ribeiro

    1997-12-01

    Full Text Available Procurou-se observar o desenvolvimento pós-embrionário de Chrysomya albiceps, testando-se, comparativamente, dietas à base de sardinha e carne eqüina. Os substratos frescos foram previamente mantidos a 30°C de temperatura durante duas horas. Foram inoculadas 50 neolarvas em 100g de dieta por repetição. Utilizaram-se quatro repetições por tratamento. O experimento foi conduzido em condições de laboratório. O peso médio das larvas após o abandono espontâneo das dietas foi de 91,19mg, no substrato à base de carne eqüina e 76,01mg, no substrato à base de sardinha, a diferença foi, portanto, significativa. A taxa de sobrevivência larval registrada foi superior a 80%, enquanto a taxa de sobrevivência pupal foi próxima a 100%. A razão sexual foi próxima a 0,5. A dieta à base de carne eqüina mostrou-se mais adequada ao desenvolvimento de C. albiceps, pois as larvas mantidas neste substrato apresentaram-se mais pesadas, o que potencializa a capacidade reprodutiva do adulto.The objective of the present study was to observe the postembryonic development of Chrysomya albiceps reared on sardines or horse meat and to compare the results. Fresh substratos were maintened m an oven ai 30°C for 2 hours. Fifty newly emerged larvas were inoculated into 100g diel per reptication. Four replications per treatment were used. The experiment was conducted under laboratory conditions. The mean weight of postfeeding larvas was 91.19mg for especimens reared on horse meat and 76.01mg for especimens reared on sardines, with a marked difference between diets. Larval viability was more than 80% for the two diets, while pupal viability was dose to 100%. The sex ratio was about 0.5. The horse meat diet proved to be more adequate for the development of C. albiceps since the larvas weighed more, with consequent potentiations of adult reproductive abilily.

  19. Influência da dieta no desenvolvimento oogênico de Fannia pusio (Wiedemann, 1830 (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1990-01-01

    Full Text Available Females of Fannia pusio were submitted to three different diets (sugar, fish and sugar + liver, which influence in the oogenetic development was observed. The oogenesis was completed in the 15th. day, both under sugar or sugar + liver diets. This species proved to be autogenous for the first ovarian cycle.

  20. Estudo morfologico e histoquimico das glandulas sexuais acessorias de chrysomya putoria durante a ovogenese (wiedemann) (diptera : calliphoridae)

    OpenAIRE

    1995-01-01

    Resumo: Chrysomya putoria é uma mosca varejeira normalmente associada a locais com precárias condições de higiene. Na natureza ela cria-se em carcaças e no esterco que acumula-se sob as gaiolas de galinhas poedeiras. Esta mosca está no Brasil a cerca de duas décadas mas na Áftica, seu local de origem, ela é descrita como díptero causador facultativo de miíase. As glândulas sexuais acessórias de temeas tem um importante papel em diferentes etapas da fertilização do ovo e sua ausência experimen...

  1. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  2. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  3. MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 1.1

    Science.gov (United States)

    This monograph is a compendium of all plant species reported as hosts of C. capitata (or potential hosts based on mere appearance on some lists). There are 353 species (312 have valid genera and species names and 41 have species identified as "sp." or "spp.") included in the monograph; 79 species ha...

  4. Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) as a natural enemy to Peckia chrysostoma (Wiedemann) (Diptera: Sarcophagidae), in Brazil.

    Science.gov (United States)

    Marchiori, C H; Pereira, L A; Filho, O M

    2003-02-01

    This paper reports the first occurence of the parasite Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) which was collected from Peckia chrysostoma pupae (Diptera: Sarcophagidae) by means of traps containing some fish baits in a wood area close to the Agronomy college (Faculdade of Agronomia) in Itumbiara, Goiás, in the period from March to September, 2001. A total of 362 gregarious specimens of parasitoids from 26 pupae of P. chrysostoma. Aphaereta sp. was collected, with several individuals emerging from the same pupae.

  5. Influência da dieta no desenvolvimento oogênico de Fannia pusio (Wiedemann, 1830) (Diptera, Fanniidae)

    OpenAIRE

    Márcia Souto Couri

    1990-01-01

    Females of Fannia pusio were submitted to three different diets (sugar, fish and sugar + liver), which influence in the oogenetic development was observed. The oogenesis was completed in the 15th. day, both under sugar or sugar + liver diets. This species proved to be autogenous for the first ovarian cycle.

  6. Toxicity of naturally occurring Bio-fly and chitosan compounds to control the Mediterranean fruit fly Ceratitis capitata (Wiedemann).

    Science.gov (United States)

    Rabea, E I; Nasr, H M; Badawy, M E I; El-Gendy, I R

    2015-01-01

    The efficacy of five compounds of a biopolymer chitosan and Bio-fly (Beauveria bassiana fungus) as biopesticide was evaluated on Ceratitis capitata under laboratory conditions. The inhibitory effects on acetylcholinesterase (AChE) and adenosinetriphosphatase (ATPase) as biochemical indicators were also determined in vivo. The results indicated that B. bassiana based Bio-fly exhibited significant toxicity against C. capitata (LC50 = 3008 and 3126 mg/L after 48 h in females and males, respectively) followed by the derivatives of chitosan, N-(4-propylbenzyl)chitosan and N-(2-nitrobenzyl)chitosan. Bio-fly displayed remarkable inhibition of AChE activity (IC50 = 2220 mg/L) while N-(2-chloro,6-flourobenzyl)chitosan, N-(4-propylbenzyl)chitosan and N-(3,4-methylenedioxybenzyl) chitosan had no significant difference in inhibitory action. In adult males, N-(2-nitrobenzyl)chitosan exhibited the highest inhibitory action (IC50 = 6569 mg/L). In addition, the toxic effects of the tested compounds on the activity of ATPase indicated that highly significant inhibition was found with N-(4-propylbenzyl)chitosan with an IC50 of 8194 and 8035 mg/L, in females and males, respectively.

  7. Bionomy of two flies of sanitary and forensic importance: Peckia (Sarcodexia lambens (Wiedemann and Oxysarcodexia amorosa (Schiner (Diptera, Sarcophagidae

    Directory of Open Access Journals (Sweden)

    Alexandre da Silva Xavier

    2015-09-01

    Full Text Available ABSTRACTThis study aims to elucidate the bionomy of Peckia(Sarcodexia lambens and Oxysarcodexia amorosa to provide data for medical, veterinary and forensic entomology analyses. We analyzed larval stage duration (L1–L3, weight of the mature larvae (L3, pupal stage duration, L1–adult duration, adult emergence and viability of larvae and adults of both species. Larval viability of P. (S. lambens was 82% and the mean duration of the larval stage was 3.51 ± 0.99 days. The mature larvae had a mean weight of 33.67 ± 7.13 mg. The mean duration of the pupal stage was 8.26 ± 0.93 days and the mean duration of the L1–adult was 11.53 ± 1.22 days. Mean lifespan for females and males was 39.33 ± 1.52 and 57.33 ± 4.72 days, respectively. Larval viability of O. amorosa was 76% and mean duration of larval stage was 3.51 ± 0.64 days. Mature larvae had a mean weight of 28.28 ± 3.38 mg. Mean duration of the pupal stage was 10.14 ± 0.63 days and mean duration of the L1–adult was 13.60 ± 0.69 days. Mean lifespan for females and males was 83.66 ± 15.94 and 84.00 ± 19.97 days, respectively. Oxysarcodexia amorosa showed a L1–adult stage longer than P. (S. lambens; however both species showed low viability. O. amorosa laid more larvae than P. (S. lambens, this fact may occur because O. amorosa had longer life duration.

  8. INFESTAÇÃO DE MOSCAS-DAS-FRUTAS EM VARIEDADES DE MANGA (Mangifera indica L. NO ESTADO DE GOIÁS INFESTATION OF FRUIT FLY IN VARIETIES OF MANGO IN THE STATE OF GOIÁS

    Directory of Open Access Journals (Sweden)

    Juracy Rocha Braga Filho

    2007-09-01

    Full Text Available

    A mangueira (Mangifera indica L. é a principal espécie frutífera da família Anacardiaceae cultivada no Brasil. A expansão dessa cultura nos últimos anos, tanto para o consumo in natura como para a exportação, é limitada por diversas pragas, principalmente pelas moscas-das-frutas. No período de setembro de 1999 a fevereiro de 2000 foi estudado o nível de infestação natural de moscas-das-frutas em dez variedades de manga, em três municípios do Estado de Goiás. Foram obtidos 1.195 pupários, dos quais emergiram 484 adultos de Anastrepha (80% dos insetos identificados, 104 lonqueídeos (17,2 % e 17 braconídeos (2,8%. Das fêmeas identificadas, 77,9% pertenciam ao gênero Anastrepha e 22,08%, a Neosilba. As espécies identificadas foram: A. obliqua (48,78%, A. fraterculus (47,97%, A. sororcula (2,03% e A. turpiniae (1,22%, referida pela primeira vez em frutos de manga no Estado. O parasitóide Doryctobracon areolatus foi encontrado em larvas/pupas de moscas-das-frutas, nas variedades Imperial e Tommy Atkins. As variedades com maiores índices de infestação foram Imperial (15,3 pupários/fruto e 73,611 pupários/kg de frutos, em Goiânia, e Tommy Atkins (7,0 pupários/fruto e 17,503 pupários/kg de frutos, no município de Orizona. Em Goiânia, a variedade Bourbon não foi infestada, e a Sabina apresentou um índice de infestação de 0,076 pupários/fruto e 0,363 pupários/ kg de frutos.

    PALAVRAS-CHAVE: Insecta; Diptera; Tephritoidea; avaliação de danos; parasitóides.

    Mango (Mangifera indica L. production has expanded greatly in Brazil but several pests, especially fruit flies, have limited both fresh fruit consumption and

  9. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  10. Dietas artificiais para a criação de larvas e adultos da mosca-das-frutas sul-americana

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2013-10-01

    Full Text Available O objetivo deste trabalho foi adequar as dietas artificiais para o desenvolvimento dos estágios de larva e adulto da mosca-das-frutas sul-americana (Anastrepha fraterculus. Para o estágio larval, foram testadas as seguintes dietas: D1, original, com 10 g de ágar; D2, modificada, com 3,6 g de ágar; e, D3, modificada, com bagaço seco de cana-de-açúcar. Para os adultos, foram testadas quatro dietas: A, levedura de cerveja + mel (2:1; B, açúcar refinado + extrato de levedura + gérmen de trigo cru (3:1:1; C, extrato de soja + açúcar mascavo + gérmen de trigo cru (3:1:1; e D, levedura seca de cervejaria + mel (2:1. Avaliaram-se os parâmetros biológicos de duração do período ovo-pupa, duração e viabilidade do estágio de pupa, massa média de pupas, razão sexual e duração e viabilidade do período ovo-adulto. O desenvolvimento larval em D1 e D2 foi semelhante e indicou que a criação de larvas pode ser realizada com 1/3 da quantidade de ágar da utilizada em D1. A utilização do bagaço seco de cana-de-açúcar, na dieta artificial, afetou negativamente o desenvolvimento larval. As dietas artificiais com levedura de cerveja + mel e com açúcar refinado + extrato de levedura + gérmen de trigo cru são as mais adequadas para a criação de adultos.

  11. The Wiedemann-Franz law in the putative one-dimensional metallic phase of PrBa2Cu4O8

    Science.gov (United States)

    Bangura, A. F.; Xu, Xiaofeng; Wakeham, N.; Peng, N.; Horii, S.; Hussey, N. E.

    2013-11-01

    The nature of the electronic state of a metal depends strongly on its dimensionality. In a system of isolated conducting chains, the Fermi-liquid (quasiparticle) description appropriate for higher dimensions is replaced by the so-called Tomonaga-Luttinger liquid picture characterized by collective excitations of spin and charge. Temperature is often regarded as a viable tuning parameter between states of different dimensionality, but what happens once thermal broadening becomes comparable to the interchain hopping energy remains an unresolved issue, one that is central to many organic and inorganic conductors. Here we use the ratio of the thermal to electrical conductivities to probe the nature of the electronic state in PrBa2Cu4O8 as a function of temperature. We find that despite the interchain transport becoming non-metallic, the charge carriers within the CuO chains appear to retain their quasiparticle nature. This implies that temperature alone cannot induce a crossover from Fermi-liquid to Tomonaga-Luttinger-liquid behaviour in quasi-one-dimensional metals.

  12. Genetics differentiation in the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)%地中海实蝇地理种群遗传分化研究

    Institute of Scientific and Technical Information of China (English)

    林丽莉; 曾玲; 梁广文; 吴佳教; 顾渝娟; 刘海军; 胡学难

    2010-01-01

    以mtDNA的CO Ⅰ基因的部分序列作为分子标记,研究了来自安哥拉、黎巴嫩、刚果共和国、尼日利亚、贝宁、多哥、加纳、科特迪瓦、南非、埃及、法国、约旦、秘鲁、智利、美国佛罗里达和美国夏威夷等16个国家和地区共75个个体的地中海实蝇Ceratitis capitaza地理种群序列特征和单倍型特征,并分析了各种群间的遗传分化水平和进化关系,结果表明,在供试的样品中发现单倍型的数目是29,其中有5种为共享倍型.地中海实蝇各地理种群的遗传多态性水平差异较大,总体遗传距离D等于0.007.非洲南撒哈拉区(安哥拉、刚果、尼日利亚、贝宁、多哥、加纳、科特迪瓦)的种群的单倍型数、单倍型百分比和群内遗传距离等遗传多态性参数值都高于其它供试地区,多样性明显较其他地区丰富.

  13. Efeito do ensacamento dos frutos no controle de pragas e doenças e na qualidade e maturação de maçãs 'Fuji Suprema'

    Directory of Open Access Journals (Sweden)

    Rosângela Teixeira

    2011-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de embalagens de diferentes materiais para a proteção contra pragas e doenças e seu efeito sobre a qualidade físico-química, maturação e teor de cálcio (Ca em maçãs 'Fuji Suprema'. O experimento foi desenvolvido nas safras de 2007/2008 e 2008/2009, em pomar manejado sob o sistema orgânico, localizado na região de São Joaquim (SC. O pomar era composto por plantas de dez anos de idade da cultivar Fuji Suprema, sobre porta-enxerto 'Marubakaido', com interenxerto 'EM-9'. Depois do raleio manual, aproximadamente 40 dias após a plena floração, os frutos foram ensacados com embalagens plásticas transparentes microperfuradas ou de tecido não texturizado (TNT. Os frutos foram mantidos ensacados até a colheita. A testemunha foi constituída por frutos não ensacados. Na colheita, os frutos foram avaliados quanto aos danos provocados por mosca-das-frutas (Anastrepha fraterculus, mariposa oriental (Grapholita molesta e lagarta enroladeira (Bonagota salubricola. As doenças foram avaliadas pela incidência de sarna da macieira (Venturia inaequalis, podridão amarga (Colletotrichum gloeosporioides e podridão carpelar (Alternaria sp., Fusarium sp.. Também foi avaliada a incidência de distúrbios fisiológicos "russeting" e "bitter pit", atributos físico-químicos de maturação e qualidade e o teor de Ca nos frutos. Independentemente do tipo de embalagem verificou-se que o ensacamento é prática eficaz na proteção contra o ataque de insetos, mas não reduz a incidência e o desenvolvimento de doenças nos frutos. Na safra de 2008/2009, o ensacamento dos frutos aumentou o teor de Ca e reduziu a incidência de "bitter pit", e aumentou a incidência do "russeting". O ensacamento dos frutos antecipou a maturação, especialmente com embalagem plástica transparente microperfurada, e reduziu a coloração vermelha, especialmente com embalagem TNT.

  14. Biological and morphological aspects of Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) on irradiated larva of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae);Aspectos biologicos e morfologicos de Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) criado em larvas irradiadas de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Valle, Giuliana Etore do

    2006-07-01

    The objective of this work was evaluate some biological and morphological aspects of Diachasmimorpha longicaudata on irradiated and not irradiated larva of bisexual and tsl strains of Ceratitis capitata. The experiments were developed at the Laboratorio de Irradiacao de Alimentos e Radioentomologia (LIARE) of CENA/USP. For gamma radiation treatment it was used a Cobalt-60 source, model Gamma beam-650. Larva of bisexual strain were irradiated with 65 Gy and the tsl strain with 45 Gy. Experiments were carried out at room temperature of 25 +- 2 deg C, 75 +- 5 % RH and 14 hours of photo phase. After irradiation, the bisexual strain larva were exposed to adults of D. longicaudata for parasitization and parameters of percentage adult emergency and rate of male and female of D. longicaudata were observed. For tsl strain, were used larva from the first and the fourth collection only, and the following parameters were observed: percentage of adult emergency, rate of male and female, and the average unitary volume and weight of pupae at the 8{sup th} and 16 days after the parasitism date. Other parameters evaluated for tsl strain related to the parasitoid morphology such as, the length of the body, antenna, tibia and ovipositor. As result, both of the first and second experiments, the rate of parasitism was satisfactory, as well as showed larger incidence of females than males in parasitized larva, discarding the possibility that gamma radiation interfere in the sexual rate. No significant differences were observed on pupae volume. Some differences on pupae weight were observed at 8th and 16th day after the parasitism date, which should be associated to pre-emerging flies (8th day) and empty pupa (16th day). None significant difference was observed on morphological parameters, so one can conclude that gamma radiation treatment did not interfere in these quality parameters of the parasitoid. (author)

  15. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas vezes, tem sido ineficiente, devido ao desenvolvimento de populações de insetos resistentes. Assim, tem surgido a necessidade de pesquisas com novas formas de controle eficazes e menos impactantes. Nesse sentido, a utilização de nematóides entomopatogênicos e extratos vegetais tem se mostrado eficiente para o controle dessa praga. No entanto, são necessários estudos para avaliar a compatibilidade entre esses métodos, visando o seu uso, em programas de manejo integrado, para essa praga. O objetivo desse trabalho foi avaliar a compatibilidade dos nematóides Steinernema carpocapsae ALL e Heterorhabditis sp. JPM4 com os extratos aquosos, preparados com vegetais secos da folha, ramo e fruto de cinamomo (Melia azedarach, folha de arruda (Ruta graveolens, gengibre (Zingiber officinales e alho (Allium sativum visando o controle de C. capitata. O bioensaio foi conduzido em delineamento inteiramente casualizado, com quatro repetições, por tratamento. Cada repetição foi constituída de um tubo de vidro, contendo 1 mL de extrato vegetal, 40% p/v e 1 mL de suspensão de nematóide entomopatogênico, com 1800 JI/mL, para S. carpocapsae ALL e 600 JI/mL, para Heterorhabditis sp. JPM4. Foi avaliada a viabilidade dos nematóides e a infectividade desses sobre larvas de C. capitata, após 48 e 120 horas. Verificou-se que todos os extratos reduziram a viabilidade e a infectividade de ambos os nematóides, sendo incompatíveis, após 120 horas de exposição. O nematóide Heterorhabditis sp. JPM4 foi mais sensível em relação ao S. carpocapsae ALL, pois apresentou, nas primeiras 48 horas redução na viabilidade e infectividade superior a 80 e 75%, respectivamente, quando exposto a todos os extratos, exceto o de gengibre.

  16. New record of Pterotaenia fasciata (Wiedemann (Diptera, Ulidiidae in Brazil, a probably mechanical vector of enteric bacteria Novo registro de Pterotaenia fasciata (Wiedemann (Diptera, Ulidiidae no Brasil, um provável vetor mecânico de enterobactérias

    Directory of Open Access Journals (Sweden)

    Anderson Sena Barnabe

    2007-03-01

    Full Text Available Pterotaenia fasciata is commonly recorded in rural areas in Argentina, but during a Diptera survey study developed in a reservoir which retains storm water from polluted canals in an urban area of Taboão da Serra municipality, SP, Brazil, we could capture P. fasciata adults. Enteric bacteria Escherichia coli T. Escherich, 1885 and Proteus sp. were isolated from P. fasciata collected in traps inside the reservoir and around it. Fecal coliforms and E. coli were found in the water of the reservoir. These records suggest that a high abundance of this species at urban areas with inadequate sewage canals should reveal these muscoid dipterans as mechanical vectors of enteric bacteria.Pterotaenia fasciata é encontrada freqüentemente em áreas rurais na Argentina, mas durante um estudo de levantamento de Diptera em um reservatório de retenção de enchentes em uma área urbana do município de Taboão da Serra, SP, Brasil, foram capturados adultos de P. fasciata. As enterobactérias Escherichia coli T. Escherich, 1885 e Proteus sp. foram isoladas de P. fasciata coletada em armadilhas no reservatório e em seu entorno. Coliformes fecais e E. coli foram encontrados na água do reservatório. Esses registros sugerem que a alta abundância dessa espécie em áreas urbanas sem saneamento básico poderia indicar esses dípteros muscóides como vetores mecânicos de enterobactérias.

  17. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  18. 墨西哥按实蝇在我国的适生性分析%Analysis of the suitability of Mexican fruit fly, Anastrepha ludens in China

    Institute of Scientific and Technical Information of China (English)

    耿建; 李志红; 万方浩; 王之岭

    2008-01-01

    墨西哥按实蝇是美洲地区严重危害水果生产的一种重要害虫.本研究采用CLIMEX模型与ArcGIS分析相结合的预测方法,明确了墨西哥按实蝇的CLIMEX参数指标体系和适生性评判标准,分析了该实蝇在我国的的适生范围和适生程度.研究发现冬季低温构成了影响墨西哥按实蝇分布的主要限制因素,墨西哥按实蝇在我国南部较为适生,分布在16.43~27.12°N,97.67~121.29°E和28.19~30.83°N,102.53~108.42°E范围内,其中云南、广西、广东、海南和台湾5省入侵并适生的可能性较高.鉴于该实蝇在我国南方地区适生范围较广,适生程度较高,我国应加强墨西哥按实蝇的植物检疫措施力度,严防该虫的传入.

  19. Biodemography of a long-lived tephritid: Reproduction and longevity in a large cohort of female Mexican fruit flies, Anastrepha ludens

    Science.gov (United States)

    Carey, James R.; Liedoc, Pablo; Muüller, Hans-Georg; Wang, Jane-Ling; Senturke, Damla; Harshman, Lawrence

    2008-01-01

    Age of sexual maturity, daily and lifetime reproductive rates, and life span were recorded in a laboratory cohort of Mexican fruit flies consisting of over 1100 females maintained individually. The results revealed that, relative to the medfly, the Mexfly is slower maturing (14 vs 17 days), more fecund (1400 vs 650–1100 eggs/female), and longer lived (50 vs 35 days). The results reinforced the generality of several earlier findings on the medfly including the deceleration of mortality at older ages and the weakness of the correlation between the rate of egg laying at early ages and both subsequent reproduction and remaining longevity. Discussion includes perspectives on the role of artificial selection in shaping the demographic traits of the mass-reared strain of Mexfly used in this study, as well as the overall significance of large scale biodemographic studies in understanding aging and longevity. PMID:16154309

  20. Relative utility of arrhenotokous and Wolbachia-associated thelytokous Odontosema anastrephae figitid fruit fly parasitoids for mass rearing and biological control

    Science.gov (United States)

    Thelytokous parasitoid strains are theoretically advantageous when utilized for biological control, as the absence of males should reduce production costs and potentially increase field efficacy. The maternally inherited intracellular bacterium, Wolbachia pipientis, is capable of inducing reproducti...

  1. Disease: H00713 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H00713 Beckwith-Wiedemann syndrome Beckwith-Wiedemann syndrome (BWS) is an imprinti...clinical pictures. ICD-10: Q87.3 MeSH: D001506 OMIM: 130650 PMID:20803657 Choufani S, Shuman C, Weksberg R Beckwith-Wiedemann...ith AC, Squire J, Sadowski P Beckwith-Wiedemann syndrome demonstrates a role for ...Silver-Russell and Beckwith-Wiedemann syndromes: opposite (epi)mutations in 11p15 result in opposite clinica...to Y, Weksberg R, Riccio A, Murrell A Disruption of genomic neighbourhood at the imprinted IGF2-H19 locus in Beckwith-Wiedemann

  2. Disease: H00462 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H00462 Stuve-Wiedemann syndrome Stuve-Wiedemann syndrome is an autosomal recessivel...37502 OMIM: 601559 PMID:8723080 (description) Wiedemann HR, Stuve A. Stuve-Wiedemann...eukemia inhibitory factor receptor (LIFR) mutations in Stuve-Wiedemann/Schwartz-Jampel type 2 syndrome. Am J Hum Genet 74:298-305 (2004) ... ...e) Gaspar IM, Saldanha T, Cabral P, Vilhena MM, Tuna M, Costa C, Dagoneau N, Daire VC, Hennekam RC Long-term follow-up in Stuve-Wiede...mann syndrome: a clinical report. Am J Med Genet A 146A:

  3. Síndrome de Beckwith-Wiedmann: relato de caso da intervenção fonoaudiológica Beckwith-Wiedemann syndrome: case report of speech therapy intervention

    Directory of Open Access Journals (Sweden)

    Bárbara de Lavra-Pinto

    2011-04-01

    Full Text Available TEMA: descrever a evolução de um caso de Síndrome de Beckwith-Wiedmann com macroglossia submetido à fonoterapia quanto aos aspectos estruturais e miofuncionais do sistema estomatognático. PROCEDIMENTOS: inicialmente foram coletados os dados do prontuário e foi realizada a entrevista inicial com a mãe. Após, a paciente, com 1 ano e 2 meses de idade, foi submetida à avaliação fonoaudiológica clínica e foram realizados exames complementares (avaliação otorrinolaringológica, exame videofluoroscópico e avaliação audiológica. Após seis meses de terapia miofuncional com a utilização de técnicas passivas, foi realizada uma reavaliação. RESULTADOS: na avaliação fonoaudiológica inicial observou-se flacidez de lábios e bochechas; ausência de vedamento labial; língua com tensão diminuída, hemi-hipertrofia direita e acentuada projeção anterior; dificuldades na mastigação e na deglutição de alimentos sólidos. Decorridos seis meses de terapia miofuncional, constatou-se maior rigidez da musculatura de lábios e bochechas, posteriorização da língua com aumento da tensão muscular, e desempenho adequado na mastigação e deglutição de alimentos sólidos. CONCLUSÃO: a intervenção fonoaudiológica precoce, baseada em técnicas de terapia miofuncional, apresentou resultados considerados satisfatórios para este caso de Síndrome de Beckwith-Wiedmann com macroglossia.BACKGROUND: describe structural and myofunctional aspects of the stomatognathic system for a case of Beckwith-Wiedmann syndrome with macroglossia that received speech therapy intervention. PROCEDURES: first, the patient clinical data was collected from hospital files. An initial interview was carried through with the mother. Then, the patient was submitted to a clinical myofunctional evaluation. Some additional complementary examinations were also held (otolaryngological assessment, videofluoroscopy examination and audiological evaluation. After six months of myofunctional therapy using passive techniques, the patient was revaluated. RESULTS: in the first myofunctional evaluation we noted lips and cheeks' flabbiness, absence of lip seal and tongue with reduced tension, right hemihypertrophy and significant anterior projection. Difficulties in mastication and swallowing of solid food were also observed. After six months of myofunctional therapy, an increase in lips and cheeks' muscle stiffness, tongue posteriorisation with superior muscular tension, and appropriate performance in mastication and swallowing of solid food were evidenced. CONCLUSION: a precocious speech-therapy intervention, based on myofunctional therapy techniques, showed good results in this case - Beckwith-Wiedmann syndrome with macroglossia.

  4. Field trials of solid triple lure (trimedlure, methyl eugenol, raspberry ketone, and DDVP) dispensers for detection and male annihilation of Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel) and Bactrocera cucurbit

    Science.gov (United States)

    Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers and Mallet CMR (ceralure, ME, RK, benzyl acetate) wafers impregnated with DDVP insecticide were evaluated in traps as potential detection and male annihilation devices. Comparisons were made with 1) liquid lure a...

  5. Extensive investigation of the IGF2/H19 imprinting control region reveals novel OCT4/SOX2 binding site defects associated with specific methylation patterns in Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Abi Habib, Walid; Azzi, Salah; Brioude, Frédéric; Steunou, Virginie; Thibaud, Nathalie; Das Neves, Cristina; Le Jule, Marilyne; Chantot-Bastaraud, Sandra; Keren, Boris; Lyonnet, Stanislas; Michot, Caroline; Rossi, Massimiliano; Pasquier, Laurent; Gicquel, Christine; Rossignol, Sylvie; Le Bouc, Yves; Netchine, Irène

    2014-11-01

    Isolated gain of methylation (GOM) at the IGF2/H19 imprinting control region 1 (ICR1) accounts for about 10% of patients with BWS. A subset of these patients have genetic defects within ICR1, but the frequency of these defects has not yet been established in a large cohort of BWS patients with isolated ICR1 GOM. Here, we carried out a genetic analysis in a large cohort of 57 BWS patients with isolated ICR1 GOM and analyzed the methylation status of the entire domain. We found a new point mutation in two unrelated families and a 21 bp deletion in another unrelated child, both of which were maternally inherited and affected the OCT4/SOX2 binding site in the A2 repeat of ICR1. Based on data from this and previous studies, we estimate that cis genetic defects account for about 20% of BWS patients with isolated ICR1 GOM. Methylation analysis at eight loci of the IGF2/H19 domain revealed that sites surrounding OCT4/SOX2 binding site mutations were fully methylated and methylation indexes declined as a function of distance from these sites. This was not the case in BWS patients without genetic defects identified. Thus, GOM does not spread uniformly across the IGF2/H19 domain, suggesting that OCT4/SOX2 protects against methylation at local sites. These findings add new insights to the mechanism of the regulation of the ICR1 domain. Our data show that mutations and deletions within ICR1 are relatively common. Systematic identification is therefore necessary to establish appropriate genetic counseling for BWS patients with isolated ICR1 GOM.

