Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang
2006-05-01
To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Ronde, Anthony de; Dooren, Maaike van; Hoek, Lian van der; Bouwhuis, Denise; Rooij, Esther de; Gemen, Bob van; Boer, R.J. de; Goudsmit, Jaap
2000-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT).
de Ronde, A.; van Dooren, M.; van der Hoek, L.; Bouwhuis, D.; de Rooij, E.; van Gemen, B.; de Boer, R.; Goudsmit, J.
2001-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT).
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Thymidine analogue-sparing highly active antiretroviral therapy (HAART).
Nolan, David; Mallal, Simon
2003-02-01
The use of alternative nucleoside reverse transcriptase inhibitors (NRTIs) to the thymidine analogues stavudine (d4T) and zidovudine(ZDV) has been advocated as a means of limiting long-term NRTI-associated toxicity, particularly the development of lipoatrophy or fat wasting. This approach reflects an increasing knowledge of the distinct toxicity profiles of NRTI drugs. However, recent clinical trials have demonstrated that the use of thymidine analogue NRTIs and newer alternative backbone NRTIs, such as tenofovir (TNF) and abacavir (ABC), is associated with comparable short-term efficacy and tolerability. Given the importance of toxicity profile differences in determining clinical management, it is important to recognise that d4T and ZDV cary significantly different risks for long-term NRTI toxicity. Recognising that all NRTIs, including thymidine analogues, have individual toxicity profiles provides a more appropriate basis for selecting optimal antiretroviral therapy. The safety and efficacy of TNF and ABC are also reviewed here, although the available data provide only limited knowledge of the long-term effects of these drugs in terms of toxicity and antiviral durability.
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Thermo-reversible supramolecular hydrogels of trehalose-type diblock methylcellulose analogues.
Yamagami, Mao; Kamitakahara, Hiroshi; Yoshinaga, Arata; Takano, Toshiyuki
2018-03-01
This paper describes the design and synthesis of new trehalose-type diblock methylcellulose analogues with nonionic, cationic, and anionic cellobiosyl segments, namely 1-(tri-O-methyl-cellulosyl)-4-[β-d-glucopyranosyl-(1→4)-β-d-glucopyranosyloxymethyl]-1H-1,2,3-triazole (1), 1-(tri-O-methyl-cellulosyl)-4-[(6-amino-6-deoxy-β-d-glucopyranosyl)-(1→4)- 6-amino-6-deoxy-β-d-glucopyranosyloxymethyl]-1H-1,2,3-triazole (2), and 4-(tri-O-methyl-cellulosyloxymethyl)-1-[β-d-glucopyranuronosyl-(1→4)-β-d-glucopyranuronosyl]-1H-1,2,3-triazole (3), respectively. Aqueous solutions of all of the 1,2,3-triazole-linked diblock methylcellulose analogues possessed higher surface activities than that of industrially produced methylcellulose and exhibited lower critical solution temperatures, that allowed the formation of thermoresponsive supramolecular hydrogels at close to human body temperature. Supramolecular structures of thermo-reversible hydrogels based on compounds 1, 2, and 3 were investigated by means of scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Detailed structure-property-function relationships of compounds 1, 2, and 3 were discussed. Not only nonionic hydrophilic segment but also ionic hydrophilic segments of diblock methylcellulose analogues were valid for the formation of thermo-reversible supramolecular hydrogels based on end-functionalized methylcellulose. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi
2018-05-11
Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Design and synthesis of biotin analogues reversibly binding with streptavidin.
Yamamoto, Tomohiro; Aoki, Kiyoshi; Sugiyama, Akira; Doi, Hirofumi; Kodama, Tatsuhiko; Shimizu, Yohei; Kanai, Motomu
2015-04-01
Two new biotin analogues, biotin carbonate 5 and biotin carbamate 6, have been synthesized. These molecules were designed to reversibly bind with streptavidin by replacing the hydrogen-bond donor NH group(s) of biotin's cyclic urea moiety with oxygen. Biotin carbonate 5 was synthesized from L-arabinose (7), which furnishes the desired stereochemistry at the 3,4-cis-dihydroxy groups, in 11% overall yield (over 10 steps). Synthesis of biotin carbamate 6 was accomplished from L-cysteine-derived chiral aldehyde 33 in 11% overall yield (over 7 steps). Surface plasmon resonance analysis of water-soluble biotin carbonate analogue 46 and biotin carbamate analogue 47 revealed that KD values of these compounds for binding to streptavidin were 6.7×10(-6) M and 1.7×10(-10) M, respectively. These values were remarkably greater than that of biotin (KD =10(-15) M), and thus indicate the importance of the nitrogen atoms for the strong binding between biotin and streptavidin. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
Directory of Open Access Journals (Sweden)
Gronenborn Angela M
2010-05-01
Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
DEFF Research Database (Denmark)
Aly, Youssef L.; Pedersen, Erik Bjerreg.; La Colla, Paolo
2007-01-01
Synthesis and antiviral activities are reported of a series of 6-(3-alkynyl benzyl)-substituted analogues of MKC-442 (6-benzyl-1-(ethoxymethyl)-5-isopropyluracil), a highly potent agent against HIV. The 3-alkynyl group is assumed to give a better stacking of the substituted benzyl group to reverse...... transcriptase (RT) and this was believed to improve antiviral activity against HIV-1. The bromo derivatives, 5-alkyl-6-(3-bromo-benzyl)-1-ethoxymethyl derivatives 7a, b and 5-alkyl-6-(3-bromobenzyl)-1-allyloxymethyl derivatives 9a, b, showed activity against HIV on the same level as their corresponding...
Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
Directory of Open Access Journals (Sweden)
Abhasnee Sobhonslidsuk
2017-01-01
Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Directory of Open Access Journals (Sweden)
Niu Meijuan
2004-10-01
Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
Directory of Open Access Journals (Sweden)
Warrilow David
2008-12-01
Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Deane, Karen J; Summers, Robert L; Lehane, Adele M; Martin, Rowena E; Barrow, Russell A
2014-05-08
The emergence and spread of malaria parasites that are resistant to chloroquine (CQ) has been a disaster for world health. The antihistamine chlorpheniramine (CP) partially resensitizes CQ-resistant (CQR) parasites to CQ but possesses little intrinsic antiplasmodial activity. Mutations in the parasite's CQ resistance transporter (PfCRT) confer resistance to CQ by enabling the protein to transport the drug away from its site of action, and it is thought that resistance-reversers such as CP exert their effect by blocking this CQ transport activity. Here, a series of new structural analogues and homologues of CP have been synthesized. We show that these compounds (along with other in vitro CQ resistance-reversers) inhibit the transport of CQ via a resistance-conferring form of PfCRT expressed in Xenopus laevis oocytes. Furthermore, the level of PfCRT-inhibition was found to correlate well with both the restoration of CQ accumulation and the level of CQ resensitization in CQR parasites.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael
2012-01-01
Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Turyadi Turyadi
2018-01-01
Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase. Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
de Ronde, A; van Dooren, M; van Der Hoek, L; Bouwhuis, D; de Rooij, E; van Gemen, B; de Boer, R; Goudsmit, J
2001-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT). Follow-up of the fate of these resistant HIV-1 strains in four newly infected individuals revealed that they were readily replaced by sensitive strains. The RT of the resistant viruses changed at amino acid 215 from tyrosine (Y) to aspartic acid (D) or serine (S), with asparagine (N) as a transient intermediate, indicating the establishment of new wild types. When we introduced these mutations and the original threonine (T)-containing wild type into infectious molecular clones and assessed their competitive advantage in vitro, the order of fitness was in accord with the in vivo observations: 215Y types with D, S, or N residues at position 215 may be warranted in order to estimate the threat to long-term efficacy of regimens including nucleoside analogues.
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin
2010-01-01
The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin
2008-01-01
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis
Gnanasekaran, Ramachandran
2017-11-08
We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.
Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis
2010-01-01
Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong
2018-01-01
As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Ceccherini-Silberstein, Francesca; Cozzi-Lepri, Alessandro; Ruiz, Lidia
2007-01-01
A negative association between the polymorphism F214L and type 1 thymidine analogue (TA) mutations (TAMs) has been observed. However, the virological response to TAs according to the detection of F214L has not been evaluated....
Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X
2014-07-01
Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
Docking mode of delvardine and its analogues into the p66 domain ...
Indian Academy of Sciences (India)
SEARCHU
Delvardine and its structural derivatives are important non-nucleoside HIV-1 reverse transcriptase inhibitors (NNRTIs). .... [PDB ID:1REV] was taken from the Protein Data Bank ... Water molecules were removed and H atoms were added.
Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita
2018-01-01
Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
DEFF Research Database (Denmark)
Silberstein, F; Cozzi-Lepri, A; Ruiz, L
2007-01-01
BACKGROUND: A negative association between the polymorphism F214L and type 1 thymidine analogue (TA) mutations (TAMs) has been observed. However, the virological response to TAs according to the detection of F214L has not been evaluated. METHODS: We studied 590 patients from EuroSIDA who started ...... were observed in patients with M41L/T215Y and mixed TAM profiles detected before the initiation of cART. CONCLUSIONS: This study provides evidence that the detection of polymorphism F214L is associated with a favorable virological response to TA-based cART.......BACKGROUND: A negative association between the polymorphism F214L and type 1 thymidine analogue (TA) mutations (TAMs) has been observed. However, the virological response to TAs according to the detection of F214L has not been evaluated. METHODS: We studied 590 patients from EuroSIDA who started TA...... therapy for the first time as part of potent combination antiretroviral therapy (cART) and who were tested for genotypic resistance within the past 6 months. End points were median reduction in the week 24 viral load and time to virological failure (2 consecutive VL measurements >400 copies/mL after...
International Nuclear Information System (INIS)
Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong
2005-01-01
The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Directory of Open Access Journals (Sweden)
Madeleine Zerbato
Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.
International Nuclear Information System (INIS)
Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong
2007-01-01
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation
Energy Technology Data Exchange (ETDEWEB)
Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn
2007-04-06
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.
Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis
2013-12-23
At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A
2017-01-01
(t)RTI group and 28·0% (37·6) in the raltegravir group (mean difference 10·2%, 95% CI 0·1-20·4; p=0·048). Mean absolute change was 1·04 kg (SD 2·29) in the N(t)RTI group and 1·81 kg (2·50) in the raltegravir group (mean difference 0·6, 95% CI -0·1 to 1·3; p=0·10). Our findings suggest that for people with virological failure of a first-line regimen containing efavirenz plus tenofovir and lamivudine or emtricitabine, the WHO-recommended switch to a ritonavir-boosted protease inhibitor plus zidovudine (a thymidine analogue nucleoside reverse transcriptase inhibitor) and lamivudine might come at the cost of peripheral lipoatrophy. Further study could help to define specific groups of people who might benefit from a switch to an N(t)RTI-sparing second-line ART regimen. The Kirby Institute and the Australian National Health and Medical Research Council. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Liu Tiantian
2010-05-01
Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Directory of Open Access Journals (Sweden)
Rami Kantor
2005-04-01
Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Sukrit Silas
2017-07-01
Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.
Directory of Open Access Journals (Sweden)
Stefanou Nikolaos
2010-08-01
Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)
2017-12-15
Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato
2012-06-06
Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic
Berman, Andrea J; Gooding, Anne R; Cech, Thomas R
2010-10-01
The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
International Nuclear Information System (INIS)
Zhu Hanneng; Chen Wenying; Xiong Sidong
2000-01-01
Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
International Nuclear Information System (INIS)
Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun
2007-01-01
Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang
2010-01-01
A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408
Directory of Open Access Journals (Sweden)
Yanrui Li
2010-01-01
Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.
Directory of Open Access Journals (Sweden)
Isabel Hostettler
2014-12-01
Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.
Else, Laura J; Taylor, Stephen; Back, David J; Khoo, Saye H
2011-01-01
HIV resides within anatomical 'sanctuary sites', where local drug exposure and viral dynamics may differ significantly from the systemic compartment. Suboptimal antiretroviral concentrations in the genital tract may result in compartmentalized viral replication, selection of resistant mutations and possible re-entry of wild-type/resistant virus into the systemic circulation. Therefore, achieving adequate antiretroviral exposure in the genital tract has implications for the prevention of sexual and vertical transmission of HIV. Penetration of antiretrovirals in the genital tract is expressed by accumulation ratios derived from the measurement of drug concentrations in time-matched seminal plasma/cervicovaginal fluid and plasma samples. Penetration varies by gender and may be drug (as opposed to class) specific with high interindividual variability. Concentrations in seminal plasma are highest for nucleoside analogues and lowest for protease inhibitors and efavirenz. Seminal accumulation of newer agents, raltegravir and maraviroc, is moderate (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitors [lamivudine/zidovudine/tenofovir/didanosine > stavudine/abacavir] > raltegravir > indinavir/maraviroc/nevirapine > efavirenz/protease inhibitors [amprenavir/atazanavir/darunavir > lopinavir/ritonavir > saquinavir] > enfuvirtide). In the female genital tract, the nucleoside analogues exhibit high accumulation ratios, whereas protease inhibitors have limited penetration; however, substantial variability exists between individuals and study centres. Second generation non-nucleoside reverse transcriptase inhibitor etravirine, and maraviroc and raltegravir, demonstrate effective accumulation in cervicovaginal secretions (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitor [zidovudine/lamivudine/didanosine > emtricitabine/tenofovir] > indinavir > maraviroc/raltegravir/darunavir/etravirine > nevirapine
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
Directory of Open Access Journals (Sweden)
Parvathi Chary
Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.
Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L
1999-12-17
Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.
DEFF Research Database (Denmark)
Cozzi-Lepri, Alessandro; Phillips, Andrew N; Martinez-Picado, Javier
2009-01-01
BACKGROUND: Because changes in antiretroviral therapy in resource-limited settings (RLSs) are delayed until patients experience immunological or clinical failure, it is important to be able to estimate the consequences in terms of accumulation of thymidine analogue (TA) mutations (TAMs). METHODS...... until the second GRT. RESULTS: At the time of the first GRT in a pair (t0), 1 year after virological failure, a median of 3 TAMs were detected, mutations 41L and 215Y in 65% of pairs and 67N in 52%. Overall, 126 TAMs were accumulated during 548 person-years of follow-up (PYFUs) (1/4.3 years; 95......% confidence interval, 3.7-5.0 years). Greater predicted activity of the TA at t0, TAM profile 2 (TAM2; vs TAM profile 1 [TAM1]) profiles at t0, use of a nonnucleoside reverse-transcriptase inhibitor (NNRTI) at t0 (vs combined NNRTI and protease inhibitor), and acquisition of HIV infection through heterosexual...
Directory of Open Access Journals (Sweden)
Johannes Van Staden
2010-10-01
Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.
LENUS (Irish Health Repository)
Bansode, Vijay B
2011-10-13
Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
International Nuclear Information System (INIS)
Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha
2005-01-01
Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B
2018-02-06
Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni
2016-01-01
Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
Directory of Open Access Journals (Sweden)
Jie Xu
Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential NNRTIs.
Babkov, Denis A; Valuev-Elliston, Vladimir T; Paramonova, Maria P; Ozerov, Alexander A; Ivanov, Alexander V; Chizhov, Alexander O; Khandazhinskaya, Anastasia L; Kochetkov, Sergey N; Balzarini, Jan; Daelemans, Dirk; Pannecouque, Christophe; Seley-Radtke, Katherine L; Novikov, Mikhail S
2015-03-01
In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives 15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular modeling of the most active compounds 15c and 15i was employed to provide insight on their inhibitory properties and direct future design efforts. Copyright © 2015 Elsevier Ltd. All rights reserved.
de Blois, Erik; Chan, Ho Sze; Breeman, Wouter A P
2012-01-01
For iodination ((125/127)I) of tyrosine-containing peptides, chloramin-T, Pre-Coated Iodo-Gen(®) tubes and Iodo-Beads(®) (Pierce) are commonly used for in vitro radioligand investigations and there have been reliant vendors hereof for decades. However, commercial availability of these radio-iodinated peptides is decreasing. For continuation of our research in this field we investigated and optimized (radio-)iodination of somatostatin analogues. In literature, radioiodination using here described somatostatin analogues and iodination techniques are described separately. Here we present an overview, including High Performance Liquid Chromatography (HPLC) separation and characterisation by mass spectrometry, to obtain mono- and di-iodinated analogues. Reaction kinetics of (125/127)I iodinated somatostatin analogues were investigated as function of reaction time and concentration of reactants, including somatostatin analogues, iodine and oxidizing agent. To our knowledge, for the here described somatostatin analogues, no (127)I iodination and optimization are described. (Radio-)iodinated somatostatin analogues could be preserved with a >90% radiochemical purity for 1 month after reversed phase HPLC-purification.
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun
2016-11-01
A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
International Nuclear Information System (INIS)
Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.
1999-01-01
We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia
2011-06-01
Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni
2008-09-01
We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.
Directory of Open Access Journals (Sweden)
Meng Shuang
2010-06-01
Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.
International Nuclear Information System (INIS)
Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.
2006-01-01
Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)
Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake
2017-11-22
Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.
Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki
2014-01-01
Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.
Directory of Open Access Journals (Sweden)
Carlos Barceló
2011-05-01
Full Text Available Analogue gravity is a research programme which investigates analogues of general relativistic gravitational fields within other physical systems, typically but not exclusively condensed matter systems, with the aim of gaining new insights into their corresponding problems. Analogue models of (and for gravity have a long and distinguished history dating back to the earliest years of general relativity. In this review article we will discuss the history, aims, results, and future prospects for the various analogue models. We start the discussion by presenting a particularly simple example of an analogue model, before exploring the rich history and complex tapestry of models discussed in the literature. The last decade in particular has seen a remarkable and sustained development of analogue gravity ideas, leading to some hundreds of published articles, a workshop, two books, and this review article. Future prospects for the analogue gravity programme also look promising, both on the experimental front (where technology is rapidly advancing and on the theoretical front (where variants of analogue models can be used as a springboard for radical attacks on the problem of quantum gravity.
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N
2005-05-01
To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Mesoporous Prussian blue analogues: template-free synthesis and sodium-ion battery applications.
Yue, Yanfeng; Binder, Andrew J; Guo, Bingkun; Zhang, Zhiyong; Qiao, Zhen-An; Tian, Chengcheng; Dai, Sheng
2014-03-17
The synthesis of mesoporous Prussian blue analogues through a template-free methodology and the application of these mesoporous materials as high-performance cathode materials in sodium-ion batteries is presented. Crystalline mesostructures were produced through a synergistically coupled nanocrystal formation and aggregation mechanism. As cathodes for sodium-ion batteries, the Prussian blue analogues all show a reversible capacity of 65 mA h g-1 at low current rate and show excellent cycle stability. The reported method stands as an environmentally friendly and low-cost alternative to hard or soft templating for the fabrication of mesoporous materials.
Reverse fault growth and fault interaction with frictional interfaces: insights from analogue models
Bonanno, Emanuele; Bonini, Lorenzo; Basili, Roberto; Toscani, Giovanni; Seno, Silvio
2017-04-01
The association of faulting and folding is a common feature in mountain chains, fold-and-thrust belts, and accretionary wedges. Kinematic models are developed and widely used to explain a range of relationships between faulting and folding. However, these models may result not to be completely appropriate to explain shortening in mechanically heterogeneous rock bodies. Weak layers, bedding surfaces, or pre-existing faults placed ahead of a propagating fault tip may influence the fault propagation rate itself and the associated fold shape. In this work, we employed clay analogue models to investigate how mechanical discontinuities affect the propagation rate and the associated fold shape during the growth of reverse master faults. The simulated master faults dip at 30° and 45°, recalling the range of the most frequent dip angles for active reverse faults that occurs in nature. The mechanical discontinuities are simulated by pre-cutting the clay pack. For both experimental setups (30° and 45° dipping faults) we analyzed three different configurations: 1) isotropic, i.e. without precuts; 2) with one precut in the middle of the clay pack; and 3) with two evenly-spaced precuts. To test the repeatability of the processes and to have a statistically valid dataset we replicate each configuration three times. The experiments were monitored by collecting successive snapshots with a high-resolution camera pointing at the side of the model. The pictures were then processed using the Digital Image Correlation method (D.I.C.), in order to extract the displacement and shear-rate fields. These two quantities effectively show both the on-fault and off-fault deformation, indicating the activity along the newly-formed faults and whether and at what stage the discontinuities (precuts) are reactivated. To study the fault propagation and fold shape variability we marked the position of the fault tips and the fold profiles for every successive step of deformation. Then we compared
Directory of Open Access Journals (Sweden)
Barceló Carlos
2005-12-01
Full Text Available Analogue models of (and for gravity have a long and distinguished history dating back to the earliest years of general relativity. In this review article we will discuss the history, aims, results, and future prospects for the various analogue models. We start the discussion by presenting a particularly simple example of an analogue model, before exploring the rich history and complex tapestry of models discussed in the literature. The last decade in particular has seen a remarkable and sustained development of analogue gravity ideas, leading to some hundreds of published articles, a workshop, two books, and this review article. Future prospects for the analogue gravity programme also look promising, both on the experimental front (where technology is rapidly advancing and on the theoretical front (where variants of analogue models can be used as a springboard for radical attacks on the problem of quantum gravity.