  6. Fomentar el uso de las TIC, para facilitar los procesos de educación personalizada en los estudiantes del grado 5-3 de la I.E. Monseñor Victor Wiedemann de Medellín

    OpenAIRE

    2013-01-01

    Tesis (Especialista en Educación Personalizada). Universidad Católica de Manizales, Facultad de Educación, 2013 Hoy en día es innegable el impacto de las TIC a nivel mundial, están presentes en todos los ámbitos sociales y con mayor auge y velocidad en el de las telecomunicaciones y la información. En el ámbito educativo se vienen incorporando éstas como los medios para lograr aprendizajes más significativos, ya que permiten nuevas formas de comunicación e interacción, a partir de redes de...

  7. Closely related Wolbachia recovered from different genera of Mexican Thelytokous figitidae (Hymenoptera)

    Science.gov (United States)

    Closely related novel Wolbachia strains were recovered from the thelytokous figitids Odontosema anastrephae Borgmeier and Aganaspis alujai Ovruski et al. No Wolbachia were detected in a bi-sexual strain of O. anastrephae. While the presence or absence of Wolbachia does not demonstrate that Wolbachia...

  8. Studies on male genitalia of sarcophagidae (Diptera based on scanning electron microscope observations Estudos sobre a genitália masculina de Sarcophagidae (Diptera baseados em observações de microscópio de varredura

    Directory of Open Access Journals (Sweden)

    Antônio Cesar Rios Leite

    1989-06-01

    Full Text Available Male genitalia of Oxyvinia exicisa (Lopes, Oxysarcodexia thomax (Walker, O. fluminensis Lopes, Sarcodexia lambens (Wiedemann, Peckia chrysostoma (Wiedemann and Liopygia ruficornis (Fabricius were studied based on scanning electron microscope photography. Some important details were evidentiated with this method.As genitálias dos machos de Oxyvinia excisa (Lopes, Oxysarcodexia tornax (Walker, O. fluminensis Lopes, sarcodexia lambens (Wiedemann, Peckia chrysostoma (Wiedemann e Liopygia ruficornis (Fabricius foram estudadas com base em fotografias de microscópio de varredura. Alguns detalhes importantes foram evidenciados por este método.

  9. Weizenbergi portreeskulptuurid tagasi Eestis

    Index Scriptorium Estoniae

    2006-01-01

    Soome Kirjanduse Selts annab Eesti Kunstimuuseumile eksponeerimiseks 123 aastat tagasi omandatud portreeskulptuurid neljast eesti kirjanikust: Lydia Koidula, Friedrich Reinhold Kreutzwald, Anna Haava ja Ferdinand Johann Wiedemann

  10. 7 CFR 319.56-44 - Untreated grapefruit, sweet oranges, and tangerines from Mexico for processing.

    Science.gov (United States)

    2010-01-01

    ... program using sterile insect technique for Mexican fruit fly. (h) Compliance agreements. Processing plants... Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE FOREIGN... technique for the Mexican fruit fly (Anastrepha ludens). (b) Fruit fly trapping protocol. (1)...

  11. 78 FR 6227 - Importation of Fresh Apricots From Continental Spain

    Science.gov (United States)

    2013-01-30

    ... fly (Medfly), Ceratitis capitata Wiedemann, The plum fruit moth, Cydia funebrana (Treitschke), Leaf...: Apiognomonia erythrostoma (Pers.), a brown rot fungus; Ceratitis capitata Wiedemann, the Mediterranean fruit... fruit would be cut open to inspect for the internal pest C. capitata. If any of these quarantine...

  12. Disease: H00718 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available a00310(64324) Lysine degradation NSD1 [HSA:64324] [KO:K15588] Beckwith-Wiedemann syndrome [DS:H00713] is a d...h A, Gicquel C, Cormier-Daire V, Colleaux L Paradoxical NSD1 mutations in Beckwith-Wiedemann

  13. Avaliação de atrativos alimentares utilizados no monitoramento de mosca-das-frutas em pessegueiro na lapa- PR Food attractants used in the monitoring of fruit flies in peach trees in lapa, Paraná (PR, Brazil

    Directory of Open Access Journals (Sweden)

    Lino Bittencourt Monteiro

    2007-04-01

    Full Text Available As moscas-das-frutas do gênero Anastrepha são uma praga-chave na cultura do pessegueiro no Paraná. Atrativos alimentares foram testados para determinar a sua eficiência no monitoramento de moscas-das-frutas capturadas em frascos caça-moscas McPhail. O experimento foi conduzido por três anos, sendo que, em 2002, foram testados como atrativo o suco de uva da marca Maguari®, o hidrolisado enzimático de proteína da marca BioAnastrepha® e o vinagre da marca Chemin Agrin®. Nos dois anos seguintes, o vinagre foi substituído pelo composto protéico hidrolisável da marca Torula®. As substâncias atrativas à base de proteína foram as mais eficientes na captura de Anastrepha spp., e as capturas ocorreram antecipadas em relação ao suco de uva. De acordo com os resultados, recomendam-se atrativos à base de proteína para monitoramento de Anastrepha spp em pessegueiro, na Lapa.Fruit flies of Anastrepha genus are a key pest in peach trees in Paraná. Food attractants were tested to determine their efficiency in monitoring fruit flies captured in McPhail fly traps. The experiment was conducted over a period of three years. In 2002 the following attractors were tested: Maguari® brand grape juice, BioAnastrepha® brand hydrolyzed enzymatic protein and Chemin Agrin® vinegar. Over the next two years, the vinegar was replaced by Torula® hydrolyzed protein compound. Protein-based attractants were the most efficient in trapping Anastrepha spp. and captured flies earlier comparing to grape juice. According to the results, the use of protein-based attractants for monitoring Anastrepha spp in the Lapa peach trees was recommended.

  14. 76 FR 51934 - Determination of Pest-Free Areas in Mendoza Province, Argentina; Request for Comments

    Science.gov (United States)

    2011-08-19

    ... of that country as being free of Ceratitis capitata, Mediterranean fruit fly (Medfly). Specifically... recognize additional areas as pest-free areas for Mediterranean fruit fly (Ceratitis capitata) in Argentina... Ceratitis capitata, the Mendoza province of Argentina also be recognized as free of A. fraterculus. \\2\\...

  15. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  16. Prevratim Tallinn v novõje Kannõ / Alina Zelimhanova

    Index Scriptorium Estoniae

    Zelimhanova, Alina

    2004-01-01

    Sihtasutuse "Eesti film" kutsel saabusid Tallinna Taani kinoinstituudi direktor Henning Camre ja teleajakirjanik Vinka Wiedemann, kes koos Soome Filmi Sihtasutuse tootmiskonsultandi Erkki Astalaga olid kutsutud koostama Eesti filmikunsti uut pikaajalist arengustrateegiat

  17. Euroopa eksperdid käisid eesti filmi nõustamas / M. T.

    Index Scriptorium Estoniae

    M. T.

    2004-01-01

    Sihtasutuse "Eesti film" kutsel saabusid Tallinna Taani kinoinstituudi direktor Henning Camre ja teleajakirjanik Vinka Wiedemann, kes koos Soome Filmi Sihtasutuse tootmiskonsultandi Erkki Astalaga olid kutsutud koostama Eesti filmikunsti uut pikaajalist arengustrateegiat

  18. Contribuição ao conhecimento da tribu Ormiini. III: gênero Euphasiopteryx Townsend, 1915 (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    Omar Tavares

    1965-01-01

    Full Text Available This is a contribution to the knowledge of the Tribu Ormiini in wich the author presents redescriptions of euphasiopteryx depleta (Wiedemann, 1830, Euphasiopteryx ochracea (Bigot, 1888 and describes a new species: Euphasiopteryx rosenoi sp. n. from Brazil.

  19. [Dipterans of forensic interest in two vegetation profiles of cerrado in Uberlândia, State of Minas Gerais, Brazil].

    Science.gov (United States)

    Rosa, Thiago A; Babata, Micaela L Y; De Souza, Carina M; De Sousa, Danielle; De Mello-Patiu, Cátia A; Mendes, Júlio

    2009-01-01

    Carrion breeding insects may be of great utility in crimes briefing. Studies on forensic entomology are restricted to few localities in Brazil and very few of them were done in the cerrado vegetation (a type of Savannah) until now. This work aimed to survey the main species of dipterans associated with the decomposition process of Sus scrofa and the insect succession pattern in carcasses in the Cerrado. The study was carried out in the dry and humid season of the year, in two cerrado vegetation profiles in Uberlândia, MG. Two pig carcasses were placed in each vegetation profile and time period of the year. The decomposition process was slower and insects were more abundant in the dry season. Differences in temperature, air humidity and pluvial precipitation seemed to be the main physical factors responsible for the differences in the time of decomposition of the pig carcasses between the two seasons. Fourteen species of dipterans (59,467 specimens) bred in the decomposing carcasses. Chrysomya albiceps (Wiedemann) was the species more abundantly breed in the two periods. The other species that breed in the carcasses were: C. putoria (Wiedemann), Hemilucilia segmentaria(Fabricius), Lucilia eximia(Wiedemann) (Calliphoridae), Peckia (Pattonella) intermutans(Walker), Peckia (Squamatoides) trivitatta(Curran), Sarcodexia lambens(Wiedemann) (Sarcophagidae), Musca domestica(L.), Ophyra aenescens(Wiedemann), Stomoxys calcitransL. (Muscidae), Fannia pusio(Wiedemann), Fannia sp. (Fanniidae), Hermetia illuscens L. (Stratiomyidae) and Phoridae sp. The Cerrado of this region presents many dipterans potential forensic indicators.

  20. ANÁLISE FAUNÍSTICA DE ESPÉCIES DE MOSCA-DAS-FRUTAS (DIP., TEPHRITIDAE EM MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    N.A. CANAL

    1998-01-01

    Full Text Available Em seis locais de quatro municípios (Janaúba, Jaíba, Nova Porteirinha e Itacarambí do norte do Estado de Minas Gerais, foram coletados 29.454 espécimes de mosca-das-frutas, pertencentes a Ceratitis capitata e a 20 espécies de Anastrepha. O levantamento foi feito entre janeiro de 94 e dezembro de 96, utilizando armadilhas plásticas tipo McPhail. Ceratitis capitata foi a espécie predominante em áreas urbanas. As espécies de Anastrepha predominaram em áreas rurais. A. obliqua, A. zenildae e Anastrepha n. sp.3 foram as espécies predominantes do gênero, entretanto, essa predominância variou de local para local em função da disponibilidade de hospedeiros. As comunidades apresentaram índices de diversidade baixos e quocientes de similaridade entre 73 e 100%.A total of 29,454 specimens of fruit fly were trapped in six sites of four counties (Janaúba, Jaíba, Nova Porteirinha and Itacarambí of the north of the State of Minas Gerais, Brazil. The specimens were collected using McPhail plastic traps from January 1994 to December 1996. The trapped fruit flies belonged to Ceratitis capitata and to 20 species of Anastrepha. Ceratitis capitata was the predominant species in the urban areas and Anastrepha species were predominant in the field areas. A. obliqua, A. zenildae and Anastrepha n. sp.3 were the predominant species of the genera, whereas the predominant species differed among localities, according to host availability. The diversity indexes were low and the coefficient of similarity varied from 73 to 100%.

  1. Umbu-cajá como repositório natural de parasitoide nativo de moscas-das-frutas Umbu-cajá as natural repository of native fruit fly parasitoids

    Directory of Open Access Journals (Sweden)

    Romulo da Silva Carvalho

    2010-10-01

    Full Text Available O objetivo deste trabalho foi avaliar diversidade de espécies de mosca-das-frutas e de parasitóides nativos em frutos de umbu-cajá (Spondias spp.. Os frutos foram coletados em nove municípios do Estado da Bahia. Estimaram-se: a infestação dos frutos pelas moscas; o índice de parasitismo das moscas; e a frequência de ocorrência das espécies de parasitóides. Pela primeira vez, a infestação de Anastrepha obliqua em frutos de umbu-cajá e a presença do parasitóide Asobara anastrephae em larvas de Anastrepha obliqua foram registradas. O parasitoide nativo Doryctobracon areolatus foi o mais frequente. A umbu-cajazeira é repositório natural de parasitoides de tefritídeos, e sua preservação é fundamental para a manutenção das relações tróficas entre as espécies de mosca-das-frutas e parasitoides.The objective of this work was to assess the species diversity of fruit fly and their parasitoids in fruit of umbu-cajá (Spondias spp.. Fruit were collected in nine municipalities of the state of Bahia, Brazil. Fruit infestation, fruit fly parasitism rates, and frequencies of the parasitoid species were estimated. For the first time, Anastrepha obliqua infesting umbu-cajá fruit and the presence of the native parasitoid Asobara anastrephae in Anastrepha oblique larvae were recorded. The native parasitoid Doryctobracon areolatus was the most frequent. Umbu-cajá tree is a natural repository of Tephritidae parasitoids, and its preservation is essential for the maintenance of trophic relationships between fruit fly species and parasitoids.

  2. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2008-11-15

    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  3. Antennal and behavioral responses to putrescine and ammonium bicarbonate in the Caribbean fruit fly (Diptera: tephritidae)

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies uses a 2-component lure that emits ammonia and putrescine, both regarded as protein cues. This study used electroantennography and flight tunnel bioassays to quantify olfactory and behavioral responses of A. suspensa to vapors from ammonium bicar...

  4. EAG and behavioral responses of the Caribbean fruit fly (Diptera:Tephritidae) to terminal diamines in a food-based lure.

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies utilize a food-based synthetic lure consisting of ammonium acetate and putrescine (1, 4 diaminobutane). Identification of additional attractant chemicals may lead to development of a more effective trapping system. This study, conducted with the...

  5. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    Traps baited with synthetic food-based lures that include blends of ammonia, either as ammonium acetate or ammonium bicarbonate, and putrescine capture a number of Anastrepha and Bactrocera species fruit flies. However, for many of these species, more flies are captured in traps baited with the pro...

  6. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures

    Science.gov (United States)

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  7. New developments in food-based synthetic attractants for pest Tephritidae.

    Science.gov (United States)

    Optimal capture of several species of Anastrepha and Bactrocera spp. tephritid fruit flies is in traps baited with the aqueous protein bait Nulure combined with borax. Nulure is produced by acid hydrolysis of corn and has an acidic pH. Addition of borax makes the solution more alkaline and more att...

  8. Ammonia as a component of fruit fly attractants.

    Science.gov (United States)

    Abstract Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Ana...

  9. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic

    Science.gov (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  10. Pheromones, male lures and trapping of tephritid fruit flies

    Science.gov (United States)

    The dipteran family of Tephritidae consists of many genera, of which several namely, Anastrepha, Bactrocera, Ceratitis, Dacus, Rhagoletis and Toxotrypana possess species of high economic importance as major pests of fruits and vegetables. Hitherto, pheromones isolated and identified for possible use...

  11. Mexican fruit fly (Diptera: tephritidae) and the phenology of its native host plant, Yellow Chapote (Rutaceae) in Mexico

    Science.gov (United States)

    In northeastern Mexico, the Mexican fruit fly, Anastrepha ludens (Loew), breeds on its native host, yellow chapote, Casimiroa greggii (Wats.), which typically produces fruit in the spring. Peak populations of the fly occur in late spring or early summer when adults emerge from the generation of lar...

  12. Laboratory and Field Age of Aqueous Grape Juice Bait and Capture of Zaprionus indianus (Diptera: Drosophilidae)

    Science.gov (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  13. Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida

    Science.gov (United States)

    Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

  14. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  15. Enhancing male sexual success in a lekking fly (Ananstrepha suspensa (Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality

    Science.gov (United States)

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual su...

  16. A safe and effective propylene glycol based capture liquid for fruit fly (Diptera: Tephritidae) traps baited with synthetic lures

    Science.gov (United States)

    Antifreeze is often used as the capture liquid in insect traps for its preservation and evaporation attributes. In tests reported herein, fruit fly traps using non-toxic household propylene glycol based antifreeze captured significantly more Anastrepha ludens than did traps with the automotive anti...

  17. Functional comparison of three transformer gene introns regulating conditional female lethality

    Science.gov (United States)

    The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...

  18. Contribución al Conocimiento de las Moscas de las Frutas (Tephritidae y sus Parasitoides en el Departamento de Antioquia

    Directory of Open Access Journals (Sweden)

    Yepes R. Francisco

    1989-12-01

    Full Text Available Las moscas de las frutas constituyen, como grupo, la plaga insectil mas importante de estos cultivos en Colombia y en el mundo. Además de Anastrepha spp., la especie más dañina dentro de las verdaderas moscas de las frutas (Tephritidae, la mosca del Mediterráneo, fue detectada por primera vez en Colombia en 1986 y confirmada su presencia en Antioquia en abril de 1987. El trabajo se realizó en tres fases simultáneamente; una de campo (11 regiones, otra de laboratorio (procesamiento de muestras y la tercera consistió en la obtención de la identificación de las especies (moscas y parasitoides Los resultados fueron: 1.la especie más distribuida y frecuentemente registrada en mayor número de hospedantes fue Anastrepha striata; fue reportada por primera vez en guayabo anselmo (Campomanesia cornifolia y guayabo de mono (Bellucia axinanthera, 2.la especie que ataca a B. axinanthera en el nordeste y oriente antioqueños es A sp. "F-]", aparentemente no descrita y considerada dentro de un grupo actualmente bajo revisión, 3.en total se encontraron 13 especies diferentes de Tephritidae (incluyendo los géneros de Anastrepha, Ceratitis y Toxotrypana y siete especies de Lonchaeidae (Neosilba spp. y Dasiops spp., 4.dentro de los parasitoides de larva-pupa de Anastrepha spp. se destacan: Doryctobracon areolatus y D. crawfordi¡ Opius anastrephae, Asobara anastrephaey Microcrasis sp. pertenecientes a la familia Braconidae y Aganaspis pelleranoi (Eucoilidae y Aceratoneuromyia indicum (Eulophidae.

  19. Rate of development of forensically-important Dipterain southern Brazil

    Directory of Open Access Journals (Sweden)

    Rodrigo F. Krüger

    2010-01-01

    Full Text Available Dipteran larvae were collected from rabbit (Oryctolagus cunniculus L. carcasses during the four seasons in 2005 in the southernmost state of Rio Grande do Sul, Brazil. The larvae were fed ground beef at ambient temperatures following collection from carcasses. The development of each species under these conditions was estimated. The most abundant species in the carcasses were Lucilia eximia (Wiedemann and Chrysomya albiceps (Wiedemann (Calliphoridae, and they were found in all seasons. The data were fitted to a linear model that describes the relationship between temperature and linear developmental rating. These two species are primary forensic indicators in southern Brazil. Other species such as Hemilucilia semidiaphana (Rondani (Calliphoridae, Synthesiomyia nudiseta (Wulp, Muscina stabulans (Fallen (Muscidae, and Fannia pusio (Wiedemann (Fanniidae were forensically less important because they only occurred in high frequency in certain seasons and during the first days of carcass decomposition.

  20. Ocorrência e Sazonalidade de Muscóides (Diptera, Calliphoridae de Importância Sanitária no Município de Itaboraí, RJ, Brasil

    Directory of Open Access Journals (Sweden)

    José Batista-da-Silva

    2010-04-01

    Abstract. This work was carried out to contribute to the knowledge of Calliphoridae flies (Diptera in Itaboraí, RJ, Brazil and quantify the predominant species of health importance. The flies were captured in eight different points in the city over a one year period, always using fish as bait, separated by species and kept properly in an entomological box in the Laboratório de Transmissores de Leishmaniose (Setor de Entomologia Médica e Forense - IOC / FIOCRUZ, RJ. A total of 1792 Calliphoridae flies were captured, belonging to seven (7 species: Chloroprocta idioidea (Robineau-Desvoidy (0.11%, Chrysomya megacephala (Fabricius (87.94%, Chrysomya albiceps (Wiedemann (6.70%, Chrysomya putoria (Wiedemann (1.23%, Cochliomyia macellaria (Fabricius (0.56%, Hemilucilia segmentaria (Fabricius (0.33%, Lucilia eximia (Wiedemann (3.13%.

  1. Revision of the Neotropical Xanthandrus Verral (Diptera, Syrphidae

    Directory of Open Access Journals (Sweden)

    Borges Zuleica M.

    2003-01-01

    Full Text Available The Neotropical genus Xanthandrus Verral, 1901 is revised. Six species are redescribed: X. bucephalus (Wiedemann, 1830, X. cubanus Fluke, 1936, X. mellinoides (Macquart, 1846, X. mexicanus Curran, 1930, X. nitidulus Fluke, 1937, and X. plaumanni Fluke, 1937. Three species are included based on original descriptions: X. flavomaculatus Shannon, 1927, X. palliatus (Fluke, 1945, and X. simplex (Loew, 1861. New synonyms proposed: Argentinomyia longicornis (Walker, 1837 = Xanthandrus biguttatus Hull, 1945 syn. nov., and Xanthandrus bucephalus (Wiedemann, 1830 = Melanostoma quadrinotata Bigot, 1884 syn. nov. Description of terminalia, a key for Neotropical species, and illustrations are also presented.

  2. Disease: H00711 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available pictures. ICD-10: Q87.1 MeSH: D056730 OMIM: 180860 PMID:19407494 Eggermann T Silver-Russell and Beckwith-Wiedemann...rell A Disruption of genomic neighbourhood at the imprinted IGF2-H19 locus in Beckwith-Wiedemann syndrome an...growth retardation. Developmental disorder H19 [HSA:283120] IGF2 [HSA:3481] [KO:K13769] RSS and the overgrowth disease Beckwith-Wiede...mann syndrome [DS:H00713] present two genetically and clinically opposite clinical

  3. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders

    DEFF Research Database (Denmark)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric

    2016-01-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver-Russell and Beckwith-Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these diso......Molecular genetic testing for the 11p15-associated imprinting disorders Silver-Russell and Beckwith-Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis...

  4. Parasitóides associados às moscas-das-frutas (Diptera: Tephritoidea em café orgânico com e sem arborização em Valença, RJ, Brasil Parasitoids associated with fruit flies (Diptera: Tephritoidea in organic coffee plantation under shaded and unshaded management in Valença, RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Elen de Lima Aguiar-Menezes

    2008-12-01

    Full Text Available Objetivou-se, com esse trabalho, determinar as espécies de parasitóides associados às moscas-das-frutas infestando seis cultivares de café arábica (Coffea arabica L., em sistema de cultivo com e sem arborização, sob manejo orgânico. Uma amostra de 1 kg de frutos maduros por cultivar foi colhida em maio de 2005. Os frutos foram depositados em bandejas plásticas, contendo uma camada de areia, a qual serviu como substrato para a fase de pupa. Os pupários foram quantificados e mantidos em copos plásticos transparentes com areia até a emergência dos insetos. Sete espécies de parasitóides da ordem Hymenoptera foram identificadas, das quais cinco da família Braconidae: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, Utetes anastrephae (Viereck, Opius bellus Gahan e Opius sp., e duas da Figitidae: Aganaspis pelleranoi (Brèthes e Lopheucoila anastrephae Weld. Larvas de Tephritidae e Lonchaeidae infestando frutos dos seis cultivares foram parasitadas por Braconidae e Figitidae, com média de 14,2% e 7,7% nos sistemas sem e com arborização, respectivamente.The aim of this work was to determine the parasitoid species associated with fruit flies infesting six cultivars of arabic coffee under shaded and unshaded organic management. A 1kg-sample of maturing fruits per cultivar was harvested in May 2005. The fruits were placed in plastic trays containing a layer of thin sand, as a substrate for pupa phase. The puparia were quantified and kept in transparent plastic cups with sand until the emergence of the insects. Seven parasitoid species of the order Hymenoptera were identified, from which five belong to the family Braconidae: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, Utetes anastrephae (Viereck, Opius bellus Gahan and Opius sp., and two of the Figitidae: Aganaspis pelleranoi (Brèthes and Lopheucoila anastrephae Weld. Larvae of Tephritidae and Lonchaeidae infesting fruits of the six

  5. Longevity of multiple species of tephritid (Diptera) fruit fly parasitoids (Hymenoptera: Braconidae: Opiinae) provided exotic and sympatric-fruit based diets.

    Science.gov (United States)

    Stuhl, Charles; Cicero, Lizette; Sivinski, John; Teal, Peter; Lapointe, Stephen; Paranhos, Beatriz Jordão; Aluja, Martín

    2011-11-01

    While adult parasitic Hymenoptera in general feed on floral and extrafloral nectars, hemipteran-honeydews and fluids from punctured hosts, Diachasmimorpha longicaudata (Ashmead), an Old World opiine braconid introduced to tropical/subtropical America for the biological control of Anastrepha spp. (Tephritidae), can survive on fruit juices as they seep from injured fruit. An ability to exploit fruit juice would allow such a parasitoid to efficiently forage for hosts and food sources simultaneously. Two New World opiines, Doryctobracon areolatus (Szepligeti) and Utetes anastrephae (Viereck), are also prominent Anastrepha parasitoids and are roughly sympatric. All three species were provided with: (1) pulp and juice diets derived from a highly domesticated Old World fruit (orange, Citrus sinensis L.) that is only recently sympatric with the Mexican flies and parasitoids and so offered little opportunity for the evolution of feeding-adaptations and (2) a less-domesticated New World fruit (guava, Psidium guajava L.), sympatric over evolutionary time with D. areolatus and U. anastrephae. Both sexes of D. longicaudata died when provided guava pulp or juice at a rate similar to a water-only control. D. areolatus and U. anastrephae, presumably adapted to the nutrient/chemical constituents of guava, also died at a similar rate. Survival of all three species on orange pulp and juice was greater than on water, and often equaled that obtained on a honey and water solution. In confirmatory experiments in Mexico, D. areolatus and U. anastrephae, as well as other tephritid parasitoids Doryctobracon crawfordi (Viereck) and Opius hirtus (Fisher), all died at a significantly higher rates when provided guava in comparison to a honey and water diet. Such a result is likely due to guavas being repellent, innutritious or toxic. D. longicaudata clearly consumed guava juice tagged with a colored dye. Dilutions of orange and guava juice resulted in shorter lifespans than dilutions of orange

  6. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.

  7. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  8. Transient progeroid phenotype and lipodystrophy in mosaic polyploidy.

    NARCIS (Netherlands)

    Karteszi, J.; Kosztolanyi, G.Y.; Czako, M.; Hadzsiev, K.; Morava, E.

    2006-01-01

    Wiedemann-Rautenstrauch syndrome is a rare disorder with a progressive course and early lethality. Severe mental and growth retardation, muscle hypotonia, a progeroid face, wrinkled skin, relative macrocephaly with late closure of the anterior fontanel, arachnodactyly and congenital heart defects ar

  9. Kirjanik soovitab / Olavi Ruitlane

    Index Scriptorium Estoniae

    Ruitlane, Olavi, 1969-

    2009-01-01

    Tutvustus: Volkonski, Peeter. ISBN 978-9985-9980-6-9. Tallinn : Menu Kirjastus, 2009 ; Preussler, Otfried. Krabat / saksa keelest tõlkinud Linda Ariva. [Tallinn] : Tänapäev, 2009 ; Teede, Andra. Atlas : [luuletused]. Pärnu : Jumalikud Ilmutused, 2009 ; Wiedemann, Vladimir. Maagide kool. Eesti okultne underground 1970-1980. Tartu : Hotpress, 2008

  10. Effective sampling range of a synthetic protein-based attractant for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Studies were conducted in Honduras to determine sampling range for female-targeted food-based synthetic attractants for pest tephritid fruit flies. Field studies were conducted in shaded coffee and adults of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), were captured. Traps (38 traps ...

  11. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  12. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  13. Attraction of Ceratitis capitata (Diptera: Tephritidae) and Nontarget Insects to the Attractant BioLure and its Individual Components in Hawaii.

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  14. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  15. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  16. One-, two-, and three-particle distributions from 158A GeV/c central Pb+Pb collisions

    NARCIS (Netherlands)

    Aggarwal, MM; Angelis, ALS; Antonenko, [No Value; Arefiev, [No Value; Astakhov, [No Value; Avdeitchikov, [No Value; Awes, TC; Baba, PVKS; Badyal, SK; Bathe, S; Batiounia, B; Bernier, T; Bhalla, KB; Bhatia, VS; Blume, C; Bucher, D; Busching, H; Carlen, L; Chattopadhyay, S; Decowski, MP; Delagrange, H; Donni, P; Majumdar, MRD; El Chenawi, K; Enosawa, K; Fokin, S; Frolov, [No Value; Ganti, MS; Garpman, S; Gavrishchuk, O; Geurts, FJM; Ghosh, TK; Glasow, R; Guskov, B; Gustafsson, H.A.; Gutbrod, HH; Hrivnacova, [No Value; Ippolitov, M; Kalechofsky, H; Kamermans, R; Karadjev, K; Karpio, K; Kolb, BW; Kosarev, [No Value; Koutcheryaev, [No Value; Kugler, A; Kulinich, P; Kurata, M; Lebedev, A; Lohner, H; Mahapatra, DP; Manko, [No Value; Martin, M; Martinez, G; Maximov, A; Miake, Y; Mishra, GC; Mohanty, B; Mora, MJ; Morrison, D; Mukhanova, T; Mukhopadhyay, DS; Naef, H; Nandi, BK; Nayak, SK; Nayak, TK; Nianine, A; Nikitine, [No Value; Nikolaev, S; Nilsson, P; Nishimura, S; Nomokonov, P; Nystrand, J; Oskarsson, A; Otterlund, [No Value; Peitzmann, T; Peressounko, D; Petracek, [No Value; Plasil, F; Purschke, ML; Rak, J; Raniwala, R; Raniwala, S; Rao, NK; Reygers, K; Roland, G; Rosselet, L; Roufanov, [No Value; Rubio, JM; Sambyal, SS; Santo, R; Sato, S; Schlagheck, H; Schutz, Y; Shabratova, G; Shah, TH; Sibiriak, [No Value; Siemiarczuk, T; Silvermyr, D; Sinha, BC; Slavine, N; Soderstrom, K; Sood, G; Sorensen, SP; Stankus, P; Stefanek, G; Steinberg, P; Stenlund, E; Sumbera, M; Svensson, T; Tsvetkov, A.; Tykarski, L; v d Pijll, EC; v Eijndhoven, N; v Nieuwenhuizen, GJ; Vinogradov, A; Viyogi, YP; Vodopianov, A; Voros, S; Wyslouch, B; Young, GR

    2003-01-01

    Several hadronic observables have been studied in central 158A GeV Pb+Pb collisions using data measured by the WA98 experiment at CERN: single pi(-) and K- production, as well as two- and three-pion interferometry. The Wiedemann-Heinz hydrodynamical model has been fitted to the pion spectrum, giving

  17. Lessons from BWS twins: Complex maternal and paternal hypomethylation and a common source of haematopoietic stem cells

    NARCIS (Netherlands)

    J. Bliek (Jet); M. Alders (Mariëlle); S.M. Maas (Saskia); R.J. Oostra; D.M. Mackay (Deborah); K. van der Lip (Karin); J.L. Callaway (Johnatan); A.S. Brooks (Alice); S. van't Padje (Sandra); A. Westerveld (Andries); N.J. Leschot (Nico); M.M.A.M. Mannens (Marcel)

    2009-01-01

    textabstractThe Beckwith-Wiedemann syndrome (BWS) is a growth disorder for which an increased frequency of monozygotic (MZ) twinning has been reported. With few exceptions, these twins are discordant for BWS and for females. Here, we describe the molecular and phenotypic analysis of 12 BWS twins and

  18. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  19. Biological and Cultural Control of Olive Fruit Fly in California---Utilization of Parasitoids from USDA-APHIS-PPQ, Guatemala and Cultural Control Methods

    Science.gov (United States)

    The parasitoid Psytallia humilis = P. cf. concolor (Szépligeti) was reared on sterile Mediterranean fruit fly, Ceratitis capitata (Wiedemann), larvae at the USDA, APHIS, PPQ, Moscamed biological control laboratory in San Miguel Petapa, Guatemala and shipped to the USDA, ARS, Parlier, for biological ...

  20. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  1. Scanning electron microscopy of the male genitalia of Sarcophagidae (Diptera

    Directory of Open Access Journals (Sweden)

    Hugo de Souza Lopes

    1990-03-01

    Full Text Available The male genitalia of nine species of Sarcophagidae (Diptera - Goniophyto honsuensis Rohdendorf, 1962, Tricharaea brevicornis (Wiedemann, 1830, Chaetoravinia derelicta (Walker, 1852, Austrohartigia spinigena (Rondani, 1864, Chrysagria duodecimpunctata Townsend, 1935, Boettcheria bisetosa Parker, 1914, Lipoptilocnema lanei Townsend, 1934, L. crispina (Lopes, 1938 and Euboettcheria alvarengai Lopes & Tibana, 1982 - were examined by scanning electron microscope (SEM and the main morphological features are descirbed.

  2. Insecticidal Activity of Basil Oil, trans-Anethole, Estragole, and Linalool to Adults of Ceratitis capitata, Bactrocera dorsalis, and B. cucurbitae

    Science.gov (United States)

    Pest tephritid fruit flies, Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and B. cucurbitae (Cocquillett) are among the species of economic significance. Their management has primarily relied on the use of food baits, male attractants and their combinations with insecticides. Basil o...

  3. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil Natural parasitism in fruit-flies in the fruticulture area of anagé, semi-arid of southwestern Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.Parasitoids are important natural control agents of tephritids and knowledge about the tritrophic relationships can support the management of these pests. This study aimed to estimate of parasitism indexes in fruit flies in 21 plant species and identify the species of parasitoids associated, in semiarid conditions of Southwestern Bahia. Eight hosts showed infestation by Anastrepha spp. and, of these, four occurred parasitism above 20.0%, of which: 20.8% (Ziziphus joazeiro L.; 21.3% (Spondias tuberosa L.; 32.4% (Spondias purpurea L. and 57.1% (Malpighia emarginata L.. The collected parasitoids belong to the Braconidae family, 89% of Doryctobracon areolatus and 11% of Asobara anastrephae.

  4. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control.

  5. Disinfestation of mangoes by irradiation; Desinfestacion de mango por irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E

    1992-05-15

    The mango is a fruit-bearing very important in the mexican economy. Mexico is between the first positions of the world like country producing with an average export volume of 40,000 annual tons in the last years. For this reason it was decided to make this investigation, which was developed according to the investigation protocols proposed by the Agricultural Research Service of the USA (ARS - US DOA). The objective is to account with the technical and scientific necessary bases to propose to the US DOA the regulation of the irradiation process like quarantine treatment for Mexican export mango. The goals are: to determine in the laboratory the minimum dose (Dmin.) to inhibit the emergency of adults of the species of the fruit flies of more importance for Mexico. To confirm the least radiation dose Dmin. for quarantine treatment based on the safety value Probit-9. To evaluate the mango quality irradiated to 2 and 2.5 times the Dmin. proposal for quarantine treatment. According to information provided by the General Direction of Vegetable Sanity, it was determined that the fly species of the fruit of more economic importance for Mexico are of the genus Anastrepha ludens, Anastrepha serpentina, Anastrepha obliqua and Ceratitis capitata. (Author)

  6. Different effects of grain boundary scattering on charge and heat transport in polycrystalline platinum and gold nanofilms

    Institute of Scientific and Technical Information of China (English)

    Ma Wei-Gang; Wang Hai-Dong; Zhang Xing; Takahashi Koji

    2009-01-01

    The in-plane electrical and thermal conductivities of several polycrystalline platinum and gold nanofilms with different thicknesses are measured in a temperature range between the boiling point of liquid nitrogen (77 K) and room temperature by using the direct current heating method. The result shows that both the electrical and thermal conductivities of the nanofilms reduce greatly compared with their corresponding bulk values. However, the electrical conductivity drop is considerably greater than the thermal conductivity drop, which indicates that the influence of the internal grain boundary on heat transport is different from that of charge transport, hence leading to the violation of the Wiedemann-Franz law. We build an electron relaxation model based on Matthieseen's rule to analyse the thermal conductivity and employ the Mayadas & Shatzkes theory to analyse the electrical conductivity. Moreover, a modified Wiedemann-Franz law is provided in this paper, the obtained results from which are in good agreement with the experimental data.

  7. Luminescence basic concepts, applications and instrumentation

    CERN Document Server

    Virk, Hardev Singh

    2014-01-01

    The word luminescence was first used by a German physicist, Eilhardt Wiedemann, in 1888. He also classified luminescence into six kinds according to the method of excitation. No better basis of classification is available today. He recognized photoluminescence, thermoluminescence, electroluminescence, crystalloluminescence, triboluminescence, and chemiluminescence. The designations are obvious, characterized by the prefix. This Volume consists of 9 Chapters, including 8 Review Papers and one Case Study. The first two papers are based on OLEDs. Organic light emitting diodes (OLEDs) have been th

  8. A Case Report: Nager Acrofacial Dysostosis

    Directory of Open Access Journals (Sweden)

    Shahin Abdollahi Fakhim

    2012-01-01

    Nager syndrome is a rare disorder resulting from developmental abnormalities of the first and second branchial arches. It is linked to five other similar syndromes: Miller syndrome, Treacher-Collins, Pierre-Robin, Genee-Wiedemann, and Franceschetti-Zwahlen-Klein. Multidisciplinary management by a craniofacial team is needed. Early intervention, intensive education, new surgical techniques, and an emphasis on coordinated care have improved the quality of life in this patient with Nager syndrome.

  9. Relativistic heat conduction and thermoelectric properties of nonuniform plasmas

    CERN Document Server

    Honda, M

    2003-01-01

    Relativistic heat transport in electron-two-temperature plasmas with density gradients has been investigated. The Legendre expansion analysis of relativistically modified kinetic equations shows that strong inhibition of heat flux appears in relativistic temperature regimes, suppressing the classical Spitzer-H{\\"a}rm conduction. The Seebeck coefficient, the Wiedemann-Franz law, and the thermoelectric figure of merit are derived in the relativistic regimes.

  10. Inaugural studies of the life history and predator/prey associations of Heringia calcarata (Loew)(Diptera: Syrphidae), a specialist predator of the woolly apple aphid, Eriosoma lanigerum (Hausmann)(Homoptera: Eriosomatidae)

    OpenAIRE

    2003-01-01

    The life history of the aphidophagous syrphid fly, Heringia calcarata (Loew), a specialist predator of woolly apple aphid, Eriosoma lanigerum (Hausmann), was studied in Virginia from 2001 to 2003, under field and laboratory conditions. Pronounced differences in the chorionic sculpting of eggs of Eupeodes americanus (Wiedemann), Syrphus rectus Osten Sacken, and H. calcarata were documented. These differences can be used to separate these aphidophagous hover flies. Gross morphological descri...

  11. An illustrated key to adult males of neotropical Fannia Robineau-Desvoidy belonging to pusio sub-group (Diptera, Fanniidae).

    Science.gov (United States)

    Couri, M S

    2005-11-01

    The 11 neotropical species of Fannia belonging to the pusio sub-group (canicularis group), are keyed F. dodgei Seago; F. femoralis (Stein); F. pamplonae Couri & Araújo; F. parafemoralis Araújo & Couri; F. paraisensis Araújo & Couri; F. punctivervis Malloch; F. pusio (Wiedemann); F. sabroskyi Seago; F. snyderi Seago; F. trimaculata (Stein); F. trimaculatoides Couri & Pamplona. The key is addressed only to the males and the illustrations help in the visualization of the characters.

  12. A taxonomic revision of the Southern South American species of the genus Fannia Robineau-Desvoidy (Diptera: Fanniidae)

    OpenAIRE

    Martha Cecilia Dominguez

    2007-01-01

    The Southern South American species of the genus Fannia Robineau-Desvoidy are revised. Twenty five valid species are recognized for the region in the present study: Fannia albitarsis Stein, Fannia anthracina (Walker), Fannia bigoti Stein, Fannia canicularis (Linnaeus), Fannia confusa Pont & Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein), Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani), Fannia heydenii (Wiedemann), Fannia hirtifemur (Stei...

  13. Primeiro relato de Muscidifurax raptorellus Kogan & Legner, 1970 (Hymenoptera: Pteromalidae) no Brasil First report of Muscidifurax raptorellus Kogan & Legner, 1970) (Hymenoptera: Pteromalidae) in Brazil

    OpenAIRE

    C.H. Marchiori; Miranda, J.M.; V.A Costa

    2009-01-01

    This study reports the first occurrence of Muscidifurax raptorellus (Hymenoptera: Pteromalidae) in Brazil. Chicken manure samples, collected at two-week interval, were taken to the laboratory and the pupae were extracted by the method of flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. In the study, ten pupae of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) were obtained, two of which yielded the parasitoid M. raptor...

  14. Current measurement in high-performance frequency converters; Strommessung in Hochleistungsumrichtern

    Energy Technology Data Exchange (ETDEWEB)

    Marien, Jan; Hetzler, Ullrich [Isabellenhuette Heusler GmbH und Co. KG, Dillenburg (Germany); Hornung, Hans-Georg; Zwinger, Stefan [Sensor-Technik Wiedemann GmbH, Kaufbeuren (Germany)

    2011-04-15

    The load cycles (raising, lowering, accelerating, braking) of cranes, lift trucks and other off-road vehicles are ideally suited for the efficient deployment of hybrid or full electrical drive technology. Current measurement is a key technology for advancing electrification. Sensor Technik Wiedemann places by her frequency converters on a shunt-based current measurement module from Isabellenhuette Heusler which permits highly accurate measurements. (orig.)

  15. Täienduseks kreevinite ja nende keele ajaloole

    Directory of Open Access Journals (Sweden)

    Eberhard Winkler

    2012-01-01

    Full Text Available Artikli eesmärk on anda mõningaid täiendusi ja täpsustusi kreevinite ajaloo, nimetuse, eluolu ja keele kohta. Käsitletakse kreevini keele suhet seda mõjutanud keelte, eelkõige vadja keelega. Senistes käsitlustes – Wiedemann (1871 ja Winkler (1997 – on neid küsimusi mainitud vaid muu seas, ilma piisava selguseta.

  16. Checklist and distribution maps of the blow flies of Venezuela (Diptera, Calliphoridae, Mesembrinellidae).

    Science.gov (United States)

    Velásquez, Yelitza; Martínez-Sánchez, Ana Isabel; Thomas, Arianna; Rojo, Santos

    2017-01-01

    A checklist of the 39 species of blow flies (Calliphoridae and Mesembrinellidae) so far known to occur in Venezuela is provided, based on a thorough literature review and the examination of ca. 500 specimens deposited in the main entomological collections of the country. Data from the literature and museum collections were used to generate distribution maps for 37 species. Three species are recorded from Venezuela for the first time: Chrysomya putoria (Wiedemann, 1830), Mesembrinella spicata Aldrich, 1925 and Mesembrinella umbrosa Aldrich, 1922.

  17. Thermal conductivity and electron-phonon relaxation in a metal heated by a subpicosecond laser pulse

    Science.gov (United States)

    Petrov, Yu. V.; Anisimov, S. I.

    2006-06-01

    This paper discusses the initial stages of the interaction of subpicosecond laser pulses with metallic targets: the absorption of light, energy transport by electronic thermal conductivity, and electron-phonon relaxation. It is shown that, with moderate surface energy density, hydrodynamic motion begins after the electronic and lattice temperatures equalize. A connection is established between the energy exchange rate between the electrons and the lattice and the electronic thermal conductivity (an analog of the Wiedemann-Franz law).

  18. Relações interespecíficas entre parasitoides nativos de moscas-das-frutas e o braconídeo exótico Diachasmimorpha longicaudata em frutos de 'umbu-cajá' Interespecific relations between native parasitoids of fruit flies and exotic braconid Diachasmimorpha longicaudata in fruits of 'umbu-cajá'

    Directory of Open Access Journals (Sweden)

    Zuzinaide Vidal Bomfim

    2010-02-01

    Full Text Available Espécies de vespas parasitoides (Hymenoptera: Braconidae são importantes agentes de controle biológico de moscas-das-frutas (Diptera: Tephritidae. Este trabalho teve por objetivo conhecer os efeitos da liberação e as relações de competitividade interespecífica do parasitoide exótico Diachasmimorpha longicaudata Ashmead sobre o complexo de parasitoides nativos de moscas-das-frutas associado a frutos de 'umbu-cajá' (Spondias spp. na região do Recôncavo Baiano. Entre os meses de abril e julho de 2006, 8.955 frutos (192,93kg foram coletados antes e após (24 e 48 horas a liberação de 9.600 fêmeas de D. longicaudata em campo. Obteve-se um total de 8.724 pupários de Tephritidae, dos quais emergiram 3.963 adultos de Anastrepha obliqua (Macquart e 1.115 parasitoides. A maior frequência relativa foi de Doryctobracon areolatus (Szépligeti, seguida por Asobara Anastrephae (Muesebeck e Utetes Anastrephae (Viereck. Após 24 e 48 horas da liberação do parasitoide exótico D. longicaudata em campo, constatou-se que o índice de parasitismo total aumentou de 15,86 para 20,4 e 45,19%, respectivamente. Assim, observou-se que a liberação da espécie exótica D. longicaudata não apresenta efeitos negativos na ocorrência dos parasitoides nativos e contribui para complementar o controle biológico natural de A. obliqua em frutos de 'umbu-cajá', nas condições deste estudo.Wasps parasitoid species (Hymenoptera: Braconidae are fruit flies (Diptera: Tephritidae biological control important agents. This study aimed to know the effects of the release and interspecific competitive relationships of the exotic parasitoid Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae on the native parasitoid complex of fruit flies in Spondias spp. in the region of Recôncavo Baiano. From April to July of 2006, 8.955 fruits (192.93kg were collected before and after (24 and 48 hours release of 9.600 females of D. longicaudata. Exactly 8.724 Tephritidae

  19. Ocorrência de moscas-das-frutas (Diptera: Tephritidae em mangueiras (Mangifera indica L. em Boa Vista, Roraima = The occurrence of fruit fly (Diptera: Tephritidae in mango (Mangifera indica L. in Boa Vista, Roraima

    Directory of Open Access Journals (Sweden)

    Adriana Bezerra Lima

    2012-08-01

    Full Text Available Um estudo foi conduzido no período de junho de 2007 a janeiro de 2008, em pomares comerciais de manga das variedades: Tommy Atkins, Haden e Palmer sendo 3 ha de cada cultivar, localizado na região do Bom Intento no Município de Boa Vista. Os espécimes de moscas-das-frutas foram coletados, por meio de armadilhas, confeccionadas com garrafas pet, que foram penduradas na copa das árvores a 1,60 m de altura. Como atrativo alimentar foi utilizado 200 mL de suco de maracujá a 30%. Foram utilizadas nove armadilhas, sendo uma armadilha por hectare. Semanalmente as armadilhas eram examinadas, ocasião em que se substituía o atrativo e os insetos capturados retirados e colocados em frascos de vidro devidamente etiquetados e transportados ao Laboratório de Entomologia do Centro de Ciências Agrárias da Universidade Federal de Roraima. As identificações dos espécimes foram feitas no Instituto Nacional de Pesquisa da Amazônia - INPA. No período de oito meses foram coletados 24 espécimes adultos do gênero Anastrepha (nove fêmeas e 15 machos. Quatro espécies foram identificadas: A. serpentina, A. striata, A. obliqua e A. turpinae. A maior frequência foi A. serpentina (44,44%, seguida de A. striata e A. obliqua ambas com 22,22% e A. turpinae com 11,11%. Os meses de maior ocorrência de Anastrepha spp. foram junho, julho e agosto. Este é o primeiro registro da espécie Anastrepha turpinae Stone, 1942, em Roraima. The study was done during th period of June 2007 to January of 2008, in commercial mango orchards having: 3 ha of cv. Tommy Atkins, 3 ha of cv. Haden. and 3 ha of cv. Palmer, located at Bom Intento in the municipal district of Boa Vista - RR. The specimens of fruit flies were collected, by trapping, made with transparent bottles pet, which were hung in the cup of the trees at 1.60 m of height. 200 mL of passion fruit juice (30% was used as an attractant feed; 9 traps were used, being one trap for hectare. Weekly The traps were

  20. Preliminary study of insects associated to indoor body decay in Colombia

    Directory of Open Access Journals (Sweden)

    Yardany Ramos-Pastrana

    2014-12-01

    Full Text Available Preliminary study of insects associated to indoor body decay in Colombia. This is the first report studying insects associated to indoor body decay process of a white pig (Sus scrofa (Artiodactyla, Suidae in a controlled indoor environment in an urban area of Florencia city, Amazonia Piedmont, Colombia. For a period of 54 days, 9,220 individuals (immature and adults, distributed in 3 orders, 5 families, 10 genera, and 10 species were collected using entomological nets and tweezers. Five decaying stages are described (fresh, bloated, active decay, advanced decay and remains. During the fresh stage we recorded Cochliomyia macellaria (Fabricius, 1775, Chrysomya albiceps (Wiedemann, 1819, Ophyra aenescens (Wiedemann, 1830, Oxysarcodexia sp., Lepidodexia sp. and Lasiophanes sp.; during the bloating stage C. macellaria, C. albiceps, Lucilia eximia (Wiedemann, 1819, Hemilucillia semidiaphana (Rondani, 1850, Musca domestica Linnaeus, 1758, O. aenescens, Oxysarcodexia sp., Lepidodexia sp., Dermestes maculatus De Geer, 1774 and Lasiphanes sp.; during the active decay C. macellaria, C. albiceps, L. eximia, M. domestica, O. aenescens, Lepidodexia sp. D. maculatus and Lasiophanes sp.; during the advanced decay C. macellaria, C. albiceps, M. domestica, Lepidodexia sp. and Lasiophanes sp.; and during the remains stage C. albiceps, D. maculatus and Lasiophanes sp. The insects were sorted out in 3 ecological categories; necrophagous, predators and parasites and sarco-saprophagous. According to Chao and Jack estimators, total richness was observed on day 20, with 100% of the expected species.

  1. Genetic syndromes associated with overgrowth in childhood.

    Science.gov (United States)

    Ko, Jung Min

    2013-09-01

    Overgrowth syndromes comprise a diverse group of conditions with unique clinical, behavioral and molecular genetic features. While considerable overlap in presentation sometimes exists, advances in identification of the precise etiology of specific overgrowth disorders continue to improve clinicians' ability to make an accurate diagnosis. Among them, this paper introduces two classic genetic overgrowth syndromes: Sotos syndrome and Beckwith-Wiedemann syndrome. Historically, the diagnosis was based entirely on clinical findings. However, it is now understood that Sotos syndrome is caused by a variety of molecular genetic alterations resulting in haploinsufficiency of the NSD1 gene at chromosome 5q35 and that Beckwith-Wiedemann syndrome is caused by heterogeneous abnormalities in the imprinting of a number of growth regulatory genes within chromosome 11p15 in the majority of cases. Interestingly, the 11p15 imprinting region is also associated with Russell-Silver syndrome which is a typical growth retardation syndrome. Opposite epigenetic alterations in 11p15 result in opposite clinical features shown in Beckwith-Wiedemann syndrome and Russell-Silver syndrome. Although the exact functions of the causing genes have not yet been completely understood, these overgrowth syndromes can be good models to clarify the complex basis of human growth and help to develop better-directed therapies in the future.

  2. Diversity and synanthropy of Calliphoridae (Diptera) in the region of Rio Claro, SP, Brazil.

    Science.gov (United States)

    De Souza, C R; Zuben, C J V

    2012-06-01

    Dipteran blowflies (Calliphoridae) are of great medical and hygienic importance as vectors of pathogens and as parasites of living and dead tissue, and their association with carrion allows their use in forensic entomology. The objective of this study was to determine the synanthropic index of adult Calliphoridae (Diptera) collected in Rio Claro, São Paulo. Sampling occurred between September 2009 and August 2010. Traps baited with sardines, beef liver, and minced meat were assessed for five consecutive days per month in three distinct ecological areas representing urban, rural, and forest environments. The most abundant species was Lucilia eximia (Wiedemann), followed by Chrysomya albiceps (Wiedemann) and Chrysomya megacephala (Fabricius). Lucilia eximia was the only species present in all seasons and the only species collected during the winter. The season with the lowest abundance was winter, with 69 (5.5%) specimens, and spring was the season with the greatest number of specimens collected (774-61.8%). The only species found outside inhabited areas (synanthropic) was Lucilia cuprina (Wiedemann), with a synanthropy index (SI) value of +5.7. The SI values for the other species were negative, showing a preference for uninhabited areas. The rural and urban areas were most similar in terms of species composition as were the beef and sardine baits. Among the baits used, liver attracted the greatest abundance of calliphorids, whereas minced meat attracted the greatest diversity.

  3. Advances and perspectives in the mass rearing of fruit fly parasitoids in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Cancino, Jorge; Montoya, Pablo [Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (DGSV/SENASICA/SAGARPA), Chiapas (Mexico). Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria. Programa Moscamed-Moscafrut

    2006-07-01

    Biological control by augmentation is applied in Mexico as part of an integrated pest management program against native fruit flies of the genus Anastrepha Schiner. The exotic parasitoid Diachasmimorpha longicaudata has been the most important species used within this context. A program for the mass rearing of 50 million parasitized pupa per week has been established in southeast Mexico, and these are released into the field according to a yearly national plan based on industry requirements. In order to reduce costs and optimize procedures, important advances have been made in the technology for mass production, including an increase in the weight of host larvae (24 mg), changes in the management of host exposition, improvements in the management of environmental conditions, suitability in time and motions are the main areas addressed. Furthermore, a quality control program is routinely applied, and the key parameters under constant evaluation are: 1) weight and volume of host larvae, 2) host mortality after exposure, 3) weight and volume of pupae, and 4) percent parasitoid viability and percent emergence. Good performance in these parameters produces adults with adequate longevity and fecundity, high flight ability and good searching behavior. The introduced egg parasitoid Fopius arisanus and the native pupal parasitoid Coptera hawardi are being evaluated for use in the future as a complement to releases into the field of D. longicaudata. Manipulating host size and exposition time, the use of starting diet and suppressing host development by irradiation, have permitted the effective use of Anastrepha eggs as hosts for the rearing of F. arisanus. Further achievements in the mass rearing of C. haywardi (e.g., the suppression of unparasitized hosts after irradiation), could give us the opportunity to employ new options to reinforce the augmentative biological control of Anastrepha fruit flies in Mexico. (author)

  4. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  5. Desarrollo de herramientas moleculares para la evaluación de la calidad genética y productividad en la cría artificial de Diachasmimorpha longicaudata, agente de control biológico de moscas plaga de los frutos

    OpenAIRE

    2016-01-01

    Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae) es un endoparasitoide solitario de estadios larvales de moscas de la fruta perteneciente a la familia Tephritidae. Es criado a nivel masivo en bioplantas y utilizado en diversas partes del mundo para las estrategias de control biológico (CB) principalmente de dípteros de importancia económica de los géneros Ceratitis, Anastrepha y Bactrocera. Actualmente, se estudia su implementación en nuestro país para el control de Ceratitis ca...

  6. Parámetros de las interacciones planta-herbívoros-enemigos naturales en Schoepfia schreberi J. F. GMEL. (Olacaceae): el fruto es el detalle.

    OpenAIRE

    2013-01-01

    En este trabajo se describe de manera general las interacciones de las especies de herbívoros asociados a los frutos de Schoepfia schreberi (Olacaceae). La investigación se llevó a cabo en tres sitios experimentales durante tres años (2009-2011). Los arbustos de S. schreberi producen frutos de enero a mayo, periodo en el que se establecen relaciones directas e indirectas por el uso de sus frutos entre la mosca de la fruta Anastrepha spatulata (Diptera: Tephritidae), dos especies de palomillas...

  7. Hongos de importancia agrícola presentes en moscas de la fruta del valle de Ica, Perú

    OpenAIRE

    Carlos E. Tipismana; Lilian R. Astudillo; Juan J. Guillermo

    2013-01-01

    El objetivo del presente trabajo fue aislar e identificar hongos de especímenes de moscas de la fruta de los géneros Ceratitis (Macleay) y Anastrepha (Schiner), del valle de Ica, Perú. Se aislaron hongos pertenecientes a los géneros Alternaria, Aspergillus, Cladosporium, Mucor, Penicillium, Rhizoctonia, Rhizopus y Trichoderma;así como levaduras y micelios estériles. Los recuentos de hongos presentaron rangos entre 8x103 a 8x104 UFC/g para el género Ceratitis; y 7x103 a 7x104 UFC/g para el g...

  8. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea) em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea) in native forests and orchards in two counties of the State of Tocantins, Brazil

    OpenAIRE

    Darcy A. do Bomfim; Manoel A. Uchôa-Fernandes; Marcos A. L. Bragança

    2007-01-01

    Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002) com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De L...

  9. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  10. Hongos de importancia agrícola presentes en moscas de la fruta del valle de Ica, Perú

    Directory of Open Access Journals (Sweden)

    Carlos E. Tipismana

    2013-05-01

    Full Text Available El objetivo del presente trabajo fue aislar e identificar hongos de especímenes de moscas de la fruta de los géneros Ceratitis (Macleay y Anastrepha (Schiner, del valle de Ica, Perú. Se aislaron hongos pertenecientes a los géneros Alternaria, Aspergillus, Cladosporium, Mucor, Penicillium, Rhizoctonia, Rhizopus y Trichoderma;así como levaduras y micelios estériles. Los recuentos de hongos presentaron rangos entre 8x103 a 8x104 UFC/g para el género Ceratitis; y 7x103 a 7x104 UFC/g para el género Anastrepha. El IVI% (Índice de Valor de Importancia demostró que Cladosporium es el género con mayor valor ecológico con un 78,05%. El Índice de Similitud de especies de hongos entre ambos géneros de mosca de la fruta analizados fue 0,5. Los resultados obtenidos confirman la presencia de hongos en moscas de la fruta; y se deduce el posible impacto de estos dípteros en el área agrícola como potenciales agentes vectores de enfermedades fúngicas para los cultivos locales de importancia económica.

  11. Survey of ear flies (Diptera, Ulidiidae in maize (Zea mays L. and a new record of Euxesta mazorca Steyskal in Brazil

    Directory of Open Access Journals (Sweden)

    Ivan Cruz

    2011-03-01

    Full Text Available Survey of ear flies (Diptera, Ulidiidae in maize (Zea mays L. and a new record of Euxesta mazorca Steyskalin Brazil. Species of Euxesta (Diptera, Ulidiidae, known as silk flies or ear flies, are becoming increasingly important as maize insect pests in South America, although very little is known about them in Brazil. The larvae of some species of this genus initially damage female reproductive tissues, and then the developing kernels on the ear. As a result of feeding, fermentation and associated odors cause complete loss of the grain because it is no longer fit for human or livestock consumption. The main objective of this work was to evaluate the incidence of Euxesta spp. in Brazilian maize fields and to determine the most prevalent species using two different hydrolyzed protein foods attractants, BioAnastrepha® (hydrolyzed maize protein and Torula, placed inside McPhail traps. The two species identified were E. eluta Loew and E. mazorca Steyskal, the latter being a new record from Brazil. Between the two species, E. eluta was the more abundant in maize fields. Both attractants were efficient in capturing the two species. However, BioAnastrepha® captured significantly more insects than Torula.