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ma, Xiongchao; Sun, Baozhen; Zhu, Fei
2018-02-01
This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tandale Babasaheb V
2008-12-01
Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy
Liu, Junhua; Wang, Xu; Liu, Peng; Deng, Rongxin; Lei, Min; Chen, Wantao; Hu, Lihong
2013-07-15
Novel 20(S)-protopanoxadiol (PPD) analogues were designed, synthesized, and evaluated for the chemosensitizing activity against a multidrug resistant (MDR) cell line (KBvcr) overexpressing P-glycoprotein (P-gp). Structure-activity relationship analysis showed that aromatic substituted aliphatic amine at the 24-positions (groups V) effectively and significantly sensitized P-gp overexpressing multidrug resistant (MDR) cells to anticancer drugs, such as docetaxel (DOC), vincristine (VCR), and adriamycin (ADM). PPD derivatives 12 and 18 showed 1.3-2.6 times more effective reversal ability than verapamil (VER) for DOC and VCR. Importantly, no cytotoxicity was observed by the active PPD analogues (5μM) against both non-MDR and MDR cells, suggesting that PPD analogues serve as novel lead compounds toward a potent and safe resistance modulator. Moreover, a preliminary mechanism study demonstrated that the chemosensitizing activity of PPD analogues results from inhibition of P-glycoprotein (P-gp) overexpressed in MDR cancer cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-06-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Verlinden, Bianca K; Niemand, Jandeli; Snyman, Janette; Sharma, Shiv K; Beattie, Ross J; Woster, Patrick M; Birkholtz, Lyn-Marie
2011-10-13
A series of alkylated (bis)urea and (bis)thiourea polyamine analogues were synthesized and screened for antimalarial activity against chloroquine-sensitive and -resistant strains of Plasmodium falciparum in vitro. All analogues showed growth inhibitory activity against P. falciparum at less than 3 μM, with the majority having effective IC(50) values in the 100-650 nM range. Analogues arrested parasitic growth within 24 h of exposure due to a block in nuclear division and therefore asexual development. Moreover, this effect appears to be cytotoxic and highly selective to malaria parasites (>7000-fold lower IC(50) against P. falciparum) and is not reversible by the exogenous addition of polyamines. With this first report of potent antimalarial activity of polyamine analogues containing 3-7-3 or 3-6-3 carbon backbones and substituted terminal urea- or thiourea moieties, we propose that these compounds represent a structurally novel class of antimalarial agents.
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
Effect of sulfur analogue of lysine on bacterial protein biosynthesis
International Nuclear Information System (INIS)
Tanaka, Hidehiko; Soda, Kenji.
1976-01-01
S-(beta-Aminoethyl)-L-cysteine, a sulfur analogue of lysine inhibited strongly growth of Escherichia coli A-19, and weakly that of Corynebacterium sp. isolated from soil, but did not inhibit growth of Aerobacter aerogenes. In Corynebacterium sp. the inhibitory effect was markedly enhanced in the presence of L-threonine. The inhibition of growth by S-(beta-aminoethyl)-L-cysteine was rapidly reversed by the addition of L-lysine. S-(beta-Aminoethyl)-L-cysteine inhibited protein synthesis and the activity of lysyl-tRNA synthetase from E. coli and A. aerogenes. All the other lysine analogues tested inhibited the activity of enzyme, but S-(beta-aminoethyl)-L-cysteine derivatives, S-(beta-N-acetyl-aminoethyl)-L-cysteine and S-(beta-aminoethyl)-alpha-N-acetyl-L-cysteine were not effective. (auth.)
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
International Nuclear Information System (INIS)
Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key
2016-01-01
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)
2016-08-26
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
Directory of Open Access Journals (Sweden)
McNamara Darren
2006-01-01
Full Text Available In this contribution we propose an analogue receiver that can perform turbo detection in MIMO systems. We present the case for a receiver that is built from nonlinear analogue devices, which perform detection in a "free-flow" network (no notion of iterations. This contribution can be viewed as an extension of analogue turbo decoder concepts to include MIMO detection. These first analogue implementations report reductions of few orders of magnitude in the number of required transistors and in consumed energy, and the same order of improvement in processing speed. It is anticipated that such analogue MIMO decoder could bring about the same advantages, when compared to traditional digital implementations.
Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.
2017-10-01
The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.
van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.
1992-01-01
To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient
Johnston, Heather J; Boys, Sarah K; Makda, Ashraff; Carragher, Neil O; Hulme, Alison N
2016-09-02
Systematic alanine scanning of the linear peptide bisebromoamide (BBA), isolated from a marine cyanobacterium, was enabled by solid-phase peptide synthesis of thiazole analogues. The analogues have comparable cytotoxicity (nanomolar) to that of BBA, and cellular morphology assays indicated that they target the actin cytoskeleton. Pathway inhibition in human colon tumour (HCT116) cells was explored by reverse phase protein array (RPPA) analysis, which showed a dose-dependent response in IRS-1 expression. Alanine scanning reveals a structural dependence to the cytotoxicity, actin targeting and pathway inhibition, and allows a new readily synthesised lead to be proposed. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram
2003-01-01
Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we
Directory of Open Access Journals (Sweden)
Rodrigo Pessôa
Full Text Available An improved understanding of the prevalence of low-abundance transmitted drug-resistance mutations (TDRM in therapy-naïve HIV-1-infected patients may help determine which patients are the best candidates for therapy. In this study, we aimed to obtain a comprehensive picture of the evolving HIV-1 TDRM across the massive parallel sequences (MPS of the viral entire proviral genome in a well-characterized Brazilian blood donor naïve to antiretroviral drugs.The MPS data from 128 samples used in the analysis were sourced from Brazilian blood donors and were previously classified by less-sensitive (LS or "detuned" enzyme immunoassay as non-recent or longstanding HIV-1 infections. The Stanford HIV Resistance Database (HIVDBv 6.2 and IAS-USA mutation lists were used to interpret the pattern of drug resistance. The minority variants with TDRM were identified using a threshold of ≥ 1.0% and ≤ 20% of the reads sequenced. The rate of TDRM in the MPS data of the proviral genome were compared with the corresponding published consensus sequences of their plasma viruses.No TDRM were detected in the integrase or envelope regions. The overall prevalence of TDRM in the protease (PR and reverse transcriptase (RT regions of the HIV-1 pol gene was 44.5% (57/128, including any mutations to the nucleoside analogue reverse transcriptase inhibitors (NRTI and non-nucleoside analogue reverse transcriptase inhibitors (NNRTI. Of the 57 subjects, 43 (75.4% harbored a minority variant containing at least one clinically relevant TDRM. Among the 43 subjects, 33 (76.7% had detectable minority resistant variants to NRTIs, 6 (13.9% to NNRTIs, and 16 (37.2% to PR inhibitors. The comparison of viral sequences in both sources, plasma and cells, would have detected 48 DNA provirus disclosed TDRM by MPS previously missed by plasma bulk analysis.Our findings revealed a high prevalence of TDRM found in this group, as the use of MPS drastically increased the detection of these
Detection of hepatitis C virus RNA using reverse transcription PCR
International Nuclear Information System (INIS)
Yap, S.F.
1998-01-01
Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory
APOBEC3G inhibits elongation of HIV-1 reverse transcripts.
Directory of Open Access Journals (Sweden)
Kate N Bishop
2008-12-01
Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
Sun, Wenlong; Zhuang, Chunlin; Li, Xia; Zhang, Bowei; Lu, Xinhua; Zheng, Zhihui; Dong, Yuesheng
2017-08-01
Protein tyrosine phosphatase 1B (PTP1B) inhibitors as potential therapies for diabetes and obesity have attracted much attention in recent years. Six varic acid analogues were isolated from two strains of fungi and evaluated for PTP1B inhibition activities. The structure-activity relationships were also characterized and predicted by molecular modeling. Further kinetic studies indicated the reversible and competitive inhibition manner of varic acid analogues. Trivaric acid showed insulin-sensitizing effect not only in vitro but also in vivo, representing a promising lead compound for further optimization. Copyright © 2017 Elsevier Ltd. All rights reserved.
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-07-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.
Report of the Van de Graaff Group: radiobiology
International Nuclear Information System (INIS)
Renan, M.J.; Van der Riet, F.; Parker, I.
1984-01-01
There exists a need for relevant information on the molecular and cellular processes induced by radiation. In this project several aspects of the problem of developing a human tumor model and growing human cells in culture, have been investigated. Human embryo fibroblasts were grown in 1000 mm plastic Petri dishes in a suitable nutrient medium, supplemented with 10% fetal calf serum and antibiotics. The following series of mutagens were utilized: ultra-violet radiation, chemical carcinogens and nucleosite analogues, such as 5-azacytidine (aza C). Some of the treated human fibroblasts were also examined by electron microscopy and the reverse transcriptase assay
International Nuclear Information System (INIS)
Pessoa-Mahana, David; Nunez, Andres; Espinosa, Christian; Mella-Raipn, Jaime; Pessoa-Mahana, Hernan
2010-01-01
The synthesis of a series of substituted arylpiperazines linked to a 2-(pyridin-3-yl)-1H-benzo[d]imidazole scaffold through an alkylic linker is reported. The novel 1-(2-(4-arylpiperazin-1-yl)alkyl)-2-(pyridin-3-yl)-1H-benzimidazole derivatives are structurally related to the anti-HIV-1 drug Delavirdine and belong to the bis(heteroaryl)piperazines family (BHAPs), a well known HIV-1 reverse transcriptase inhibitors group. (author)
Labruère, Raphaël; Gautier, Benoît; Testud, Marlène; Seguin, Johanne; Lenoir, Christine; Desbène-Finck, Stéphanie; Helissey, Philippe; Garbay, Christiane; Chabot, Guy G; Vidal, Michel; Giorgi-Renault, Sylviane
2010-12-03
We designed and synthesized two novel series of azapodophyllotoxin analogues as potential antivascular agents. A linker was inserted between the trimethoxyphenyl ring E and the tetracyclic ABCD moiety of the 4-aza-1,2-didehydropodophyllotoxins. In the first series, the linker enables free rotation between the two moieties; in the second series, conformational restriction of the E nucleus was considered. We have identified several new compounds with inhibitory activity toward tubulin polymerization similar to that of CA-4 and colchicine, while displaying low cytotoxic activity against normal and/or cancer cells. An aminologue and a methylenic analogue were shown to disrupt endothelial cell cords on Matrigel at subtoxic concentrations, and an original assay of drug washout allowed us to demonstrate the rapid reversibility of this effect. These two new analogues are promising leads for the development of vascular-disrupting agents in the podophyllotoxin series.
Directory of Open Access Journals (Sweden)
Crumpacker Clyde S
2011-01-01
Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Bessems, J.G.M.; Koppele, J.M. te; Dijk, P.A. van; Stee, L.L.P. van; Commandeur, J.N.M.; Vermeulen, N.P.E.
1996-01-01
1. The cytochrome P450-dependent binding of paracetamol and a series of 3,5-disubstituted paracetamol analogues (R = -F, -Cl, -Br, -I, -C(H)3, -C2H5, -iC3H7) have been determined with β-naphthoflavone (βNF)-induced rat liver microsomes and produced reverse type I spectral changes. K(s,app) varied
La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano
2011-03-24
New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.
Directory of Open Access Journals (Sweden)
Mok Helen OL
2006-09-01
Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This
Rethinking of the criteria for natural analogue study. A case of Tono natural analogue study
International Nuclear Information System (INIS)
Yoshida, Hidekazu
1996-01-01
Natural analogue regarding long-term performance of the geological disposal system for radioactive waste isolation is essentially the study of geochemical process which has been evolved in geological environment. All geochemical studies, however, will not be nominated as natural analogue studies. It is, therefore, important to be clear the criteria for natural analogue study with the view of analogy by following three categories, (1) Conceptual model development, (2) Data provision and (3) Model testing, for the concept of geological disposal and safety assessment model. Rethinking of the criteria for natural analogue study through the case of Tono Natural Analogue Study, and the usefulness of natural analogue study for the safety assessment of geological disposal system in Japan have been presented in this paper. (author)
Patick, A K; Boritzki, T J; Bloom, L A
1997-10-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.
Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella
2005-01-01
The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-01-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
CEC natural analogue working group
International Nuclear Information System (INIS)
Come, B.; Chapman, N.A.
1986-01-01
The second meeting of the CEC Natural Analogue Working Group took place on June 17-19, 1986, hosted by the Swiss NAGRA in Interlaken (CH). A review of recent progress in natural analogue programmes was carried out, and complemented by detailed discussions about geomicrobiology, archaeological analogues, natural colloids, and use of analogues to increase confidence in safety assessments for radioactive waste disposal. A statement drafted by the Group, and the presentations made, are put together in this report
Grgic, Ivana; Lunar, Maja M.; Poljak, Mario; Vince, Adriana; Vrakela, Ivana Baca; Planinic, Ana; Seme, Katja; Begovac, Josip
2013-01-01
Abstract The aim of this study was to determine the prevalence of transmitted drug resistance (TDR) in newly diagnosed and treatment-naive HIV-infected patients from Croatia and evaluate a possible contribution of transmission clusters to the spread of resistant virus. The study enrolled treatment-naive HIV-infected patients that entered clinical care at the Croatian Reference Center for HIV/AIDS between 2006 and 2008. The protease gene and a part of the reverse transcriptase gene of the HIV-1 genome were sequenced by using the Trugene HIV-1 Genotyping System. The prevalence of transmitted drug resistance was analyzed by using the surveillance drug resistance mutations (SDRM) list recommended by the WHO in 2009. We report findings for 118 of 180 eligible patients (65.6% coverage). SDRM were detected in 26 of 118 patients (22.0%) who were infected with subtype B and belonged mostly to the men having sex with men (MSM). The majority of patients with primary resistance carried SDRM associated with resistance to nucleoside analogues reverse transcriptase inhibitors (NRTIs, 23 of 118 patients, 19.5%). The most frequently found NRTI SDRM was T215S (17 of 118 patients, 14.4%). SDRM associated with resistance to nonnucleoside reverse transcriptase inhibitors were detected in three (2.5%) patients and primary resistance to protease inhibitors was not detected. Non-B subtypes were detected in 13/118 patients (11%). A total of 12 transmission pairs and eight distinct transmission clusters were identified with the largest cluster harboring sequences from 19 patients; among them all but two were carrying the T215S mutation. This study showed a high prevalence of TDR in newly diagnosed MSM from Croatia and is an important contribution concerning the relationship between local transmission clusters and the spread of resistant virus. PMID:22906365
Directory of Open Access Journals (Sweden)
Lin Bai
Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.
Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong
2007-06-30
Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.
Effect of sequence and stereochemistry reversal on p53 peptide mimicry.
Directory of Open Access Journals (Sweden)
Alessio Atzori
Full Text Available Peptidomimetics effective in modulating protein-protein interactions and resistant to proteolysis have potential in therapeutic applications. An appealing yet underperforming peptidomimetic strategy is to employ D-amino acids and reversed sequences to mimic a lead peptide conformation, either separately or as the combined retro-inverso peptide. In this work, we examine the conformations of inverse, reverse and retro-inverso peptides of p53(15-29 using implicit solvent molecular dynamics simulation and circular dichroism spectroscopy. In order to obtain converged ensembles for the peptides, we find enhanced sampling is required via the replica exchange molecular dynamics method. From these replica exchange simulations, the D-peptide analogues of p53(15-29 result in a predominantly left-handed helical conformation. When the parent sequence is reversed sequence as either the L-peptide and D-peptide, these peptides display a greater helical propensity, feature reflected by NMR and CD studies in TFE/water solvent. The simulations also indicate that, while approximately similar orientations of the side-chains are possible by the peptide analogues, their ability to mimic the parent peptide is severely compromised by backbone orientation (for D-amino acids and side-chain orientation (for reversed sequences. A retro-inverso peptide is disadvantaged as a mimic in both aspects, and further chemical modification is required to enable this concept to be used fruitfully in peptidomimetic design. The replica exchange molecular simulation approach adopted here, with its ability to provide detailed conformational insights into modified peptides, has potential as a tool to guide structure-based design of new improved peptidomimetics.
Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao
2016-01-01
Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were
CEC Natural Analogue Working Group
International Nuclear Information System (INIS)
Come, B.; Chapman, N.A.
1989-01-01
The central theme for the third meeting of the CEC analogue working group was ''How can analogue data be used for performance assessments, both in support of the results and for presentation to the public''. This report puts together the most recent achievements in this field, together with a review of on-going natural analogue programmes
Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max
2014-01-01
During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.
Diab , Roudayna; Jordheim , Lars P; Degobert , Ghania; Peyrottes , Suzanne; Périgaud , Christian; Dumontet , Charles; Fessi , Hatem
2009-01-01
International audience; Bis(tbutyl-S-acyl-2-thioethyl)-cytidine monophosophate is a new cytotoxic mononucleotide prodrug which have been developed to reverse the cellular resistance to nucleoside analogues. Unfortunately, its in vivo utilisation was hampered by its poor water solubility, raising the need of a molecular vector capable to mask its physicochemical characteristics although without affecting its cytotoxic activity. Hydroxypropyl-beta-cyclodextrin was used to prepare the prodrug in...
Analogue alternative the electronic analogue computer in Britain and the USA, 1930-1975
Small, James S
2013-01-01
We are in the midst of a digital revolution - until recently, the majority of appliances used in everyday life have been developed with analogue technology. Now, either at home or out and about, we are surrounded by digital technology such as digital 'film', audio systems, computers and telephones. From the late 1940s until the 1970s, analogue technology was a genuine alternative to digital, and the two competing technologies ran parallel with each other. During this period, a community of engineers, scientists, academics and businessmen continued to develop and promote the analogue computer.
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K
2015-04-01
MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Aoife Corcoran
2016-02-01
Full Text Available Structurally similar double-point modified analogues of 1,25-dihydroxyvitamin D2 (1,25D2 were screened in vitro for their pro-differentiating activity against the promyeloid cell line HL60. Their affinities towards human full length vitamin D receptor (VDR and metabolic stability against human vitamin D 24-hydroxylase (CYP24A1 were also tested. The analogues (PRI-1730, PRI-1731, PRI-1732, PRI-1733 and PRI-1734 contained 5,6-trans modification of the A-ring and of the triene system, additional hydroxyl or unsaturation at C-22 in the side chain and reversed absolute configuration (24-epi at C-24 of 1,25D2. As presented in this paper, introduction of selected structural modifications simultaneously in two distinct parts of the vitamin D molecule resulted in a divergent group of analogues. Analogues showed lower VDR affinity in comparison to that of the parent hormones, 1,25D2 and 1,25D3, and they caused effective HL60 cell differentiation only at high concentrations of 100 nM and above. Unexpectedly, introducing of a 5,6-trans modification combined with C-22 hydroxyl and 24-epi configuration switched off entirely the cell differentiation activity of the analogue (PRI-1734. However, this analogue remained a moderate substrate for CYP24A1, as it was metabolized at 22%, compared to 35% for 1,25D2. Other analogues from this series were either less (12% for PRI-1731 and PRI-1733 or more (52% for PRI-1732 resistant to the enzymatic deactivation. Although the inactive analogue PRI-1734 failed to show VDR antagonism, when tested in HL60 cells, its structure might be a good starting point for our design of a vitamin D antagonist.
NCBI nr-aa BLAST: CBRC-DDIS-06-0095 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DDIS-06-0095 gb|AAX19886.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excel...sa] gb|AAX19887.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excelsa] AAX19886.1 1e-44 25% ...
Wu, Hong-Min; Zhou, Kuo; Wu, Tao; Cao, Yin-Guang
2016-09-01
A novel series of pyrazine-1,3-thiazine hybrid conjugates were synthesized in excellent yield. These derivatives were subsequently tested against human immunodeficiency virus (HIV-1); hemagglutinin type 1 and neuraminidase type 1-'influenza' A (H1N1) virus; enterovirus 71 (EV71); and coxsackievirus B3. The effect of these conjugates on the key enzymes responsible for the progression of these viral infections was also illustrated via enzyme-based assay, such as HIV-1 reverse transcriptase (RT) and neuraminidase, where entire tested molecules showed considerable inhibition. Particularly, among the tested derivatives, compound 3k was identified as most promising inhibitor of HIV-1 with 94% of inhibition (IC50 3.26 ± 0.2 μm). Moreover, the compound 3d was found to be the most potent analogue to inhibit the H1N1 virus with IC50 of 5.32 ± 0.4 μm together with inhibition of the neuraminidase enzyme (IC50 11.24 ± 1.1 μm). In regard to inhibitory activity against enterovirus 71 (EV71) and coxsackievirus B3 (CVB3), the tested derivatives showed considerable inhibition of infection. Molecular docking studies were also performed for the most promising inhibitors with their corresponding target protein to exemplify the structural requirement for better inhibitory activity. The results of inhibitory assay showed that designed molecules possess considerable inhibitory activity against the virus tested. © 2016 John Wiley & Sons A/S.