  12. Effect of Lunar Phases, Tides, and Wind Speed on the Abundance of Diptera Calliphoridae in a Mangrove Swamp.

    Science.gov (United States)

    Batista-da-Silva, J A

    2014-02-01

    Abiotic factors, such as lunar phases and tides, have a significant effect on insect development. Reproduction and immature development are usually interlinked to these abiotic factors. The tide is at its highest levels at full moon or new moon, hindering the feeding of the immature or causing their drowning. The oviposition by adult females is also compromised on these days because much of the available food is submerged. Another important abiotic factor is the wind, which displaces odoriferous particles in the air. Wind speed and direction are important elements to indicate potential sources of food for insects. I report on the effects of lunar phases, tides, and wind speed on the Calliphoridae fauna in mangrove swamps. The different species collected were identified, and the predominant species in the area were quantified. A total of 1,710 flies were collected over a 1-year period. Six Calliphoridae flies, Chloroprocta idioidea (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Chrysomya albiceps (Wiedemann), Chrysomya putoria (Wiedemann), Cochliomyia macellaria (Fabricius), and Lucilia eximia (Wiedemann) were collected. Data indicated that lunar phases have a significant effect on the abundance of C. albiceps (r = 0.39, p < 0.01), and that the variation of the tides also affected the abundance of C. putoria (r = 0.40, p < 0.00), C. macellaria (r = 0.41, p < 0.00), and C. idioidea (r = 0.31, p < 0.04). The wind speed, however, did not affect these species.

  13. Genetic craniofacial aberrations.

    Science.gov (United States)

    Pirinen, S

    1998-12-01

    Many craniofacial and dental anomalies have a genetic background. Much research related to the molecular pathology of genetic conditions is being carried out, and new information related to mapping of disease genes, gene identification, and mutations in these genes is accumulating with incredible speed. It is important to be well informed of the molecular background of the conditions that we treat at anomaly clinics. This article reviews the most recent molecular findings related to Turner syndrome, Beckwith-Wiedemann syndrome, Marfan syndrome, Treacher Collins syndrome, cleidocranial dysplasia, and cleft lip and palate.

  14. The airway in patients with craniofacial abnormalities.

    Science.gov (United States)

    Nargozian, Charles

    2004-01-01

    Airway management for patients with craniofacial disorders poses many challenges. The anaesthesiologist must be familiar with the normal bony and soft-tissue anatomy in the airway and how anatomy is altered by various congenital disorders. Specific areas to assess include the oral cavity, anterior mandibular space, maxilla, temporomandibular joint and vertebral column. Congenital conditions that may alter normal anatomy and therefore anaesthetic management include cleft lip and palate with or without Pierre Robin syndrome, craniofacial dysostosis, mandibulofacial dysostosis/Treacher Collins syndrome, hemifacial microsomia, Klippel-Feil syndrome, Beckwith-Wiedemann syndrome, trisomy 21/Down's syndrome, Freeman-Sheldon/whistling face syndrome/craniocarpotarsal dysplasia, fibrodysplasia ossificans progressiva, mucopolysaccharidosis and vascular malformations.

  15. Quantum thermal transport in stanene

    Science.gov (United States)

    Zhou, Hangbo; Cai, Yongqing; Zhang, Gang; Zhang, Yong-Wei

    2016-07-01

    By way of the nonequilibrium Green's function simulations and analytical expressions, the quantum thermal conductance of stanene is studied. We find that, due to the existence of Dirac fermion in stanene, the ratio of electron thermal conductance and electric conductance becomes a chemical-potential-dependent quantity, violating the Wiedemann-Franz law. This finding is applicable to any two-dimensional (2D) materials that possess massless Dirac fermions. In strong contrast to the negligible electronic contribution in graphene, surprisingly, the electrons and phonons in stanene carry a comparable heat current. The unusual behaviors in stanene widen our knowledge of quantum thermal transport in 2D materials.

  16. Clinico‑genetic heterogeneity of chondrodysthrophic myotonia

    Directory of Open Access Journals (Sweden)

    N. A. Shnayder

    2012-01-01

    Full Text Available Chondrodystrophic myotonia characterized by generalized myotonic myopathy, masklike face, skeletal dysplasia, contracture of joints,growth retardation and bone maturation delay. Two types have been defined by the age of manifestation of the symptoms: the severe neonatal form, sometimes called type 2 (Stuve–Wiedemann syndrome, and the classical form (Schwartz–Jampel syndrome with late infantile or childhood manifestation. Therapy targets electrical stabilization of the muscle membrane. Successful therapies include anticonvulsants and antiarrhythmic drugs.

  17. Syndromes that Link the Endocrine System and Genitourinary Tract.

    Science.gov (United States)

    Özlük, Yasemin; Kılıçaslan, Işın

    2015-01-01

    The endocrine system and genitourinary tract unite in various syndromes. Genitourinary malignancies may cause paraneoplastic endocrine syndromes by secreting hormonal substances. These entities include Cushing`s syndrome, hypercalcemia, hyperglycemia, polycythemia, hypertension, and inappropriate ADH or HCG production. The most important syndromic scenarios that links these two systems are hereditary renal cancer syndromes with specific genotype/phenotype correlation. There are also some very rare entities in which endocrine and genitourinary systems are involved such as Carney complex, congenital adrenal hyperplasia and Beckwith-Wiedemann syndrome. We will review all the syndromes regarding manifestations present in endocrine and genitourinary organs.

  18. A taxonomic revision of the Southern South American species of the genus Fannia Robineau-Desvoidy (Diptera: Fanniidae

    Directory of Open Access Journals (Sweden)

    Martha Cecilia Dominguez

    2007-01-01

    Full Text Available The Southern South American species of the genus Fannia Robineau-Desvoidy are revised. Twenty five valid species are recognized for the region in the present study: Fannia albitarsis Stein, Fannia anthracina (Walker, Fannia bigoti Stein, Fannia canicularis (Linnaeus, Fannia confusa Pont & Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein, Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani, Fannia heydenii (Wiedemann, Fannia hirtifemur (Stein, Fannia incisurata (Zetterstedt, Fannia petrocchiae Shannon & Del Ponte, Fannia punctiventris Malloch, Fannia pusilla (Bigot, Fannia pusio (Wiedemann, Fannia scalaris (Fabricius, Fannia schnusei Stein, Fannia setosa (Bigot, Fannia tucumanensis Albuquerque, Fannia tumidifemur Stein and three new species from Argentina are described: two from the province of San Luis (Fannia roigi sp. nov. and Fannia hermani sp. nov. and one from the province of Mendoza (Fannia losgateados sp. nov.. The unknown male of Fannia fusconotata is described for the first time. The Neotropical Fannia euchaetophora Carvalho is synonymized with Fannia flavicornis Stein. Redescriptions are provided for all known species and genitalic illustrations given for both sexes. Keys for each sex are given, and knowledge on the geographical distribution of all species is updated and summarized.Las especies de Fannia de America del Sur Austral son revisadas. Se reconocen 25 especies para la region en el presente estudio: Fannia albitarsis Stein, Fannia anthracina (Walker, Fannia bigoti Stein, Fannia canicularis (Linnaeus, Fanniaconfusa Pont&Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein, Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani, Fannia heydenii (Wiedemann, Fannia hirtifemur (Stein, Fannia incisurata (Zetterstedt, Fannia petrocchiae Shannon & Del Ponte, Fannia punctiventris Malloch, Fannia pusilla (Bigot, Fannia pusio (Wiedemann, Fannia

  19. Primeiro relato de Muscidifurax raptorellus Kogan & Legner, 1970 (Hymenoptera: Pteromalidae no Brasil First report of Muscidifurax raptorellus Kogan & Legner, 1970 (Hymenoptera: Pteromalidae in Brazil

    Directory of Open Access Journals (Sweden)

    C.H. Marchiori

    2009-02-01

    Full Text Available This study reports the first occurrence of Muscidifurax raptorellus (Hymenoptera: Pteromalidae in Brazil. Chicken manure samples, collected at two-week interval, were taken to the laboratory and the pupae were extracted by the method of flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. In the study, ten pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae were obtained, two of which yielded the parasitoid M. raptorellus . The percentage of parasitism was 5.0%.

  20. Transport Properties near Quantum Critical Point in 2D Hubbard Model

    Science.gov (United States)

    Chen, Kuang-Shing; Pathak, Sandeep; Yang, Shuxiang; Su, Shi-Quan; Galanakis, Dimitris; Mikelsons, Karlis; Moreno, Juana; Jarrell, Mark

    2011-03-01

    We obtain high quality estimates of the self energy Σ (K , ω) by direct analytic continuation of Σ (K , iωn) obtained from Continuous-Time Quantum Monte Carlo. We use these results to investigate the transport properties near the quantum critical point found in the 2D Hubbard model at finite doping. Resistivity, thermal conductivity, Wiedemann-Franz Law, and thermopower are examined in the Fermi liquid, Marginal Fermi liquid (MFL), and pseudo-gap regions. Σ (k , ω) with k along the nodal direction displays temperature-dependent scaling similar to that seen in the experiment. A next-nearest neighbor hopping tOISE-0730290.

  1. Miíase por Lucilia eximia (Diptera: Calliphoridae em Didelphis albiventris (Mammalia: Didelphidae no Brasil Central

    Directory of Open Access Journals (Sweden)

    Edison Cansi

    2011-12-01

    Abstract. In May 2009 were collected 18 larvae of Lucilia eximia (Wiedemann, a fly responsible for primary and secondary myiasis in livestock and humans. The larvae were taken from the myiasis on anal and auricular regions of an opossum Didelphis albiventris (Lund, in Brasília Zoo, and later identified in the laboratory. After 15 days, 15 adults emerged from L. eximia. This is the first record of this blowfly causing a primary myiasis in a marsupial species in the Brasília Cerrado.

  2. The impact of industrial anthropization on mosquito (Diptera, Culicidae) communities in mangrove areas of Guanabara Bay (Rio de Janeiro, Brazil).

    Science.gov (United States)

    de Souza, A S; Couri, M S; Florindo, L

    2012-02-01

    The effects of industrial anthropization on species composition and community diversity of Culicidae (Diptera) were studied in a mangrove area impacted by industrial activities as compared to a preserved area, both around Guanabara Bay in the state of Rio de Janeiro, Brazil. Diversity, equitability, and species richness in Culicidae community differed between the studied areas. Indicator species analysis and correspondence analysis were carried out and indicated that the Sabethini, especially Wyeomyia (Phoniomyia) theobaldi Lane, Wyeomyia (Phoniomyia) fuscipes (Edwards), and a non-identified species of Wyeomyia sp. were associated to the preserved area, whereas Aedes taeniorhynchus Wiedemann and Aedes scapularis (Rondani) to the impacted area.

  3. Holography of the Dirac Fluid in Graphene with two currents

    CERN Document Server

    Seo, Yunseok; Kim, Philip; Sachdev, Subir; Sin, Sang-Jin

    2016-01-01

    Recent experiments have uncovered evidence of the strongly coupled nature of the graphene: the Wiedemann-Franz law is violated by up to a factor of 20 near the charge neutral point. We describe this strongly-coupled plasma by a holographic model in which there are two distinct conserved U(1) currents. We find that our analytic results for the transport coefficients for two current model have a significantly improved match to the density dependence of the experimental data than the models with only one current. We also discuss the origin of the two currents.

  4. Constitutional mosaic genome-wide uniparental disomy due to diploidisation: an unusual cancer-predisposing mechanism.

    Science.gov (United States)

    Romanelli, Valeria; Nevado, Julián; Fraga, Mario; Trujillo, Alex Martín; Mori, Maria Ángeles; Fernández, Luis; Pérez de Nanclares, Guiomar; Martínez-Glez, Víctor; Pita, Guillermo; Meneses, Heloisa; Gracia, Ricardo; García-Miñaur, Sixto; García de Miguel, Purificación; Lecumberri, Beatriz; Rodríguez, José Ignacio; González Neira, Anna; Monk, David; Lapunzina, Pablo

    2011-03-01

    Molecular studies in a patient with Beckwith-Wiedemann syndrome phenotype who developed two different tumours revealed an unexpected observation of almost complete loss of heterozygosity of all chromosomes. It is shown, by means of numerous molecular methods, that the absence of maternal contribution in somatic cells is due to high-degree (∼ 85%) genome-wide paternal uniparental disomy (UPD). The observations indicate that the genome-wide UPD results from diploidisation, and have important implications for genetic counselling and tumour surveillance for the growing number of UPD associated imprinting disorders.

  5. Genetic Considerations in the Prenatal Diagnosis of Overgrowth Syndromes

    Science.gov (United States)

    Vora, Neeta; Bianchi, Diana W.

    2015-01-01

    Large (>90%) for gestational age (LGA) fetuses are usually identified incidentally. Detection of the LGA fetus should first prompt the provider to rule out incorrect dates and maternal diabetes. Once this is done, consideration should be given to certain overgrowth syndromes, especially if anomalies are present. The overgrowth syndromes have significant clinical and molecular overlap, and are associated with developmental delay, tumors, and other anomalies. Although genetic causes of overgrowth are considered postnatally, they are infrequently diagnosed prenatally. Here, we review prenatal sonographic findings in fetal overgrowth syndromes, including Pallister-Killian, Beckwith-Wiedemann, Sotos, Perlman, and Simpson-Golabi-Behmel. We also discuss prenatal diagnosis options and recurrence risks. PMID:19609940

  6. Linear and quadratic in temperature resistivity from holography

    CERN Document Server

    Ge, Xian-Hui; Wu, Shang-Yu; Wu, Shao-Feng

    2016-01-01

    We present a new black hole solution in the Lifshitz spacetime with a hyperscaling violating factor. We analytically compute all of the DC thermoelectric conductivities in this theory. We find that both the linear-T and quadratic-T contributions to the resistivity can be realized, indicating that a more detailed comparison with experimental phenomenology can be performed in this scenario. At zero temperature, the Lorenz ratios are a constant, obeying the Wiedemann-Franz law, indications of a Fermi-liquid ground state.

  7. Los Laparocerus Schoenherr, 1834 de las Canarias orientales, islas Salvajes y Marruecos (Coleoptera, Curculionidae, Entiminae

    Directory of Open Access Journals (Sweden)

    Machado, A.

    2011-12-01

    Full Text Available This contribution to the knowledge of the genus Laparocerus Schoenherr, 1834 in Macaronesia concerns species from the Eastern Canaries, Salvage Islands and Morocco. Laparocerus rasus Wollaston, 1864 is redescribed and two new subspecies localised in Fuerteventura are ascribed to it: L. rasus betancor n. spp. and L. rasus jandiensis n. ssp. Several new species are described from that same island: L. maxorata n. sp., L. colonnellii n. sp., L. calvus n. sp., L. xericola n. sp., L. fraterculus n. sp., and L. longipennis n. sp.; from the island of Lanzarote L. curvipes famara n. ssp., and from the Selvage Islands L. garretai albosquamosus n. spp. The only confirmed species form Morocco, Laparocerus susicus (Escalera, 1914, is redescribed and L. susicus montanus n. spp., from the interior, and L. susicus inexpectatus nov. nom., from the coastal region of Tiznit are assigned to it. A retro-colonization from the Canary Islands to the continent is hypothesized for this Moroccan species. Doubtful records and unresolved species are commented on, and keys in Spanish and English for identifying all Laparocerus inhabiting this geographical context are provided.Esta contribución al conocimiento del género Laparocerus Schoenherr, 1834 está dedicada a las Canarias orientales, islas Salvajes y Marruecos. Se redescribe Laparocerus rasus Wollaston, 1864 y se le asignan dos nuevas subespecies localizadas en Fuerteventura: L. rasus betancor n. spp. y L. rasus jandiensis n. ssp. De esta misma isla se describen varias especies nuevas: L. maxorata n. sp., L. colonnellii n. sp., L. calvus, n. sp., L. xericola n. sp., L. fraterculus n. sp. y L. longipennis n. sp.; de la isla de Lanzarote L. curvipes famara n. ssp., y de las islas Salvajes L. garretai albosquamosus n. spp. Se redescribe la única especie confirmada de Marruecos, Laparocerus susicus (Escalera, 1914, a la que se adscriben L. susicus montanus n. spp., del interior, y L. susicus inexpectatus nom. nov., de

  8. Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., two yeast species isolated from Cerrado ecosystem in North Brazil.

    Science.gov (United States)

    Rosa, Carlos A; Morais, Paula B; Lachance, Marc-André; Santos, Renata O; Melo, Weilan G P; Viana, Rodney H O; Bragança, Marcos A L; Pimenta, Raphael S

    2009-05-01

    Two novel yeast species, Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., were isolated, respectively, from larvae of Anastrepha mucronata (Diptera: Tephritidae) collected from ripe fruit of Peritassa campestris ('Bacupari', Hippocrateaceae) and from flowers of Centropogon cornutus (Campanulaceae) in the Cerrado ecosystem of the state of Tocantins, Brazil. Analysis of the D1/D2 large-subunit rRNA gene sequences placed W. queroliae in the Wickerhamomyces clade near Wickerhamomyces ciferri and Candida silvicultrix. Candida jalapaonensis belongs to the Wickerhamiella clade and is related to Candida drosophilae. The type strain of Wickerhamomyces queroliae is UFMG-05-T200.1(T) (=CBS 10936(T)=NRRL Y-48478(T)) and the type strain of Candida jalapaonensis is UFMG-03-T210(T) (=CBS 10935(T)=NRRL Y-48477(T)).

  9. 柳州市2000~2008年检疫性实蝇监测调查报告

    Institute of Scientific and Technical Information of China (English)

    谢晓雁; 贝荣良; 殷积奎

    2010-01-01

    2000~2008 年在柳州市以及各县区范围内建立检疫性实蝇监测体系,对柳州市及周边县区实蝇的发生进行监测调查,通过对调查结果的统计分析,确定柳州市检疫性实蝇发生的优势种和高发期,监测调查结果表明:柳州市未发现地中海实蝇Ceratitis capitata(Widedmann)、墨西哥实蝇Anastrepha ludens、加勒比实蝇A.suspensa 等我国过去没有报道的实蝇种类.

  10. Tapachula-7, a new genetic sexing strain of the Mexican fruit fly (Diptera: Tephritidae): sexual compatibility and competitiveness.

    Science.gov (United States)

    Orozco, Dina; Meza, J Salvador; Zepeda, Silvia; Solís, Eduardo; Quintero-Fong, J Luis

    2013-04-01

    A new genetic sexing strain of the Mexican fruit fly, Anastrepha ludens (Loew), was evaluated in tests of sexual behavior to determine its possible application using the sterile insect technique. Tests in field cages measuring time to sexual maturity, compatibility with wild flies, and competitiveness were compared between the genetic sexing strain, Tapachula-7, and the mass-reared standard bisexual strain. The results indicated that the onset of sexual maturity was similar for both laboratory strains. Males from the Tapachula-7 strain do not differ from the standard bisexual strain in compatibility and competitiveness with wild insects. The results indicate that the release of Tapachula-7 males in the field would be viable in programs that use the sterile insect technique for the control of the Mexican fruit fly.

  11. Insecticidal activity of raw ethanolic extracts from Magnolia dealbata Zucc on a tephritid pest.

    Science.gov (United States)

    Flores-Estévez, Norma; Vasquez-Morales, Suria G; Cano-Medina, Tomás; Sánchez-Velásquez, Lázaro R; Noa-Carrazana, Juan C; Díaz-Fleischer, Francisco

    2013-01-01

    Ethanolic extracts from Magnolia dealbata (Zucc.) (Magnoliaceae); leaves, bark, seeds, sarcotesta and flowers were evaluated for insecticidal activity against adults of the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae). Using feeding bioassays composed from sugar-extract mixtures, only the extract from sarcotesta indicated insecticidal activity against the flies. The extracts from the other four plant tissues (leaves, bark, seeds and flowers) did not manifest any biological activity. The most effective extract was obtained from oven-dried sarcotesta, whereas extracts from fresh sarcotesta were inactive. Our results suggest that M. dealbata sarcotesta contains secondary metabolites with insecticidal activity against A. ludens adults. These metabolites are as potent as natural pyrethins and represent a potential substance for controlling this type of pest.

  12. Forensic entomology cases in Thailand: a review of cases from 2000 to 2006.

    Science.gov (United States)

    Sukontason, Kom; Narongchai, Paitoon; Kanchai, Chaturong; Vichairat, Karnda; Sribanditmongkol, Pongruk; Bhoopat, Tanin; Kurahashi, Hiromu; Chockjamsai, Manoch; Piangjai, Somsak; Bunchu, Nophawan; Vongvivach, Somsak; Samai, Wirachai; Chaiwong, Tarinee; Methanitikorn, Rungkanta; Ngern-Klun, Rachadawan; Sripakdee, Duanghatai; Boonsriwong, Worachote; Siriwattanarungsee, Sirisuda; Srimuangwong, Chaowakit; Hanterdsith, Boonsak; Chaiwan, Khankam; Srisuwan, Chalard; Upakut, Surasak; Moopayak, Kittikhun; Vogtsberger, Roy C; Olson, Jimmy K; Sukontason, Kabkaew L

    2007-10-01

    This paper presents and discusses 30 cases of cadavers that had been transferred for forensic entomology investigations to the Department of Forensic Medicine, Faculty of Medicine, Chiang Mai University, northern Thailand, from 2000 to 2006. Variable death scenes were determined, including forested area and suburban and urban outdoor and indoor environments. The fly specimens found in the corpses obtained were the most commonly of the blow fly of family Calliphoridae, and consisted of Chrysomya megacephala (F.), Chrysomya rufifacies (Macquart) Chrysomya villeneuvi Patton, Chrysomya nigripes Aubertin, Chrysomya bezziana Villeneuve, Chrysomya chani Kurahashi, Lucilia cuprina (Wiedemann), Hemipyrellia ligurriens (Wiedemann), and two unknown species. Flies of the family Muscidae [Hydrotaea spinigera Stein, Synthesiomyia nudiseta (Wulp)], Piophilidae [Piophila casei (L.)], Phoridae [Megaselia scalaris (Loew)], Sarcophagidae [Parasarcophaga ruficornis (F.) and three unknown species], and Stratiomyiidae (Sargus sp.) were also collected from these human remains. Larvae and adults of the beetle, Dermestes maculatus DeGeer (Coleoptera: Dermestidae), were also found in some cases. Chrysomya megacephala and C. rufifacies were the most common species found in the ecologically varied death scene habitats associated with both urban and forested areas, while C. nigripes was commonly discovered in forested places. S. nudiseta was collected only from corpses found in an indoor death scene.

  13. Mechanical, electrical, and thermal properties of the directionally solidified Bi-Zn-Al ternary eutectic alloy

    Institute of Scientific and Technical Information of China (English)

    M.Şahin; E.Çadrl

    2014-01-01

    A Bi-2.0Zn-0.2Al (wt%) ternary eutectic alloy was prepared using a vacuum melting furnace and a casting furnace. The samples were directionally solidified upwards at a constant growth rate (V=18.4μm/s) under different temperature gradients (G=1.15-3.44 K/mm) and at a constant temperature gradient (G=2.66 K/mm) under different growth rates (V=8.3-500μm/s) in a Bridgman-type directional so-lidification furnace. The dependence of microstructure parameter (λ) on the solidification parameters (G and V) and that of the microhardness (Hv) on the microstructure and solidification parameters were investigated. The resistivity (ρ) measurements of the studied alloy were per-formed using the standard four-point-probe method, and the temperature coefficient of resistivity (α) was calculated from theρ-Τcurve. The enthalpy (Δ H) and the specific heat (Cp) values were determined by differential scanning calorimetry analysis. In addition, the thermal con-ductivities of samples, obtained using the Wiedemann-Franz and Smith-Palmer equations, were compared with the experimental results. The results revealed that, the thermal conductivity values obtained using the Wiedemann-Franz and Smith-Palmer equations for the Bi-2.0Zn-0.2Al (wt%) alloy are in the range of 5.2-6.5 W/Km and 15.2-16.4 W/Km, respectively.

  14. Evaluating the Effects of Different Vegetation Types on Necrophagous Fly Communities (Diptera: Calliphoridae; Sarcophagidae): Implications for Conservation

    Science.gov (United States)

    Pereira de Sousa, José Roberto; Carvalho-Filho, Fernando da Silva; Juen, Leandro; Esposito, Maria Cristina

    2016-01-01

    The present study was conducted in five different phytogeographic zones of the Brazilian state of Maranhão, three of which (the Amazon Forest, Cerrado, and Palm Groves) are more heterogeneous, whereas the other two (Marshlands and Mangroves) are more homogeneous. In each zone, nine sites were visited for the collection of necrophagous flies using bait traps in 2010, 2011, and 2012. The calliphorid and sarcophagid communities observed at each site were compared in terms of species richness, composition, and abundance. The more heterogeneous zones had higher species richness, except in the case of the sarcophagids in the forest habitats. The calliphorids Chloroprocta idioidea (Robineau- Desvoidy, 1830), Mesembrinella bicolor (Fabricius, 1805), Hemilucilia semidiaphana (Rondani, 1850) and Lucilia eximia (Wiedemann, 1819) were more closely associated with the Cerrado, Palm Grove and Amazon Forest zones, and Chrysomya megacephala (Fabricius, 194) with the Mangrove. In the sarcophagids, Peckia (Euboettcheria) subducta (Lopes, 1935) and P. (Pattonella) palidipilosa (Curran & Walley, 1934) were associated with the Amazon Forest, and P. (Sarcodexia) lambens (Wiedemann, 1830) and Tricharaea (Sarcophagula) occidua (Fabricius, 1794) with the Palm Grove and Cerrado zones. In the calliphorids, the greatest dissimilarity was recorded between the Amazon Forest and the Mangrove and Lowland grassland zones. In the sarcophagids, by contrast, the greatest dissimilarities were recorded between the Amazon Forest and all the other four zones. In general, then, the phytogeographic zones with the highest environmental heterogeneity were characterized by the greatest species richness and abundance of necrophagous flies. PMID:27798664

  15. Attraction and Oviposition of Lucilia eximia (Diptera: Calliphoridae) to Resources Colonized by the Invasive Competitor Chrysomya albiceps (Diptera: Calliphoridae).

    Science.gov (United States)

    Spindola, Aline F; Zheng, Le; Tomberlin, Jeffery K; Thyssen, Patricia J

    2016-10-15

    The present study aimed to determine if the presence of immatures of the invasive blow fly species Chrysomya albiceps (Wiedemann) influences the adult behavior of the native species Lucilia eximia (Wiedemann) in Brazil. The level of attraction and oviposition by the native species was assessed in a dual-choice assay. The evaluation was based on sex and stage of ovarian development of L. eximia adults to a resource not colonized (NCR) or colonized (RPC) with eggs, different instars, or densities of C. albiceps A significant difference in attraction was observed based on sex and stages of ovarian development. Males and nongravid females were more attracted to RPC, whereas gravid females preferred NCR. Moreover, males exhibited the lowest response in all assays among the three sex categories examined. In general, adults preferably oviposited on NCR rather than RPC. Also, between the eggs and second instar treatments, L. eximia laid more eggs on RPC with eggs than second instars (predatory stage). Lucilia eximia attraction to second-instar C. albiceps at different densities was marginally significant. Overall, results indicate the invasive species, C. albiceps, is impacting the behavior of the native blow fly, L. eximia, with regards to its attraction and colonization of vertebrate carrion, which could explain why native blow fly populations have significantly decreased since the introduction of C. albiceps.

  16. Omphalocoeles: A decade in review

    Directory of Open Access Journals (Sweden)

    Simmi Singh

    2016-12-01

    Full Text Available Background. Omphalocoeles are associated with significant morbidity and mortality. The presentation varies greatly and management options differ accordingly. Limited literature exists regarding the varied presentation, associated congenital abnormalities and survival from a South African, or even an African perspective. Objective. To describe the presentation of omphalocoeles, associated abnormalities and survival rates. Methods. A retrospective epidemiological chart review of patients referred to the paediatric surgical service with newly diagnosed omphalocoeles, between January 2002 and December 2012. Data retrieved included patient demographics, perinatal history, HIV status, associated abnormalities, size of the omphalocoele, management and outcome. Results. One hundred and fifty-four patients were diagnosed with an omphalocoele during the study period. There were 117 (75.9% associated congenital abnormalities, 64 (41.5% minor omphalocoeles (defined as 5 cm. Eleven patients (7.1% had ruptured omphalocoeles. Beckwith-Wiedemann syndrome was the most commonly associated abnormality (37.6%, followed by cardiac defects (34.4%. Conclusion. Omphalocoeles are associated with high numbers of congenital abnormalities. This further complicates management in a resource-poor environment. There is an increased association with Beckwith-Wiedemann syndrome compared with previous studies. This highlights the need to be vigilant with glucose monitoring and to prevent secondary, avoidable complications.

  17. Irradiation of mangoes as a quarantine treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E.; Enkerlin H, W.; Toledo A, J.; Reyes F, J.; Casimiro G, A

    1991-06-15

    This research project was conducted following guidelines of research protocols for post-harvest treatments developed by the United States Department of Agriculture CUSA. Laboratory bioassays included the irradiation of mangoes infested with third instar larvae of Anastrepha serpentina (Wied), A. ludens (Loew), A. obliqua (Macquart) and Ceratitis capitata (Wied) , at doses from 10 to 250 Gy. Irradiation doses were applied using a Co-60 AECL Model JS-7400 irradiator. The design was chosen to obtain a maximum to minimum ratio equal to, or less than, 1.025. C. capitata was the species most tolerant to irradiation. A dose of 60 Gy applied to third instar fruit fly larvae sterilized this species and prevented emergence of adults of the other three species. A dose of 250 Gy was required to prevent emergence of C. capitata. In fertility tests using emerged adults of A . Iudens, and A. obliqua a dose of 30 Gy gave 45 % and 27 % fertility, respectively. Adults of A. serpentina that emerged, died before reaching sexual maturity. The confirmatory tests, at probit-9 security level, were done at 100 Gy for the three species of Anastrepha and at 150 Gy for C. capitata. The quality of mangoes irradiated up to 1000 Gy was evaluated by chemical, physiological, and sensorial tests. The determination of vitamin C indicated that there was no loss of the nutritive value of the fruit. It also was observed that fruit metabolism was not accelerated since no significant increase in respiration or transpiration was registered and consumers accepted both treated and untreated fruit in the same way. (Author)

  18. The smart aerial release machine, a universal system for applying the sterile insect technique.

    Directory of Open Access Journals (Sweden)

    Ruben Leal Mubarqui

    Full Text Available Beyond insecticides, alternative methods to control insect pests for agriculture and vectors of diseases are needed. Management strategies involving the mass-release of living control agents have been developed, including genetic control with sterile insects and biological control with parasitoids, for which aerial release of insects is often required. Aerial release in genetic control programmes often involves the use of chilled sterile insects, which can improve dispersal, survival and competitiveness of sterile males. Currently available means of aerially releasing chilled fruit flies are however insufficiently precise to ensure homogeneous distribution at low release rates and no device is available for tsetse.Here we present the smart aerial release machine, a new design by the Mubarqui Company, based on the use of vibrating conveyors. The machine is controlled through Bluetooth by a tablet with Android Operating System including a completely automatic guidance and navigation system (MaxNav software. The tablet is also connected to an online relational database facilitating the preparation of flight schedules and automatic storage of flight reports. The new machine was compared with a conveyor release machine in Mexico using two fruit flies species (Anastrepha ludens and Ceratitis capitata and we obtained better dispersal homogeneity (% of positive traps, p<0.001 for both species and better recapture rates for Anastrepha ludens (p<0.001, especially at low release densities (<1500 per ha. We also demonstrated that the machine can replace paper boxes for aerial release of tsetse in Senegal.This technology limits damages to insects and allows a large range of release rates from 10 flies/km2 for tsetse flies up to 600,000 flies/km2 for fruit flies. The potential of this machine to release other species like mosquitoes is discussed. Plans and operating of the machine are provided to allow its use worldwide.

  19. Sphaerionini (Coleoptera, Cerambycidae, Cerambycinae: novos taxons, sinonímia, chaves e nova combinação

    Directory of Open Access Journals (Sweden)

    Ubirajara R Martins

    1990-01-01

    Full Text Available New taxa described: Neomallocera, gen. n., type-species, Mallocera opulenta Newman, 1841; Protomallocera, gen. n., type-species, Mallocera hilairei Gounelle, 1908; Championa chemsaki, sp. n. (Mexico: Chiapas; Parasphaerion, gen. n., type-species, P. granulosum, sp. n. (Suriname; Mephritus quadrimaculatus, sp. n. (Bolivia: Cochabamba. M. castaneus, sp. n. (Peru: Pasco; M. fraterculus, sp. n. (Peru: Cajamarca; Nesostizocera suturalis. sp. n. (Peru and Ecuador; Morphaneflus, gen. n., type-species, M. prolixus, sp. n. (Argentina: Salta, Jujuy; Amethysphaerion eximium, sp. n. (Ecuador; A. jocosum, sp. n. (Brazil: Espírito Santo; A. submetallicum, sp. n. (Brazil: Minas Gerais; A. guarani, sp. n. (Paraguay; Aposphaerion punctulatum, sp. n. (Brazil: Amazonas; Pilisphaerion, gen. n., type-species, P. exoticum, sp. n. (Brazil: Pará; Adiposphaerion, gen n., type-species. A. rubrum, sp. n. (Brazil: Amazonas; Minipsyrassa guanabarina, sp. n. (Brazil: Rio de Janeiro; Sphaerioeme, gen. n., type-species, S. rubristerna, sp. n. (Suriname, Brazil: Goiás, Mato Grosso, Minas Gerais, São Paulo, Paraná; Apoclausirion. gen. n., type-species, A. nigricorne (Brazil: Mato Grosso. Mallocera pickeli Melzer, 1931 is considered a synonym of M. simplex White, 1853. Psyrassa trinidadensis Gilmour, 1963 is transferred to the genus Amethysphaerion. Keys to the genera related with Mallocera and to the species of Amethysphaerion are added.

  20. Curva de sobrevivência e estimativa de entropia em Lucilia cuprina (Diptera, Calliphoridae Survivorship curve and estimate of entropy in Lucilia cuprina (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Francely M. Fernandes

    2003-09-01

    Full Text Available Lucilia cuprina (Wiedemann, 1830 is a cosmopolite blowfly species of medical and veterinary importance because it produces myiasis, mainly in ovine. In order to evaluate the demographic characteristics of this species, survivorship curves for 327 adult males and 323 adult females, from generation F1 maintained under experimental conditions, were obtained. Entropy was utilized as the estimator of the survival pattern to quantify the mortality distribution of individuals as a function of age. The entropy values 0.216 (males and 0.303 (females were obtained. These results denote that, considering the survivorship interval until the death of the last individual for each sex, the males present a tendency of mortality in more advanced age intervals, in comparison with the females.

  1. Particle accelerator physics

    CERN Document Server

    Wiedemann, Helmut

    2015-01-01

    This book by Helmut Wiedemann is a well-established, classic text, providing an in-depth and comprehensive introduction to the field of high-energy particle acceleration and beam dynamics. The present 4th edition has been significantly revised, updated and expanded. The newly conceived Part I is an elementary introduction to the subject matter for undergraduate students. Part II gathers the basic tools in preparation of a more advanced treatment, summarizing the essentials of electrostatics and electrodynamics as well as of particle dynamics in electromagnetic fields. Part III is an extensive primer in beam dynamics, followed, in Part IV, by an introduction and description of the main beam parameters and including a new chapter on beam emittance and lattice design. Part V is devoted to the treatment of perturbations in beam dynamics. Part VI then discusses the details of charged particle acceleration. Parts VII and VIII introduce the more advanced topics of coupled beam dynamics and describe very intense bea...

  2. Heat transport through atomic contacts.

    Science.gov (United States)

    Mosso, Nico; Drechsler, Ute; Menges, Fabian; Nirmalraj, Peter; Karg, Siegfried; Riel, Heike; Gotsmann, Bernd

    2017-02-06

    Heat transport and dissipation at the nanoscale severely limit the scaling of high-performance electronic devices and circuits. Metallic atomic junctions serve as model systems to probe electrical and thermal transport down to the atomic level as well as quantum effects that occur in one-dimensional (1D) systems. Whereas charge transport in atomic junctions has been studied intensively in the past two decades, heat transport remains poorly characterized because it requires the combination of a high sensitivity to small heat fluxes and the formation of stable atomic contacts. Here we report heat-transfer measurements through atomic junctions and analyse the thermal conductance of single-atom gold contacts at room temperature. Simultaneous measurements of charge and heat transport reveal the proportionality of electrical and thermal conductance, quantized with the respective conductance quanta. This constitutes a verification of the Wiedemann-Franz law at the atomic scale.

  3. Electrical and thermal transport in the quasiatomic limit of coupled Luttinger liquids

    Science.gov (United States)

    Szasz, Aaron; Ilan, Roni; Moore, Joel E.

    2017-02-01

    We introduce a new model for quasi-one-dimensional materials, motivated by intriguing but not yet well-understood experiments that have shown two-dimensional polymer films to be promising materials for thermoelectric devices. We consider a two-dimensional material consisting of many one-dimensional systems, each treated as a Luttinger liquid, with weak (incoherent) coupling between them. This approximation of strong interactions within each one-dimensional chain and weak coupling between them is the "quasiatomic limit." We find integral expressions for the (interchain) transport coefficients, including the electrical and thermal conductivities and the thermopower, and we extract their power law dependencies on temperature. Luttinger liquid physics is manifested in a violation of the Wiedemann-Franz law; the Lorenz number is larger than the Fermi liquid value by a factor between γ2 and γ4, where γ ≥1 is a measure of the electron-electron interaction strength in the system.

  4. Hangout With CERN: Hot stuff - the early Universe (S01E06)

    CERN Multimedia

    Kahle, Kate

    2012-01-01

    This Hangout takes us well into the past, as we delve into the very early Universe. The LHC can recreate these early-Universe conditions in the lab by colliding heavy ions together. But why do we collide these different particle species? What is in store for the heavy-ion collisions after the end-of-year break? What is this mysterious quark-gluon plasma? CERN's Quantum Diaries blogger and ATLAS physicist Pauline Gagnon is joined by theorists Urs Wiedemann and Stefan Floerchinger, as well as experts from the LHC's heavy-ion experiment, ALICE: Despina Hatzifotiadou, Antonin Maire, David Dobrigkeit Chinellato, Leticia Cunqueiro Mendez and Kenneth Read. Also connecting are ATLAS physicists Steven Goldfarb and Tiina Wickstroem from the Science Museum in London with content developer Alice Lighton, as well as Fraser Cain, publisher of Universe Today. Recorded live on 6th December 2012.

  5. Thermoelectric properties of a weakly coupled quantum dot: enhanced thermoelectric efficiency

    Energy Technology Data Exchange (ETDEWEB)

    Tsaousidou, M [Materials Science Department, University of Patras, Patras 26504 (Greece); Triberis, G P, E-mail: rtsaous@upatras.g [Physics Department, Solid State Section, University of Athens, Panepistimiopolis, 15784, Zografos, Athens (Greece)

    2010-09-08

    We study the thermoelectric coefficients of a multi-level quantum dot (QD) weakly coupled to two electron reservoirs in the Coulomb blockade regime. Detailed calculations and analytical expressions of the power factor and the figure of merit are presented. We restrict our interest to the limit where the energy separation between successive energy levels is much larger than the thermal energy (i.e., the quantum limit) and we report a giant enhancement of the figure of merit due to the violation of the Wiedemann-Franz law when phonons are frozen. We point out the similarity of the electronic and the phonon contribution to the thermal conductance for zero-dimensional electrons and phonons. Both contributions show an activated behavior. Our findings suggest that the control of the electron and phonon confinement effects can lead to nanostructures with improved thermoelectric properties.

  6. Heat diffusion in the disordered electron gas

    Science.gov (United States)

    Schwiete, G.; Finkel'stein, A. M.

    2016-03-01

    We study the thermal conductivity of the disordered two-dimensional electron gas. To this end, we analyze the heat density-heat density correlation function concentrating on the scattering processes induced by the Coulomb interaction in the subtemperature energy range. These scattering processes are at the origin of logarithmic corrections violating the Wiedemann-Franz law. Special care is devoted to the definition of the heat density in the presence of the long-range Coulomb interaction. To clarify the structure of the correlation function, we present details of a perturbative calculation. While the conservation of energy strongly constrains the general form of the heat density-heat density correlation function, the balance of various terms turns out to be rather different from that for the correlation functions of other conserved quantities such as the density-density or spin density-spin density correlation function.

  7. Internal convection in thermoelectric generator models

    Science.gov (United States)

    Apertet, Y.; Ouerdane, H.; Goupil, C.; Lecæur, Ph

    2012-11-01

    Coupling between heat and electrical currents is at the heart of thermoelectric processes. In a thermoelectric system this may be seen, from a thermal viewpoint, as an additional thermal flux linked to the appearance of an electrical current. Since this additional flux is associated with the global displacement of charge carriers in the system, it can be qualified as convective in opposition to the conductive part related to both phonon transport and heat transport by electrons under open circuit condition as, e.g., in the Wiedemann-Franz relation. In this article we demonstrate that considering the convective part of the thermal flux allows both new insight into the thermoelectric energy conversion and the derivation of the maximum power condition for generators with realistic thermal coupling.

  8. Low temperature thermal conductivity of bilayer lanthanum-strontium-manganite (La1.2Sr1.8Mn2O7

    Energy Technology Data Exchange (ETDEWEB)

    Ronning, Filip [Los Alamos National Laboratory; Kurita, Nobuyuki [Los Alamos National Laboratory; Movshovich, Roman [Los Alamos National Laboratory; Mcclellan, Kenneth J [Los Alamos National Laboratory; Hur, N [INHA UNIV.; Vekhter, I [LA STATE UNIV.

    2008-01-01

    Thermal conductivity measurements were performed on bilayer manganite La{sub 1.2}Sr{sub 1.8}Mn{sub 2}O{sub 7} down to 0.1 K and up to 7.5 T. Due to the fact that ferromagnetic magnons can be largely gapped with a magnetic field, we could separate the magnon contribution to the thermal conductivity as well as the specific heat. Consequently, we find evidence for the transport of heat by 2-dimensional ferromagnetic magnons which are scattered by electrons. Assuming that the Wiedemann-Franz law is obeyed we find a self consistent analysis which shows a phonon thermal conductivity at low temperatures proportional to T{sup 1.7}. This is evidence that structurally glassy dynamics persist down to very low temperatures in the manganites.

  9. Thermal conductance of pressed contacts at liquid helium temperatures

    Science.gov (United States)

    Salerno, L. J.; Kittel, P.; Spivak, A. L.

    1983-01-01

    It is pointed out that the optimum design of cryogenic instruments requires accurate thermal models. The present models are limited by a lack of knowledge of the low temperature thermal conductance of the bolted joints which are typically used in the instrument-to-system interface. In connection with studies of pressed contacts, it has been found that the thermal conductance does not obey the Wiedemann-Franz law. The present investigation is concerned with the characterization of the thermal conductance of pressed contacts at liquid helium-4 temperatures, taking into account the dependence of thermal contact conductance on applied force and temperature. It is shown that for the 0.4 micron OFHC copper pressed contact pair, the thermal conductance varies roughly as the second power of the temperature, and increases with increasing applied force.

  10. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. 'Clemenules'

    Energy Technology Data Exchange (ETDEWEB)

    Alonso, Miquel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Palou, Lluis [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain)]. E-mail: lluis.palou@ivia.es; Angel del Rio, Miguel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Jacas, Josep-Anton [Departament de Ciencies Experimentals, Universitat Jaume I (UJI), Campus del Riu Sec, E-12071 Castello de la Plana (Spain)

    2007-10-15

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  11. A novel familial 11p15.4 microduplication associated with intellectual disability, dysmorphic features, and obesity with involvement of the ZNF214 gene.

    Science.gov (United States)

    Sofos, Elvera; Pescosolido, Matthew F; Quintos, Jose B; Abuelo, Dianne; Gunn, Shelly; Hovanes, Karine; Morrow, Eric M; Shur, Natasha

    2012-01-01

    We evaluated a patient with mild intellectual disability, obesity, overgrowth, and dysmorphic features. Array comparative genomic hybridization (aCGH) analysis showed a single copy number increase of a BAC clone in the 11p15.4 region. Oligonucleotide aCGH refined the duplication to approximately 2.29  megabases (Mb) in size. Testing the parents revealed that the father, who had learning disabilities and overgrowth, also had the 11p15.4 duplication, and the mother had a normal microarray. In addition, the patient's brother and grandmother all share clinical features with the proband and tested positive for the duplication. The duplicated region (Chr11:6,934,067-9,220,605) encompasses 29 genes, including the ZNF214 gene, which has been postulated to play a role in Beckwith-Wiedemann syndrome [Alders et al., 2000]. This three-generation pedigree outlines features of a novel microduplication syndrome.

  12. First Report of Necrophagous Insects on Human Corpses in Riyadh, Saudi Arabia.

    Science.gov (United States)

    Alajmi, R A; AlGhufaili, H; Farrukh, A; Aljohani, H; Mashaly, A M A

    2016-11-01

    Necrophagous species of insects provide useful complementary data to estimate the postmortem interval in forensic cases. Here, for the first time, we report on insect specimens collected from human corpses in Riyadh, Kingdom of Saudi Arabia. During the study, 14 beetle larvae were collected from the outdoor corpse (case report one) and five flies and seven beetles were collected from the indoor corpse (case report two). Sequencing was performed to study the mitochondrial DNA (mtDNA) as the prospective basis of an identification technique. The sequencing focused on a section of the cytochrome oxidase I encoding region of mtDNA. Two beetle species, Dermestes frischii (Kugelann) and Dermestes maculatus (De Geer) (Coleoptera: Dermestidae), and one fly species, Chrysomya albiceps (Wiedemann) (Diptera: Calliphoridae), were identified. These results will be instrumental in the implementation of a Saudi database of forensically relevant insects.

  13. A case of familial isolated hemihyperplasia

    Directory of Open Access Journals (Sweden)

    Bacino Carlos A

    2004-02-01

    Full Text Available Abstract Background Hemihyperplasia (hemihypertrophy is defined as asymmetric body overgrowth of one or more body parts. Hemihyperplasia can be isolated or be part of well-defined syndromes such as in the case of Beckwith-Wiedemann syndrome (BWS. Isolated hemihyperplasia is usually sporadic, but a number of familial occurrences have been described. Case presentation We describe a Tunisian family in which three maternal cousins and their maternal grandfather present with isolated hemihyperplasia. Conclusions The etiology of isolated hemihyperplasia is unknown although in BWS, genomic imprinting has been shown to play a role in the asymmetric overgrowth. Given the similarity between these two conditions, it is possible that both may share a common pathogenesis. We also discuss the possible genetic mechanisms leading to the production of hemihyperplasia in this family.

  14. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. ‘Clemenules’

    Science.gov (United States)

    Alonso, Miquel; Palou, Lluís; Ángel del Río, Miguel; Jacas, Josep-Anton

    2007-10-01

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  15. Overview of prohibited and permitted plant regulatory listing systems

    Science.gov (United States)

    Westbrooks, Randy G.; Tasker, Alan V.

    2011-01-01

    Pest risk analysis is a process that evaluates the risks involved with a proposed species to help determine whether it should be permitted or denied entry into a country, and how the risks could be managed if it is imported. The prohibited listing approach was developed in the late 1800s and early 1900s in response to outbreaks of plant and animals pests such as foot and mouth disease of livestock, Mediterranean fruitfly (Ceratitis capitata Wiedemann), and Gypsy moth (Lymantria dispar L.). Under this approach, selected species of concern are evaluated to determine if they should be regulated for entry. Under the permitted listing approach that was first used on a national level in Australia in the 1990s, all species that are proposed for introduction are assessed to determine if they should be regulated.

  16. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  17. Hot-water phytosanitary treatment against Ceratitis capitata (Diptera: Tephritidae) in 'Ataulfo' mangoes.

    Science.gov (United States)

    Hernández, Emilio; Rivera, Pedro; Bravo, Bigail; Toledo, Jorge; Caro-Corrales, José; Montoya, Pablo

    2012-12-01

    We determined the thermal death rate constants and mortality curves for the eggs and different instars of Ceratitis capitata (Mediterranean fruit fly) (Wiedemann) submerged in isolation in water at 44, 46, and 48 degrees C and submerged within fruits of Mangifera indica (mango) (L.) in water at 43.1, 44.1, 45.1, and 46.1 degrees C. The first instar was the most tolerant to this treatment, with estimated times for achieving 99.9968% mortality of 103.28, 92.73, and 92.49 min at temperatures of 43.1, 44.1, and 45.1 degrees C, respectively. The results of the study indicate that 'Ataulfo' mangoes weighing capitata while maintaining market quality at least for 15 d.

  18. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis.

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  19. Nonlinear Peltier effect and thermoconductance in nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Bogachek, E.N.; Scherbakov, A.G.; Landman, U. [School of Physics, Georgia Institute of Technology, Atlanta, Georgia 30332-0430 (United States)

    1999-10-01

    A theoretical analysis of thermal transport in nanowires, in field-free conditions and under influence of applied magnetic fields, is presented. It is shown that in the nonlinear regime (finite applied voltage) new peaks in the Peltier coefficient appear leading to violation of Onsager{close_quote}s relation between the Peltier and thermopower coefficients. Oscillations of the Peltier coefficient in a magnetic field are demonstrated. The thermoconductance has a steplike quantized structure similar to the electroconductance and it exhibits deviations from the Wiedemann-Franz law. The strong dependence of the thermoconductance on the applied magnetic field leads to the possibility of magnetic blockade of thermal transport in wires with a small number of conducting channels. Possible control of thermal transport in nanowires through external parameters, that is applied through finite voltages and magnetic fields, is discussed. {copyright} {ital 1999} {ital The American Physical Society}

  20. Nonlinear Peltier effect and thermoconductance in nanowires

    Science.gov (United States)

    Bogachek, E. N.; Scherbakov, A. G.; Landman, Uzi

    1999-10-01

    A theoretical analysis of thermal transport in nanowires, in field-free conditions and under influence of applied magnetic fields, is presented. It is shown that in the nonlinear regime (finite applied voltage) new peaks in the Peltier coefficient appear leading to violation of Onsager's relation between the Peltier and thermopower coefficients. Oscillations of the Peltier coefficient in a magnetic field are demonstrated. The thermoconductance has a steplike quantized structure similar to the electroconductance and it exhibits deviations from the Wiedemann-Franz law. The strong dependence of the thermoconductance on the applied magnetic field leads to the possibility of magnetic blockade of thermal transport in wires with a small number of conducting channels. Possible control of thermal transport in nanowires through external parameters, that is applied through finite voltages and magnetic fields, is discussed.

  1. CO fundamental bands in late-type stars. II - Spectrum simulations for F-K stars

    Science.gov (United States)

    Wiedemann, Guenter; Ayres, Thomas R.

    1991-01-01

    The procedure of Ayres and Wiedemann (1989) was applied to a range of stellar-atmosphere models to study the CO Delta-v = 1 spectrum and to establish its use as a remote sensor of thermal conditions in late-type stars. Spectra were computed to examine the sensitivity of the CO Delta-v = 1 to fundamental stellar parameters and to assess the errors introduced into the spectrum intepretation by uncertain input parameters and non-LTE effects. Results of the sensitivity study demonstrate that CO fundamental spectra are useful probes for the temperature structure of the outer layers of cool stellar atmospheres, but that their value is limited by the uncertainties introduced by non-LTE effects. However, in stars with surface gravities of log g of about 1.5 and greater, the values of these uncertainties are reasonably small.

  2. GENE IMPRINTING: ENGRAVING THE PATHOGENESIS OF HERIDETARY DISEASES

    Directory of Open Access Journals (Sweden)

    Sandeep Satapathy

    2014-01-01

    Full Text Available Gene imprinting has conduited the scope of our understanding of phenotypic expression and its corelation with constituent genotype. It is an epigenetic process that involves DNA methylation and histone modulation to attain monoallelic gene expression without altering the genetic sequences. A distinctive model of non-mendelian genetics, imprinting extends the control over expression of traits and selection of the allele that would direct the same, in a manner decided by the parent of origin. The constitutive existence of this imprinting even after gametogenesis, throughout the somatic development extends a clue for its regulatory hold on several heridetary traits. Several heridetary diseases like Cancers, Russell-Silver syndrome, Beckwith-Wiedemann syndrome, Prader-Willi and Angelman Syndromes and Neurodegenration have shown to be a subsequent error in the genomic impriting process. So, understanding these epigenetic regulations can be a therapeutic strategy for disease modelling and especially targeting their patterns of heridetary inheritance.

  3. Livebirth prevalence and follow-up of malformation syndromes in 27,472 newborns.

    Science.gov (United States)

    Higurashi, M; Oda, M; Iijima, K; Iijima, S; Takeshita, T; Watanabe, N; Yoneyama, K

    1990-01-01

    The results of a survey of the birth prevalence of congenital anomalies among 27,472 consecutive newborn babies at a large maternity hospital in Tokyo are reported. There were 29 cases with trisomy-21; 5 cases with trisomy-13 syndrome; 5 with trisomy-18 syndrome; 2 with cri-du-chat syndrome; and one each with partial monosomy 4p, partial trisomy 5p, partial trisomy 6p, partial trisomy 9p, partial trisomy 9q, partial monosomy 10p, and partial monosomy 13q. Single cases of the following were observed: the Hallermann-Streiff syndrome, the Treacher-Collins syndrome, achondroplasia, arthrogryposis, the Beckwith-Wiedemann syndrome, the asplenia syndrome, the Klippel-Trenaunay-Weber syndrome, the Marfan syndrome, the Carpenter syndrome, the Goldenhar syndrome, and the Pierre Robin syndrome. The results of follow-ups to determine the life-prognosis of each patient with an autosomal aberration are reported.

  4. CDKN1C mutations: two sides of the same coin.

    Science.gov (United States)

    Eggermann, Thomas; Binder, Gerhard; Brioude, Frédéric; Maher, Eamonn R; Lapunzina, Pablo; Cubellis, Maria Vittoria; Bergadá, Ignacio; Prawitt, Dirk; Begemann, Matthias

    2014-11-01

    Cyclin-dependent kinase (CDK)-inhibitor 1C (CDKN1C) negatively regulates cellular proliferation and it has been shown that loss-of-function mutations in the imprinted CDKN1C gene (11p15.5) are associated with the overgrowth disorder Beckwith-Wiedemann syndrome (BWS). With recent reports of gain-of-function mutations of the PCNA domain of CDKN1C in growth-retarded patients with IMAGe syndrome or Silver-Russell syndrome (SRS), its key role for growth has been confirmed. Thereby, the last gap in the spectrum of molecular alterations in 11p15.5 in growth-retardation and overgrowth syndromes could be closed. Recent functional studies explain the strict association of CDKN1C mutations with clinically opposite phenotypes and thereby contribute to our understanding of the function and regulation of the gene in particular and epigenetic regulation in general.

  5. Intrauterine Growth Restriction Associated with Hematologic Abnormalities: Probable Manifestations of Placental Mesenchymal Dysplasia

    Science.gov (United States)

    Martinez-Payo, Cristina; Bernabeu, Rocio Alvarez; Villar, Isabel Salas; Goy, Enrique Iglesias

    2015-01-01

    Introduction Placental mesenchymal dysplasia is a rare vascular disease associated with intrauterine growth restriction, fetal demise as well as Beckwith–Wiedemann syndrome. Some neonates present hematologic abnormalities possibly related to consumptive coagulopathy and hemolytic anemia in the placental circulation. Case report We present a case of placental mesenchymal dysplasia in a fetus with intrauterine growth restriction and cerebellar hemorrhagic injury diagnosed in the 20th week of pregnancy. During 26th week, our patient had an intrauterine fetal demise in the context of gestational hypertension. We have detailed the ultrasound findings that made us suspect the presence of hematologic disorders during 20th week. Discussion We believe that the cerebellar hematoma could be the consequence of thrombocytopenia accompanied by anemia. If hemorrhagic damage during fetal life is found, above all associates with an anomalous placental appearance and with intrauterine growth restriction, PMD should be suspected along other etiologies. PMID:26495159

  6. Natural enemies of woolly apple aphid (Hemiptera: Aphididae) in Washington State.

    Science.gov (United States)

    Gontijo, Lessando M; Cockfield, Stephen D; Beers, Elizabeth H

    2012-12-01

    Woolly apple aphid, Eriosoma lanigerum (Hausmann), has become a pest of increasing importance in Washington apple orchards in the past decade. The increase in aphid outbreaks appears to be associated with changes in pesticide programs and disruption of biological control. We sampled woolly apple aphid colonies in central Washington apple orchards for natural enemies of this pest from 2006 to 2008. The most common predators encountered were Syrphidae (Syrphus opinator Osten Sacken, Eupeodes fumipennis Thomson, and Eupeodes americanus Wiedemann); Chrysopidae (Chrysopa nigricornis Burmeister); and Coccinellidae (Coccinella transversoguttata Brown and Hippodamia convergens Guérin-Méneville). The specialist syrphid Heringia calcarata Loew was recorded for the first time occurring in Washington apple orchards. The only parasitoid found in aerial colonies of woolly apple aphid was Aphelinus mali Haldeman; root colonies, however, were not parasitized. Identification of important natural enemies provides a better basis for conservation biological control of this pest.

  7. Magnetomechanical damping and magnetoelastic hysteresis in permalloy

    Science.gov (United States)

    Ercuta, A.; Mihalca, I.

    2002-11-01

    The inverse Wiedemann effect (IWE) consisting in longitudinal magnetization reversals was detected with a cylindrical permalloy layer subjected to circular DC magnetic fields while performing low frequency (~1 Hz) free torsion oscillations. Hysteresis occurring in the magnetization vs elastic strain dependence (the `magnetoelastic hysteresis') suggested irreversible processes activated mechanically. Joint vibration and magnetization time records were carried out by means of an experimental set-up including inverted pendulum and conventional integrating fluxmeter, in order to compare the relative energy losses ascribed to the magnetomechanical damping (MMD) and to the magnetoelastic hysteresis, respectively. The experimental results clearly pointed out a close connection between IWE and MMD providing evidence that, when simultaneously examined, both effects reflect the same basic phenomenon: the irreversible magnetization changes induced by the elastic strain.

  8. Experimental study on the in-plane thermal conductivity of Au nanofilms

    Institute of Scientific and Technical Information of China (English)

    CAO Bingyang; ZHANG Qingguang; ZHANG Xing; TAKAHASHI Koji; IKUTA Tatsuya; QIAO Wenming; FUJII Motoo

    2007-01-01

    The in-plane thermal conductivity of Au nanofilms with thickness of 23 nm, which are fabricated by the electron beamphysical vapor deposition method and a suspension technology, is experimentally measured at 80-300 K by a one-dimensional steady-state electrical heating method. Strong size effects are found on the measured nanofilm thermal conductivity. The Au nanofilm in-plane thermal conductivity is much less than that of the bulk material. With the increasing temperature, the nanofilm thermal conductivity increases.This is opposite to the temperature dependence of the bulk property. The Lorenz number of the Au nanofilms is about three times larger than the bulk value and decreases with the increasing temperature, which indicates the invalidity of the Wiedemann-Franz law for metallic nanofilms.

  9. Diptera Brachycera found inside the esophagus of a mummified adult male from the early XIX century, Lisbon, Portugal

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    2008-03-01

    Full Text Available Fly puparia and adult fragments of diptera muscid were found inside the esophagus of a mummified body from the early XIX century, buried inside the crypt of the Sacrament Church (Lisbon, Portugal. The identification of the material revealed a monospecific colonization by Ophyra capensis (Wiedemann (Diptera: Muscidae, a species known to invade corpses in the ammoniacal fermentation wave. This species can be found in corpses kept indoors, not available to the early waves of blowflies (Diptera: Calliphoridae. In the present case, the number of pupae and their developmental stage suggest that the female invaded the mummified corpse through the partially opened mouth and the oviposition took place directly inside the esophagus. This is the first case of O. capensis infesting internal organs of an intact corpse. The use of chemical products for the embalming process probably explains why external colonization did not occur.