Natural Analogue Synthesis Report
Energy Technology Data Exchange (ETDEWEB)
A. M. Simmons
2002-05-01
The purpose of this report is to present analogue studies and literature reviews designed to provide qualitative and quantitative information to test and provide added confidence in process models abstracted for performance assessment (PA) and model predictions pertinent to PA. This report provides updates to studies presented in the ''Yucca Mountain Site Description'' (CRWMS M and O 2000 [151945], Section 13) and new examples gleaned from the literature, along with results of quantitative studies conducted specifically for the Yucca Mountain Site Characterization Project (YMP). The intent of the natural analogue studies was to collect corroborative evidence from analogues to demonstrate additional understanding of processes expected to occur during postclosure at a potential Yucca Mountain repository. The report focuses on key processes by providing observations and analyses of natural and anthropogenic (human-induced) systems to improve understanding and confidence in the operation of these processes under conditions similar to those that could occur in a nuclear waste repository. The process models include those that represent both engineered and natural barrier processes. A second purpose of this report is to document the various applications of natural analogues to geologic repository programs, focusing primarily on the way analogues have been used by the YMP. This report is limited to providing support for PA in a confirmatory manner and to providing corroborative inputs for process modeling activities. Section 1.7 discusses additional limitations of this report. Key topics for this report are analogues to emplacement drift degradation, waste form degradation, waste package degradation, degradation of other materials proposed for the engineered barrier, seepage into drifts, radionuclide flow and transport in the unsaturated zone (UZ), analogues to coupled thermal-hydrologic-mechanical-chemical processes, saturated zone (SZ) transport
NATURAL ANALOGUE SYNTHESIS REPORT
International Nuclear Information System (INIS)
Simmons, A.M.
2004-01-01
The purpose of this report is to present analogue studies and literature reviews designed to provide qualitative and quantitative information to test and provide added confidence in process models abstracted for performance assessment (PA) and model predictions pertinent to PA. This report provides updates to studies presented in the Yucca Mountain Site Description (CRWMS M and O 2000 [151945], Section 13) and new examples gleaned from the literature along with results of quantitative studies conducted specifically for the Yucca Mountain Project (YMP). The intent of the natural analogue studies was to collect corroborative evidence from analogues to demonstrate additional understanding of processes expected to occur during postclosure at a potential Yucca Mountain repository. The report focuses on key processes by providing observations and analyses of natural and anthropogenic (human-induced) systems to improve understanding and confidence in the operation of these processes under conditions similar to those that could occur in a nuclear waste repository. The process models include those that represent both engineered and natural barrier processes. A second purpose of this report is to document the various applications of natural analogues to geologic repository programs, focusing primarily on the way analogues have been used by the YMP. This report is limited to providing support for PA in a confirmatory manner and to providing corroborative inputs for process modeling activities. Section 1.7 discusses additional limitations of this report. Key topics for this report are analogues to emplacement-drift degradation, waste-form degradation, waste-package degradation, degradation of other materials proposed for the engineered barrier, seepage into drifts, radionuclide flow and transport in the unsaturated zone (UZ), analogues to coupled thermal-hydrologic-mechanical-chemical processes, saturated-zone (SZ) transport, impact of radionuclide release on the biosphere
Patient specific root-analogue dental implants – additive manufacturing and finite element analysis
Directory of Open Access Journals (Sweden)
Gattinger Johannes
2016-09-01
Full Text Available Aim of this study was to prove the possibility of manufacturing patient specific root analogue two-part (implant and abutment implants by direct metal laser sintering. The two-part implant design enables covered healing of the implant. Therefore, CT-scans of three patients are used for reverse engineering of the implants, abutments and crowns. Patient specific implants are manufactured and measured concerning dimensional accuracy and surface roughness. Impacts of occlusal forces are simulated via FEA and compared to those of standard implants.
Martin, John C; Hitchcock, Michael J M; De Clercq, Erik; Prusoff, William H
2010-01-01
The occasion of this 25th anniversary issue encouraged us to reminisce about the important history of the discovery of the dideoxynucleoside analogues for the treatment of HIV/AIDS and to chronicle our thoughts about a particular exciting and rewarding period of our scientific careers. Following the identification of the anti-HIV activity of zidovudine (AZT), we participated in the urgent quest to discover optimal treatments of HIV infection and AIDS. A number of previously synthesized nucleoside analogues were comparatively evaluated, and stavudine (D4T) emerged as a promising candidate for development. Following clinical evaluation, D4T became a mainstay of the initial antiretroviral combination therapy, prolonging and saving numerous lives. It has only recently been supplanted by better-tolerated treatments. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.
Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre
2012-04-01
The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano
2005-01-13
Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.
NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS
African Journals Online (AJOL)
2005-11-02
Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).
Reversal of chloroquine resistance in Plasmodium falciparum by CDR 87/209 and analogues.
Walter, R D; Seth, M; Bhaduri, A P
1993-03-01
The spreading of resistance towards chloroquine has diminished its value as a potent and safe drug in malaria endemic areas. Recent reports on the reversal of chloroquine resistance in the malaria parasite Plasmodium falciparum in vitro and in vivo by verapamil, desipramine and other Ca(2+)-channel blockers and antidepressants has initiated a strategy for chemotherapy by treatment with chloroquine in combination with a drug resistance modulator. Described here is a class of modulators of distinct structure which reverse chloroquine resistance in a different manner. Contrary to verapamil and desipramine, CDRI 87/209, the most potent compound of this new class and used as a chemical lead, did not restore chloroquine accumulation in the resistant parasites, thereby indicating that besides the proposed blockade of drug efflux other mechanisms are vulnerable targets for a chemotherapeutic approach towards drug resistance. Similar to the former modulators, CDRI 87/209 showed only weak intrinsic plasmodicidal activity and the increase of drug susceptibility was restricted to resistant plasmodia.
Low prevalence of primary HIV resistance in western Massachusetts.
Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J
2010-01-01
Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.
DEFF Research Database (Denmark)
Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens
2012-01-01
Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...
(3,4-dihydroisoquinolin-2(1H)-yl)
Indian Academy of Sciences (India)
Administrator
HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.
New targets and novel antiretrovirals | Wood | Southern African ...
African Journals Online (AJOL)
Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...
Use of analogues to build technologists' confidence: NAnet
International Nuclear Information System (INIS)
Noseck, Ulrich
2008-01-01
The relevance of analogues to radioactive waste management stems from the long timescales that have to be considered. Periods up to a million or more years into the future need to be considered and these are beyond experimental investigation and human experience. Within the last years the term 'Natural Analogue' has got a much wider meaning and includes man-made analogues as well. The role of natural analogues in the safety case depends amongst others on the time scale to be covered. Therefore, it is useful to classify them by the time period addressed in the study. Here it is referred to: industrial analogues which started earliest 150 years ago, archaeological analogues, which cover time frames between the past 10 000 and 150 years, and geological analogues, which usually cover time frames of more than 10 000 years and in most cases more than million years. The current interest in analogues in different countries is reflected by several recent review projects with emphasis on the application of natural analogue study results in performance assessment. The most recent international review was performed within the 5. EURATOM Framework of the EC by the NAnet project, a network on the review of natural analogue studies with emphasis on the application of analogues in long-term safety assessment and communication. The overall aim of the NAnet project was to review the past and present use and understanding of natural analogues, and to make recommendations for their future use. The project covered 'traditional' natural analogue studies, such as large-scale investigations of radionuclide transport around uranium ore bodies, and process or mechanistic analogue studies such as those examining natural glass and bentonite clay stability. To complete the picture, a restricted range of other studies of natural systems which employ a similar philosophy to analogues was also included in the scope. These included studies which have examined radionuclide transport and retardation
Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd
2013-11-05
Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable
Natural and archaeological analogues: a review
International Nuclear Information System (INIS)
Brookins, D.G.
1987-01-01
In this chapter natural analogues in the geomedia for various aspects of radioactive waste disposal are discussed. Particular reference is made to the Okla Natural Reactor in Gabon. Igneous contact zones are discussed and natural analogues of waste-form materials. The importance of archaeological remains and anthropogenic materials left by man, in assessing weathering conditions and serving as radioactive waste analogues, is also emphasised. (UK)
DEFF Research Database (Denmark)
Dukes, J.P.; King, D.P.; Alexandersen, Søren
2006-01-01
Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...
Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng
2014-07-01
The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We
Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin
2017-04-01
Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.
Aulicino, Paula C; Rocco, Carlos A; Mecikovsky, Debora; Bologna, Rosa; Mangano, Andrea; Sen, Luisa
2010-01-01
Patterns and pathways of HIV type-1 (HIV-1) antiretroviral (ARV) drug resistance-associated mutations in clinical isolates are conditioned by ARV history and factors such as viral subtype and fitness. Our aim was to analyse the frequency and association of ARV drug resistance mutations in a group of long-term vertically infected patients from Argentina. Plasma samples from 71 patients (38 children and 33 adolescents) were collected for genotypic HIV-1 ARV resistance testing during the period between February 2006 and October 2008. Statistically significant pairwise associations between ARV resistance mutations in pol, as well as associations between mutations and drug exposure, were identified using Fisher's exact tests with Bonferroni and false discovery rate corrections. Phylogenetic analyses were performed for subtype assignment. In protease (PR), resistance-associated mutations M46I/L, I54M/L/V/A/S and V82A/F/T/S/M/I were associated with each other and with minor mutations at codons 10, 24 and 71. Mutations V82A/F/T/S/M/I were primarily selected by the administration of ritonavir (RTV) in an historical ARV regimen. In reverse transcriptase, thymidine analogue mutation (TAM)1 profile was more common than TAM2. The non-nucleoside K103N+L100I mutations were observed at high frequency (15.5%) and were significantly associated with the nucleoside mutation L74V in BF recombinants. Associations of mutations at PR sites reflect the frequent use of RTV at an early time in this group of patients and convergent resistance mechanisms driven by the high exposure to protease inhibitors, as well as local HIV-1 diversity. The results provide clinical evidence of a molecular interaction between K103N+L100I and L74V mutations at the reverse transcriptase gene in vivo, limiting the future use of second-generation non-nucleoside reverse transcriptase inhibitors such as etravirine.
Alcobía-Díaz, B; Lópiz, Y; García-Fernández, C; Rizo de Álvaro, B; Marco, F
Reverse total shoulder arthroplasty in rotator cuff arthropathy patients, improves anteversion and abduction, but not rotational, outcomes. The main aim of this study is to determine its repercussions on daily life activities in our patients. Between 2009 and 2011 we implanted 210 shoulder arthroplasties, 126 of them were reverse total shoulder arthroplasty in a rotator cuff arthropathy context. About 88% were women, with a mean age at time of surgery of 81 years, 95% were retired. The mean follow up was 53 months. The Constant scale, Visual Analogue Scale, Charlson Comorbidity Index, range of motion were measured for each patient and whether they could manage 40 daily life activities by means of a new questionnaire, classifying them according toshoulder functional demand. Mean normalized by sex and age Constant value was 81.2%. Mean Visual Analogue Scale and Charlson Index were 3.56 and 1.69 respectively. Improvement in anteversion and abduction, not in rotational range of motion. Limitation was found in low and high functional demand activities in 20% and 51% respectively, especially those which involved internal rotation. Reverse total shoulder arthroplasty treatment for RCA in the elderly, achieves adequate pain management and good functional outcomes. Nevertheless, an important risk of DLA limitation must be accepted in those which involve internal rotation or shoulder high functional demand. Copyright © 2017 SECOT. Publicado por Elsevier España, S.L.U. All rights reserved.
DEFF Research Database (Denmark)
Shah, Peter Jivan
1992-01-01
A short term analogue memory is described. It is based on a well-known sample-hold topology in which leakage currents have been minimized partly by circuit design and partly by layout techniques. Measurements on a test chip implemented in a standard 2.4 micron analogue CMOS process show a droop...
Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa
Directory of Open Access Journals (Sweden)
Aline Aki Tanikawa
2013-08-01
Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.
Analogue to Digital and Digital to Analogue Converters (ADCs and DACs): A Review Update
Pickering, J.
2015-06-15
This is a review paper updated from that presented for CAS 2004. Essentially, since then, commercial components have continued to extend their performance boundaries but the basic building blocks and the techniques for choosing the best device and implementing it in a design have not changed. Analogue to digital and digital to analogue converters are crucial components in the continued drive to replace analogue circuitry with more controllable and less costly digital processing. This paper discusses the technologies available to perform in the likely measurement and control applications that arise within accelerators. It covers much of the terminology and 'specmanship' together with an application-oriented analysis of the realisable performance of the various types. Finally, some hints and warnings on system integration problems are given.
Kendon, Vivien M; Nemoto, Kae; Munro, William J
2010-08-13
We briefly review what a quantum computer is, what it promises to do for us and why it is so hard to build one. Among the first applications anticipated to bear fruit is the quantum simulation of quantum systems. While most quantum computation is an extension of classical digital computation, quantum simulation differs fundamentally in how the data are encoded in the quantum computer. To perform a quantum simulation, the Hilbert space of the system to be simulated is mapped directly onto the Hilbert space of the (logical) qubits in the quantum computer. This type of direct correspondence is how data are encoded in a classical analogue computer. There is no binary encoding, and increasing precision becomes exponentially costly: an extra bit of precision doubles the size of the computer. This has important consequences for both the precision and error-correction requirements of quantum simulation, and significant open questions remain about its practicality. It also means that the quantum version of analogue computers, continuous-variable quantum computers, becomes an equally efficient architecture for quantum simulation. Lessons from past use of classical analogue computers can help us to build better quantum simulators in future.
Reversal learning enhanced by lysergic acid diethylamide (LSD)
King, A.R.; Martin, I.L.; Arabella Melville, K.
1974-01-01
1 Small doses of lysergic acid diethylamide (LSD) (12.5-50 μg/kg) consistently facilitated learning of a brightness discrimination reversal. 2 2-Bromo-lysergic acid diethylamide (BOL-148), a structural analogue of LSD, with similar peripheral anti-5-hydroxytrypamine activity but no psychotomimetic properties, had no effect in this learning situation at a similar dose (25 μg/kg). 3 LSD, but not BOL-148, caused a small but significant increase in brain 5-hydroxytryptamine levels, but had no effect on the levels of catecholamines in the brain at 25 μg/kg. PMID:4458849
DEFF Research Database (Denmark)
1997-01-01
The present invention relates to a solid phase methodology for the preparation of a combinatorial library of structural analogues of the natural product balanol (ophiocordin, azepinostatin), which is a protein kinase C (PKC) and protein kinase A (PKA) inhibitor. The method comprises solid...
Cephalostatin analogues--synthesis and biological activity.
Flessner, Timo; Jautelat, Rolf; Scholz, Ulrich; Winterfeldt, Ekkehard
2004-01-01
Starting off in the early 90's the field of cephalostatin analogues has continually expanded over the last 10 years. First syntheses prepared symmetric analogues like 14b (119) and 26 (65), which were subsequently desymmetrized to provide analogues like beta-hydroxy ketone 31 (19). Importantly the straightforward approach provided already compounds with mu-molar potency and the same pattern of activity as cephalostatin 1 (1) (see Chapter 2.1). Chemically more demanding, two new methods for the directed synthesis of (bissteroidal) pyrazines were devised and subsequently applied to a wide variety of differently functionalized coupling partners. These new methods allowed for the synthesis of various analogues (Chapter 2.2.; and, last but not least, for the totals synthesis of several cephalostatin natural products; Chapter 1.). Functionalization and derivatization of the 12-position was performed (Chapter 2.1 and 3) and synthetic approaches to establish the D-ring double bond were successfully investigated (Chapter 3). [figure: see text] Dealing synthetically with the spiroketal moiety, novel oxidative opening procedures on monomeric delta 14, 15-steroids were devised as well as intensive studies regarding spiroketal synthesis and spiroketal rearrangements were conducted (Chapter 3.2. and 4.). Last but not least direct chemical modification of ritterazines and cephalostatins were studied, which provided a limited number of ritterazine analogues (Chapter 4.). All these synthetic activities towards analogues are summarized in Fig. 18. During this period of time the growing number of cephalostatins and ritterazines on the one hand and of analogues on the other hand provided several SAR trends, which can guide future analogue synthesis. The combined SAR findings are displayed in Fig. 19. So far it is apparent that: Additional methoxylations or hydroxylations in the steroidal A ring core structure (1-position) are slightly decreasing activity (compare cephalostatin 1 1 to
Analogue to Digital and Digital to Analogue (AD/DA) Conversion Techniques: An Overview
CERN. Geneva
2002-01-01
The basic ideas behind modern Analogue to Digital and Digital to Analogue (AD/DA) conversion methods will be introduced: a general view of the importance of these devices will be given, along with the digital representation of time-varying, real-world analogue signals. Some CERN applications will be outlined. The variety of conversion methods, their limitations, error sources and measurement methods will form the major part of this presentation. A review of the technological progress in this field over the last 30 years will be presented, concluding with the present 'state of the art' and a quick look at what is just around the corner. This Technical Training Seminar is in the framework of the FEED-2002 Lecture Series, and it is a prerequisite to attending to any of the FEED-2002 Terms. FEED-2002 is a two-term course that will review the techniques dealing with closed loop systems, focussing on time-invariant linear systems. (free attendance, no registration required) More information on the FEED-2002 ...
Detection of human telomerase reverse transcriptase messenger ...
African Journals Online (AJOL)
Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
International video project on natural analogues
International Nuclear Information System (INIS)
Guentensperger, Marcel
1993-01-01
A natural analogue can be defined as a natural process which has occurred in the past and is studied in order to test predictions about the future evolution of similar processes. In recent years, natural analogues have been used increasingly to test the mathematical models required for repository performance assessment. Analogues are, however, also of considerable use in public relations as they allow many of the principles involved in demonstrating repository safety to be illustrated in a clear manner using natural systems with which man is familiar. The international Natural Analogue Working Group (NAWG), organised under the auspices of the CEC, has recognised that such PR applications are of considerable importance and should be supported from a technical level. At the NAWG meeting in Pitlochry, Scotland (June 1990), it was recommended that the possibilities for making a video film on this topic be investigated and Nagra was requested to take the lead role in setting up such a project
Basic science and pathogenesis of ageing with HIV: potential mechanisms and biomarkers.
Lagathu, Claire; Cossarizza, Andrea; Béréziat, Véronique; Nasi, Milena; Capeau, Jacqueline; Pinti, Marcello
2017-06-01
: The increased prevalence of age-related comorbidities and mortality is worrisome in ageing HIV-infected patients. Here, we aim to analyse the different ageing mechanisms with regard to HIV infection. Ageing results from the time-dependent accumulation of random cellular damage. Epigenetic modifications and mitochondrial DNA haplogroups modulate ageing. In antiretroviral treatment-controlled patients, epigenetic clock appears to be advanced, and some haplogroups are associated with HIV infection severity. Telomere shortening is enhanced in HIV-infected patients because of HIV and some nucleoside analogue reverse transcriptase inhibitors. Mitochondria-related oxidative stress and mitochondrial DNA mutations are increased during ageing and also by some nucleoside analogue reverse transcriptase inhibitors. Overall, increased inflammation or 'inflammageing' is a major driver of ageing and could result from cell senescence with secreted proinflammatory mediators, altered gut microbiota, and coinfections. In HIV-infected patients, the level of inflammation and innate immunity activation is enhanced and related to most comorbidities and to mortality. This status could result, in addition to age, from the virus itself or viral protein released from reservoirs, from HIV-enhanced gut permeability and dysbiosis, from antiretroviral treatment, from frequent cytomegalovirus and hepatitis C virus coinfections, and also from personal and environmental factors, as central fat accumulation or smoking. Adaptive immune activation and immunosenescence are associated with comorbidities and mortality in the general population but are less predictive in HIV-infected patients. Biomarkers to evaluate ageing in HIV-infected patients are required. Numerous systemic or cellular inflammatory, immune activation, oxidative stress, or senescence markers can be tested in serum or peripheral blood mononuclear cells. The novel European Study to Establish Biomarkers of Human Ageing MARK
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Song, Yue; Shen, Keng; Yu, Jing-rong
2007-11-06
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase
Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa
2012-11-01
Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.
Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William
2007-01-01
Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...
Manuel-Manresa, Pilar; Korrodi-Gregório, Luís; Hernando, Elsa; Villanueva, Alberto; Martínez-García, David; Rodilla, Ananda M; Ramos, Ricard; Fardilha, Margarida; Moya, Juan; Quesada, Roberto; Soto-Cerrato, Vanessa; Pérez-Tomás, Ricardo
2017-07-01
Lung cancer has become the leading killer cancer worldwide, due to late diagnosis and lack of efficient anticancer drugs. We have recently described novel natural-derived tambjamine analogues that are potent anion transporters capable of disrupting cellular ion balance, inducing acidification of the cytosol and hyperpolarization of cellular plasma membranes. Although these tambjamine analogues were able to compromise cell survival, their molecular mechanism of action remains largely unknown. Herein we characterize the molecular cell responses induced by highly active indole-based tambjamine analogues treatment in lung cancer cells. Expression changes produced after compounds treatment comprised genes related to apoptosis, cell cycle, growth factors and its receptors, protein kinases and topoisomerases, among others. Dysregulation of BCL2 and BIRC5 /survivin genes suggested the apoptotic pathway as the induced molecular cell death mechanism. In fact, activation of several proapoptotic markers (caspase-9, caspase-3, and PARP) and reversion of the cytotoxic effect upon treatment with an apoptosis inhibitor (Z-VAD-FMK) were observed. Moreover, members of the Bcl-2 protein family suffered changes after tambjamine analogues treatment, with a concomitant protein decrease towards the prosurvival members. Besides this, it was observed cellular accumulation of ROS upon compound treatment and an activation of the stress-kinase p38 MAPK route that, when inhibited, reverted the cytotoxic effect of the tambjamine analogues. Finally, a significant therapeutic effect of these compounds was observed in subcutaneous and orthotopic lung cancer mice models. Taken together, these results shed light on the mechanism of action of novel cytotoxic anionophores and demonstrate the therapeutic effects against lung cancer. Mol Cancer Ther; 16(7); 1224-35. ©2017 AACR . ©2017 American Association for Cancer Research.
From reverse transcription to human brain tumors
Directory of Open Access Journals (Sweden)
Dmitrenko V. V.
2013-05-01
Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line
Analogue Hawking radiation from astrophysical black-hole accretion
International Nuclear Information System (INIS)
Das, Tapas K
2004-01-01
We show that spherical accretion onto astrophysical black holes can be considered as a natural example of an analogue system. We provide, for the first time, an exact analytical scheme for calculating the analogue Hawking temperature and surface gravity for general relativistic accretion onto astrophysical black holes. Our calculation may bridge the gap between the theory of transonic astrophysical accretion and the theory of analogue Hawking radiation. We show that the domination of the analogue Hawking temperature over the actual Hawking temperature may be a real astrophysical phenomenon, though observational tests of this fact will at best be difficult and at worst might prove to be impossible. We also discuss the possibilities of the emergence of analogue white holes around astrophysical black holes. Our calculation is general enough to accommodate accreting black holes with any mass
Kayillo, Sindy; Gray, Michael J; Shalliker, R Andrew; Dennis, Gary R
2005-05-06
Isotopic substitution is a technique used to highlight particular bonds within a molecule for kinetic, spectroscopic and structure analysis. It is presumed that although some properties such as stretching frequencies will not be the same for substituted analogues, the chemical interactions will not vary appreciably as a function of labelling. Reversed-phase liquid chromatography has been used to demonstrate that there are significant differences between the chromatographic behaviour of a sequence of deuterated and protonated oligomeric polystyrenes. Two-dimensional reversed-phase liquid chromatography was used to show that even the diasteromers of the oligomers (n = 5) have retention mechanisms that are dependent on the subtle changes to the molecular conformation and electronic structure, which are a consequence of deuteration.
Reverse isotope dilution method for determining benzene and metabolites in tissues
International Nuclear Information System (INIS)
Bechtold, W.E.; Sabourin, P.J.; Henderson, R.F.
1988-01-01
A method utilizing reverse isotope dilution for the analysis of benzene and its organic soluble metabolites in tissues of rats and mice is presented. Tissues from rats and mice that had been exposed to radiolabeled benzene were extracted with ethyl acetate containing known, excess quantities of unlabeled benzene and metabolites. Butylated hydroxytoluene was added as an antioxidant. The ethyl acetate extracts were analyzed with semipreparative reversed-phase HPLC. Isolated peaks were collected and analyzed for radioactivity (by liquid scintillation spectrometry) and for mass (by UV absorption). The total amount of each compound present was calculated from the mass dilution of the radiolabeled isotope. This method has the advantages of high sensitivity, because of the high specific activity of benzene, and relative stability of the analyses, because of the addition of large amounts of unlabeled carrier analogue
Synthesis and biological evaluation of febrifugine analogues.
Mai, Huong Doan Thi; Thanh, Giang Vo; Tran, Van Hieu; Vu, Van Nam; Vu, Van Loi; Le, Cong Vinh; Nguyen, Thuy Linh; Phi, Thi Dao; Truong, Bich Ngan; Chau, Van Minh; Pham, Van Cuong
2014-12-01
A series of febrifugine analogues were designed and synthesized. Antimalarial activity evaluation of the synthetic compounds indicated that these derivatives had a strong inhibition against both chloroquine-sensitive and -resistant Plasmodium falciparum parasites. Many of them were found to be more active than febrifugine hydrochloride. The tested analogues had also a significant cytotoxicity against four cancer cell lines (KB, MCF7, LU1 and HepG2). Among the synthetic analogues, two compounds 17b and 17h displayed a moderate cytotoxicity while they exhibited a remarkable antimalarial activity.
Assessment of six dissimilarity metrics for climate analogues
Grenier, Patrick; Parent, Annie-Claude; Huard, David; Anctil, François; Chaumont, Diane
2013-04-01
Spatial analogue techniques consist in identifying locations whose recent-past climate is similar in some aspects to the future climate anticipated at a reference location. When identifying analogues, one key step is the quantification of the dissimilarity between two climates separated in time and space, which involves the choice of a metric. In this communication, spatial analogues and their usefulness are briefly discussed. Next, six metrics are presented (the standardized Euclidean distance, the Kolmogorov-Smirnov statistic, the nearest-neighbor distance, the Zech-Aslan energy statistic, the Friedman-Rafsky runs statistic and the Kullback-Leibler divergence), along with a set of criteria used for their assessment. The related case study involves the use of numerical simulations performed with the Canadian Regional Climate Model (CRCM-v4.2.3), from which three annual indicators (total precipitation, heating degree-days and cooling degree-days) are calculated over 30-year periods (1971-2000 and 2041-2070). Results indicate that the six metrics identify comparable analogue regions at a relatively large scale, but best analogues may differ substantially. For best analogues, it is also shown that the uncertainty stemming from the metric choice does generally not exceed that stemming from the simulation or model choice. A synthesis of the advantages and drawbacks of each metric is finally presented, in which the Zech-Aslan energy statistic stands out as the most recommended metric for analogue studies, whereas the Friedman-Rafsky runs statistic is the least recommended, based on this case study.
Directory of Open Access Journals (Sweden)
Chen Hao-tai
2011-10-01
Full Text Available Abstract A reverse transcriptase loop-mediated isothermal amplification (RT-LAMP assay was rapidly used to detect serotype Asia 1 of foot-and-mouth disease virus (FMDV within 45 min at 61°C. All FMDV serotype Asia 1 reference strains were positive by RT-LAMP, while other viruses such as FMDV serotypes O, C, A and classical swine fever virus, swine vesicular disease virus, porcine reproductive and respiratory syndrome virus and Japanese encephalitis virus remained negative. Furthermore, FMDV sreotype Asia 1 positive samples were able to detect by RT-LAMP assay. This RT-LAMP assay may be suitable particularly for diagnosis of FMDV serotype Asia 1 infection in field stations.
Neuroprotective effects of an oxyntomodulin analogue in the MPTP mouse model of Parkinson's disease.
Liu, WeiZhen; Li, Yanwei; Jalewa, Jaishree; Saunders-Wood, Taylor; Li, Lin; Hölscher, Christian
2015-10-15
Oxyntomodulin is a hormone and a growth factor. It activates two receptors, the Glucagon-like peptide 1 (GLP-1) and the glucagon receptor. GLP-1 mimetics are on the market as treatments for type 2 diabetes and are well tolerated. These drugs have shown neuroprotective properties in animal models of neurodegenerative disorders. In addition, the GLP-1 mimetic exendin-4 has shown protective effects in animal models of Parkinson's disease (PD), and a clinical trial in PD patients showed promising first positive results. D-Ser2-oxyntomodulin (Oxy) is a protease resistant oxyntomodulin analogue that has been developed to treat diabetes. Here we demonstrate for the first time that such analogues have neuroprotective effects. The drug showed protective effects in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of PD. MPTP was injected daily (20 mg/kg i.p.) for 7 days, and Oxy injected once-daily for 14 days i.p. Oxy treatment prevented or reversed the MPTP- induced motor impairment (Rotarod, spontaneous locomotion, swim activity, muscle strength test), the MPTP-induced reduction in Tyrosine Hydroxylase (TH) levels (dopamine synthesis) in the substantia nigra and basal ganglia, the reduction of the synaptic marker synapstophysin, the inactivation of the growth factor kinase Akt/PKB and of the anti-apoptotic signaling molecule Bcl-2, and the increase of levels of the pro-inflammatory cytokine TNF-α. The results demonstrate that oxyntomodulin analogues show promise as a novel treatment of PD. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis and anticancer evaluation of spermatinamine analogues
Moosa, Basem; Sagar, Sunil; Li, Song; Esau, Luke; Kaur, Mandeep; Khashab, Niveen M.
2016-01-01
analogues and their cytotoxic evaluation against three human cancer cell lines i.e. cervix adenocarcinoma (HeLa), breast adenocarcinoma (MCF-7), and prostate carcinoma (DU145). Analogues 12, 14 and 15 were found to be the most potent against one or more cell
Insulin analogues in pregnancy and specific congenital anomalies
DEFF Research Database (Denmark)
de Jong, Josta; Garne, Ester; Wender-Ozegowska, Ewa
2016-01-01
Insulin analogues are commonly used in pregnant women with diabetes. It is not known if the use of insulin analogues in pregnancy is associated with any higher risk of congenital anomalies in the offspring compared with use of human insulin. We performed a literature search for studies of pregnant...... women with pregestational diabetes using insulin analogues in the first trimester and information on congenital anomalies. The studies were analysed to compare the congenital anomaly rate among foetuses of mothers using insulin analogues with foetuses of mothers using human insulin. Of 29 studies, we...... samples in the included studies provided insufficient statistical power to identify a moderate increased risk of specific congenital anomalies. Copyright © 2015 John Wiley & Sons, Ltd....
Glucagon-like peptide-1 analogues: An overview
Directory of Open Access Journals (Sweden)
Vishal Gupta
2013-01-01
Full Text Available Abnormalities of the incretin axis have been implicated in the pathogenesis of type 2 diabetes mellitus. Glucagon-like peptide-1 (GLP-1 and gastroinhibitory intestinal peptide constitutes >90% of all the incretin function. Augmentation of GLP-1 results in improvement of beta cell health in a glucose-dependant manner (post-prandial hyperglycemia and suppression of glucagon (fasting hyperglycemia, amongst other beneficial pleiotropic effects. Native GLP-1 has a very short plasma half-life and novel methods have been developed to augment its half life, such that its anti-hyperglycemic effects can be exploited. They can be broadly classified as exendin-based therapies (exenatide, exenatide once weekly, DPP-4-resistant analogues (lixisenatide, albiglutide, and analogues of human GLP-1 (liraglutide, taspoglutide. Currently, commercially available analogues are exenatide, exenatide once weekly, and liraglutide. This review aims to provide an overview of most GLP-1 analogues.
Energy Technology Data Exchange (ETDEWEB)
Mendo, C
1988-09-01
Most analogue simulators have evolved from SPICE. The history and description of SPICE-like simulators are given. From a mathematical formulation of the electronic circuit the following analysis are possible: DC, AC, transient, noise, distortion, Worst Case and Statistical.
Uncertainties and credibility building of safety analyses. Natural analogues
International Nuclear Information System (INIS)
Laciok, A.
2001-07-01
The substance of natural analogues and their studies is defined as a complementary method to laboratory and in-situ experiments and modelling. The role of natural analogues in the processes of development of repositories is defined, mainly in performance assessment of repository system and communication with public. The criteria for identification of natural analogues which should be evaluated in the phase of initiation of new studies are specified. Review part of this report is divided to study of natural analogues and study of anthropogenic and industrial analogues. The main natural analogue studies performed in various countries, in different geological setting, with various aims are characterized. New results acquired in recently finished studies are included: Palmottu (2nd phase of project financed by European Commission), Oklo (results of research financed also by European Commission), Maqarin (3rd phase) and other information obtained from last meetings and workshops of NAWG. In view of the fact that programmes of development of deep repositories in Czech and Slovak Republics are interconnected, the natural analogues studies carried out in the Czech republic are incorporated in separate chapter - study of uranium accumulation in Tertiary clays at Ruprechtov site and study of degradation of natural glasses. In final part the areas of natural analogue studies as an integral part of development of deep geological repository are proposed along with characterization of broader context and aspects of realization of these studies (international cooperation, preparation and evaluation of procedures, communication with public). (author)
DEFF Research Database (Denmark)
1997-01-01
The present invention relates to new compounds being structurally and functionally similar to Actinomycin D and to combinatorial libraries of such compounds. The Actinomycin D analogues according to the present invention comprise two linear or cyclic peptide moieties constituted by $g...
Introduction to electronic analogue computers
Wass, C A A
1965-01-01
Introduction to Electronic Analogue Computers, Second Revised Edition is based on the ideas and experience of a group of workers at the Royal Aircraft Establishment, Farnborough, Hants. This edition is almost entirely the work of Mr. K. C. Garner, of the College of Aeronautics, Cranfield. As various advances have been made in the technology involving electronic analogue computers, this book presents discussions on the said progress, including some acquaintance with the capabilities of electronic circuits and equipment. This text also provides a mathematical background including simple differen
In vitro structure-activity relationship of Re-cyclized octreotide analogues
Energy Technology Data Exchange (ETDEWEB)
Dannoon, Shorouk F. [Department of Chemistry, University of Missouri, Columbia, MO 65211 (United States); Bigott-Hennkens, Heather M. [Department of Veterinary Medicine and Surgery, University of Missouri, Columbia, MO 65211 (United States); Ma Lixin [Department of Radiology, University of Missouri, Columbia, MO 65211 (United States); International Institute of Nano and Molecular Medicine, University of Missouri, Columbia, MO 65211 (United States); Nuclear Science and Engineering Institute, University of Missouri, Columbia, MO 65211 (United States); Research Service, Harry S. Truman Memorial Veterans' Hospital, Columbia, MO 65201 (United States); Gallazzi, Fabio [Structural Biology Core, University of Missouri, Columbia, MO 65211 (United States); Lewis, Michael R., E-mail: lewismic@missouri.ed [Department of Veterinary Medicine and Surgery, University of Missouri, Columbia, MO 65211 (United States); Department of Radiology, University of Missouri, Columbia, MO 65211 (United States); Nuclear Science and Engineering Institute, University of Missouri, Columbia, MO 65211 (United States); Research Service, Harry S. Truman Memorial Veterans' Hospital, Columbia, MO 65201 (United States); Jurisson, Silvia S., E-mail: jurissons@missouri.ed [Department of Chemistry, University of Missouri, Columbia, MO 65211 (United States); Department of Radiology, University of Missouri, Columbia, MO 65211 (United States); Nuclear Science and Engineering Institute, University of Missouri, Columbia, MO 65211 (United States)
2010-07-15
Introduction: Development of radiolabeled octreotide analogues is of interest for targeting somatostatin receptor (SSTR)-positive tumors for diagnostic and therapeutic purposes. We are investigating a direct labeling approach for incorporation of a Re ion into octreotide analogues, where the peptide sequences are cyclized via coordination to Re rather than through a disulfide bridge. Methods: Various octreotide analogue sequences and coordination systems (e.g., S{sub 2}N{sub 2} and S{sub 3}N) were synthesized and cyclized with nonradioactive Re. In vitro competitive binding assays with {sup 111}In-DOTA-Tyr{sup 3}-octreotide in AR42J rat pancreatic tumor cells yielded IC{sub 50} values as a measure of SSTR affinity of the Re-cyclized analogues. Three-dimensional structures of Re-cyclized Tyr{sup 3}-octreotate and its disulfide-bridged analogue were calculated from two-dimensional NMR experiments to visualize the effect of metal cyclization on the analogue's pharmacophore. Results: Only two of the 11 Re-cyclized analogues investigated showed moderate in vitro binding affinity toward somatostatin subtype 2 receptors. Three-dimensional molecular structures of Re- and disulfide-cyclized Tyr{sup 3}-octreotate were calculated, and both of their pharmacophore turns appear to be very similar with minor differences due to metal coordination to the amide nitrogen of one of the pharmacophore amino acids. Conclusions: Various Re-cyclized analogues were developed and analogue 4 had moderate affinity toward somatostatin subtype 2 receptors. In vitro stable studies that are in progress showed stable radiometal cyclization of octreotide analogues via NS{sub 3} and N{sub 2}S{sub 2} coordination forming five- and six-membered chelate rings. In vivo biodistribution studies are underway of {sup 99m}Tc-cyclized analogue 4.
A novel lunar bed rest analogue.
Cavanagh, Peter R; Rice, Andrea J; Licata, Angelo A; Kuklis, Matthew M; Novotny, Sara C; Genc, Kerim O; Englehaupt, Ricki K; Hanson, Andrea M
2013-11-01
Humans will eventually return to the Moon and thus there is a need for a ground-based analogue to enable the study of physiological adaptations to lunar gravity. An important unanswered question is whether or not living on the lunar surface will provide adequate loading of the musculoskeletal system to prevent or attenuate the bone loss that is seen in microgravity. Previous simulations have involved tilting subjects to an approximately 9.5 degrees angle to achieve a lunar gravity component parallel to the long-axis of the body. However, subjects in these earlier simulations were not weight-bearing, and thus these protocols did not provide an analogue for load on the musculoskeletal system. We present a novel analogue which includes the capability to simulate standing and sitting in a lunar loading environment. A bed oriented at a 9.5 degrees angle was mounted on six linear bearings and was free to travel with one degree of freedom along rails. This allowed approximately 1/6 body weight loading of the feet during standing. "Lunar" sitting was also successfully simulated. A feasibility study demonstrated that the analogue was tolerated by subjects for 6 d of continuous bed rest and that the reaction forces at the feet during periods of standing were a reasonable simulation of lunar standing. During the 6 d, mean change in the volume of the quadriceps muscles was -1.6% +/- 1.7%. The proposed analogue would appear to be an acceptable simulation of lunar gravity and deserves further exploration in studies of longer duration.
Causal structure of analogue spacetimes
International Nuclear Information System (INIS)
Barcelo, Carlos; Liberati, Stefano; Sonego, Sebastiano; Visser, Matt
2004-01-01
The so-called 'analogue models of general relativity' provide a number of specific physical systems, well outside the traditional realm of general relativity, that nevertheless are well-described by the differential geometry of curved spacetime. Specifically, the propagation of perturbations in these condensed matter systems is described by 'effective metrics' that carry with them notions of 'causal structure' as determined by an exchange of quasi-particles. These quasi-particle-induced causal structures serve as specific examples of what can be done in the presence of a Lorentzian metric without having recourse to the Einstein equations of general relativity. (After all, the underlying analogue model is governed by its own specific physics, not necessarily by the Einstein equations.) In this paper we take a careful look at what can be said about the causal structure of analogue spacetimes, focusing on those containing quasi-particle horizons, both with a view to seeing what is different from standard general relativity, and what the similarities might be. For definiteness, and because the physics is particularly simple to understand, we will phrase much of the discussion in terms of acoustic disturbances in moving fluids, where the underlying physics is ordinary fluid mechanics, governed by the equations of traditional hydrodynamics, and the relevant quasi-particles are the phonons. It must however be emphasized that this choice of example is only for the sake of pedagogical simplicity and that our considerations apply generically to wide classes of analogue spacetimes
Natural analogues and radionuclide transport model validation
International Nuclear Information System (INIS)
Lever, D.A.
1987-08-01
In this paper, some possible roles for natural analogues are discussed from the point of view of those involved with the development of mathematical models for radionuclide transport and with the use of these models in repository safety assessments. The characteristic features of a safety assessment are outlined in order to address the questions of where natural analogues can be used to improve our understanding of the processes involved and where they can assist in validating the models that are used. Natural analogues have the potential to provide useful information about some critical processes, especially long-term chemical processes and migration rates. There is likely to be considerable uncertainty and ambiguity associated with the interpretation of natural analogues, and thus it is their general features which should be emphasized, and models with appropriate levels of sophistication should be used. Experience gained in modelling the Koongarra uranium deposit in northern Australia is drawn upon. (author)
International Nuclear Information System (INIS)
Ahonen, L.; Blomqvist, R.; Suksi, J.
1993-01-01
The report gives a summary of the results of investigations carried out in 1992 at the Palmottu natural analogue study site, which is a small U-Th mineralization in Nummi-Pusula, southwestern Finland. Additionally, the report includes several separate articles dealing with various aspects of the Palmottu Analogue Project: (1) deep groundwater flow, (2) interpretation of hydraulic connections, (3) characterization of groundwater colloids, (4) uranium mineral-groundwater equilibrium, (5) water-rock interaction and (6) modelling of in situ matrix diffusion. The Palmottu Analogue Project aims at a more profound understanding of radionuclide transport processes in fractured crystalline bedrock. The essential factors controlling transport are groundwater flow and interaction between water and rock. Accordingly, the study includes (1) structural interpretations partly based on geophysical measurements, (2) hydrological studies including hydraulic drill-hole measurements, (3) flow modelling, (4) hydrogeochemical characterization of groundwater, uranium chemistry and colloid chemistry, (5) mineralogical studies, (6) geochemical interpretation and modelling, (7) studies of radionuclide mobilization and retardation including matrix diffusion, and (8) modelling of uranium series data. Palaeohydrogeological aspects, due to the anticipated future glaciation of the Fennoscandian Shield, are of special interest. Quaternary sediments are studied to gain information on post-glacial migration in the overburden. (orig.)