  10. On jet quenching parameters in strongly coupled non-conformal gauge theories

    CERN Document Server

    Buchel, A

    2006-01-01

    Recently Liu, Rajagopal and Wiedemann (LRW) [hep-ph/0605178] proposed a first principle, nonperturbative quantum field theoretic definition of ``jet quenching parameter'' \\hat{q} used in models of medium-induced radiative parton energy loss in nucleus-nucleus collisions at RHIC. Relating \\hat{q} to a short-distance behavior of a certain light-like Wilson loop, they used gauge theory-string theory correspondence to evaluate \\hat{q} for the strongly coupled N=4 SU(N_c) gauge theory plasma. We generalize analysis of LRW to strongly coupled non-conformal gauge theory plasma. We find that a jet quenching parameter is gauge theory specific (not universal). Furthermore, it appears it's value increases as the number of effective adjoint degrees of freedom of a gauge theory plasma increases.

  11. Thermal conductivity of nanoscale thin nickel films

    Institute of Scientific and Technical Information of China (English)

    YUAN Shiping; JIANG Peixue

    2005-01-01

    The inhomogeneous non-equilibrium molecular dynamics (NEMD) scheme is applied to model phonon heat conduction in thin nickel films. The electronic contribution to the thermal conductivity of the film is deduced from the electrical conductivity through the use of the Wiedemann-Franz law. At the average temperature of T = 300 K, which is lower than the Debye temperature ()D = 450 K,the results show that in a film thickness range of about 1-11 nm, the calculated cross-plane thermal conductivity decreases almost linearly with the decreasing film thickness, exhibiting a remarkable reduction compared with the bulk value. The electrical and thermal conductivities are anisotropic in thin nickel films for the thickness under about 10 nm. The phonon mean free path is estimated and the size effect on the thermal conductivity is attributed to the reduction of the phonon mean free path according to the kinetic theory.

  12. [Hepatoblastoma, Etiology, Case Reports].

    Science.gov (United States)

    Puchmajerová, A; Křepelová, A; Indráková, J; Sítková, R; Balaščak, I; Kruseová, J; Švojgr, K; Kodet, R; Kynčl, M; Vícha, A; Macek, M

    2016-01-01

    Hepatoblastoma is an uncommon malignant neoplasm in general, yet, it is the most common liver malignancy in children with the incidence about one per milion children. This type of liver tumor usually occurs before the age of three years. The etiology of hepatoblastoma remains unknown. However, there are some genetic conditions known to be associated with an increased risk of developing hepatoblastoma such as Beckwith-Wiedemann syndrome, hemihypertrophy, APC-associated polyposis, α-1-antitrypsin defficiency and some metabolic disorders including tyrosinemia, galactosemia and glycogen storage disease type 1. There is a higher risk of hepatoblastoma in children with very low birthweight, children who acquire hepatitis B at an early age and children with congenital biliary atresia.

  13. Elections to the Senior Staff Advisory Committee (“The Nine”) 2014

    CERN Multimedia

    Jean-Philippe Tock, spokesperson of the "Nine"

    2014-01-01

    The electronic voting process for the Senior Staff Advisory Committee (“The Nine”) was closed on Thursday 28 August 2014 at 17.00.   Of the 511 Senior Staff members eligible to vote, 302 voted. This represents a participation of 59%, to be compared to 63% in 2013, 61% in 2012, 43% in 2011, 44% in 2010, 57% in 2009, 53% in 2008, 63% in 2007, 64% in 2006 and 66% in 2005. The results are: Electoral group 1 (Research Physicists) Candidate Dept Votes Result Urs WIEDEMANN PH 155 ELECTED   Electoral group 2 (Applied Physicists, Engineers, Computer Scientists) Candidate Dept Votes Result Johan BREMER TE 59   Horst BREUKER PH 17   Olivier BRUNNER BE 41   Katy FORAZ EN 55   Wolfgang HOFLE BE 8   Yacine KADI EN 12   Pierre NININ GS 14   Mauro NONIS EN 14 &...

  14. Studies of variations of the cyclin-dependent kinase inhibitor 1C and the cyclin-dependent kinase 4 genes in relation to type 2 diabetes mellitus and related quantitative traits

    DEFF Research Database (Denmark)

    Nielsen, Eva-Maria D; Hansen, Lars; Stissing, Trine

    2005-01-01

    glucose-tolerant subjects the most frequent variants did not show any difference in allele frequencies between the type 2 diabetic patients and the control subjects. However, in two genotype-quantitative trait correlation studies involving 206 glucose-tolerant offspring of type 2 diabetic patients and 359......CDK4 is involved in the regulation of body weight, pancreatic beta-cell proliferation, insulin responsiveness, and diabetes pathogenesis. CDK4 activity is inhibited by CDKN1C, which is regulated by insulin. In addition, CDKN1C plays an important role in beta-cell proliferation and is involved...... in the pathogenesis of the Beckwith-Wiedemann syndrome, a disorder characterized by neonatal hyperinsulinaemic hypoglycaemia and pre- and post-natal overgrowth. The aim of this study was to investigate if variations in the proximal promoter and the coding region of the CDKN1C and CDK4 genes are associated with type 2...

  15. Tabanidae (Diptera of Amazônia XX: description of Tabanus pseudonebulosus n.sp.

    Directory of Open Access Journals (Sweden)

    Inocêncio de Sousa Gorayeb

    2006-03-01

    Full Text Available Tabanus pseudonebulosus, new species, is described based on 217 female specimens and 5 males collected in Venezuela (Guarico, Aguaio, Santa Elena, and Palmarito and in Brazil (Pará: Santana do Araguaia, Serra das Andorinhas in São Geraldo do Araguaia, Serra Norte Carajás and Gorotire; Amazonas: Canutama; Mato Grosso do Sul: Corumbá, mostly in open vegetation, scrub forest and in rocky environments. Observed intraspecific variation in the specimens is presented and related to collection localities, and morphological differences are diagnosed in relation to the similar species Tabanus nebulosus DeGeer 1776 and T. importunus Wiedemann 1828. Morphometrical data and indices for specimens in different localities are provided. Drawings and photo of the new species are presented.

  16. News from the Library: E-book or printed book? You can have the best of both worlds!

    CERN Multimedia

    CERN Library

    2011-01-01

    Over the last couple of years, the Library has been expanding its collection of electronic books. The most popular titles are, of course, also bought as paper copies and are available for loan.   More than 15,000 titles, across all CERN-relevant disciplines, are now available for download from the Library. Recently, Springer physics and astronomy books, as well as all volumes from Lecture Notes in Physics, were added. So, from now on, readers will not have to queue up for popular books such as "Particle Accelerator Physics" (Wiedemann) or "Particle Detection with Drift Chambers" (Blum, Rolandi and Riegler), which are often in high demand. From left to right: Tullio Basaglia (CERN Library), Christian Caron (Springer) and Wim van der Stelt (Springer). In addition to providing electronic access, the publisher offers people at CERN the possibility to purchase paperback copies, distributed under the label “My Copy”, for the tempting price of &a...

  17. Necrophagous Muscoids that develop in carcasses of Didelphis albiventris Lund, 1841 (Didelphimorphia, Didelphidae in Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Ândrio Zafalon da Silva

    2010-06-01

    Full Text Available Information regarding the similarity of the fauna that colonizes decomposing wildlife is insipient among the different carcass models. Species with different tissues and alimentary diets are hypothesized to be a colonization source of different necrophagous species. To verify this hypothesis, we observed the decomposition of a carcass of Didelphis albiventris Lund, 1841 (Didelphimorphia, Didelphidae, that had been run over by a vehicle. 2,273 adults were reared from specimens at immature stages collected on the carcass. The most representative species belongs to Calliphoridae, Muscidae, Sarcophagidae and Fanniidae, with numeric dominance of Lucilia eximia Wiedemann, 1819 (Diptera, Calliphoridae. Another six species were found, besides non-identified Fanniidae specimens. All species were colonizers of traditionally used forensic models.

  18. Identifying fly puparia by clearing technique: application to forensic entomology.

    Science.gov (United States)

    Sukontason, Kabkaew L; Ngern-Klun, Radchadawan; Sripakdee, Duanghatai; Sukontason, Kom

    2007-10-01

    In forensic investigations, immature stages of the fly (egg, larva, or puparia) can be used as entomological evidence at death scenes, not only to estimate the postmortem interval (PMI), analyze toxic substances, and to determine the manner of death but also to indicate the movement of a corpse in homicide cases. Of these immature stages, puparia represent the longest developmental time, which makes them of useful. However, in order for forensic entomologists to use puparia effectively, it is crucial that they are able to accurately identify the species of fly found in a corpse. Typically, these puparia are similar in general appearance, being coarctate and light brown to dark brown in color, which makes identification difficult. In this study, we report on the clearing technique used to pale the integument of fly puparia, thereby allowing observation of the anterior end (second to fourth segments) and the profile of the posterior spiracle, which are important clues for identification. We used puparia of the blowfly, Chrysomya megacephala (F.), as the model species in this experiment. With placement in a 20% potassium hydroxide solution daily and mounting on a clearing medium (Permount(R), New Jersey), the profile of the posterior spiracle could be clearly examined under a light microscope beginning on the fifth day after pupation, and the number of papillae in the anterior spiracle could be counted easily starting from the ninth day. Comparison of morphological features of C. megacephala puparia with those of other blowflies (Chrysomya nigripes [Aubertin], Chrysomya rufifacies [Macquart], Chrysomya villeneuvi [Patton], Lucilia cuprina [Wiedemann], and Hemipyrellia ligurriens [Wiedemann]) and a housefly (Musca domestica L.) revealed that the anterior ends and the profiles of the posterior spiracles had markedly distinguishing characteristics. Morphometric analysis of the length and width of puparia, along with the length of the gaps between the posterior spiracles

  19. Thermophysical Properties of a Chromium Nickel Molybdenum Steel in the Solid and Liquid Phases

    Science.gov (United States)

    Wilthan, B.; Reschab, H.; Tanzer, R.; Schützenhöfer, W.; Pottlacher, Gernot

    2008-02-01

    Numerical simulation of vacuum arc re-melting, pressurized or protective electro-slag re-melting, and ingot casting have become quite important in the metal industry. However, a major drawback of these simulation techniques is the lack of accurate thermophysical properties for temperatures above 1,500 K. Heat capacity, heat of fusion, density, and thermal conductivity are important input parameters for the heat transfer equation. Since, direct measurements of thermal conductivity of alloys in the liquid state are almost impossible, its estimation from electrical conductivity using the Wiedemann Franz law is very useful. The afore-mentioned thermophysical properties of several steels are investigated within the context of an ongoing project. Here, we present a full set of thermophysical data for the chromium nickel molybdenum steel meeting the standard DIN 1.4435 (X2CrNiMo18-14-3); these values will be used by our partner to simulate various re-melting and solidification processes. Wire-shaped samples of the steel are resistively volume-heated, as part of a fast capacitor discharge circuit. Time-resolved measurements with sub-μs resolution of current through the specimen are performed with a Pearson probe. The voltage drop across the specimen is measured with knife-edge contacts and ohmic voltage dividers, the temperature of the sample with a pyrometer, and the volumetric expansion of the wire with a fast acting CCD camera. These measurements enable the heat of fusion, the heat capacity, and the electrical resistivity to be determined as a function of temperature in the solid and liquid phases. The thermal conductivity and thermal diffusivity are estimated via the Wiedemann Franz law.

  20. Developmental rates of immatures of three Chrysomya species (Diptera: Calliphoridae) under the effect of methylphenidate hydrochloride, phenobarbital, and methylphenidate hydrochloride associated with phenobarbital.

    Science.gov (United States)

    Rezende, Fábio; Alonso, Marcela A; Souza, Carina M; Thyssen, Patrícia J; Linhares, Arício X

    2014-05-01

    Entomotoxicology is focused on obtaining data on necrophagous entomofauna, for criminal investigations purposes. This study aimed to evaluate the effect of different concentrations of methylphenidate hydrochloride, phenobarbital, and their association on the developmental rate, larval and pupal survivorship, and the interval of emergence of adults of Chrysomya albiceps (Wiedemann), Chrysomya megacephala (Fabricius), and Chrysomya putoria (Wiedemann) (Diptera: Calliphoridae). Considering the therapeutic dose (TD) of methylphenidate hydrochloride (0.29 mg/Kg), the concentrations tested were 10× TD, 50× TD, and 100× TD. For phenobarbital, the concentrations used were 1× TD (=150 mg/Kg), 3.3× TD, and 6.7× TD. For the association of the drugs, the combinations used were 10× TD-methylphenidate hydrochloride plus 1× TD-phenobarbital, 50× TD-methylphenidate hydrochloride plus 3.3× TD-phenobarbital, and 100× TD-methylphenidate hydrochloride plus 6.7× TD-phenobarbital. The control group, without addition of drug, was maintained under the same conditions of temperature (25 ± 1 °C), humidity (70 ± 10%), and photoperiod (12 h). Specimens of each group were weighed every 12 h until pupariation. The developmental rate of the three Chrysomya species immatures was monitored. For C. albiceps the developmental time was delayed in 24 h for methylphenidate hydrochloride group and in 12 h for the phenobarbital and the drugs association groups. The effect was observed only at specific ages for C. megacephala, without altering the developmental time. For C. putoria, the developmental time was delayed in 12 h for methylphenidate hydrochloride group and in 24 h for the phenobarbital and the drugs association groups. The emergence interval was similar among all experimental groups, but larval and pupal viabilities were affected in different ways.

  1. Survey of the Genetic Diversity of Forensically Important Chrysomya (Diptera: Calliphoridae) from Egypt.

    Science.gov (United States)

    Salem, Abeer M; Adham, Fatma K; Picard, Christine J

    2015-05-01

    Minimum postmortem interval estimations of a corpse using blow fly larvae in medicolegal investigations require correct identification and the application of appropriate developmental data of the identified fly species. Species identification of forensically relevant blow flies could be very difficult and time consuming when specimens are damaged or in the event of morphologically indistinguishable immature stages, which are most common at crime scenes. In response to this, an alternative, accurate determination of species may depend on sequencing and molecular techniques for identification. Chrysomyinae specimens (n = 158) belonging to three forensically important species [Chrysomya albiceps (Wiedemann), Chrysomya megacephala (F.), and Chrysomya marginalis (Wiedemann)] (Diptera: Calliphoridae) were collected from four locations in Egypt (Giza, Dayrout, Minya, and North Sinai) and sequenced across the mitochondrial cytochrome oxidase subunit I (COI) gene. Phylogenetic analyses using neighbor-joining, maximum likelihood and maximum parsimony methods resulted in the same topological structure and confirmed DNA based identification of all specimens. Interspecific divergence between pairs of species was 5.3% (C. marginalis-C. megacephala), 7% (C. albiceps-C. megacephala), and 8% (C. albiceps-C. marginalis). These divergences are sufficient to confirm the utility of cytochrome oxidase subunit I gene in the molecular identification of these flies in Egypt. Importantly, the maximum intraspecific divergence among individuals within a species was <1% and the least nucleotide divergence between species used for phylogenetic analysis was 3.6%. This study highlights the need for thorough and diverse sampling to capture all of the possible genetic diversity if DNA barcoding is to be used for molecular identification.

  2. Distribution Modeling of three screwworm species in the ecologically diverse landscape of North West Pakistan.

    Science.gov (United States)

    Zaidi, Farrah; Fatima, Syeda Hira; Khisroon, Muhammad; Gul, Ayesha

    2016-10-01

    North West Pakistan (NWP) is characterized by four eco-zones: Northern Montane Region, North Western Hills, Submontane Region and Indus Plains. Present study identified 1037 cases of traumatic myiasis in the region during 2012-2015. Screw worm larvae were classified as 12 species: Chrysomya bezziana (Villeneuve), Chryomya megacephala (Fabricius), Chrysomya rufifacies (Macquart), Lucilia cuprina (Wiedemann), Lucilia sericata (Meigen), Lucilia illustris (Meigen), Lucilia porphyrina (Walker), Hemipyrellia ligguriens (Wiedemann), Calliphora vicina (Robineau-Desvoidy), Wohlfahrtia magnifica (Schiner), Sarcophaga crassipalpalis (Macquart), Sarchophaga species. Among these C. bezziana, L. cuprina and W. magnifica with approximately 882 case reports were the principal agents of traumatic myiasis. The species W. magnifica is a first report from Pakistan. In order to investigate spatial distribution of these dominant species we used MaxEnt niche model. Our results revealed a well-established occurrence of C. bezziana and L. cuprina in the four eco-regions while W. magnifica is currently contained in the Submontane Region. Several hot spot areas of infestation were detected all characterized by high human population density showing synanthropic nature of these species. Wohlfahrtia magnifica was excluded from Northern Montane Region with severe winters and Southern Indus Plains with harsh summers revealing that invasive species are initially sensitive to extreme of temperatures. Presence of L. cuprina in the wet areas of North Humid Belt (Maximum annual precipitation: 1641mm) depicted a moisture preference of the species. In perspective of changing climate and future predictions of severe events such as droughts and flooding in NWP, W. magnifica can potentially alter the species composition. Considering these findings in an eco-geographically dynamic region of Pakistan we predict that two factors (1) Growing human population (2) Climatic conditions, equally contribute to range

  3. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2012-08-01

    Full Text Available Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri; similarly, establishment of Bactrocera dorsalis (Hendel in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan, Diachasmimorpha longicaudata (Ashmead and Fopius vandenboschi (Fullaway were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa. Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more

  4. Genetic technologies to enhance the Sterile Insect Technique (SIT)

    Energy Technology Data Exchange (ETDEWEB)

    Alphey, Luke; Baker, Pam; Condon, George C.; Condon, Kirsty C.; Dafa' alla, Tarig H.; Fu, Guoliang; Jin, Li; Labbe, Genevieve; Morrison, Neil M.; Nimmo, Derric D.; O' Connell, Sinead; Phillips, Caroline E.; Plackett, Andrew; Scaife, Sarah; Woods, Alexander, E-mail: luke.alphey@zoo.ox.ac.u [Oxitec Ltd., Oxford (United Kingdom); Burton, Rosemary S.; Epton, Matthew J.; Gong, Peng [University of Oxford (United Kingdom). Dept. of Zoology

    2006-07-01

    The Sterile Insect Technique (SIT) has been used very successfully against range of pest insects, including various tephritid fruit flies, several moths and a small number of livestock pests. However, modern genetics could potentially provide several improvements that would increase the cost-effectiveness of SIT, and extend the range of suitable species. These include improved identification of released individuals by incorporation of a stable, heritable, genetic marker; built-in sex separation (genetic sexing); reduction of the hazard posed by non-irradiated accidental releases from mass-rearing facility (fail-safe); elimination of the need for sterilization by irradiation (genetic sterilization). We discuss applications of these methods and the state of the art, at the time of this meeting, in developing suitable strains. We have demonstrated, in several key pest species, that the required strains can be constructed by introducing a repressible dominant lethal genetic system, a method known as RIDL(trade mark). Based on field experience with Medfly, incorporation of a genetic sexing system into SIT programs for other tephritids could potentially provide a very significant improvement in cost-effectiveness. We have now been able to make efficient female-lethal strains for Medfly. One advantage of our approach is that it should be possible rapidly to extend this technology to other fruit fly species; indeed we have recently been able also to make genetic sexing strains of Medfly (Anastrepha ludens). (author)

  5. Diet Shapes Mortality Response to Trauma in Old Tephritid Fruit Flies.

    Directory of Open Access Journals (Sweden)

    James R Carey

    Full Text Available Despite the importance of trauma in healthspan and lifespan in humans as well as in non-human species, with one important exception the literature in both gerontology and ecology contains virtually no experimental demographic studies concerned with trauma in any species. We used dietary manipulation [full diet (F versus sugar-only (S] to produce four levels of frailty in 55-day old tephritid fruit flies (Anastrepha ludens that were then subject to the trauma of cage transfer stress (n = 900/sex in each of the 4 treatments. The key results included the following: (1 there is a trauma effect caused by the transfer that depends on previous diet before transfer, new diet after transfer and gender of the fly; (2 males are more vulnerable than females; (3 if initial diet was F, flies are relatively immune against the trauma, and the subsequent diet (F or S does not matter; (4 however if initial diet was S, then the effect of the trauma depends largely on the diet after the transfer; (5 flies transferred from S to F diets do very well in terms of remaining longevity (i.e. greatest remaining longevity, while flies transferred from S to S diet do poorly (i.e. shortest remaining longevity. We discuss both the strengths and weaknesses of this study and implications of the results.

  6. Mango resistance to fruit flies. II - resistance of the alfa cultivar

    Energy Technology Data Exchange (ETDEWEB)

    Rossetto, C.J.; Bortoletto, N., E-mail: rossetto@iac.sp.gov.b [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Votuporanga, SP (Brazil). Polo Regional do Noroeste Paulista; Walder, J.M.M.; Mastrangelo, T. de A., E-mail: jmwalder@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil); Carvalho, C.R.L.; Castro, J.V. de, E-mail: climonta@iac.sp.gov.b, E-mail: josalba@iac.sp.gov.b [Instituto Agronomico de Campinas, SP (Brazil); Pinto, A.C. de Q. [EMBRAPA, Brasilia, DF (Brazil); Cortelazzo, A.L., E-mail: angelo@unicamp.b [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia

    2006-07-01

    The percentage of infested mango fruits of five selected mango varieties was evaluated during three years under field conditions. Three varieties with field resistance to fruit flies had less then 10% of fruits infested. Tommy Atkins, the susceptible commercial check, had 42,9% and the susceptible check had 98.9 % of infested fruits. The three field resistant varieties plus the susceptible commercial check, Tommy Atkins, were further tested in laboratory, under caged conditions, with artificial infestation of Anastrepha obliqua. The attempts of oviposition and the number of pupae developed from each fruit were evaluated. Under caged conditions, the cultivar Alfa maintained its field resistance and Espada Stahl and IAC 111 lost the field resistance and were as susceptible as Tommy Atkins. The attempts of oviposition were positively and highly correlated with the number of pupae developed in the fruits. Non preference for oviposition was confirmed as the main mechanism of resistance of mango fruits to fruit flies. In the absence of a more susceptible variety (no choice test) the cultivar Alfa has kept the resistance (author)

  7. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil

    Directory of Open Access Journals (Sweden)

    Flávio R. M. Garcia

    2012-12-01

    Full Text Available The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA to evaluate the parasitoid’s potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  8. Development of Myrmeleon brasiliensis (Navas) (Neuroptera, Myrmeleontidae), in laboratory, with different natural diets

    Energy Technology Data Exchange (ETDEWEB)

    Missirian, Giani L.B. [Centro Universitario da Grande Dourados, MS (Brazil). Curso de Ciencias Biologicas; Uchoa-Fernandes, Manoel A. [Universidade Federal da Grande Dourados, MS (Brazil). Faculdade de Ciencias Biologicas e Ambientais]. E-mail: uchoa.fernandes@ufgd.edu.br; Fischer, Erich [Universidade Federal de Mato Grosso do Sul, Campo Grande, MS (Brazil). Dept. de Biologia

    2006-07-01

    Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp.), fruit fly larvae (Anastrepha spp. and Ceratitis capitata) and mixed diet (Atta spp. plus fruit fly larvae)] on the development of larvae and pupae of M. brasiliensis (Navas, 1914) and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days) of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm), the mean weight (mg) or the mean body size (mm) in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments. (author)

  9. Wolbachia in two populations of Melittobia digitata Dahms (Hymenoptera: Eulophidae)

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Claudia S.; Sivinski, John [United States Dept. of Agriculture, Gainesville, FL (United States). Center for Medical, Agriculture and Veterinary Entomology]. E-mails: cclaudia@bioinf.uni-leipzig.de; john.sivinski@ars.usda.gov; Matthews, Robert W. [University of Georgia, Athens, GA (United States). Dept. of Entomology]. E-mail: rmatthew@uga.edu; Gonzalez, Jorge M. [Texas A and M Univ., College Station, TX (United States). Dept. of Entomology]. E-mail: jmgonzalez@neo.tamu.edu; Aluja, Martin [Instituto de Ecologia A.C., Veracruz (Mexico)]. E-mail: martin.aluja@inecol.edu.mx

    2008-11-15

    We investigated two populations of Melittobia digitata Dahms, a gregarious parasitoid (primarily upon a wide range of solitary bees, wasps, and flies), in search of Wolbachia infection. The first population, from Xalapa, Mexico, was originally collected from and reared on Mexican fruit fly pupae, Anastrepha ludens Loew (Diptera: Tephritidae); the other, from Athens, Georgia, was collected from and reared on prepupae of mud dauber wasps, Trypoxylon politum Say (Hymenoptera: Crabronidae). PCR studies of the ITS2 region corroborated that both parasitoid populations were the same species; this potentially provides a useful molecular taxonomic profile since females of Melittobia species are superficially similar. Amplification of the Wolbachia surface protein gene (wsp) confirmed the presence of this endosymbiont in both populations. Sequencing revealed that the Wolbachia harbored in both populations exhibited a wsp belonging to a unique subgroup (denoted here as Dig) within the B-supergroup of known wsp genes. This new subgroup of wsp may either belong to a different strain of Wolbachia from those previously found to infect Melittobia or may be the result of a recombination event. In either case, known hosts of Wolbachia with a wsp of this subgroup are only distantly related taxonomically. Reasons are advanced as to why Melittobia - an easily reared and managed parasitoid - holds promise as an instructive model organism of Wolbachia infection amenable to the investigation of Wolbachia strains among its diverse hosts. (author)

  10. Superparasitism in the Fruit Fly Parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) and the Implications for Mass Rearing and Augmentative Release.

    Science.gov (United States)

    Montoya, Pablo; Pérez-Lachaud, Gabriela; Liedo, Pablo

    2012-09-25

    Superparasitism, a strategy in which a female lays eggs in/on a previously parasitized host, was attributed in the past to the inability of females to discriminate between parasitized and non-parasitized hosts. However, superparasitism is now accepted as an adaptive strategy under specific conditions. In fruit fly parasitoids, superparasitism has mainly been studied as concerns the new association between Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae) and the Mexican fruit fly Anastrepha ludens (Loew) (Diptera: Tephritidae), wherein this phenomenon is a common occurrence in both mass rearing and field conditions. Studies of this species have shown that moderate levels of superparasitism result in a female-biased sex ratio and that both massreared and wild females superparasitize their hosts without detrimental effects on offspring demographic parameters, including longevity and fecundity. These studies suggest that superparasitism in this species is advantageous. In this paper, we review superparasitism in D. longicaudata, discuss these findings in the context of mass rearing and field releases and address the possible implications of superparasitism in programs employing augmentative releases of parasitoids for the control of fruit fly pests.

  11. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil.

    Science.gov (United States)

    Garcia, Flávio R M; Ricalde, Marcelo P

    2012-12-21

    The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus) was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA) to evaluate the parasitoid's potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  12. An improved quarantine method for mangoes against the Mexican fruit fly based on high-pressure processing combined with heat.

    Science.gov (United States)

    Velazquez, Gonzalo; Candelario, Hugo Ernesto; Ramírez, José A; Montoya, Pablo; Loera-Gallardo, Jesús; Vázquez, Manuel

    2010-05-01

    The Mexican fruit fly Anastrepha ludens Loew (Diptera: Tephritidae) is one of the most important insects infesting mangoes, citrus, and other fruits in Mexico and other Latin-American countries. Quarantine methods approved to destroy this insect decrease the shelf life of commodities. The objective of this study was to determine the effect of high-pressure processing using an initial temperature of 50 degrees C on the survivorship of eggs and larvae of the Mexican fruit fly. Eggs and larvae were pressurized at 25, 50, 75, 100, or 150 MPa for 0, 5, 10, or 20 min. The hatching ability of pressurized eggs of 1, 2, 3, and 4 days old and survivorship of the first, second, and third instars were registered. Further, the ability to pupate was studied in surviving third instars. The results showed that eggs were more resistant than larvae to the high-pressure processing. Treatments at 150 MPa at initial 50 degrees C for 10 min destroyed all eggs and larvae of A. ludens, indicating that this process might be useful as a quarantine method for infested mangoes or other fruits.

  13. Mexican Fruit Fly Populations in the Semi-Arid Highlands of the Sierra Madre Oriental in Northeastern Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Mora-Olivo, A; Gaona-García, G; Reyes-Zepeda, F; Rocandio-Rodríguez, M

    2017-01-04

    The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most important pests of citrus in Mexico. We report the results of an analysis of A. ludens populations that inhabit the semi-arid highlands of the Sierra Madre Oriental in northeastern Mexico. This study aimed to provide information on population fluctuation of A. ludens and how it relates to climate variables, as well as insights into habitat and native parasitoids. Population peaked in the period July-November when ripe fruits of the wild host, Casimiroa pubescens Ramírez, were available. No adults were captured the rest of the year, suggesting that high populations depend on the availability of wild host fruit. No significant relationships between population fluctuation and climatic variables were observed, except for minimum temperature. Fruit samples of citron (Citrus medica L.), pomegranate (Punica granatum L.), and C. pubescens were collected to determine degree of infestation. Infestation levels (pupae/g) ranged between 0.0006 for citron, 0.0047 for pomegranate, and 0.0240 for C. pubescens. A native parasitoid of Tephritidae, Doryctobracon crawfordii (Viereck) (Braconidae), was identified. Parasitism percentage was calculated at 12.5% on C. pubescens fruits. No parasitoids were observed on citron or pomegranate fruit samples. These results contribute to knowledge on behavior of A. ludens native to temperate environments where no commercial hosts are available. Further research on host expansion of this pest in light of scenarios of global climate change is suggested.

  14. Evaluation of the Host Status of Mature Green Papayas 'Maradol' for the Mexican Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; Díaz-Fleischer, Francisco

    2014-10-01

    The suitability of mature green 'Maradol' papaya as a host of Anastrepha ludens (Loew) was studied under field and laboratory conditions. Field tests were conducted on commercial-ripened and spot-ripened fruit in two orchards and during two seasons in the state of Chiapas. Fruits at exportation ripeness are in "commercial ripeness", while fruits that are harvested immediately preceding exportation ripeness are in "spot ripeness." The field tests consisted of forced infestation experiments that evaluated papayas at two ripeness stages: the commercial- or exportation-ripened fruit (green fruits with one or two yellow stripes) and fruit before exportation ripeness called "spot ripeness." These tests were conducted in two orchards and during two seasons in the state of Chiapas, Mexico. Laboratory trials were performed with commercial-ripened fruit only. Fruit from four different postharvest periods (3, 24, 48, and 72 h) were exposed to groups of gravid flies. No larvae emerged from the fruit that was collected in the field experiments. However, some larvae and several fertile flies were obtained from the commercial-ripened fruit 72 h postharvest but not 3, 24, and 48 h postharvest in the laboratory. The results of this study indicate that the commercially ripe fruits of papaya Maradol were resistant to or free from infestation of A. ludens flies under field conditions, though these fruits must be considered nonnatural, conditional host because they became infested in the laboratory.

  15. Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford

    Science.gov (United States)

    2016-09-01

    Rare Disorders; Undiagnosed Disorders; Disorders of Unknown Prevalence; Cornelia De Lange Syndrome; Prenatal Benign Hypophosphatasia; Perinatal Lethal Hypophosphatasia; Odontohypophosphatasia; Adult Hypophosphatasia; Childhood-onset Hypophosphatasia; Infantile Hypophosphatasia; Hypophosphatasia; Kabuki Syndrome; Bohring-Opitz Syndrome; Narcolepsy Without Cataplexy; Narcolepsy-cataplexy; Hypersomnolence Disorder; Idiopathic Hypersomnia Without Long Sleep Time; Idiopathic Hypersomnia With Long Sleep Time; Idiopathic Hypersomnia; Kleine-Levin Syndrome; Kawasaki Disease; Leiomyosarcoma; Leiomyosarcoma of the Corpus Uteri; Leiomyosarcoma of the Cervix Uteri; Leiomyosarcoma of Small Intestine; Acquired Myasthenia Gravis; Addison Disease; Hyperacusis (Hyperacousis); Juvenile Myasthenia Gravis; Transient Neonatal Myasthenia Gravis; Williams Syndrome; Lyme Disease; Myasthenia Gravis; Marinesco Sjogren Syndrome(Marinesco-Sjogren Syndrome); Isolated Klippel-Feil Syndrome; Frasier Syndrome; Denys-Drash Syndrome; Beckwith-Wiedemann Syndrome; Emanuel Syndrome; Isolated Aniridia; Beckwith-Wiedemann Syndrome Due to Paternal Uniparental Disomy of Chromosome 11; Beckwith-Wiedemann Syndrome Due to Imprinting Defect of 11p15; Beckwith-Wiedemann Syndrome Due to 11p15 Translocation/Inversion; Beckwith-Wiedemann Syndrome Due to 11p15 Microduplication; Beckwith-Wiedemann Syndrome Due to 11p15 Microdeletion; Axenfeld-Rieger Syndrome; Aniridia-intellectual Disability Syndrome; Aniridia - Renal Agenesis - Psychomotor Retardation; Aniridia - Ptosis - Intellectual Disability - Familial Obesity; Aniridia - Cerebellar Ataxia - Intellectual Disability; Aniridia - Absent Patella; Aniridia; Peters Anomaly - Cataract; Peters Anomaly; Potocki-Shaffer Syndrome; Silver-Russell Syndrome Due to Maternal Uniparental Disomy of Chromosome 11; Silver-Russell Syndrome Due to Imprinting Defect of 11p15; Silver-Russell Syndrome Due to 11p15 Microduplication; Syndromic Aniridia; WAGR Syndrome; Wolf

  16. Postmortem Attraction of Sarcosaprophagous Diptera to Tramadol-Treated Rats and Morphometric Aspects of the Developed Larvae.

    Science.gov (United States)

    AbouZied, E M

    2016-06-01

    The presence of some specific drugs in animal tissues may affect the time of minimal postmortem intervals estimated during forensic entomological investigations. To test the effects of a specific drug on decomposition, a field study was conducted at Fayoum University campus, Egypt, from March to May 2013, using tramadol, a synthetic analgesic opioid used to treat moderate to severe pain in humans. Albino rats were used as the animal model during this study. The duration of the fresh stage of tramadol treated rat (Ttr) carcasses was significantly shorter (2.4 ± 0.27 days) compared to tramadol free rat (Tfr) carcasses (6.4 ± 0.49 days). The dry carcass stage of Ttr lasted longer (10.3 ± 0.99 days) as compared to (7.4 ± 0.18 days) the Tfr carcass. The decomposition process of the (Ttr) carcass was not significantly faster (24.9 ± 1.58 days) as compared to (Tfr) carcasses (29.5 ± 1.69). Lucilia cuprina (Wiedemann), Chrysomya albiceps (Wiedemann), and Musca domestica L. were less attracted to Ttr carcass-baited traps than traps with Tfr carcasses. However, females of Sarcophaga spp. showed a greater attraction to Ttr carcasses. Females of another sarcophagid fly, Wohlfahrtia spp. exhibited similar attraction tendencies to both types of trap baits. Larvae of S. argyrostoma (Robineau-Desvoidy) collected from Ttr carcasses developed to a significantly longer total body length (10.4 ± 0.04 mm) as compared to the average length of the larvae collected from Tfr carcasses (8.9 ± 0.34 mm). During days 9-13 after rat death, the relative lengths of larvae from Ttr carcasses were not significantly different from Tfr carcasses. Larvae fed on Ttr carcasses pupated 2 days later than the control larvae.

  17. Las miasis como entidad de interés en Medicina del Trabajo Myiasis as an entity of interest in occupational medicine

    Directory of Open Access Journals (Sweden)

    Alejandro González Medina

    2011-12-01

    Full Text Available En escasas ocasiones se ha hecho referencia a las miasis en el ámbito de la Medicina del Trabajo. Es un error bastante generalizado pensar que este tipo de parasitación es exclusiva de países subdesarrollados o de estratos sociales carentes de las mínimas medidas de higiene. Sin embargo, es importante conocer los agentes etiológicos y advertir del riesgo que afecta a ciertos sectores laborales expuestos a materia orgánica en descomposición o a ciertos alimentos que por sus características químicas actúan de atrayentes para los dípteros. Para ello, estudiamos los casos de miasis que se diagnosticaron en varios centros sanitarios ubicados en Granada, Málaga, Almería y Jaén durante el periodo comprendido entre septiembre de 2010 y junio de 2011 y consideramos con especial interés los que se iniciaron por una infestación durante el periodo laboral. Se observa en las miasis laborales un predominio de las especies Piophila casei (Linnaeus, 1758 y Sarcophaga (Bercaea africa (Wiedemann, 1824. Asimismo, exponemos las principales características del ciclo vital de los dípteros de interés sanitario y las medidas de seguridad que deben adoptarse para evitar este tipo de accidente laboral.In few occasions, reference to myiasis in the scope of Occupational Medicine has been done. It is a generalized mistake to think that this type of parasitation is exclusive of underdeveloped countries or social layers without the minimal hygiene measures. Nevertheless, it is important to know the etiological agents and to notice the risk that affects certain occupational sectors exposed to organic matter in decay proccess or to certain foods that by their chemical characteristics act of appealing to the Diptera. We studied the cases of myiasis diagnosed in some medical centers located in Granada, Málaga, Almería and Jaén during the period between September 2010 and June 2011 and we considered with special interest those that began by an infestation

  18. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae Relationship between time of larval development and fecundity in the female of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. Manso

    2006-07-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw , la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw (- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw (- como en las sw(+ , los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.We studied the relationship between the development time in the larva stage and the resulting female fecundity, in Ceratitis capitata Wiedemann wild-type individuals compared to mutant individuals showing slow development (sw. We observed the morphology of the ovaries in the progenies of the crossing between mutant and wild-type strains, comparing females segregating by «development time». This study showed that sw(- females developing later have got less ovarioles, and a more heterogeneous distribution of ovules, than females developing earlier. It was also found that the wild type females developing late also produce lower numbers both of ovarioles and fully developed ova, than those developing

  19. Insect Fauna Associated with Exposed Pig Carcasses in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Ana Ries

    2015-12-01

    Resumo. O conhecimento dos padrões de insetos que visitam carcaças em decomposição e a análise dos parâmetros relacionados a sua presença auxilia na determinação do intervalo post-mortem (IPM. Estas informações dependem de estudos regionais, pois a diversidade de insetos e as condições ambientais interferem neste contexto. O objetivo do estudo foi analisar a entomofauna que coloniza carcaças expostas em diferentes estágios de decomposição na área de estudo. O experimento foi conduzido no sul do Brasil utilizando três porcos domésticos (Sus scrofa Linnaeus, abatidos no local. Insetos adultos associados às carcaças foram amostrados diariamente com rede entomológica, coleta manual e armadilhas pitfall. Foram realizados testes estatísticos para avaliar a diversidade de insetos. Durante o processo de decomposição (14 dias, espécimes de Scarabaeidae (25% e Calliphoridae (23% foram os mais abundantes, considerando-se a totalidade das amostras. A diversidade de insetos é distinguível quando são analisados todos os parâmetros. A fase de Putrefação negra (IV exibiu a maior diversidade de acordo com os métodos aplicados. O padrão de sucessão foi estabelecido a partir do índice de dominância das espécies: fase Fresca - Lucilia eximia Wiedemann (Diptera, Calliphoridae, fase Cromática e de Inchamento – Chrysomya albiceps (Wiedemann (Diptera, Calliphoridae, e fase de Putrefação Negra e de Esqueletização – Aphodiinae sp. 1 (Coleoptera, Scarabaeidae.

  20. Selenium hyperaccumulator plants Stanleya pinnata and Astragalus bisulcatus are colonized by Se-resistant, Se-excluding wasp and beetle seed herbivores.

    Science.gov (United States)

    Freeman, John L; Marcus, Matthew A; Fakra, Sirine C; Devonshire, Jean; McGrath, Steve P; Quinn, Colin F; Pilon-Smits, Elizabeth A H

    2012-01-01

    Selenium (Se) hyperaccumulator plants can concentrate the toxic element Se up to 1% of shoot (DW) which is known to protect hyperaccumulator plants from generalist herbivores. There is evidence for Se-resistant insect herbivores capable of feeding upon hyperaccumulators. In this study, resistance to Se was investigated in seed chalcids and seed beetles found consuming seeds inside pods of Se-hyperaccumulator species Astragalus bisulcatus and Stanleya pinnata. Selenium accumulation, localization and speciation were determined in seeds collected from hyperaccumulators in a seleniferous habitat and in seed herbivores. Astragalus bisulcatus seeds were consumed by seed beetle larvae (Acanthoscelides fraterculus Horn, Coleoptera: Bruchidae) and seed chalcid larvae (Bruchophagus mexicanus, Hymenoptera: Eurytomidae). Stanleya pinnata seeds were consumed by an unidentified seed chalcid larva. Micro X-ray absorption near-edge structure (µXANES) and micro-X-Ray Fluorescence mapping (µXRF) demonstrated Se was mostly organic C-Se-C forms in seeds of both hyperaccumulators, and S. pinnata seeds contained ∼24% elemental Se. Liquid chromatography-mass spectrometry of Se-compounds in S. pinnata seeds detected the C-Se-C compound seleno-cystathionine while previous studies of A. bisulcatus seeds detected the C-Se-C compounds methyl-selenocysteine and γ-glutamyl-methyl-selenocysteine. Micro-XRF and µXANES revealed Se ingested from hyperaccumulator seeds redistributed throughout seed herbivore tissues, and portions of seed C-Se-C were biotransformed into selenocysteine, selenocystine, selenodiglutathione, selenate and selenite. Astragalus bisulcatus seeds contained on average 5,750 µg Se g(-1), however adult beetles and adult chalcid wasps emerging from A. bisulcatus seed pods contained 4-6 µg Se g(-1). Stanleya pinnata seeds contained 1,329 µg Se g(-1) on average; however chalcid wasp larvae and adults emerging from S. pinnata seed pods contained 9 and 47 µg Se g(-1). The

  1. Selenium hyperaccumulator plants Stanleya pinnata and Astragalus bisulcatus are colonized by Se-resistant, Se-excluding wasp and beetle seed herbivores.

    Directory of Open Access Journals (Sweden)

    John L Freeman

    Full Text Available Selenium (Se hyperaccumulator plants can concentrate the toxic element Se up to 1% of shoot (DW which is known to protect hyperaccumulator plants from generalist herbivores. There is evidence for Se-resistant insect herbivores capable of feeding upon hyperaccumulators. In this study, resistance to Se was investigated in seed chalcids and seed beetles found consuming seeds inside pods of Se-hyperaccumulator species Astragalus bisulcatus and Stanleya pinnata. Selenium accumulation, localization and speciation were determined in seeds collected from hyperaccumulators in a seleniferous habitat and in seed herbivores. Astragalus bisulcatus seeds were consumed by seed beetle larvae (Acanthoscelides fraterculus Horn, Coleoptera: Bruchidae and seed chalcid larvae (Bruchophagus mexicanus, Hymenoptera: Eurytomidae. Stanleya pinnata seeds were consumed by an unidentified seed chalcid larva. Micro X-ray absorption near-edge structure (µXANES and micro-X-Ray Fluorescence mapping (µXRF demonstrated Se was mostly organic C-Se-C forms in seeds of both hyperaccumulators, and S. pinnata seeds contained ∼24% elemental Se. Liquid chromatography-mass spectrometry of Se-compounds in S. pinnata seeds detected the C-Se-C compound seleno-cystathionine while previous studies of A. bisulcatus seeds detected the C-Se-C compounds methyl-selenocysteine and γ-glutamyl-methyl-selenocysteine. Micro-XRF and µXANES revealed Se ingested from hyperaccumulator seeds redistributed throughout seed herbivore tissues, and portions of seed C-Se-C were biotransformed into selenocysteine, selenocystine, selenodiglutathione, selenate and selenite. Astragalus bisulcatus seeds contained on average 5,750 µg Se g(-1, however adult beetles and adult chalcid wasps emerging from A. bisulcatus seed pods contained 4-6 µg Se g(-1. Stanleya pinnata seeds contained 1,329 µg Se g(-1 on average; however chalcid wasp larvae and adults emerging from S. pinnata seed pods contained 9 and 47 µg Se g

  2. Development of Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, in laboratory, with different natural diets Desenvolvimento de Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, em laboratório, com diferentes dietas naturais

    Directory of Open Access Journals (Sweden)

    Giani L. B. Missirian

    2006-12-01

    Full Text Available Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp., fruit fly larvae (Anastrepha spp. and Ceratitis capitata and mixed diet (Atta spp. plus fruit fly larvae] on the development of larvae and pupae of M. brasiliensis (Navás, 1914 and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm, the mean weight (mg or the mean body size (mm in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments.Larvas de formiga-leão são conhecidas por suas armadilhas ("funis" que constroem em solo arenoso, sob as quais esperam por suas presas. Este trabalho teve como objetivos verificar o efeito de diferentes dietas naturais [formigas-cortadeiras (Atta spp., larvas de moscas-das-frutas (Anastrepha spp. e Ceratitis capitata e dieta mista (Atta spp. e larvas de moscas-das-frutas] sobre o desenvolvimento larval e pupal de M. brasiliensis (Navás, 1914 e estimar o número e tamanho de presas capturadas, por instar larval, em cada dieta. No segundo e terceiro instares, as larvas de M. brasiliensis alimentadas com formigas-cortadeiras consumiram um número maior de presas e a

  3. Estimativa do intervalo pós-morte em um canino (Canis lupus familiaris Linnaeus 1758 pela entomologia forense em Cabedelo-PB, Brasil: relato de caso

    Directory of Open Access Journals (Sweden)

    G. Martins

    2013-08-01

    Full Text Available O intervalo pós-morte (IPM é um instrumento importante de diagnóstico relacionado à prática forense. O uso de insetos tem sido relatado como um modo eficiente para estimá-lo, quando o cadáver encontra-se em estágio avançado de decomposição. Objetivou-se com este trabalho estimar o IPM com base em evidências entomológicas em um canino. Foram coletadas larvas de moscas no cadáver e encaminhadas ao laboratório de entomologia, onde foram criadas e eclodiram adultos da espécie Chrysomya albiceps (Wiedemann, 1819. Somando-se os dados abióticos de temperatura e umidade relativa do local de coleta e do local de criação, estimou-se um IPM mínimo de 3,34 dias do momento da postura dos ovos pelas moscas até a coleta das larvas. Com base nos resultados obtidos, conclui-se que a entomologia forense, como ferramenta para estimativa do IPM, mostrou-se eficaz e determinante na elucidação do caso em questão.

  4. A new mechanised cultural practice to reduce Ceratitis capitata Wied. populations in area-wide IPM

    Directory of Open Access Journals (Sweden)

    P. Chueca

    2013-11-01

    Full Text Available The Mediterranean fruit fly (or medfly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae, affects most of the fruit species grown in temperate and tropical climate regions, causing significant economic damage. One of the classical cultural strategies against this pest is to gather and bury the remaining fruit after harvest, but this is economically unfeasible today. Wood shredders already available in current Spanish groves can be used to grind or crush fruits laying on the soil as an alternative to this practice and to the use of pesticides in area-wide integrated pest management (IPM. With the purpose of evaluating this alternative, the initial step of this study was to perform laboratory tests to assess the efficacy of crushing and grinding as a method for controlling medflies. The results showed that grinding was 78% effective against larval stages, while crushing resulted in a 17% efficacy, leading us to choose the first alternative. As a second step, the operational parameters (type of cutting tool, shaft rotation speed and tractor speed of the wood shredders were adjusted to efficiently carry out this practice under field conditions. Finally, the effect of the mechanised grinding of fallen fruit on C. capitata populations was evaluated for two consecutive years in commercial citrus orchards. The results showed a significant 27-46% reduction in C. capitata populations the following spring, thus demonstrating that the newly proposed mechanised alternative can be included in the current area-wide IPM of the pest in Spain.

  5. Systematic Comparison of Jet Energy-Loss Schemes in a realistic hydrodynamic medium

    CERN Document Server

    Bass, Steffen A; Majumder, Abhijit; Nonaka, Chiho; Qin, Guang-You; Renk, Thorsten; Ruppert, Jörg

    2008-01-01

    We perform a systematic comparison of three different jet energy-loss approaches. These include the Armesto-Salgado-Wiedemann scheme based on the approach of Baier-Dokshitzer-Mueller-Peigne-Schiff (BDMPS/ASW), the Higher Twist approach (HT) and a scheme based on the approach of Arnold-Moore-Yaffe (AMY). In this comparison, an identical medium evolution will be utilized for all three approaches: not only does this entail the use of the same realistic three-dimensional relativistic fluid dynamics (RFD) simulation, but also includes the use of identical initial parton-distribution functions and final fragmentation functions. We are, thus, in a unique position, not only to isolate fundamental differences between the various approaches, but also to make rigorous calculations for different experimental measurements using "state of the art" components. All three approaches are reduced to a version which contains only one free tunable parameter, this is then related to the well known transport parameter $\\hat{q}$. We...

  6. Academic Training: 2003 - 2004 Academic Training Programme

    CERN Multimedia

    2004-01-01

    ACADEMIC TRAINING Françoise Benz tel. 73127 academic.training@cern.ch 3rd Term - 5 April to 2nd July 2004 REGULAR LECTURE PROGRAMME 19, 20, 21, 22, 23 April Complex Systems, Chaos and Measurements by P. Collet / Ecole Polytechnique, Palaiseau, France 26, 27, 28, 29 April The Theory of Heavy Ion Collisions by U. Wiedemann / CERN-PH/TH 10, 11, 12, 13, 14 May Particle Identification at the LHC by D. Fournier / LAL, Orsay, France 1, 2, 3, 4 June Neural Systems, Genetic Algorithms by V. Robles Forcada and M. Perez Hernandez / Univ. Politecnica de Madrid E. 7, 8, 9, June Real Time Process Control by T. Riesco / CERN-TS 14, 15, 16, 17, 18 June The Cosmic Microwave Background by M. Zaldarriaga / Harvard University, USA 21, 22, 23, June Fixed Target Physics at CERN : Results and Prospects by J. Engelen / CERN-DG 28, 29, 30 June, 1, 2, July Search for Dark Matter by B. Sadoulet / Univ. of California, Berkeley, USA The lectures are open to all those interested, without application. The abstrac...

  7. Pericentric inversion of chromosome 11 (p14.3q21) associated with developmental delays, hypopigmented skin lesions and abnormal brain MRI findings - a new case report

    Energy Technology Data Exchange (ETDEWEB)

    Zachor, D.A.; Lofton, M. [Univ. of Alabama, Birmingham (United States)

    1994-09-01

    We report 3 year old male, referred for evaluation of developmental delays. Pregnancy was complicated by oligohydramnios, proteinuria and prematurity. Medical history revealed: bilateral inguinal hernia, small scrotal sac, undescended testes, developmental delays and behavioral problems. The child had: microcephaly, facial dysmorphic features, single palmar creases, hypopigmented skin lesions of variable size, intermittent exotropia and small retracted testes. Neurological examination was normal. Cognitive level was at the average range with mild delay in his adaptive behavior. Expressive language delays and severe articulation disorder were noted, as well as clumsiness, poor control and precision of gross and fine motor skills. Chromosomal analysis of peripheral leukocytes indicated that one of the number 11 chromosomes had undergone a pericentric inversion with breakpoints on the short (p) arm at band p14.3 and the long (q) arm at band q21. An MRI of the brain showed mild delay in myelinization pattern of white matter. Chromosome 11 inversion in other sites was associated with Beckwith-Wiedemann syndrome and several malignancies. To our knowledge this is the first description of inv(11)(p14.3q21) that is associated with microcephaly, dysmorphic features, hypopigmented skin lesions and speech delay. This inversion may disrupt the expression of the involved genes. However, additional cases with the same cytogenetic anomaly are needed to explore the phenotypic significance of this disorder.

  8. Neonatal progeroid variant of Marfan syndrome with congenital lipodystrophy results from mutations at the 3' end of FBN1 gene.

    Science.gov (United States)

    Jacquinet, Adeline; Verloes, Alain; Callewaert, Bert; Coremans, Christine; Coucke, Paul; de Paepe, Anne; Kornak, Uwe; Lebrun, Frederic; Lombet, Jacques; Piérard, Gérald E; Robinson, Peter N; Symoens, Sofie; Van Maldergem, Lionel; Debray, François-Guillaume

    2014-04-01

    We report a 16-year-old girl with neonatal progeroid features and congenital lipodystrophy who was considered at birth as a possible variant of Wiedemann-Rautenstrauch syndrome. The emergence of additional clinical signs (marfanoid habitus, severe myopia and dilatation of the aortic bulb) lead to consider the diagnosis of the progeroid variant of Marfan syndrome. A de novo donor splice-site mutation (c.8226+1G>A) was identified in FBN1. We show that this mutation leads to exon 64 skipping and to the production of a stable mRNA that should allow synthesis of a truncated profibrillin-1, in which the C-terminal furin cleavage site is altered. FBN1 mutations associated with a similar phenotype have only been reported in four other patients. We confirm the correlation between marfanoid phenotype with congenital lipodystrophy and neonatal progeroid features (marfanoid-progeroid-lipodystrophy syndrome) and frameshift mutations at the 3' end of FBN1. This syndrome should be considered in differential diagnosis of neonatal progeroid syndromes.

  9. The FAO/IAEA interactive spreadsheet for design and operation of insect mass rearing facilities

    Energy Technology Data Exchange (ETDEWEB)

    Caceres, Carlos, E-mail: carlos.e.caceres@aphis.usda.co [International Atomic Energy Agency (IAEA), Seibersdorf (Austria). Agency' s Labs. Programme of Nuclear Techniques in Food and Agriculture; Rendon, Pedro [U.S. Department of Agriculture (USDA/APHIS/CPHST), Guatemala City (Guatemala). Animal and Plant Health Inspection. Center for Plant Health Science and Technology

    2006-07-01

    An electronic spreadsheet is described which helps users to design, equip and operate facilities for the mass rearing of insects for use in insect pest control programmes integrating the sterile insect technique. The spreadsheet was designed based on experience accumulated in the mass rearing of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), using genetic sexing strains based on a temperature sensitive lethal (tsl) mutation. The spreadsheet takes into account the biological, production, and quality control parameters of the species to be mass reared, as well as the diets and equipment required. All this information is incorporated into the spreadsheet for user-friendly calculation of the main components involved in facility design and operation. Outputs of the spreadsheet include size of the different rearing areas, rearing equipment, volumes of diet ingredients, other consumables, as well as personnel requirements. By adding cost factors to these components, the spreadsheet can estimate the costs of facility construction, equipment, and operation. All the output parameters can be easily generated by simply entering the target number of sterile insects required per week. For other insect species, the biological and production characteristics need to be defined and inputted accordingly to obtain outputs relevant to these species. This spreadsheet, available under http://www-naweb.iaea.org/nafa/ipc/index.html, is a powerful tool for project and facility managers as it can be used to estimate facility cost, production cost, and production projections under different rearing efficiency scenarios. (author)

  10. Vector competence of Mexican and Honduran mosquitoes (Diptera: Culicidae) for enzootic (IE) and epizootic (IC) strains of Venezuelan equine encephalomyelitis virus.

    Science.gov (United States)

    Turell, Michael J; O'Guinn, Monica L; Navarro, Roberto; Romero, Guadeloupe; Estrada-Franco, José G

    2003-05-01

    Experimental studies evaluated the vector competence of Ochlerotatus taeniorhynchus (Wiedemann), Culex cancer Theobald, Culex pseudes (Dyar and Knab), Culex taeniopus Dyar and Knab, and a Culex (Culex) species, probably Culex quinquefasciatus Say, and Culex nigripalpus Theobald from Chiapas, Mexico, and Tocoa, Honduras, for epizootic (IC) and enzootic (IE) strains of Venezuelan equine encephalomyelitis (VEE) virus. Culex pseudes was highly susceptible to infection with both the IC and IE strains of VEE (infection rates >78%). Patterns of susceptibility to VEE were similar for Oc. taeniorhynchus collected in Mexico and Honduras. Although Oc. taeniorhynchus was highly susceptible to the epizootic IC strains (infection rates > or = 95%, n = 190), this species was less susceptible to the enzootic IE strain (infection rates < or = 35%, n = 233). The Culex (Culex) species were refractory to both subtypes of VEE, and none of 166 contained evidence of a disseminated infection. Virus-exposed Cx. pseudes that refed on susceptible hamsters readily transmitted virus, confirming that this species was an efficient vector of VEE. Although Oc. taeniorhynchus that fed on hamsters infected with the epizootic IC strain transmitted VEE efficiently, only one of six of those with a disseminated infection with the enzootic IE virus that fed on hamsters transmitted virus by bite. These data indicate that Cx. pseudes is an efficient laboratory vector of both epizootic and enzootic strains of VEE and that Oc. taeniorhynchus could be an important vector of epizootic subtypes of VEE.

  11. Vector competence of North American mosquitoes (Diptera: Culicidae) for West Nile virus.

    Science.gov (United States)

    Turell, M J; O'Guinn, M L; Dohm, D J; Jones, J W

    2001-03-01

    We evaluated the potential for several North American mosquito species to transmit the newly introduced West Nile (WN) virus. Mosquitoes collected in the New York City metropolitan area during the recent WN virus outbreak, at the Assateague Island Wildlife Refuge, VA, or from established colonies were allowed to feed on chickens infected with WN virus isolated from a crow that died during the 1999 outbreak. These mosquitoes were tested approximately 2 wk later to determine infection, dissemination, and transmission rates. Aedes albopictus (Skuse), Aedes atropalpus (Coquillett), and Aedes japonicus (Theobald) were highly susceptible to infection, and nearly all individuals with a disseminated infection transmitted virus by bite. Culex pipiens L. and Aedes sollicitans (Walker) were moderately susceptible. In contrast, Aedes vexans (Meigen), Aedes aegypti (L.), and Aedes taeniorhynchus (Wiedemann) were relatively refractory to infection, but individual mosquitoes inoculated with WN virus did transmit virus by bite. Infected female Cx. pipiens transmitted WN virus to one of 1,618 F1 progeny, indicating the potential for vertical transmission of this virus. In addition to laboratory vector competence, host-feeding preferences, relative abundance, and season of activity also determine the role that these species could play in transmitting WN virus.

  12. Biallelic expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in adult cattle

    Indian Academy of Sciences (India)

    Mengnan Wang; Dongjie Li; Mingyue Zhang; Wenzhi Yang; Guojiang Wu; Yali Cui; Shijie Li

    2015-09-01

    Genomic imprinting of the Cdkn1c/Kcnq1ot1 region shows lack of conservation between human and mouse. This region has been reported to be associated with Beckwith–Wiedemann syndrome (BWS) and cancer. To increase our understanding of imprinted genes in bovine Cdkn1c/Kcnq1ot1 imprinting cluster, we assessed the imprinting status of four cattle genes (Tssc4, Nap1l4, Phlda2 and Osbpl5) in seven types of tissues: heart, liver, spleen, lung, kidney, skeletal muscle and subcutaneous fat using polymorphism-based sequencing approach. It was found that all the four genes showed biallelic expression in tissues in which transcripts were detected. Nap1l4 and Tssc4 were detected in all examined tissues, while the expression of Phlda2 and Osbpl5 was tissue-specific. Phlda2 was not detected in heart and subcutaneous fat, and Osbpl5 was not detected in spleen and skeletal muscle. In addition, identification of species-specific imprinted genes is necessary to understand the evolution of genomic imprinting and to elucidate mechanisms leading to allele-specific expression.