Directory of Open Access Journals (Sweden)
Bryan L Roth
Full Text Available In this paper we determined the pharmacological profiles of novel ketamine and phencyclidine analogues currently used as 'designer drugs' and compared them to the parent substances via the resources of the National Institute of Mental Health Psychoactive Drug Screening Program. The ketamine analogues methoxetamine ((RS-2-(ethylamino-2-(3-methoxyphenylcyclohexanone and 3-MeO-PCE (N-ethyl-1-(3-methoxyphenylcyclohexanamine and the 3- and 4-methoxy analogues of phencyclidine, (1-[1-(3-methoxyphenylcyclohexyl]piperidine and 1-[1-(4-methoxyphenylcyclohexyl]piperidine, were all high affinity ligands for the PCP-site on the glutamate NMDA receptor. In addition methoxetamine and PCP and its analogues displayed appreciable affinities for the serotonin transporter, whilst the PCP analogues exhibited high affinities for sigma receptors. Antagonism of the NMDA receptor is thought to be the key pharmacological feature underlying the actions of dissociative anaesthetics. The novel ketamine and PCP analogues had significant affinities for the NMDA receptor in radioligand binding assays, which may explain their psychotomimetic effects in human users. Additional actions on other targets could be important for delineating side-effects.
Application of natural analogues in the Yucca Mountain project - overview
International Nuclear Information System (INIS)
Simmons, Ardyth M.
2003-01-01
The Natural Analogue Synthesis Report (NASR) [1] provides a compilation of information from analogues that test, corroborate, and add confidence to process models and model predictions pertinent to total system performance assessment (TSPA). The report updated previous work [2] with new literature examples and results of quantitative studies conducted by the Yucca Mountain Project (YMP). The intent of the natural analogue studies was to collect corroborative evidence from analogues to demonstrate greater understanding of processes expected to occur during postclosure of a proposed Yucca Mountain repository. Natural analogues, as used here, refer to either natural or anthropogenic systems in which processes similar to those expected to occur in a nuclear waste repository are thought to have occurred over long time periods (decades to millenia) and large spatial scales (up to tens of kilometers). In the past, the YMP has used analogues for testing and building confidence in conceptual and numerical process models in a number of ways. Yucca Mountain mineral alteration phases provided a self-analogue for postclosure alteration [3]. Thermodynamic parameters for silica minerals of the Wairakai, New Zealand geothermal field were added to databases used in geochemical modeling [4]. Scoping calculations of radionuclide transport using the Yucca Mountain TSPA numerical model were conducted for the Peqa Blanca site [5]. Eruption parameters from the Cerro Negro volcano, Nicaragua, were used to verify codes that model ash plume dispersion [6]. Analogues have also been used in supplemental science and performance analyses to provide multiple lines of evidence in support of both analyses and model reports (AMRs) [7]; in screening arguments for inclusion or exclusion of features, events, and processes (FEP)s in TSPAs; in the quantification of uncertainties [7]; in expert elicitations of volcanic and seismic hazards [8, 9] and in peer reviews [10]. Natural analogues may be applied
Synthesis and anticancer evaluation of spermatinamine analogues
Moosa, Basem
2016-02-04
Spermatinamine was isolated from an Australian marine sponge, Pseudoceratina sp. as an inhibitor of isoprenylcystiene carboxyl methyltransferase (Icmt), an attractive and novel anticancer target. Herein, we report the synthesis of spermatinamine analogues and their cytotoxic evaluation against three human cancer cell lines i.e. cervix adenocarcinoma (HeLa), breast adenocarcinoma (MCF-7), and prostate carcinoma (DU145). Analogues 12, 14 and 15 were found to be the most potent against one or more cell lines with the IC50 values in the range of 5 - 10 μM. The obtained results suggested that longer polyamine linker along with aromatic oxime substitution provided the most potent analogue compounds against cancer cell lines.
Conformationally restrained aromatic analogues of fosmidomycin and FR900098.
Kurz, Thomas; Schlüter, Katrin; Pein, Miriam; Behrendt, Christoph; Bergmann, Bärbel; Walter, Rolf D
2007-07-01
The synthesis and in-vitro antimalarial activity of conformationally restrained bis(pivaloyloxymethyl) ester analogues of the natural product fosmidomycin is presented. In contrast to alpha-aryl-substituted analogues, conformationally restrained aromatic analogues exhibit only moderate in-vitro antimalarial activity against the chloroquine-sensitive strain 3D7 of Plasmodium falciparum. The most active derivative displays an IC(50) value of 47 microM.
Lindenmayer, A; Schoen, H F
1967-08-01
The initiation of perithecia in the homothallic ascomycete Sordaria fimicola was completely suppressed, without seriously inhibiting vegetative growth, by growing the fungus on an agar medium containing one of the following additions: 1) 1 mum 5-fluorouracil, 2) 10 to 100 mum 6-azauracil, 8-azaguanine or 8-azaadenine, 3) 50 to 500 mum cyanide or azide, 4) 5% (w/v) casein hydrolysate. In contrast to the selective activity of the analogues of 3 RNA bases, whose inhibition could be reversed by the appropriate normal bases only, none of the analogues of thymine were active, neither were the thio-derivatives of RNA bases. Other inhibitors of RNA and protein synthesis, like actinomycin D, puromycin and cycloheximide, were also without selective activity, although the last of these inhibited perithecial maturation at 0.1 mum concentration but not initiation. Amino acid analogues were inactive, as were the metabolic inhibitors thiourea, 2,4-dinitrophenol and fluoride. The compounds which inhibited the formation of perithecia also lowered the branching frequency of leading hyphae, but not their linear growth rates. Consequently, the branch densities were diminished in their presence. Hypotheses to account for these findings are discussed in terms of inhibition of growth in general, of the synthesis of some specific messenger RNAs, and of RNA-mediated transport across membranes, the last of which seeming the most fruitful for further work.
Directory of Open Access Journals (Sweden)
Pedersen Niels C
2007-04-01
Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be
Directory of Open Access Journals (Sweden)
G. Ibarra-Berastegi
2011-06-01
Full Text Available In this paper, reanalysis fields from the ECMWF have been statistically downscaled to predict from large-scale atmospheric fields, surface moisture flux and daily precipitation at two observatories (Zaragoza and Tortosa, Ebro Valley, Spain during the 1961–2001 period. Three types of downscaling models have been built: (i analogues, (ii analogues followed by random forests and (iii analogues followed by multiple linear regression. The inputs consist of data (predictor fields taken from the ERA-40 reanalysis. The predicted fields are precipitation and surface moisture flux as measured at the two observatories. With the aim to reduce the dimensionality of the problem, the ERA-40 fields have been decomposed using empirical orthogonal functions. Available daily data has been divided into two parts: a training period used to find a group of about 300 analogues to build the downscaling model (1961–1996 and a test period (1997–2001, where models' performance has been assessed using independent data. In the case of surface moisture flux, the models based on analogues followed by random forests do not clearly outperform those built on analogues plus multiple linear regression, while simple averages calculated from the nearest analogues found in the training period, yielded only slightly worse results. In the case of precipitation, the three types of model performed equally. These results suggest that most of the models' downscaling capabilities can be attributed to the analogues-calculation stage.
Sanyal, A J; Boyer, T D; Frederick, R T; Wong, F; Rossaro, L; Araya, V; Vargas, H E; Reddy, K R; Pappas, S C; Teuber, P; Escalante, S; Jamil, K
2017-06-01
The goal of hepatorenal syndrome type 1 (HRS-1) treatment is to improve renal function. Terlipressin, a synthetic vasopressin analogue, is a systemic vasoconstrictor used for the treatment of HRS-1, where it is available. To compare the efficacy of terlipressin plus albumin vs. placebo plus albumin in patients with HRS-1. Pooled patient-level data from two large phase 3, randomised, placebo-controlled studies were analysed for HRS reversal [serum creatinine (SCr) value ≤133 μmol/L], 90-day survival, need for renal replacement therapy and predictors of HRS reversal. Patients received intravenous terlipressin 1-2 mg every 6 hours plus albumin or placebo plus albumin up to 14 days. The pooled analysis comprised 308 patients (terlipressin: n = 153; placebo: n = 155). HRS reversal was significantly more frequent with terlipressin vs. placebo (27% vs. 14%; P = 0.004). Terlipressin was associated with a more significant improvement in renal function from baseline until end of treatment, with a mean between-group difference in SCr concentration of -53.0 μmol/L (P albumin resulted in a significantly higher rate of HRS reversal vs. albumin alone in patients with HRS-1. Terlipressin treatment is associated with improved renal function. (ClinicalTrials.gov identifier: OT-0401, NCT00089570; REVERSE, NCT01143246). © 2017 The Authors. Alimentary Pharmacology and Therapeutics published by John Wiley & Sons Ltd.
U.S. Nuclear Regulatory Commission natural analogue research program
International Nuclear Information System (INIS)
Kovach, L.A.; Ott, W.R.
1995-01-01
This article describes the natural analogue research program of the U.S. Nuclear Regulatory Commission (US NRC). It contains information on the regulatory context and organizational structure of the high-level radioactive waste research program plan. It also includes information on the conditions and processes constraining selection of natural analogues, describes initiatives of the US NRC, and describes the role of analogues in the licensing process
Insulin analogues and cancer: a note of caution
Directory of Open Access Journals (Sweden)
Joseph A.M.J.L. eJanssen
2014-05-01
Full Text Available Abstract In view of the lifelong exposure and large patient populations involved, insulin analogues with an increased mitogenic effect in comparison to human insulin may potentially constitute a major health problem, since these analogues may possibly induce the growth of pre-existing neoplasms. At present, the available data suggest that insulin analogues are safe. In line with these findings, we observed that serum of diabetic patients treated with insulin analogues, compared to that of diabetic patients treated with human insulin, did not induce an increased phosphorylation of tyrosine residues of the insulin-like growth factor-I receptor (IGF-IR. However, the classical model of the IGF-IR signaling may be insufficient to explain (all mitogenic effects of insulin analogues since also non-canonical signaling pathways of the IGF-IR may play a major role in this respect. Although phosphorylation of tyrosine residues of the IGF-IR is generally considered to be the initial activation step within the intracellular IGF-IR signaling pathway, it has been found that cells undergo a signaling switch under hyperglycemic conditions. After this switch, a completely different mechanism is utilized to activate the mitogenic (mitogen-activated protein kinase (MAPK pathways of the IGF-IR that is independent from tyrosine phosphorylation of the IGF-IR. At present it is unknown whether activation of this alternative intracellular pathway of the IGF-IR occurs during hyperglycemia in vivo and whether it is stronger in patients treated with (some insulin analogues than in patients treated with human insulin. In addition, it is unknown whether the insulin receptors (IRs also undergo a signaling switch during hyperglycemia. This should be investigated in future studies. Finally, relative overexpression of IR isoform A (IR-A in (pre cancer tissues may play a key role in the development and progression of human cancers during treatment with insulin (analogues. Further
Characterisation of insulin analogues therapeutically available to patients
Adams, Gary G.
2018-03-29
The structure and function of clinical dosage insulin and its analogues were assessed. This included \\'native insulins\\' (human recombinant, bovine, porcine), \\'fast-acting analogues\\' (aspart, glulisine, lispro) and \\'slow-acting analogues\\' (glargine, detemir, degludec). Analytical ultracentrifugation, both sedimentation velocity and equilibrium experiments, were employed to yield distributions of both molar mass and sedimentation coefficient of all nine insulins. Size exclusion chromatography, coupled to multi-angle light scattering, was also used to explore the function of these analogues. On ultracentrifugation analysis, the insulins under investigation were found to be in numerous conformational states, however the majority of insulins were present in a primarily hexameric conformation. This was true for all native insulins and two fast-acting analogues. However, glargine was present as a dimer, detemir was a multi-hexameric system, degludec was a dodecamer (di-hexamer) and glulisine was present as a dimer-hexamer-dihexamer system. However, size-exclusion chromatography showed that the two hexameric fast-acting analogues (aspart and lispro) dissociated into monomers and dimers due to the lack of zinc in the mobile phase. This comprehensive study is the first time all nine insulins have been characterised in this way, the first time that insulin detemir have been studied using analytical ultracentrifugation and the first time that insulins aspart and glulisine have been studied using sedimentation equilibrium. The structure and function of these clinically administered insulins is of critical importance and this research adds novel data to an otherwise complex functional physiological protein.
Fungal growth inhibitory properties of new phytosphingolipid analogues.
Mormeneo, D; Manresa, A; Casas, J; Llebaria, A; Delgado, A
2008-04-01
To study the growth inhibitory properties of a series of phytosphingosine (PHS) and phytoceramide (PHC) analogues. A panel of two yeast (Candida albicans and Saccharomyces cerevisiae) and six moulds (Aspergillus repens, Aspergillus niger, Penicillium chrysogenum, Cladosporium cladosporioides, Arthroderma uncinatum and Penicillium funiculosum) has been used in this study. A series of new PHS and PHC analogues differing at the sphingoid backbone and the functional group at C1 position were synthesized. Among PHS analogues, 1-azido derivative 1c, bearing the natural D-ribo stereochemistry, showed a promising growth inhibitory profile. Among PHC analogues, compound 12, with a bulky N-pivaloyl group and a Z double bond at C3 position of the sphingoid chain, was the most active growth inhibitor. Minimal inhibitory concentration values were in the range of 23-48 micromol l(-1) for 1c and 44-87 micromol l(-1) for 12. Only scattered data on the antifungal activity of phytosphingolipids have been reported in the literature. This is the first time that a series of analogues of this kind are tested and compared to discern their structural requirements for antifungal activity.
Management of HIV During Pregnancy
Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M
2016-01-01
According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...
CO2 Capture with Enzyme Synthetic Analogue
Energy Technology Data Exchange (ETDEWEB)
Cordatos, Harry
2010-11-08
Overview of an ongoing, 2 year research project partially funded by APRA-E to create a novel, synthetic analogue of carbonic anhydrase and incorporate it into a membrane for removal of CO2 from flue gas in coal power plants. Mechanism background, preliminary feasibility study results, molecular modeling of analogue-CO2 interaction, and program timeline are provided.
Insulin analogues with improved absorption characteristics.
Brange, J; Hansen, J F; Langkjaer, L; Markussen, J; Ribel, U; Sørensen, A R
1992-01-01
The insulin preparations available today are not ideal for therapy as s.c. injection does not provide a physiological insulin profile. With the aim to improve the absorption properties recombinant DNA technology has been utilized to design novel insulin molecules with changed physico-chemical characteristics and hence altered subcutaneous absorption kinetics. Soluble, long-acting human insulin analogues in which the isoelectric point has been increased from 5.4 to approx. 7 are absorbed very slowly, providing a more constant basal insulin delivery with lower day-to-day variation than present protracted preparations. In addition they have better storage stability. Rapid-acting human insulin analogues with largely reduced self-association are absorbed substantially faster from subcutaneous tissue than current regular insulin and thus are better suited for bolus injection. The absorption kinetics of these analogues have been able to explain the mechanism behind the dose effect on insulin absorption rate.
Colour break in reverse bicolour daffodils is associated with the presence of Narcissus mosaic virus
Directory of Open Access Journals (Sweden)
Davies Kevin M
2011-08-01
Full Text Available Abstract Background Daffodils (Narcissus pseudonarcissus are one of the world's most popular ornamentals. They also provide a scientific model for studying the carotenoid pigments responsible for their yellow and orange flower colours. In reverse bicolour daffodils, the yellow flower trumpet fades to white with age. The flowers of this type of daffodil are particularly prone to colour break whereby, upon opening, the yellow colour of the perianth is observed to be 'broken' into patches of white. This colour break symptom is characteristic of potyviral infections in other ornamentals such as tulips whose colour break is due to alterations in the presence of anthocyanins. However, reverse bicolour flowers displaying colour break show no other virus-like symptoms such as leaf mottling or plant stunting, leading some to argue that the carotenoid-based colour breaking in reverse bicolour flowers may not be caused by virus infection. Results Although potyviruses have been reported to cause colour break in other flower species, enzyme-linked-immunoassays with an antibody specific to the potyviral family showed that potyviruses were not responsible for the occurrence of colour break in reverse bicolour daffodils. Colour break in this type of daffodil was clearly associated with the presence of large quantities of rod-shaped viral particles of lengths 502-580 nm in tepals. Sap from flowers displaying colour break caused red necrotic lesions on Gomphrena globosa, suggesting the presence of potexvirus. Red necrotic lesions were not observed in this indicator plant when sap from reverse bicolour flowers not showing colour break was used. The reverse transcriptase polymerase reactions using degenerate primers to carla-, potex- and poty-viruses linked viral RNA with colour break and sequencing of the amplified products indicated that the potexvirus Narcissisus mosaic virus was the predominant virus associated with the occurrence of the colour break
Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B
1993-08-01
Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.
Natural analogue working group
International Nuclear Information System (INIS)
Come, B.; Chapman, N.
1986-01-01
A Natural Analogue Working Group was established by the Commission of the European Communities in 1985. The purpose of this group is to bring together modellers with earth scientists and others, so that maximum benefit can be obtained from natural analogue studies with a view to safe geological disposal of radioactive waste. The first meeting of this group was held in Brussels from November 5 to 7, 1985. The discussions mainly concerned the identification of the modellers' needs and of the earth scientists' capacity to provide for them. Following the debates, a written statement was produced by the Group; this document forms the core of the present Report. Notes and outlines of many of the presentations made are grouped in four appendixes. The valuable contribution of all those involved in the meeting is gratefully acknowledged
Segal, Meirav; Fischer, Bilha
2012-02-28
Uridine cannot be utilized as fluorescent probe due to its extremely low quantum yield. For improving the uracil fluorescence characteristics we extended the natural chromophore at the C5 position by coupling substituted aromatic rings directly or via an alkenyl or alkynyl linker to create fluorophores. Extension of the uracil base was achieved by treating 5-I-uridine with the appropriate boronic acid under the Suzuki coupling conditions. Analogues containing an alkynyl linker were obtained from 5-I-uridine and the suitable boronic acid in a Sonogashira coupling reaction. The uracil fluorescent analogues proposed here were designed to satisfy the following requirements: a minimal chemical modification at a position not involved in base-pairing, resulting in relatively long absorption and emission wavelengths and high quantum yield. 5-((4-Methoxy-phenyl)-trans-vinyl)-2'-deoxy-uridine, 6b, was found to be a promising fluorescent probe. Probe 6b exhibits a quantum yield that is 3000-fold larger than that of the natural chromophore (Φ 0.12), maximum emission (478 nm) which is 170 nm red shifted as compared to uridine, and a Stokes shift of 143 nm. In addition, since probe 6b adopts the anti conformation and S sugar puckering favored by B-DNA, it makes a promising nucleoside analogue to be incorporated in an oligonucleotide probe for detection of genetic material.
A Low-cost Multi-channel Analogue Signal Generator
Müller, F; The ATLAS collaboration; Shen, W; Stamen, R
2009-01-01
A scalable multi-channel analogue signal generator is presented. It uses a commercial low-cost graphics card with multiple outputs in a standard PC as signal source. Each color signal serves as independent channel to generate an analogue signal. A custom-built external PCB was developed to adjust the graphics card output voltage levels for a specific task, which needed differential signals. The system furthermore comprises a software package to program the signal shape. The signal generator was successfully used as independent test bed for the ATLAS Level-1 Trigger Pre-Processor, providing up to 16 analogue signals.
Synthesis of an Orthogonal Topological Analogue of Helicene
DEFF Research Database (Denmark)
Wixe, Torbjörn; Wallentin, Carl‐Johan; Johnson, Magnus T.
2013-01-01
The synthesis of an orthogonal topological pentamer analogue of helicene is presented. This analogue forms a tubular structure with its aromatic systems directed parallel to the axis of propagation, which creates a cavity with the potential to function as a host molecule. The synthetic strategy r...
The history of antiretrovirals: key discoveries over the past 25 years.
De Clercq, Erik
2009-09-01
Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.