  13. Cold Tolerance of the Mediterranean Fruit Fly in Date and Mandarin.

    Science.gov (United States)

    Gazit, Yoav; Akiva, Ruti; Gavriel, Sagi

    2014-10-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is an endemic pest in Israel and there can be low levels of infestation of dates (Phoenix dactylifera L.). Because C. capitata is considered a quarantine pest by several major importing countries, the export of fresh dates requires the elimination of this pest. For mandarin, cold storage at 1.11°C for 15 d is considered to be an effective treatment for the elimination of C. capitata. In this study, we compared the cold tolerance of C. capitata in "Barhi" dates to that of C. capitata in mandarins (Citrus unshiu Marcovitch, "Satsuma"). In Barhi dates, we found the third instars to be the most cold-tolerant as compared with other life stages. Ceratitis capitata in date fruits were significantly less cold-tolerant than C. capitata in Satsuma mandarins. The last viable larvae in dates and mandarins were found after 8 and 13 d of treatment, respectively, and the calculated mortality curves in the two crops were significantly different. These results demonstrate that C. capitata is more sensitive to cold treatment when in date fruits than in mandarins. Therefore, the quarantine cold treatments used to eliminate C. capitata from mandarins should be sufficiently effective if applied to fresh date fruits.

  14. On the parasitoid complex of butterflies with descriptions of two new species of parasitic wasps (Hymenoptera: Eulophidae) from Goa, India.

    Science.gov (United States)

    Gupta, Ankita; Gawas, Sandesh M; Bhambure, Ravindra

    2015-11-01

    In comprehensive rearing of butterflies from Goa, India, an interesting parasitoid complex of wasps and tachinid flies was found. Two new species of parasitic wasps are described and illustrated: Tetrastichus thetisae n. sp. (Hymenoptera: Eulophidae), a gregarious parasitoid reared from the pupa of Curetis thetis (Drury) (Lepidoptera: Lycaenidae) on the host plant Derris sp., and Sympiesis thyrsisae n. sp. (Hymenoptera: Eulophidae), a gregarious parasitoid reared from the caterpillar of Gangara thyrsis (Fabricius) (Lepidoptera: Hesperiidae) on the host plant Cocos nucifera L. Additionally, the following host-parasitoid associations are recorded: Amblypodia anita Hewitson (Lepidoptera: Lycaenidae) with Parapanteles sp. (Hymenoptera: Braconidae); Coladenia indrani (Moore) (Lepidoptera: Hesperiidae) with Sympiesis sp. (Hymenoptera: Eulophidae); Danaus chrysippus L. (Lepidoptera: Nymphalidae) with Sturmia convergens (Wiedemann) (Diptera: Tachinidae); Idea malabarica Moore (Lepidoptera: Nymphalidae) with Brachymeria sp. (Hymenoptera: Chalcididae) and Palexorista sp. (Diptera: Tachinidae); Notocrypta curvifascia Felder & Felder (Lepidoptera: Hesperiidae) with Cotesia erionotae (Wilkinson) (Hymenoptera: Braconidae); and Rapala sp. (Lepidoptera: Lycaenidae) with an inominate species close to Aplomya spp. (Diptera: Tachinidae). This discovery is the first record of Tetrastichus as parasitoid of Curetis thetis, Sympiesis as parasitoid of Gangara thyrsis and Coladenia indrani, Brachymeria and Palexorista as parasitoids of Idea malabarica, and Cotesia erionotae as parasitoid of Notocrypta curvifascia. Data on habitat, brief diagnoses and host records for all parasitoids are provided.

  15. Thermal conductance of Nb thin films at sub-kelvin temperatures

    Science.gov (United States)

    Feshchenko, A. V.; Saira, O.-P.; Peltonen, J. T.; Pekola, J. P.

    2017-02-01

    We determine the thermal conductance of thin niobium (Nb) wires on a silica substrate in the temperature range of 0.1–0.6 K using electron thermometry based on normal metal-insulator-superconductor tunnel junctions. We find that at 0.6 K, the thermal conductance of Nb is two orders of magnitude lower than that of Al in the superconducting state, and two orders of magnitude below the Wiedemann-Franz conductance calculated with the normal state resistance of the wire. The measured thermal conductance exceeds the prediction of the Bardeen-Cooper-Schrieffer theory, and demonstrates a power law dependence on temperature as T4.5, instead of an exponential one. At the same time, we monitor the temperature profile of the substrate along the Nb wire to observe possible overheating of the phonon bath. We show that Nb can be successfully used for thermal insulation in a nanoscale circuit while simultaneously providing an electrical connection.

  16. The effect of temperature on the electrical properties of inkjet-printed silver nanoparticle ink during electrical sintering.

    Science.gov (United States)

    Moon, Seung-Jae

    2013-09-01

    In this work, the thermal behavior of ink-jet-printed nanoparticle ink during electrical sintering was demonstrated. The ink consisting of silver nanoparticles approximately 50 nm in size and 34 wt% was used. Constant currents of 0.11, 0.22, and 0.31 A were applied to Joule-heat the inkjet-printed silver nanoparticles. During the sintering process, in-situ voltage and current measurements were taken to calculate the heat source and thermal conductivity. In order to estimate the temperature during the electrical sintering process, numerical modeling of the two-dimensional heat conduction equation was adopted. Thermal conductivity was obtained from the in-situ electrical conductivity measurement and coupled to the numerical model using the Wiedemann Franz law. From these numerical modeling results, the relationship between the specific resistance of the ink and the temperature was determined. During the electrical sintering process, the specific resistance of the ink was strongly related to the sintering temperature. The specific resistance of the ink decreases as the process temperature rises.

  17. Effects of temperature dependence of electrical and thermal conductivities on the Joule heating of a one dimensional conductor

    Science.gov (United States)

    Antoulinakis, F.; Chernin, D.; Zhang, Peng; Lau, Y. Y.

    2016-10-01

    We examine the effects of temperature dependence of the electrical and thermal conductivities on Joule heating of a one-dimensional conductor by solving the coupled non-linear steady state electrical and thermal conduction equations. The spatial temperature distribution and the maximum temperature and its location within the conductor are evaluated for four cases: (i) constant electrical conductivity and linear temperature dependence of thermal conductivity, (ii) linear temperature dependence of both electrical and thermal conductivities, (iii) the Wiedemann-Franz relation for metals, and (iv) polynomial fits to measured data for carbon nanotube fibers and for copper. For (i) and (ii), it is found that there are conditions under which no steady state solution exists, which may indicate the possibility of thermal runaway. For (i), analytical solutions are constructed, from which explicit expressions for the parameter bounds for the existence of steady state solutions are obtained. The shifting of these bounds due to the introduction of linear temperature dependence of electrical conductivity (case (ii)) is studied numerically. These results may provide guidance in the design of circuits and devices in which the effects of coupled thermal and electrical conduction are important.

  18. Do fly parasites of bats and their hosts coevolve?speciation in Trichobius phyllostomae group (Diptera, Streblidae and their hosts (Chiroptera, Phyllostomidae suggests that they do not

    Directory of Open Access Journals (Sweden)

    Gustavo Graciolli

    2012-12-01

    Full Text Available We examined whether, like many parasite-host systems of coevolution, a group of obligate parasitic bat flies (Trichobius phyllostomae Kessel and related species cospeciate with their hosts. We first did a cladistic analysis of the T. phyllostomae group and combined that analysis with a phylogenetic hypothesis from the literature for the Stenodermatinae bats. The cladistic analysis included, as outgroups, one species from each morphological group and complex of Trichobius Gervais, and one species from the following genera: Paratrichobius Miranda-Ribeiro, Megistopoda Macquart, Megistapophysys Dick & Wenzel, Neotrichobius Wenzel & Aitken, Speiseria Kessel and Strebla Wiedemann. The cladogram was rooted with a species of Strebla in the subfamily Streblinae. One cladogram was obtained and which found Trichobius to be polyphyletic. The phylogenetic hypothesis as follows: (Paratrichobius, (Neotrichobius, (Megistopoda, Megistapophysis is the sister-group of the phyllostomae group and the following relationships within the ingroup, (((T. vampyropis Wenzel, Trichobius sp. 2 ((T. hispidus Wenzel, T. petersoni Wenzel ((Trichobius sp. 1 (T. phyllostomae, T. brennani Wenzel. When we compared phylogenies through historical association analyses, cospeciation was uncommon, while host-switching was more common and better explained the association between the phyllostomae group and their bat hosts.

  19. Insecticidal effects of various concentrations of selected extractions of Cestrum parqui on adult and immature Ceratitis capitata.

    Science.gov (United States)

    Zapata, Nelson; Budia, Flor; Viñuela, Elisa; Medina, Pilar

    2006-04-01

    Aqueous extracts of Cestrum parqui L'Héritier (Solanaceae) were evaluated at different concentrations in several stages of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). For adults, the study was extended to extracts obtained with several solvents of an increasing degree of polarity. Aqueous extracts from C. parqui showed a high toxicity to neonate larvae when ingested through diet, inhibiting pupation at a concentration above 0.6%. Lower concentrations delayed the larval development and reduced the percentages of pupae formed and adult emergence. An LC50 = 0.9% after 3 d of continuous ingestion of C. parqui aqueous extracts could be calculated, whereas extracts obtained with organic compounds were nearly innocuous except with the use of the solvent methanol/water (80:20), the more polar of those tested, that killed 12.5% of adults. Aqueous extracts were also harmful to adults by diminishing the reproductive potential, which implies a significant effect on the offspring. Egg contact with insecticide or dipping third instars did not cause any adverse effect, supporting the hypothesis that only by means of ingestion can the toxic compounds of C. parqui reach the target. Our results showed that C. parqui components causing C. capitata mortality are mostly dissolved in water and not in organic solvents, which point out their polar character.

  20. Mosaic segmental uniparental isodisomy and progressive clonal selection: a common mechanism of late onset β-thalassemia major

    Science.gov (United States)

    Harteveld, Cornelis L.; Refaldi, Chiara; Giambona, Antonino; Ruivenkamp, Claudia A. L.; Hoffer, Mariëtte J. V.; Pijpe, Jeroen; De Knijff, Peter; Borgna-Pignatti, Caterina; Maggio, Aurelio; Cappellini, Maria D.; Giordano, Piero C.

    2013-01-01

    Genomic DNA of 3 patients, born as healthy carriers and developing a late-onset severe transfusion-dependent beta-thalassemia major was studied by high-density genome wide SNP array analysis. A mosaic loss of heterozygosity for almost the entire 11p was found, not attributable to deletions but involving mosaicism for segmental paternal isodisomy of 11p. Mitotic recombination leading to mosaic segmental uniparental isodisomy on chromosome 11p in multiple tissues has been described as a molecular disease mechanism for a subset of sporadic Beckwith-Wiedemann syndrome cases. A similar mechanism also seems to be involved in causing late-onset disease in carriers of recessive mutations in other genes located in 11p, such as late-onset beta-thalassemia major and sickle cell disease. We suggest that the loss of maternally imprinted IGF-2 and H19 genes may account for the selective advantage of hematopoietic cells containing this segmental paternal isodisomy of 11p carrying the β-thalassemia mutation. PMID:22983591

  1. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. MANSO

    2006-01-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw, la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw(- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw(- como en las sw(+, los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.

  2. Decomposition and dipteran succession in pig carrion in central Argentina: ecological aspects and their importance in forensic science.

    Science.gov (United States)

    Horenstein, M Battán; Linhares, A Xavier; De Ferradas, B Rosso; García, D

    2010-03-01

    Data on the insect species associated with corpse decomposition are particularly important for estimation of the post-mortem interval (PMI) in forensic science because the PMI is based on the lifecycle and behaviour of necrophagous insects, among other measures. To determine the dipteran succession on pig carrion, four experiments, one in each season, were carried out during 2004 in a rural area of Córdoba, central Argentina. Two pigs (Sus scrofa L.) were used in each of the four experiments. At each time-point one pig was placed in the shade and the other under direct sunlight. Insects were collected daily during the first 4 weeks and thereafter every 2 or 3 days. Five stages of decomposition were observed and a total of 24 710 adult specimens were collected, belonging to the following eight families of Diptera: Calliphoridae; Muscidae; Sarcophagidae; Phoridae; Piophilidae; Fanniidae; Sphaeroceridae, and Anthomyiidae. All Calliphoridae collected in this study were considered to be of potential forensic importance because of their necrophagous behaviour and because their immature stages use carrion as a food source. Other species, such as Musca domestica L. and Ophyra aenescens (Wiedemann), were also considered to represent potential forensic indicators.

  3. A Monte Carlo study of jet fragmentation functions in PbPb and pp collisions at sqrt{s}=2.76 TeV

    CERN Document Server

    Pérez-Ramos, Redamy

    2014-01-01

    The parton-to-hadron fragmentation functions (FFs) obtained from the YaJEM and PYTHIA6 Monte Carlo event generators, are studied for jets produced in a strongly-interacting medium and in the QCD "vacuum" respectively. The medium modifications are studied with the YaJEM code in two different scenarios by (i) accounting for the medium induced virtuality DeltaQ^2 transferred to the leading parton from the medium, and (ii) by altering the infrared sector in the Borghini-Wiedemann approach. The results of our simulations are compared to experimental jet data measured by the CMS experiment in PbPb and pp collisions at a center-of-mass energy of 2.76 TeV. Though both scenarios qualitatively describe the shape and main physical features of the FFs, the ratios are in much better agreement with the first scenario. Results are presented for the Monte Carlo FFs obtained for different parton flavours (quark and gluon) and accounting exactly, or not, for the experimental jet reconstruction biases.

  4. Potential for mosquitoes (Diptera: Culicidae) from Florida to transmit Rift Valley fever virus.

    Science.gov (United States)

    Turell, Michael J; Britch, Seth C; Aldridge, Robert L; Kline, Daniel L; Boohene, Carl; Linthicum, Kenneth J

    2013-09-01

    We evaluated Aedes atlanticus Dyar and Knab, Aedes infirmatus Dyar and Knab, Aedes vexans (Meigen), Anopheles crucians Wiedemann, Coquillettidia perturbans (Walker), Culex nigripalpus Theobald, Mansonia dyari Belkin, Heinemann, and Page, and Psorophora ferox (Von Humboldt) from Florida to determine which of these species should be targeted for control should Rift Valley fever virus (RVFV) be detected in North America. Female mosquitoes that had fed on adult hamsters inoculated with RVFV were incubated for 7-21 d at 26 degrees C, then allowed to refeed on susceptible hamsters, and tested to determine infection, dissemination, and transmission rates. We also inoculated mosquitoes intrathoracically, held them for 7 d, and then allowed them to feed on a susceptible hamster to check for a salivary gland barrier. When exposed to hamsters with viremias > or = 10(7.6) plaque-forming units per milliliter of blood, at least some individuals in each of the species tested became infected; however, Cx. nigripalpus, An. crucians, and Ae. infirmatus were essentially incompetent vectors in the laboratory because of either a midgut escape or salivary gland barrier. Each of the other species should be considered as potential vectors and would need to be controlled if RVFV were introduced into an area where they were found. Additional studies need to be conducted with other geographic populations of these species and to determine how environmental factors affect transmission.

  5. Half-filled Landau level, topological insulator surfaces, and three-dimensional quantum spin liquids

    Science.gov (United States)

    Wang, Chong; Senthil, T.

    2016-02-01

    We synthesize and partly review recent developments relating the physics of the half-filled Landau level in two dimensions to correlated surface states of topological insulators in three dimensions. The latter are in turn related to the physics of certain three-dimensional quantum spin liquid states. The resulting insights provide an interesting answer to the old question of how particle-hole symmetry is realized in composite fermion liquids. Specifically the metallic state at filling ν =1/2 —described originally in pioneering work by Halperin, Lee, and Read as a liquid of composite fermions—was proposed recently by Son to be described by a particle-hole symmetric effective field theory distinct from that in the prior literature. We show how the relation to topological insulator surface states leads to a physical understanding of the correctness of this proposal. We develop a simple picture of the particle-hole symmetric composite fermion through a modification of older pictures as electrically neutral "dipolar" particles. We revisit the phenomenology of composite fermi liquids (with or without particle-hole symmetry), and show that their heat/electrical transport dramatically violates the conventional Wiedemann-Franz law but satisfies a modified one. We also discuss the implications of these insights for finding physical realizations of correlated topological insulator surfaces.

  6. Thin semi-rigid coaxial cables for cryogenics applications

    Science.gov (United States)

    Kushino, Akihiro; Kasai, Soichi

    2013-03-01

    We have developed cryogenic coaxial cables for low temperature signal readout from sensitive devices, such as transition edge sensors, superconducting tunnel junctions, and kinetic inductance detectors. In order to reduce heat penetration into cryogenic stages, low thermal conductivity metals were chosen for both center and outer electrical conductors. Various types of coaxial cables, employing stainless-steel, cupro-nickel, brass, beryllium-copper, phosphor-bronze, niobium, and niobium-titanium, were manufactured using drawing dies. Thermal and electrical properties were investigated between 1 and 8 K. Coaxial cables made of copper alloys showed thermal conductance roughly consistent with literature, meanwhile Nb coaxial cable must be affected by the drawing process and thermal conductance was lowered. Attenuation of superconducting Nb and NbTi coaxial cables were observed to be adequately small up to above 10 GHz compared to those of normal conducting coaxial cables, which are subject to the Wiedemann-Franz law. We also measured normal conducting coaxial cables with silver-plated center conductors to improve high frequency performance.

  7. PRESENCE OF THE MEDITERRANEAN FRUIT FLY(Ceratitis capitata Wied. IN SELECTED OLIVE ORCHARDS OF CENTRAL DALMATIA

    Directory of Open Access Journals (Sweden)

    M. Bjeliš

    2007-12-01

    Full Text Available Mediterranean fruit fly (Ceratitis capitata Wiedemann is a regular pest of large number of cultivated and wild host plants in Dalmatia. However, this pest does not develop either inside fruits of cultivated olive - Olea europaea sativa or wild olive „ mastrinka“ - Olea europaea oleaster. The main objective of this research was to prove regular presence, time of appearance and flight duration of the Mediterranean fruit fly inside selected orchards of central Dalmatia. During the four years of research, from 2001 to 2004 by using of traps and parapheromone trimedlure, the regular presence of the Mediterranean fruit fly was proved inside four selected orchards on the area of cities of Split and Kaštela, with differences in adult caught between localities and years. During the 2001 year, on the three locations in the area of city of Kaštela, the highest capture during the total research period was recorded, while on the locations in Split, the highest capture was recorded during 2003 year, but also significant during 2001 year. The lowest number of adult, less than 5 flies/trap was captured on all four locations during 2002 year.

  8. Population Fluctuation of Ceratitis capitata (Diptera: Tephritidae) as a Function of Altitude in Eastern Guatemala.

    Science.gov (United States)

    Flores, S; Montoya, P; Ruiz-Montoya, L; Villaseñor, A; Valle, A; Enkerlin, W; Liedo, P

    2016-08-01

    Population fluctuations of Ceratitis capitata (Wiedemann) were evaluated over a period of 12 mo in four altitudinal strata (400-750, 750-1,100, 1,100-1,450, and 1,450-1,800 meters above sea level, masl) in Eastern Guatemala. Within each altitudinal range, sampling plots were established in coffee plantations and adjacent areas, in which Jackson traps were set and baited with Trimedlure. Coffee berries and other host fruits were collected. Population density was lowest at the 400-750 masl stratum and highest at 1,450-1,800 masl. At every altitudinal range, the fluctuations of the pest were associated mainly with the availability of ripe coffee berries as a primary host. From 750-1,450 masl, the pest was also associated with the availability of sweet orange and mandarins in commercial and backyard orchards. The highest densities of the pest were recorded in the dry season. Citrus were the main alternate host where ripe coffee berries were not available. This knowledge on population dynamics of C. capitata will contribute to develop more effective area-wide pest management strategies including the use of sterile insects, natural enemies, and bait sprays.

  9. Pupal development of Ceratitis capitata (Diptera: Tephritidae) and Diachasmimorpha longicaudata (Hymenoptera: Braconidae) at different moisture values in four soil types.

    Science.gov (United States)

    Bento, F de M M; Marques, R N; Costa, M L Z; Walder, J M M; Silva, A P; Parra, J R P

    2010-08-01

    This study aimed to evaluate adult emergence and duration of the pupal stage of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and emergence of the fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead), under different moisture conditions in four soil types, using soil water matric potential. Pupal stage duration in C. capitata was influenced differently for males and females. In females, only soil type affected pupal stage duration, which was longer in a clay soil. In males, pupal stage duration was individually influenced by moisture and soil type, with a reduction in pupal stage duration in a heavy clay soil and in a sandy clay, with longer duration in the clay soil. As matric potential decreased, duration of the pupal stage of C. capitata males increased, regardless of soil type. C. capitata emergence was affected by moisture, regardless of soil type, and was higher in drier soils. The emergence of D. longicaudata adults was individually influenced by soil type and moisture factors, and the number of emerged D. longicaudata adults was three times higher in sandy loam and lower in a heavy clay soil. Always, the number of emerged adults was higher at higher moisture conditions. C. capitata and D. longicaudata pupal development was affected by moisture and soil type, which may facilitate pest sampling and allow release areas for the parasitoid to be defined under field conditions.

  10. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  11. Potential geographical distributions of the fruit flies Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa in China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Zhang, Runjie

    2009-10-01

    There have been relatively few attempts to model the distributions of the fruit flies Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch in China, but the geographic distributions of these species are of considerable concern in terms of biosecurity. In this study, two different modeling methods (genetic algorithm for rule-set prediction [GARP] and maximum entropy species distribution modeling [Maxent]) were used to predict the potential distributions of these three fly species in China, by using distribution records and a set of environmental predictor variables. The results showed that Maxent performed well, compared with modeling by GARP, at each test threshold. For all three species, the results predicted by Maxent agreed with the observed distributions in Africa and in other parts of the world. In China, C. capitata seems to have the highest number of favorable habitat areas, relative to C. cosyra and C. rosa, i.e., Yunnan, Guizhou, Guangxi, Guangdong, Hainan, Fujian, Sichuan and Chongqing, whereas C. cosyra has the smallest range of suitable areas, i.e., Yunnan, some parts of Hainan and Sichuan. The suitable areas for C. rosa are mainly restricted to Yunnan, Hainan, southern Guangdong, and a few areas of Sichuan. The indications are that on the whole, Southwest and South China are the areas with the highest risk for establishment from these three fly species. Jackknife tests reveal that environmental variables associated with temperature have the strongest influence on the potential distributions of all three species relative to other variables.

  12. Field Estimates of Attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to Methyl Eugenol in Varying Environments.

    Science.gov (United States)

    Manoukis, Nicholas C; Siderhurst, Matthew; Jang, Eric B

    2015-06-01

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation, and control of invasive pests. Here, we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel) to estimate the relationship between distance from a trap baited with trimedlure and methyl eugenol, respectively, and probability of capture for a receptive male insect. Experiments were conducted using a grid of traps with a central release point at two sites on Hawaii Island, a Macadamia orchard on the East side of the island and a lava field on the West side. We found that for B. dorsalis and methyl eugenol there is a 65% probability of capture at ∼36 m from a single trap, regardless of habitat. For C. capitata, we found a 65% probability of capture at a distance of ∼14 m from a single trap in the orchard and 7 m in the lava field. We also present results on the spatial and temporal pattern of recaptures. The attraction data are analyzed via a hyperbolic secant-based capture probability model.

  13. Eggs of Ephestia kuehniella and Ceratitis capitata, and motile stages of the astigmatid mites Tyrophagus putrescentiae and Carpoglyphus lactis as factitious foods for Orius spp.

    Science.gov (United States)

    Bonte, Jochem; de Walle, Anaïs Van; Conlong, Des; De Clercq, Patrick

    2015-11-17

    Several factitious foods were assessed for rearing the anthocorid predators Orius thripoborus (Hesse) and Orius naivashae (Poppius) (Hemiptera: Anthocoridae) in the laboratory. Developmental and reproductive traits of both Orius species were examined when offered frozen eggs of the Mediterranean flour moth, Ephestia kuehniella Zeller, frozen processed eggs of the medfly, Ceratitis capitata Wiedemann, or mixed motile stages of the astigmatid mites Tyrophagus putrescentiae (Schrank) or Carpoglyphus lactis (L). Whereas C. lactis and T. putresecentiae proved to be an inferior food for rearing O. thripoborus and O. naivashae, eggs of C. capitata eggs fully supported development and reproduction of both predators. Results on medfly eggs were similar or slightly inferior to those on E. kuehniella eggs, which is the standard food for culturing these anthocorid bugs. O. thripoborus could be maintained for four consecutive generations on C. capitata eggs indicating that processed medfly eggs can be a suitable and cheaper alternative to E. kuehniella eggs for prolonged rearing of these Orius spp. This article is protected by copyright. All rights reserved.

  14. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  15. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata.

    Science.gov (United States)

    de Souza, João Maria Gomes Alencar; de Lima-Filho, Paulo Augusto; Molina, Wagner Franco; de Almeida, Lúcia Maria; de Gouveia, Milson Bezerra; de Macêdo, Francisco Pepino; Laumann, Raul Alberto; Paranhos, Beatriz Aguiar Jordão

    2015-01-01

    The sterile insect technique (SIT) is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann): (1) wild males, (2) irradiated with Co-60 (steriles), and (3) irradiated (steriles) and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild), based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings' shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  16. The Mediterranean fruit fly (Ceratitis capitata in Iran: genetic diversity and comparison with other countries

    Directory of Open Access Journals (Sweden)

    M. Rajabiyan

    2015-04-01

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (Wiedemann is an economically important pest on fruits all over the world. The origin of this fly is thought to be from Africa, but it has recently expanded its distribution in many geographic regions including Iran. Due to the wide spread of this pest in Iran and its serious damage to fruit on trees, including citrus orchards of northern Iran, the present study was conducted firstly to investigate genetic diversity within populations of C. capitata based on the sequences of three mitochondrial DNA (mtDNA genes including cytochrome C oxidase I (COI, NAHD dehydrogenase subunits 4 and 5 (ND4 and ND5 and secondly to compare the Iranian haplotypes with those found in other countries. Results of this study indicated low levels of genetic diversity (four, four and three haplotypes among different populations of this pest, respectively for the COI, ND4 and ND5 genes in northern Iranian populations. The genetic similarity and very low levels of genetic diversity of northern Iranian populations suggest that the pest colonisation occurred relatively recently. In addition, haplotypes of Mazandaran province are similar to haplotypes of those countries that have recently been infected by this pest.

  17. Host status of avocado ('Hass') to Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    de Graaf, J

    2009-08-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) (Diptera: Tephritidae) are pests potentially associated with avocado (Persea americana Mill.) in South Africa. The aim of the study was to determine the host status of 'Hass' avocado to these tephritid pests over 4 yr. Unpunctured harvested avocado was exposed to fruit flies in the laboratory under no-choice conditions for 24 h. In field studies, each species was exposed for 48 h under no-choice conditions to avocado attached to the tree. Fruit was harvested immediately, 4, 8 and 18 d after exposure. In all the experiments, the fruit was incubated at 25 degrees C for 49 d after harvest. Hass avocado fruit was sourced from pack-houses throughout the avocado production areas and inspected for any internal pests. Similar inspections were done from 2005 to 2008 at arrival in Europe following standard export procedures. Analysis indicated that Hass avocado is a conditional nonhost for C. capitata and a poor but potential host for C. rosa and C. cosyra. No requirement for a risk mitigation treatment for C. capitata on South African Hass avocado was found. Fruit sampling data did not produce any infested fruit, suggesting that natural conditions and/or existing procedures functioning in a systems approach are likely to mitigate the quarantine risks of C. rosa and C. cosyra on Hass avocado in South Africa.

  18. The distribution, relative abundance, and seasonal phenology of Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    De Villiers, Marelize; Manrakhan, Aruna; Addison, Pia; Hattingh, Vaughan

    2013-10-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) are fruit fly species (Diptera: Tephritidae) of economic importance in South Africa. These pests cause direct damage to a number of commercially produced fruit and are of phytosanitary concern. A study was conducted to determine the distribution, relative abundance, and seasonal occurrence of the three species in different climatic regions of South Africa. The relative abundance and seasonal phenology of C. capitata and C. rosa were also compared between production areas and home gardens in Stellenbosch, Western Cape. Yellow bucket traps baited with Biolure were used to trap the flies over a 2-yr period in the different sampling areas. Different fruit types were sampled in Stellenbosch to determine fruit fly infestation. C. capitata was found to have a widespread distribution in South Africa, whereas C. rosa were absent from or only present in low numbers in the drier regions. C. cosyra was restricted to the North East and East coast, following a similar pattern to the distribution of marula, Sclerocarrya birrea, an important wild host. Fruit in home gardens provided a breeding ground for C. capitata and C. rosa and a source for infestation of orchards when fruit started to mature, highlighting the need for an area-wide strategy for the control of fruit flies.

  19. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. DÍAZ

    2008-01-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata , mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.

  20. 地中海实蝇幼虫分子鉴定%Molecular identification for larvae of Ceratitis capitata

    Institute of Scientific and Technical Information of China (English)

    叶军; 周国梁; 易建平; 吴家教; 阮长浩; 梁帆; 郑建中; 王文兵

    2007-01-01

    通过对从秘鲁进口的葡萄中截获实蝇类幼虫进行ITS区和线粒体CO Ⅰ,COⅡ,COⅢ、ND5基因序列的扩增和测序,并与GenBank中对应的序列进行比对,结果表明,截获样品ITS区序列和地中海实蝇Ceratitis capitata(Wiedemann)同源性为95.16%(其中ITS1为99.52%,ITS2为86.2%),线粒体COⅠ,COⅡ,COⅢ,ND5基因序列和地中海实蝇C.capitata同源性为100%,99.9%,99.5%,99.8%;基于CO Ⅰ序列构建的系统发育树中,幼虫样品和地中海实蝇最为接近.根据序列分析和系统发育关系分析的结果,将截获的实蝇类幼虫鉴定为地中海实蝇C.capitata.