Dijken, Peter van; Lammers, Aleida A.; Ozaki, Shoichiro; Potter, Barry V.L.; Erneux, Christophe; Haastert, Peter J.M. van
1994-01-01
A series of P-32-labeled D-myo-inositol 1,3,4,5-tetrakisphosphate [Ins(1,3,4,5)P-4] analogues was enzymically prepared from the corresponding D-myo-inositol 1,4,5-trisphosphate [Ins(1,4,5)P-3] analogues using recombinant rat brain Ins(1,4,5)P-3 3-kinase and [gamma-P-32]ATP. Ins(1,4,5)P-3 analogues
On the robustness of entanglement in analogue gravity systems
International Nuclear Information System (INIS)
Bruschi, D E; Friis, N; Fuentes, I; Weinfurtner, S
2013-01-01
We investigate the possibility of generating quantum-correlated quasi-particles utilizing analogue gravity systems. The quantumness of these correlations is a key aspect of analogue gravity effects and their presence allows for a clear separation between classical and quantum analogue gravity effects. However, experiments in analogue systems, such as Bose–Einstein condensates (BECs) and shallow water waves, are always conducted at non-ideal conditions, in particular, one is dealing with dispersive media at non-zero temperatures. We analyse the influence of the initial temperature on the entanglement generation in analogue gravity phenomena. We lay out all the necessary steps to calculate the entanglement generated between quasi-particle modes and we analytically derive an upper bound on the maximal temperature at which given modes can still be entangled. We further investigate a mechanism to enhance the quantum correlations. As a particular example, we analyse the robustness of the entanglement creation against thermal noise in a sudden quench of an ideally homogeneous BEC, taking into account the super-sonic dispersion relations. (paper)
A preliminary feasibility study on natural analogue in Korea
Energy Technology Data Exchange (ETDEWEB)
Kim, Chun Soo; Bae, Dae Seok; Kim, Kyung Su; Koh, Yong Kwon; Park, Byung Yun
2000-03-01
Preliminary study on the assessment of natural analogue study in Korea for the deep geological disposal of high-level radioactive waste was carried out. The project on natural analogue study in other countries are introduced. The uranium-bearing deposit in Okcheon belt are summarized, which reported to be uranium-bearing minerals in order to assess to feasibility for natural analogue study in Korea. Among the uranium-bearing deposits, the Deokpyeong area, reported to be the highest reservoir and grade, are selected as the study site, and the elementary investigation, including survey of radioactivity and geochemistry are carried out. According to the investigation of surface environment, the radioactivity and uranium content in the surface water and shallow groundwater does not show any anormal values. However, the radioactivity is expected to be increased in depth and the groundwater reacted with uranium-bearing graphite formation shows high unanium content, indicating the potential possibility for natural analogue study in Korea. In future, if more detail study are performed, the assessment of natural analogue study in Korea are expected.
Analogue Signal Processing: Collected Papers 1994-95
DEFF Research Database (Denmark)
1996-01-01
This document is a collection of the papers presented at international conferences and in international journals by the analogue signal processing group of Electronics Institute, Technical University of Denmark, in 1994 and 1995.......This document is a collection of the papers presented at international conferences and in international journals by the analogue signal processing group of Electronics Institute, Technical University of Denmark, in 1994 and 1995....
A chemoselective and continuous synthesis of m-sulfamoylbenzamide analogues
Directory of Open Access Journals (Sweden)
Arno Verlee
2017-02-01
Full Text Available For the synthesis of m-sulfamoylbenzamide analogues, small molecules which are known for their bioactivity, a chemoselective procedure has been developed starting from m-(chlorosulfonylbenzoyl chloride. Although a chemoselective process in batch was already reported, a continuous-flow process reveals an increased selectivity at higher temperatures and without catalysts. In total, 15 analogues were synthesized, using similar conditions, with yields ranging between 65 and 99%. This is the first automated and chemoselective synthesis of m-sulfamoylbenzamide analogues.
On Using Current Steering Logic in Mixed Analogue-digital Circuits
DEFF Research Database (Denmark)
Lehmann, Torsten
1998-01-01
The authors investigate power supply noise in mixed analogue-digital circuits, arising from communication between the analogue and digital parts of the circuit. Current steering techniques and proper buffering are used to show which noise currents can be reduced and which cannot. In addition......, a high-swing current steering buffer for driving analogue switches or external digital signals is proposed....
UK Natural Analogue Coordinating Group: fourth annual report
International Nuclear Information System (INIS)
Read, D.; Hooker, P.J.
1992-01-01
HMIP has a research programme investigating some naturally radioactive sites as geochemical analogues of radionuclide migration. All of the analogue sites under investigation, both in the U.K. and overseas, are located where elevated uranium concentrations occur naturally. Coordination of the programme is achieved through the UK Natural Analogue Co-ordinating Group (NACG) which has met three times in this reporting period. The NACG is steered by the British Geological Survey. Its purpose is to ensure that the different research projects have an integrated function aimed at increasing our understanding of natural geochemical processes. Effort is also being expended in testing research models which may be used in such assessments. (author)
International Nuclear Information System (INIS)
Lin, C.W.; Grant, D.; Bianchi, B.; Miller, T.; Witte, D.; Shue, Y.K.; Nadzan, A.
1986-01-01
Cholecystokinin (CCK) peptides are a family of hormones which also occur in brain. In pancreas CCK stimulates the release of amylase, a process that is dependent on the mobilization of intracellular Ca 2+ . Recent evidence suggests that inositol 1,4,5-trisphosphate, the breakdown product of phosphatidylinositol 4,5-bisphosphate, is responsible for the rise in intracellular Ca 2+ . Their laboratory has developed assays to study synthetic CCK analogues using radioligand binding, PI breakdown and amylase release. They have shown that there are good correlations among these three assay systems for the carboxy terminal fragments of CCK 8 . Recently, they have discovered synthetic analogues of CCK 4 that are full agonists in amylase release but are ineffective in causing PI breakdown. In particular, A-61576, Boc-5-amino-2-indolemethylene-pent-2-ene-1-oyl-Leu-Asp-Phe-NH 2 , is a full agonist in the amylase releasing assay, but is devoid of PI stimulating activity. A-61576 completely reverses the stimulation of PI response induced by CCK 8 , indicative of an antagonist. Since a mechanism other than the PI breakdown is responsible for amylase release by A-61576, they suggest that separate receptors are responsible for PI breakdown and amylase release
Diab, Roudayna; Jordheim, Lars P; Degobert, Ghania; Peyrottes, Suzanne; Périgaud, Christian; Dumontet, Charles; Fessi, Hatem
2009-01-01
Bis(tbutyl-S-acyl-2-thioethyl)-cytidine monophosophate is a new cytotoxic mononucleotide prodrug which have been developed to reverse the cellular resistance to nucleoside analogues. Unfortunately, its in vivo utilisation was hampered by its poor water solubility, raising the need of a molecular vector capable to mask its physicochemical characteristics although without affecting its cytotoxic activity. Hydroxypropyl-beta-cyclodextrin was used to prepare the prodrug inclusion complexes, allowing it to be solubilized in water and hence to be used for in vitro and in vivo experiments. A molar ratio of the cyclodextrin: prodrug of 3 was sufficient to obtain complete solubilization of the prodrug. The inclusion complex was characterized by differential scanning calorimetry, which revealed the disappearance of the melting peak of the prodrug suggesting the formation of inclusion complex. Proton Nuclear Magnetic Resonance spectroscopy provided a definitive proof of the inclusion complex formation, which was evidenced by the large chemical shift displacements observed for protons located in the interior of the hydrophobic cyclodextrin cavity. The complex retained its cytotoxic activity as shown by in vitro cell survival assays on murine leukemia cells. These results provided a basis for potential therapeutic applications of co-formulation of this new nucleotide analogue with hydroxypropyl-beta-CD in cancer therapy.
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
Analogue computer display of accelerator beam optics
International Nuclear Information System (INIS)
Brand, K.
1984-01-01
Analogue computers have been used years ago by several authors for the design of magnetic beam handling systems. At Bochum a small analogue/hybrid computer was combined with a particular analogue expansion and logic control unit for beam transport work. This apparatus was very successful in the design and setup of the beam handling system of the tandem accelerator. The center of the stripper canal was the object point for the calculations, instead of the high energy acceleration tube a drift length was inserted into the program neglecting the weak focusing action of the tube. In the course of the installation of a second injector for heavy ions it became necessary to do better calculations. A simple method was found to represent accelerating sections on the computer and a particular way to simulate thin lenses was adopted. The analogue computer system proved its usefulness in the design and in studies of the characteristics of different accelerator installations over many years. The results of the calculations are in very good agreement with real accelerator data. The apparatus is the ideal tool to demonstrate beam optics to students and accelerator operators since the effect of a change of any of the parameters is immediately visible on the oscilloscope
Analogue Signal Processing: Collected Papers 1996-97
DEFF Research Database (Denmark)
1997-01-01
This document is a collection of the papers presented at international conferences and in international journals by the analogue signal processing group of the Department of Information Technology, Technical University of Denmark, in 1996 and 1997.......This document is a collection of the papers presented at international conferences and in international journals by the analogue signal processing group of the Department of Information Technology, Technical University of Denmark, in 1996 and 1997....
Bazin, Marc-Antoine; El Kihel, Laïla; Boulouard, Michel; Bouët, Valentine; Rault, Sylvain
2009-11-01
Neurosteroids have been reported to modulate memory processes in rodents. Three analogues of dehydroepiandrosterone (DHEA), two of them previously described (7beta-aminoDHEA and 7beta-amino-17-ethylenedioxy-DHEA), and a new one (3beta-hydroxy-5alpha-androstane-6,17-dione) were synthesized, and their effects were evaluated on memory. This study examined their effects on long term and short term memory in male (6 weeks old) NMRI mice in comparison with the reference drug. Long term memory was assessed using the passive avoidance task and short term memory (spatial working memory) using the spontaneous alternation task in a Y maze. Moreover, the effects of DHEA and its analogues on spontaneous locomotion were measured. In all tests, DHEA and analogues were injected at three equimolar doses (0.300-1.350-6.075 microM/kg). DHEA and its three analogues administered immediately post-training at the highest doses (6.075 microM/kg, s.c.) improved retention in passive avoidance test. Without effect per se in the spatial working memory task, the four compounds failed to reverse scopolamine (1mg/kg, i.p.)-induced deficit in spontaneous alternation. These data suggested an action of DHEA and analogues in consolidation of long term memory particularly when emotional components are implied. Moreover, data indicated that pharmacological modulation of DHEA as performed in this study provides derivatives giving the same mnemonic profile than reference molecule.
Análogos de insulina Insulin analogues
Directory of Open Access Journals (Sweden)
Manuel E. Licea Puig
2006-12-01
diabetes mellitus (DM. The recombinant technology of deoxyribonucleic acid (DNA has allowed the development of human insulin; however, this has not totally solved the problems related to immunogenecity, among other problems. Therefore, the new technologies are applied to create insulin analogues. It is our purpose to review relevant pharmacological and clinical aspects related to the insulin analogues, as well as their usefulness in the treatment of DM. The insulin analogues result from biochemical modifications of human insulin. These modifications of the insulin molecule alter not only the absorption, but also the beginning and duration of the action, which offer advantages over the conventional insulins. At present, there are three rapid acting insulin analogues: insulin lispro, insulin aspart and glulisine; and three long acting analogues; glargine, detemir and albulin. Albulin is the latest long acting analogue reported. At present, it is being subjected to various in vitro and in vivo studies. Besides, there have been developed diverse formulations where the rapid acting insulin analogues are premixed with the long acting analogues. The rapid acting insulin analogues have showed a modest global benefit against the conventional insulins in type 1 diabetics. The long acting analogues focus their attention in those persons with DM with nocturnal hypoglycemic episodes. Longer term studies are necessary to confirm the safety and benefits of these preparations, as well as to determine their effect on the micro- and macroangiopathic complications of DM.
International Nuclear Information System (INIS)
Van Dijk, A.A.; Huismans, H.
1982-01-01
Virions of bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and African horsesickness virus (AHSV) can be converted to core particles by treatment with chymotrypsin and magnesium. The conversion is characterized by the removal of the 2 outer capsid polypeptides of the virion. The loss of these 2 proteins results in an increase in density from 1,36 g/ml to 1,40 g/ml on CsCl gradients. The BTV, EHDV and AHSV core particles have an associated double-stranded RNA dependent RNA transcriptase that appears to transcribe mRNA optimally at 28 degrees Celsius. It was found, at least in the case of BTV, that this low temperature preference is not an intrinsic characteristic of the transcriptase, but is due to a temperature-dependent inhibition of transcription at high core concentrations
Chemopreventive properties of curcumin analogues ...
African Journals Online (AJOL)
Chemopreventive properties of curcumin analogues, ... These compounds .... using microscope with 400 × magnification. APC ... Figure 3: Microscopic images of rat colorectal tissue stained with APC rabbit polyclonal antibody with different.
Analogues of luteinizing hormone-releasing hormone containing cytotoxic groups.
Janáky, T; Juhász, A; Bajusz, S; Csernus, V; Srkalovic, G; Bokser, L; Milovanovic, S; Redding, T W; Rékási, Z; Nagy, A
1992-02-01
In an attempt to produce better cytotoxic analogues, chemotherapeutic antineoplastic radicals including an alkylating nitrogen mustard derivative of D-phenylalanine (D-melphalan), reactive cyclopropane, anthraquinone derivatives [2-(hydroxymethyl)anthraquinone and the anticancer antibiotic doxorubicin], and an antimetabolite (methotrexate) were coupled to suitably modified agonists and antagonists of luteinizing hormone-releasing hormone (LH-RH). Analogues with D-lysine6 and D-ornithine6 or N epsilon-(2,3-diaminopropionyl)-D-lysine and N delta-(2,3-diaminopropionyl)-D-ornithine were used as carriers for one or two cytotoxic moieties. The enhanced biological activities produced by the incorporation of D amino acids into position 6 of the agonistic analogues were further increased by the attachment of hydrophobic cytotoxic groups, resulting in compounds with 10-50 times higher activity than LH-RH. Most of the monosubstituted agonistic analogues showed high affinities for the membrane receptors of human breast cancer cells, while the receptor binding affinities of peptides containing two cytotoxic side chains were lower. Antagonistic carriers [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,D-Lys6,D-Ala10] LH-RH [where Nal(2) is 3-(2-naphthyl)alanine], [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,N epsilon-(2,3-diaminopropionyl)-D-Lys6,D-Ala10]LH-RH, and their D-Pal(3)3 homologs [Pal(3) is 3-(3-pyridyl)alanine] as well as [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Pal(3)3,Tyr5,N epsilon-(2,3-diamino-propionyl)-D-Lys6,D-Ala10]LH-RH were linked to cytotoxic compounds. The hybrid molecules inhibited ovulation in rats at doses of 10 micrograms and suppressed LH release in vitro. The receptor binding of cytotoxic analogues was decreased compared to the precursor peptides, although analogues with 2-(hydroxymethyl)anthraquinone hemiglutarate had high affinities. All of the cytotoxic analogues tested inhibited [3H]thymidine incorporation into DNA in cultures of human breast and prostate cancer cell lines
Insulin analogues and severe hypoglycaemia in type 1 diabetes
DEFF Research Database (Denmark)
Kristensen, P L; Hansen, L S; Jespersen, M J
2012-01-01
The effect of insulin analogues on glycaemic control is well-documented, whereas the effect on avoidance of severe hypoglycaemia remains tentative. We studied the frequency of severe hypoglycaemia in unselected patients with type 1 diabetes treated with insulin analogues, human insulin, or mixed...
How stakeholders view the use of analogues in safety cases: PAMINA
International Nuclear Information System (INIS)
Atherton, Elizabeth; Bailey, Lucy
2008-01-01
The aim of this presentation is to provide an overview of some research that has been undertaken in the UK to investigate stakeholders' views of analogues. There are various reasons for using analogues including: to try and explain difficult concepts; to compare disposal facility features with familiar and/or natural systems; to provide an alternative, non-numerical line of reasoning to support the Safety Case conclusions; to provide evidence of behaviour over very long timescales, that cannot be achieved in the laboratory. There are some dangers when using analogues that people should be aware of: the analogue conditions may not be the same as those found in a disposal facility, so the analogue may have limited application. Some analogues may have negative implications, for example artefacts that have corroded. Analogues can be taken too far and used in inappropriate ways to try and support an assumption. So it is important to find out how stakeholders view the use of analogues in a safety case. NDA is involved in an EC funded project called Pamina (Performance Assessment Methodologies in Application). The project involves 26 partners from 11 European countries, plus other associated members and runs for 3 years from October 2006 to October 2009. The NDA is involved in several parts of the project: Exploring issues of modelling uncertainty; Evaluating effectiveness of approaches for communicating safety cases with stakeholders. NDA ran a workshop in October 2007 in Manchester. The aims of the workshop were to explore how different methods of communicating aspects of a safety case were received by stakeholders. The workshop presented stakeholders with: Examples of different repository concepts; Descriptions of barrier performance; Different ways of presenting numerical results; Use of natural analogues
Lindenmayer, Aristid; Schoen, Howard F.
1967-01-01
The initiation of perithecia in the homothallic ascomycete Sordaria fimicola was completely suppressed, without seriously inhibiting vegetative growth, by growing the fungus on an agar medium containing one of the following additions: 1) 1 μm 5-fluorouracil, 2) 10 to 100 μm 6-azauracil, 8-azaguanine or 8-azaadenine, 3) 50 to 500 μm cyanide or azide, 4) 5% (w/v) casein hydrolysate. In contrast to the selective activity of the analogues of 3 RNA bases, whose inhibition could be reversed by the appropriate normal bases only, none of the analogues of thymine were active, neither were the thio-derivatives of RNA bases. Other inhibitors of RNA and protein synthesis, like actinomycin D, puromycin and cycloheximide, were also without selective activity, although the last of these inhibited perithecial maturation at 0.1 μm concentration but not initiation. Amino acid analogues were inactive, as were the metabolic inhibitors thiourea, 2,4-dinitrophenol and fluoride. The compounds which inhibited the formation of perithecia also lowered the branching frequency of leading hyphae, but not their linear growth rates. Consequently, the branch densities were diminished in their presence. Hypotheses to account for these findings are discussed in terms of inhibition of growth in general, of the synthesis of some specific messenger RNAs, and of RNA-mediated transport across membranes, the last of which seeming the most fruitful for further work. PMID:16656614
Defining reference conditions for acidified waters using a modern analogue approach
International Nuclear Information System (INIS)
Simpson, Gavin L.; Shilland, Ewan M.; Winterbottom, Julie M.; Keay, Janey
2005-01-01
Analogue matching is a palaeolimnological technique that aims to find matches for fossil sediment samples from a set of modern surface sediment samples. Modern analogues were identified that closely matched the pre-disturbance conditions of eight of the UK Acid Waters Monitoring Network (AWMN) lakes using diatom- and cladoceran-based analogue matching. These analogue sites were assessed in terms of hydrochemistry, aquatic macrophytes and macro-invertebrates as to their suitability for defining wider hydrochemical and biological reference conditions for acidified sites within the AWMN. The analogues identified for individual AWMN sites show a close degree of similarity in terms of their hydrochemical characteristics, aquatic macrophytes and, to a lesser extent, macro-invertebrate fauna. The reference conditions of acidified AWMN sites are inferred to be less acidic than today and to support a wider range of acid-sensitive aquatic macrophyte and macro-invertebrate taxa than that recorded in the AWMN lakes over the period of monitoring since 1988. - The use of a palaeolimnological technique to identify modern ecological reference analogues for acidified lakes is demonstrated
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda
2010-06-05
The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Giri, Shibashish; Bader, Augustinus
2014-09-01
Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a
Energy Technology Data Exchange (ETDEWEB)
Skagius, K [Kemakta Consultants co., Stockholm (Sweden); Wingefors, S [Swedish Nuclear Power Inspectorate, Stockholm (Sweden)
1993-12-31
The study of natural analogues has been established as one of the most important methods for validation of concepts and models applied for the assessment of long-term performance of repositories for nuclear waste. The objectives of such studies range from detailed investigations of processes and features on a small scale to attempts of explaining the evolution of whole sites. For studies of specific processes it may well be as important to consider the larger scale settings as boundary conditions. This appreciation of context and an integrated view may be as important for evaluation of most natural analogues as for performance assessments. This is more evident the more the evaluation depends on a knowledge about the evolution of the natural analogue. The attempted formulation of scenarios of the Koongarra Analogue has been based on the external conditions and external features. A rapid weathering of the host rock, i.e. the chlorite schist, is assumed to have started around the onset of the Pleistocene Ice Age (ca 1.6 Ma BP). The eventual oxidation and mobilization of the uranium ore could then have occurred under unsaturated or saturated conditions. This leads to the following major scenarios: (1) Uranyl Phosphates formed under unsaturated conditions, with a periodical evolution of the dispersion fan in conjunction with alternating dry (glacial) and wet (interglacial) periods during the Pleistocene Ice Age; (2) Uranyl Phosphates formed under unsaturated conditions as a single event, taking place either early or late during the Pleistocene Ice Age; (3)Uranyl Phosphates formed under saturated conditions, in conjunction with periods of higher and lower flow due to the climatic cycling. Although the original objectives may not have been fully achieved, this work is believed to contribute to a better understanding of the Koongarra Analogue as well as to give a basis for further scenario work
Energy Technology Data Exchange (ETDEWEB)
Skagius, K. [Kemakta Consultants co., Stockholm (Sweden); Wingefors, S. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden)
1992-12-31
The study of natural analogues has been established as one of the most important methods for validation of concepts and models applied for the assessment of long-term performance of repositories for nuclear waste. The objectives of such studies range from detailed investigations of processes and features on a small scale to attempts of explaining the evolution of whole sites. For studies of specific processes it may well be as important to consider the larger scale settings as boundary conditions. This appreciation of context and an integrated view may be as important for evaluation of most natural analogues as for performance assessments. This is more evident the more the evaluation depends on a knowledge about the evolution of the natural analogue. The attempted formulation of scenarios of the Koongarra Analogue has been based on the external conditions and external features. A rapid weathering of the host rock, i.e. the chlorite schist, is assumed to have started around the onset of the Pleistocene Ice Age (ca 1.6 Ma BP). The eventual oxidation and mobilization of the uranium ore could then have occurred under unsaturated or saturated conditions. This leads to the following major scenarios: (1) Uranyl Phosphates formed under unsaturated conditions, with a periodical evolution of the dispersion fan in conjunction with alternating dry (glacial) and wet (interglacial) periods during the Pleistocene Ice Age; (2) Uranyl Phosphates formed under unsaturated conditions as a single event, taking place either early or late during the Pleistocene Ice Age; (3)Uranyl Phosphates formed under saturated conditions, in conjunction with periods of higher and lower flow due to the climatic cycling. Although the original objectives may not have been fully achieved, this work is believed to contribute to a better understanding of the Koongarra Analogue as well as to give a basis for further scenario work
International Nuclear Information System (INIS)
Skagius, K.; Wingefors, S.
1992-01-01
The study of natural analogues has been established as one of the most important methods for validation of concepts and models applied for the assessment of long-term performance of repositories for nuclear waste. The objectives of such studies range from detailed investigations of processes and features on a small scale to attempts of explaining the evolution of whole sites. For studies of specific processes it may well be as important to consider the larger scale settings as boundary conditions. This appreciation of context and an integrated view may be as important for evaluation of most natural analogues as for performance assessments. This is more evident the more the evaluation depends on a knowledge about the evolution of the natural analogue. The attempted formulation of scenarios of the Koongarra Analogue has been based on the external conditions and external features. A rapid weathering of the host rock, i.e. the chlorite schist, is assumed to have started around the onset of the Pleistocene Ice Age (ca 1.6 Ma BP). The eventual oxidation and mobilization of the uranium ore could then have occurred under unsaturated or saturated conditions. This leads to the following major scenarios: (1) Uranyl Phosphates formed under unsaturated conditions, with a periodical evolution of the dispersion fan in conjunction with alternating dry (glacial) and wet (interglacial) periods during the Pleistocene Ice Age; (2) Uranyl Phosphates formed under unsaturated conditions as a single event, taking place either early or late during the Pleistocene Ice Age; (3)Uranyl Phosphates formed under saturated conditions, in conjunction with periods of higher and lower flow due to the climatic cycling. Although the original objectives may not have been fully achieved, this work is believed to contribute to a better understanding of the Koongarra Analogue as well as to give a basis for further scenario work
DEFF Research Database (Denmark)
Hardlei, Tore Forsingdal; Obeid, Rima; Herrmann, Wolfgang
2013-01-01
BACKGROUND: Haptocorrin (HC) carries cobalamin analogues (CorA), but whether CorA are produced in the body is unknown. All cobalamins (Cbl) to the foetus are delivered by the Cbl-specific protein transcobalamin (TC), and therefore analysis of cord serum for CorA may help to clarify the origin...
Concise synthesis of new bridged-nicotine analogues
DEFF Research Database (Denmark)
Crestey, François; Hooyberghs, Geert; Kristensen, Jesper Langgaard
2012-01-01
This study describes a very efficient strategy for the synthesis of two new bridged-nicotine analogues. Starting from either 4- or 3-chloropyridine the desired tricyclic ring systems are accessed in just three steps in 23% and 40% overall yield, respectively.......This study describes a very efficient strategy for the synthesis of two new bridged-nicotine analogues. Starting from either 4- or 3-chloropyridine the desired tricyclic ring systems are accessed in just three steps in 23% and 40% overall yield, respectively....
Deficiencies in fat-soluble vitamins in long-term users of somatostatin analogue
Fiebrich, H. -B.; van den Berg, G.; Kema, I. P.; Links, T. P.; Kleibeuker, J. H.; van Beek, A. P.; Walenkamp, A. M. E.; Sluiter, W. J.; de Vries, E. G. E.
2010-01-01
P>Background Somatostatin analogues are administered to control hormone hypersecretion in acromegaly and carcinoid patients. Somatostatin analogues can increase fat in the stools, which can lead to loss of fat-soluble vitamins. The effect of long-term somatostatin analogue use on vitamin levels
Climate Analogues for agricultural impact projection and adaptation – a reliability test
Directory of Open Access Journals (Sweden)
Swen P.M. Bos
2015-10-01
Full Text Available The climate analogue approach is often considered a valuable tool for climate change impact projection and adaptation planning, especially for complex systems that cannot be modelled reliably. Important examples are smallholder farming systems using agroforestry or other mixed-cropping approaches. For the projected climate at a particular site of interest, the analogue approach identifies locations where the current climate is similar to these projected conditions. By comparing baseline-analogue site pairs, information on climate impacts and opportunities for adaptation can be obtained. However, the climate analogue approach is only meaningful, if climate is a dominant driver of differences between baseline and analogue site pairs. For a smallholder farming setting on Mt. Elgon in Kenya, we tested this requirement by comparing yield potentials of maize and coffee (obtained from the IIASA Global Agro-ecological Zones dataset among 50 close analogue sites for different future climate scenarios and models, and by comparing local ecological knowledge and farm characteristics for one baseline-analogue pair.Yield potentials among the 50 closest analogue locations varied strongly within all climate scenarios, hinting at factors other than climate as major drivers of what the analogue approach might interpret as climate effects. However, on average future climatic conditions seemed more favourable to maize and coffee cultivation than current conditions. The detailed site comparison revealed substantial differences between farms in important characteristics, such as farm size and presence of cash crops, casting doubt on the usefulness of the comparison for climate change analysis. Climatic constraints were similar between sites, so that no apparent lessons for adaptation could be derived. Pests and diseases were also similar, indicating that climate change may not lead to strong changes in biotic constraints at the baseline site in the near future. From
King, A R; Martin, I L; Melville, K A
1974-11-01
1 Small doses of lysergic acid diethylamide (LSD) (12.5-50 mug/kg) consistently facilitated learning of a brightness discrimination reversal.2 2-Bromo-lysergic acid diethylamide (BOL-148), a structural analogue of LSD, with similar peripheral anti-5-hydroxytrypamine activity but no psychotomimetic properties, had no effect in this learning situation at a similar dose (25 mug/kg).3 LSD, but not BOL-148, caused a small but significant increase in brain 5-hydroxytryptamine levels, but had no effect on the levels of catecholamines in the brain at 25 mug/kg.
Saag, Michael S
2012-12-01
Numerous investigational antiretroviral agents are in clinical development. Among them are festinavir (BMS986001), a thymidine analogue similar to stavudine with reduced potential for toxicity; GS-7340, a prodrug of tenofovir that achieves greater intracellular concentrations; MK-1439, a nonnucleoside analogue reverse transcriptase inhibitor (NNRTI) that retains activity against common NNRTI-associated resistance mutations; and albuvirtide, a long-acting parenteral fusion inhibitor. Investigational integrase strand transfer inhibitors (InSTIs) include elvitegravir, recently approved by the US Food and Drug Administration (FDA) as part of a once-daily, single-tablet formulation with cobicistat/tenofovir/emtricitabine; dolutegravir, which maintains some activity against raltegravir- and elvitegravir-resistant mutants; and S/GSK1265744, which also maintains some activity against resistance mutations in the integrase gene and is being developed as a long-lasting parenteral agent. Novel 2-(quinolin-3-yl)acetic acid derivatives (LEDGINs), agents that were originally thought to inhibit the interaction of integrase with its cofactor lens epithelium-derived growth factor p75 (LEDGF/p75), be active against InSTI-resistant mutants and to have additive activity when combined with InSTIs. This article summarizes a presentation by Michael S. Saag, MD, at the IAS-USA live Improving the Management of HCV Disease continuing medical education program held in New York in October 2012.
Müllers, Erik; Uhlig, Tobias; Stirnnagel, Kristin; Fiebig, Uwe; Zentgraf, Hanswalter; Lindemann, Dirk
2011-02-01
Prototype foamy virus (PFV) Gag lacks the characteristic orthoretroviral Cys-His motifs that are essential for various steps of the orthoretroviral replication cycle, such as RNA packaging, reverse transcription, infectivity, integration, and viral assembly. Instead, it contains three glycine-arginine-rich boxes (GR boxes) in its C terminus that putatively represent a functional equivalent. We used a four-plasmid replication-deficient PFV vector system, with uncoupled RNA genome packaging and structural protein translation, to analyze the effects of deletion and various substitution mutations within each GR box on particle release, particle-associated protein composition, RNA packaging, DNA content, infectivity, particle morphology, and intracellular localization. The degree of viral particle release by all mutants was similar to that of the wild type. Only minimal effects on Pol encapsidation, exogenous reverse transcriptase (RT) activity, and genomic viral RNA packaging were observed. In contrast, particle-associated DNA content and infectivity were drastically reduced for all deletion mutants and were undetectable for all alanine substitution mutants. Furthermore, GR box I mutants had significant changes in particle morphology, and GR box II mutants lacked the typical nuclear localization pattern of PFV Gag. Finally, it could be shown that GR boxes I and III, but not GR box II, can functionally complement each other. It therefore appears that, similar to the orthoretroviral Cys-His motifs, the PFV Gag GR boxes are important for RNA encapsidation, genome reverse transcription, and virion infectivity as well as for particle morphogenesis.
Analogue Electrical Circuit for Simulation of the Duffing-Holmes Equation
DEFF Research Database (Denmark)
Tamaseviciute, E.; Tamasevicius, A.; Mykolaitis, G.
2008-01-01
An extremely simple second order analogue electrical circuit for simulating the two-well Duffing-Holmes mathematical oscillator is described. Numerical results and analogue electrical simulations are illustrated with the snapshots of chaotic waveforms, phase portraits (Lissajous figures...
The macrophage scavenger receptor CD163
DEFF Research Database (Denmark)
Nielsen, Marianne Jensby; Madsen, Mette; Møller, Holger J
2006-01-01
CD163 is the monocyte/macrophage-specific receptor for haptoglobin-hemoglobin (Hp-Hb) complexes. The cytoplasmic tail of human CD163 exists as a short tail variant and two long tail variants. Reverse transcriptase-polymerase chain reaction analysis indicated that all three CD163 variants are subs......CD163 is the monocyte/macrophage-specific receptor for haptoglobin-hemoglobin (Hp-Hb) complexes. The cytoplasmic tail of human CD163 exists as a short tail variant and two long tail variants. Reverse transcriptase-polymerase chain reaction analysis indicated that all three CD163 variants...
DEFF Research Database (Denmark)
Uhrbrand, Katrine; Myrmel, Mette; Maunula, Leena
2010-01-01
Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently to evalu......Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently...
3-alkyl fentanyl analogues: Structure-activity-relationship study
Vučković, Sonja; Savić-Vujović, Katarina; Srebro, Dragana; Ivanović, Milovan; Došen-Mićović, Ljiljana; Stojanović, Radan; Prostran, Milica
2012-01-01
Introduction. Fentanyl belongs to 4-anilidopiperidine class of synthetic opioid analgesics. It is characterized by high potency, rapid onset and short duration of action. A large number of fentanyl analogues have been synthesized so far, both to establish the structure-activity-relationship (SAR) and to find novel, clinically useful analgesic drugs. Objective. In this study, newly synthesized 3-alkyl fentanyl analogues were examined for analgesic activity and compared with fentanyl. Methods. ...
Waffle, Lindsay; Godin, Laurent; Harris, Lyal B.; Kontopoulou, M.
2016-05-01
We characterize a set of analogue materials used for centrifuge analogue modelling simulating deformation at different levels in the crust simultaneously. Specifically, we improve the rheological characterization in the linear viscoelastic region of materials for the lower and middle crust, and cohesive synthetic sands without petroleum-binding agents for the upper crust. Viscoelastic materials used in centrifuge analogue modelling demonstrate complex dynamic behaviour, so viscosity alone is insufficient to determine if a material will be an effective analogue. Two series of experiments were conducted using an oscillating bi-conical plate rheometer to measure the storage and loss moduli and complex viscosities of several modelling clays and silicone putties. Tested materials exhibited viscoelastic and shear-thinning behaviour. The silicone putties and some modelling clays demonstrated viscous-dominant behaviour and reached Newtonian plateaus at strain rates clays demonstrated elastic-dominant power-law relationships. Based on these results, the elastic-dominant modelling clay is recommended as an analogue for basement cratons. Inherently cohesive synthetic sands produce fine-detailed fault and fracture patterns, and developed thrust, strike-slip, and extensional faults in simple centrifuge test models. These synthetic sands are recommended as analogues for the brittle upper crust. These new results increase the accuracy of scaling analogue models to prototype. Additionally, with the characterization of three new materials, we propose a complete lithospheric profile of analogue materials for centrifuge modelling, allowing future studies to replicate a broader range of crustal deformation behaviours.
Probenazole treatment inhibits anthocyanins biosynthesis via ...
African Journals Online (AJOL)
ELO
2012-01-05
Jan 5, 2012 ... State Key Laboratory of Genetic Engineering and Institute of Plant Biology, School of Life .... was reverse-transcribed with SuperScript reverse transcriptase ..... treated plant have more drought and salt stress tolerance.
Labelling and evaluation of new stabilised neurotensin (8-13) analogues for SPET
International Nuclear Information System (INIS)
Chavatte, K.; Terriere, D.; Jeannin, L.
1998-01-01
Neurotensin (8-13) analogues were biologically stabilised by replacement of the peptide bond between amino acids 8 and 9 by the reduced ψ(CH 2 -NH) isostere. DTPA analogues for In-111 labelling and 2-bromo-phenyl-acetyl analogues for radioiodination, showed receptor affinities in the low nanomolar range in combination with a biological half live in human plasma up to 275 minutes. Biodistribution studies in male Wistar rats of metabolically stabilised and non-stabilised 111 In-DTPA-NT(8-13) analogues showed a major clearance from the blood through the kidneys. 125 I-labelled Neurotensin (8-13) analogues showed accumulation up to 2.2% of the injected dose per g tissue in the liver which might be an important disadvantage when diagnosis of tumours in the gut is aimed. It is strongly suggested that stabilised neurotensin (8-13) analogues whether labelled with In-111, I-123 and the near future with Tc-99m, may act as new potential peptidergic radiopharmaceuticals for SPET diagnosis of different NT-receptor positive tumours like non-endocrine pancreas carcinoma, small cell lung carcinoma or colon adeno carcinoma. It is enticing to speculate that metabolically stabilised Neurotensin (8-13) analogues labelled with an appropriate isotope might be useful in therapy of different human cancers. (author)
Thymidine analogues to assess microperfusion in human tumors
International Nuclear Information System (INIS)
Janssen, Hilde L.; Ljungkvist, Anna S.; Rijken, Paul F.; Sprong, Debbie; Bussink, Jan; Kogel, Albert J. van der; Haustermans, Karin M.; Begg, Adrian C.
2005-01-01
Purpose: To validate the use of the thymidine analogues as local perfusion markers in human tumors (no labeling indicates no perfusion) by comparison with the well-characterized perfusion marker Hoechst 33342. Methods and Materials: Human tumor xenografts from gliomas and head-and-neck cancers were injected with iododeoxyuridine (IdUrd) or bromodeoxyuridine (BrdUrd) and the fluorescent dye Hoechst 33342. In frozen sections, each blood vessel was scored for the presence of IdUrd/BrdUrd labeling and Hoechst in surrounding cells. The percentage of analogue-negative vessels was compared with the fraction of Hoechst-negative vessels. Collocalization of the two markers was also scored. Results: We found considerable intertumor variation in the fraction of perfused vessels, measured by analogue labeling, both in the human tumor xenografts and in a series of tumor biopsies from head-and-neck cancer patients. There was a significant correlation between the Hoechst-negative and IdUrd/BrdUrd-negative vessels in the xenografts (r 85, p = 0.0004), despite some mismatches on a per-vessel basis. Conclusions: Thymidine analogues can be successfully used to rank tumors according to their fraction of perfused vessels. Whether this fraction correlates with the extent of acute hypoxia needs further confirmation
Analogues of estradiol as potential breast tumor imaging agents
International Nuclear Information System (INIS)
Gibson, R.E.; Rzeszotarski, W.J.; Ferriera, N.L.; Jagoda, E.M.; Reba, R.C.; Eckelman, W.C.
1984-01-01
The radioiodinated analogue of estradiol, 11β-methoxy-17α-[/sup 125/I]iodovinylestradiol (MIVE/sub 2/), has been shown to be a good candidate for the imaging of estrogen dependent breast tumors. Although there has been no extensive study on the sensitivity of radiotracers of this type, the authors have not observed localization of the radiotracer in metastatic lesions containing less than 20 fmole estrogen receptor/mg protein or in bone metasteses. In order to improve the sensitivity, they have examined several structural analogues of moxestrol (the parent structure for MIVE/sub 2/) for affinity to the ER isolated from immature rat uterus. The 11β-ethyl analogue (EEE/sub 2/) of ethynyl estradiol (EE/sub 2/) exhibits the highest affinity with the 11β-methyl analogue second best. Although the lipophilicity is also very high this compound should not be much more lipophilic than 16-iodoestradiol or MIVE/sub 2/ since the introduction of iodine increases the log P by greater than 1. The distribution of the tritiated derivative of EEE/sub 2/ is under study
From BPA to its analogues: Is it a safe journey?
Usman, Afia; Ahmad, Masood
2016-09-01
Bisphenol-A (BPA) is one of the most abundant synthetic chemicals in the world due to its uses in plastics. Its widespread exposure vis-a-vis low dose effects led to a reduction in its safety dose and imposition of ban on its use in infant feeding bottles. This restriction paved the way for the gradual market entry of its analogues. However, their structural similarity to BPA has put them under surveillance for endocrine disrupting potential. The application of these analogues is increasing and so are the studies reporting their toxicity. This review highlights the reasons which led to the ban of BPA and also reports the exposure and toxicological data available on its analogues. Hence, this compilation is expected to answer in a better way whether the replacement of BPA by these analogues is safer or more harmful? Copyright © 2016. Published by Elsevier Ltd.
Design of a saturated analogue and digital current transducer
International Nuclear Information System (INIS)
Pross, Alexander
2002-01-01
This project describes the development of a new analogue and digital current transducer, providing a range of new theoretical design methods for these novel devices. The main control feature is the limit cycling operation, and the novel use of the embedded sigma-delta modulator sensor structure to derive a low component count digital sensor. The research programme was initiated into the design, development and evaluation of a novel non-Hall sensing analogue and digital current transducer. These transducers are used for measurement of high currents in power systems applications. The investigation is concerned with a new design which uses a magnetic ferrite core without an air gap for current measurement. The motivation for this work was to design a new control circuit which provides a low component count, and utilises the non-linear properties of the magnetic ferrite core to transmit direct current. The use of a limit cycle control circuit was believed to be particularly suitable for the analogue and digital transducers, for two main reasons: the low component count, and the output signal is directly digital. In line with the motivations outlined above, the outcome of the research has witnessed the design, development and evaluation of a practically realisable analogue and digital current transducer. The design procedure, which is documented in this thesis, is considered to be a major contribution to the field of transducers design and development using a control systems approach. Mathematical models for both analogue and digital transducers were developed and the resulting model based predictions were found to be in good agreement with measured results. Simplification of the new model sensing device was achieved by approximating the non-linear ferrite core using FFT analysis. This is also considered to be a significant contribution. The development analogue and digital current censors employed a sampled data control systems design and utilised limit cycling
Natural analogues, paradigm for manmade repositories for radioactive wastes
International Nuclear Information System (INIS)
Pavelescu, M.; Pavelescu, A.
2004-01-01
Natural analogues are given by nature. They show the results of natural processes which have lasted thousands or millions of years. They provide an excellent example of what could happen in an underground site, offering in the same time the opportunity to test by observation and measurement, many of the geochemical processes that are expected to influence in a realistic and appropriate way, the predicted reliability of the radioactive waste repository over long periods of geological time. The natural analogue studies attempt to understand the multiprocessing complexity of the natural system, which contrasts with the limitations of the laboratory experiments and bring arguments to overcome the difficult time scale issue. By this the natural analogues are a useful paradigm for manmade repository for radioactive wastes. The paper discusses the implicit link in the public mind between natural analogues and manmade waste repository with an accent of the positive impact on public acceptance. It is also discussed the decisive qualities of the natural analogues concerning providing valid long term data and increasing the confidence of the public for manmade repositories. The debate is conducting in terms of sustainable development, having at base high-level principles in order to protect humans and their environment, both now and in the future, from potential hazards arising from such wastes. Safe radwaste management involves the application of technology and resources in a regulated manner so that the public, workers and the environment are protected in accordance with the accepted national and international standards. There are at least seven high-level principles which are mentioned in the paper. It is presented the general concept of the deep geological repository, very important for an acceptable solution for the management of nuclear waste, what is a prerequisite for a renewal of nuclear power. Further are introduced natural and archaeological (manufactured) analogue
Solid-phase synthesis of new saphenamycin analogues with antimicrobial activity
DEFF Research Database (Denmark)
Laursen, Jane B.; de Visser, P.C.; Nielsen, H.K.
2002-01-01
in parallel with a series of differently substituted benzoic acid derivatives. Treatment with TFA-CH2Cl2 (5:995) released the expected saphenamycin analogues into solution. These new analogues were purified, characterized and screened for antimicrobial activity against Bacillus subtilis and Proteus mirabilis...
Natural analogues for containment-providing barriers for a HLW repository in salt
Energy Technology Data Exchange (ETDEWEB)
Wolf, J.; Noseck, U.
2015-06-15
In 2005, a German research project was started to develop a novel approach to prove safety for a HLW repository in a salt formation, to refine the safety concept, to identify open scientific issues and to define necessary R&D work. This project aimed at identifying the key information for a HLW repository in salt. One important question is how this information may be best fulfilled by natural analogue studies. This question is answered by starting a review of the required key information needs of the safety case (post-closure phase) in order to assess whether or not these requirements can be supported by natural analogues information. In order to structure the review and to address the key elements of the safety concepts, three types of natural analogues are distinguished: (i) natural analogues for the integrity of the geological barrier, (ii) natural analogues for the integrity of the geotechnical barriers and (iii) natural analogues for release scenarios. For the safety case in salt type (i) and (ii) are of highest importance and are treated in this paper. The assessment documented in this paper on the one hand indicates the high potential benefit of natural analogues for a safety case in salt and on the other hand helps to focus the available human and financial resources for the safety case on the most safety-relevant aspects. (authors)
GnRH Analogues in the Prevention of Ovarian Hyperstimulation Syndrome
Alama, Pilar; Bellver, Jose; Vidal, Carmen; Giles, Juan
2013-01-01
The GnRH analogue (agonist and antagonist GnRH) changed ovarian stimulation. On the one hand, it improved chances of pregnancy to obtain more oocytes and better embryos. This leads to an ovarian hyper-response, which can be complicated by the ovarian hyperstimulation syndrome (OHSS). On the other hand, the GnRH analogue can prevent the incidence of OHSS: GnRH antagonist protocols, GnRH agonist for triggering final oocyte maturation, either together or separately, coasting, and the GnRH analogue may prove useful for avoiding OHSS in high-risk patients. We review these topics in this article. PMID:23825982
Directory of Open Access Journals (Sweden)
Kashanchi Fatah
2006-01-01
Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their
Telomere-independent functions of telomerase in nuclei, cytoplasm, and mitochondria
Energy Technology Data Exchange (ETDEWEB)
Chiodi, Ilaria; Mondello, Chiara, E-mail: mondello@igm.cnr.it [Istituto di Genetica Molecolare, Consiglio Nazionale delle Ricerche, Pavia (Italy)
2012-09-28
Telomerase canonical activity at telomeres prevents telomere shortening, allowing chromosome stability and cellular proliferation. To perform this task, the catalytic subunit (telomerase reverse transcriptase, TERT) of the enzyme works as a reverse transcriptase together with the telomerase RNA component (TERC), adding telomeric repeats to DNA molecule ends. Growing evidence indicates that, besides the telomeric-DNA synthesis activity, TERT has additional functions in tumor development and is involved in many different biological processes, among which cellular proliferation, gene expression regulation, and mitochondrial functionality. TERT has been shown to act independently of TERC in the Wnt-β-catenin signaling pathway, regulating the expression of Wnt target genes, which play a role in development and tumorigenesis. Moreover, TERT RNA-dependent RNA polymerase activity has been found, leading to the genesis of double-stranded RNAs that act as precursor of silencing RNAs. In mitochondria, a TERT TERC-independent reverse transcriptase activity has been described that could play a role in the protection of mitochondrial integrity. In this review, we will discuss some of the extra-telomeric functions of telomerase.
Influence of prostaglandin analogues on epithelial cell proliferation and xenograft growth.
Tutton, P J; Barkla, D H
1980-01-01
The influence of two prostaglandin (PG) analogues, 16,16-dimethyl PG E2 and 16,16-dimethyl PG F2 alpha and of the cyclo-oxygenase inhibitor, flurbiprofen, on epithelial cell proliferation was assessed using a stathmokinetic technique. The epithelia examined were those of the jejunal crypts, the colonic crypts and that of dimethylhydrazine-induced adenocarcinomas of rat colon. The influence of the two prostaglandin analogues, and of flurbiprofen, on the growth of a human colorectal tumour propagated as xenografts in immune-deprived mice was also assessed. The PG E2 analogue transiently inhibited xenograft growth, but was without effect on the mitotic rate in the rat tissues. The PG F2 alpha analogue was also found to inhibit xenograft growth but, unlike the PG E2 analogue, it was found to be a strong inhibitor of cell proliferation in rat colonic tumours, and an accelerator of proliferation in jejunal-crypt cells. The only statistically significant effect of flurbiprofen was to accelerate cell division in the rat colonic tumours.
Optoelectronic properties of higher acenes, their BN analogue and substituted derivatives
International Nuclear Information System (INIS)
Armaković, Stevan; Armaković, Sanja J.; Holodkov, Vladimir; Pelemiš, Svetlana
2016-01-01
We have investigated optoelectronic properties of higher acenes: pentacene, hexacene, heptacene, octacene, nonacene, decacene and their boron-nitride (BN) analogues, within the framework of density functional theory (DFT). We have also investigated the optoelectronic properties of acenes modified by BN substitution. Calculated optoelectronic properties encompasses: oxidation and reduction potentials, electron and hole reorganization energies and energy difference between excited first singlet and triplet states ΔE(S_1−T_1). Oxidation and reduction potentials indicate significantly better stability of BN analogues, comparing with their all-carbon relatives. Although higher acenes possess lower electron and hole reorganization energies, with both best values much lower than 0.1 eV, their BN analogues also have competitive values of reorganization energies, especially for holes for which reorganization energy is also lower than 0.1 eV. On the other hand ΔE(S_1−T_1) is much better for BN analogues, having values that indicate that BN analogues are possible applicable for thermally activated delayed fluorescence. - Highlights: • Optoelectronic properties of structures based on higher acenes have been investigated. • Oxidation and reduction potentials together with reorganization energies are calculated. • TADF is analyzed through calculation of ΔE(S_1−T_1), which is much better for BN analogues. • Reorganization energies of acenes improve with the increase of number of benzene rings.
Cross-reactivity of amphetamine analogues with Roche Abuscreen radioimmunoassay reagents
International Nuclear Information System (INIS)
Cody, J.T.
1990-01-01
Cross-reactivity of amphetamine analogues with the Abuscreen amphetamine radioimmunoassay reagents was determined for both the standard and high specificity antibody systems. Compounds tested included 2-methoxyamphetamine, 4-hydroxymethamphetamine, 2,5-dimethoxyamphetamine (DMA), 4-bromo-2,5-dimethoxyamphetamine (DOB), 4-bromo-2,5-dimethoxy-beta-phenethylamine (BDMPEA), 3,4,5-trimethoxyamphetamine (TMA), 3,4-methylenedioxyamphetamine (MDA), N,N-dimethyl-3,4-methylenedioxyamphetamine and N-hydroxy-3,4-methylenedioxyamphetamine (N-OH MDA), 3,4-methylenedioxymethamphetamine (MDMA), 3,4-methylenedioxyethylamphetamine (MDEA), 2,5-dimethoxy-4-ethylamphetamine, 2,5-dimethoxy-4-methylamphetamine (DOM), and 3,4,5-trimethoxyphenethylamine (mescaline). Blank negative reference material was spiked with 1,000 to 100,000 ng/mL of the amphetamine analogue and used as sample in the assays. MDA was the only analogue that showed cross reactivity equal to or greater than that of amphetamine. None of the other analogue compounds demonstrated a positive result at even the highest concentration; however several showed depressed counts at various concentration levels
Bharate, Sandip B; Bhutani, Kamlesh K; Khan, Shabana I; Tekwani, Babu L; Jacob, Melissa R; Khan, Ikhlas A; Singh, Inder Pal
2006-03-15
In the present communication, naturally occurring phloroglucinol-monoterpene adducts, euglobals G1-G4 (3b/a and 4a/b) and 16 new analogues (13a/b-18a/b and 19-22) were synthesized by biomimetic approach. These synthetic compounds differ from natural euglobals in the nature of monoterpene and acyl functionality. All of these compounds were evaluated for their antibacterial, antifungal, antileishmanial and antimalarial activities. Analogue 17b possessed good antibacterial activity against methicillin-resistant Staphylococcus aureus, while analogues 19-22 possessed potent antifungal activity against Candida glabrata with IC50s ranging from 1.5 to 2.5 microg/mL. Euglobals along with all synthesized analogues exhibited antileishmanial activity. Amongst these, euglobal G2 (3a), G3 (4a) and analogues 13a and 14a showed potent antileishmanial activity with IC50s ranging from 2.8 to 3.9 microg/mL. Analogue 16a possessed antimalarial activity against chloroquine sensitive D6 clone of Plasmodium falciparum. None of the compounds showed toxicity against mammalian kidney fibroblasts (vero cells) upto the concentration of 4.76 microg/ml.
Di Tullio, Maurizio; Maccallini, Cristina; Ammazzalorso, Alessandra; Giampietro, Letizia; Amoroso, Rosa; De Filippis, Barbara; Fantacuzzi, Marialuigia; Wiczling, Paweł; Kaliszan, Roman
2012-07-01
A series of 27 analogues of clofibric acid, mostly heteroarylalkanoic derivatives, have been analyzed by a novel high-throughput reversed-phase HPLC method employing combined gradient of eluent's pH and organic modifier content. The such determined hydrophobicity (lipophilicity) parameters, log kw , and acidity constants, pKa , were subjected to multiple regression analysis to get a QSRR (Quantitative StructureRetention Relationships) and a QSPR (Quantitative Structure-Property Relationships) equation, respectively, describing these pharmacokinetics-determining physicochemical parameters in terms of the calculation chemistry derived structural descriptors. The previously determined in vitro log EC50 values - transactivation activity towards PPARα (human Peroxisome Proliferator-Activated Receptor α) - have also been described in a QSAR (Quantitative StructureActivity Relationships) equation in terms of the 3-D-MoRSE descriptors (3D-Molecule Representation of Structures based on Electron diffraction descriptors). The QSAR model derived can serve for an a priori prediction of bioactivity in vitro of any designed analogue, whereas the QSRR and the QSPR models can be used to evaluate lipophilicity and acidity, respectively, of the compounds, and hence to rational guide selection of structures of proper pharmacokinetics. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002
Directory of Open Access Journals (Sweden)
Watitpun Chotip
2003-03-01
Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.
The Planetary Terrestrial Analogues Library (PTAL)
Werner, S. C.; Dypvik, H.; Poulet, F.; Rull Perez, F.; Bibring, J.-P.; Bultel, B.; Casanova Roque, C.; Carter, J.; Cousin, A.; Guzman, A.; Hamm, V.; Hellevang, H.; Lantz, C.; Lopez-Reyes, G.; Manrique, J. A.; Maurice, S.; Medina Garcia, J.; Navarro, R.; Negro, J. I.; Neumann, E. R.; Pilorget, C.; Riu, L.; Sætre, C.; Sansano Caramazana, A.; Sanz Arranz, A.; Sobron Grañón, F.; Veneranda, M.; Viennet, J.-C.; PTAL Team
2018-04-01
The Planetary Terrestrial Analogues Library project aims to build and exploit a spectral data base for the characterisation of the mineralogical and geological evolution of terrestrial planets and small solar system bodies.
Luciferase-Specific Coelenterazine Analogues for Optical Contamination-Free Bioassays
Ryo Nishihara; Masahiro Abe; Shigeru Nishiyama; Daniel Citterio; Koji Suzuki; Sung Bae Kim
2017-01-01
Spectral overlaps among the multiple optical readouts commonly cause optical contamination in fluorescence and bioluminescence. To tackle this issue, we created five-different lineages of coelenterazine (CTZ) analogues designed to selectively illuminate a specific luciferase with unique luciferase selectivity. In the attempt, we found that CTZ analogues with ethynyl or styryl groups display dramatically biased bioluminescence to specific luciferases and pHs by modifying the functional groups ...
Synthesis and antioxidant activity of peptide-based ebselen analogues.
Satheeshkumar, Kandhan; Mugesh, Govindasamy
2011-04-18
A series of di- and tripeptide-based ebselen analogues has been synthesized. The compounds were characterized by (1)H, (13)C, and (77)Se NMR spectroscopy and mass spectral techniques. The glutathione peroxidase (GPx)-like antioxidant activity has been studied by using H(2)O(2) , tert-butyl hydroperoxide (tBuOOH), and cumene hydroperoxide (Cum-OOH) as substrates, and glutathione (GSH) as a cosubstrate. Although all the peptide-based compounds have a selenazole ring similar to that of ebselen, the GPx activity of these compounds highly depends on the nature of the peptide moiety attached to the nitrogen atom of the selenazole ring. It was observed that the introduction of a phenylalanine (Phe) amino acid residue in the N-terminal reduces the activity in all three peroxide systems. On the other hand, the introduction of aliphatic amino acid residues such as valine (Val) significantly enhances the GPx activity of the ebselen analogues. The difference in the catalytic activity of dipeptide-based ebselen derivatives can be ascribed mainly to the change in the reactivity of these compounds toward GSH and peroxide. Although the presence of the Val-Ala-CO(2) Me moiety facilitates the formation of a catalytically active selenol species, the reaction of ebselen analogues that has a Phe-Ile-CO(2) Me residue with GSH does not generate the corresponding selenol. To understand the antioxidant activity of the peptide-based ebselen analogues in the absence of GSH, these compounds were studied for their ability to inhibit peroxynitrite (PN)-mediated nitration of bovine serum albumin (BSA) and oxidation of dihydrorhodamine 123. In contrast to the GPx activity, the PN-scavenging activity of the Phe-based peptide analogues was found to be comparable to that of the Val-based compounds. However, the introduction of an additional Phe residue to the ebselen analogue that had a Val-Ala dipeptide significantly reduced the potency of the parent compound in PN-mediated nitration. Copyright
Conjugate dynamical systems: classical analogue of the quantum energy translation
International Nuclear Information System (INIS)
Torres-Vega, Gabino
2012-01-01
An aspect of quantum mechanics that has not been fully understood is the energy shift generated by the time operator. In this study, we introduce the use of the eigensurfaces of dynamical variables and commutators in classical mechanics to study the classical analogue of the quantum translation of energy. We determine that there is a conjugate dynamical system that is conjugate to Hamilton's equations of motion, and then we generate the analogue of the time operator and use it in the translation of points along the energy direction, i.e. the classical analogue of the Pauli theorem. The theory is illustrated with a nonlinear oscillator model. (paper)
Luciferase-Specific Coelenterazine Analogues for Optical Contamination-Free Bioassays.
Nishihara, Ryo; Abe, Masahiro; Nishiyama, Shigeru; Citterio, Daniel; Suzuki, Koji; Kim, Sung Bae
2017-04-19
Spectral overlaps among the multiple optical readouts commonly cause optical contamination in fluorescence and bioluminescence. To tackle this issue, we created five-different lineages of coelenterazine (CTZ) analogues designed to selectively illuminate a specific luciferase with unique luciferase selectivity. In the attempt, we found that CTZ analogues with ethynyl or styryl groups display dramatically biased bioluminescence to specific luciferases and pHs by modifying the functional groups at the C-2 and C-6 positions of the imidazopyradinone backbone of CTZ. The optical contamination-free feature was exemplified with the luciferase-specific CTZ analogues, which illuminated anti-estrogenic and rapamycin activities in a mixture of optical probes. This unique bioluminescence platform has great potential for specific and high throughput imaging of multiple optical readouts in bioassays without optical contamination.
Tenofovir-related nephrotoxicity: case report and review of the literature.
James, Christopher W; Steinhaus, Mary C; Szabo, Susan; Dressier, Robert M
2004-03-01
Tenofovir is a nucleotide reverse transcriptase inhibitor for treatment of human immunodeficiency virus (HIV) infection. Several cases of renal failure associated with tenofovir therapy recently have been reported. A 54-year-old man with HIV experienced decreasing renal function and Fanconi's syndrome secondary to tenofovir therapy. His condition gradually improved after discontinuation of the drug. The available medical literature for reported cases of tenofovir-related nephrotoxicity indicates that this complication is apparently rare. However, our case report and literature review underscore the importance of monitoring renal function when treating patients with any nucleotide reverse transcriptase inhibitor.
Nontoxic piperamides and their synthetic analogues as novel antifouling reagents
Huang, Xiang-Zhong
2014-03-25
Bioassay-guided isolation of an acetone extract from a terrestrial plant Piper betle produced four known piperamides with potent antifouling (AF) activities, as evidenced by inhibition of settlement of barnacle cypris larvae. The AF activities of the four piperamides and 15 synthesized analogues were compared and their structure-activity relationships were probed. Among the compounds, piperoleine B and 1-[1-oxo-7-(3′,4′-methylenedioxyphenyl)-6E-heptenyl]-piperidine (MPHP) showed strong activity against settlement of cyprids of the barnacle Balanus amphitrite, having EC50 values of 1.1 ± 0.3 and 0.5 ± 0.2 μg ml-1, respectively. No toxicity against zebra fish was observed following incubation with these two compounds. Besides being non-toxic, 91% of piperoleine B-treated cyprids and 84% of MPHP-treated cyprids at a concentration of 100 μM completed normal metamorphosis in recovery bioassays, indicating that the anti-settlement effect of these two compounds was reversible. Hydrolysis and photolysis experiments indicated that MPHP could be decomposed in the marine environment. It is concluded that piperamides are promising compounds for use in marine AF coatings. © 2014 © 2014 Taylor & Francis.
Sensitivity of groundwater recharge using climatic analogues and HYDRUS-1D
Directory of Open Access Journals (Sweden)
B. Leterme
2012-08-01
Full Text Available The sensitivity of groundwater recharge to different climate conditions was simulated using the approach of climatic analogue stations, i.e. stations presently experiencing climatic conditions corresponding to a possible future climate state. The study was conducted in the context of a safety assessment of a future near-surface disposal facility for low and intermediate level short-lived radioactive waste in Belgium; this includes estimation of groundwater recharge for the next millennia. Groundwater recharge was simulated using the Richards based soil water balance model HYDRUS-1D and meteorological time series from analogue stations. This study used four analogue stations for a warmer subtropical climate with changes of average annual precipitation and potential evapotranspiration from −42% to +5% and from +8% to +82%, respectively, compared to the present-day climate. Resulting water balance calculations yielded a change in groundwater recharge ranging from a decrease of 72% to an increase of 3% for the four different analogue stations. The Gijon analogue station (Northern Spain, considered as the most representative for the near future climate state in the study area, shows an increase of 3% of groundwater recharge for a 5% increase of annual precipitation. Calculations for a colder (tundra climate showed a change in groundwater recharge ranging from a decrease of 97% to an increase of 32% for four different analogue stations, with an annual precipitation change from −69% to −14% compared to the present-day climate.
Optoelectronic properties of higher acenes, their BN analogue and substituted derivatives
Energy Technology Data Exchange (ETDEWEB)
Armaković, Stevan, E-mail: stevan.armakovic@df.uns.ac.rs [University of Novi Sad, Faculty of Sciences, Department of Physics, Trg Dositeja Obradovića 4, 21000, Novi Sad (Serbia); Armaković, Sanja J. [University of Novi Sad, Faculty of Sciences, Department of Chemistry, Biochemistry and Environmental Protection, Trg Dositeja Obradovića 3, 21000, Novi Sad (Serbia); Holodkov, Vladimir [Educons University, Faculty of Sport and Tourism - TIMS, Radnička 30a, 21000, Novi Sad (Serbia); Pelemiš, Svetlana [University of East Sarajevo, Faculty of Technology, Karakaj bb, 75400, Zvornik, Republic of Srpska, Bosnia and Herzegovina (Bosnia and Herzegovina)
2016-02-15
We have investigated optoelectronic properties of higher acenes: pentacene, hexacene, heptacene, octacene, nonacene, decacene and their boron-nitride (BN) analogues, within the framework of density functional theory (DFT). We have also investigated the optoelectronic properties of acenes modified by BN substitution. Calculated optoelectronic properties encompasses: oxidation and reduction potentials, electron and hole reorganization energies and energy difference between excited first singlet and triplet states ΔE(S{sub 1}−T{sub 1}). Oxidation and reduction potentials indicate significantly better stability of BN analogues, comparing with their all-carbon relatives. Although higher acenes possess lower electron and hole reorganization energies, with both best values much lower than 0.1 eV, their BN analogues also have competitive values of reorganization energies, especially for holes for which reorganization energy is also lower than 0.1 eV. On the other hand ΔE(S{sub 1}−T{sub 1}) is much better for BN analogues, having values that indicate that BN analogues are possible applicable for thermally activated delayed fluorescence. - Highlights: • Optoelectronic properties of structures based on higher acenes have been investigated. • Oxidation and reduction potentials together with reorganization energies are calculated. • TADF is analyzed through calculation of ΔE(S{sub 1}−T{sub 1}), which is much better for BN analogues. • Reorganization energies of acenes improve with the increase of number of benzene rings.
DEFF Research Database (Denmark)
Kaasgaard, Thomas; Andresen, Thomas Lars; Jensen, Simon Skøde
2009-01-01
of alkylated compounds in liposomes, it was demonstrated that the MTX-analogue partitioned into the water phase and thereby became available for cell uptake. It was concluded that liposomes containing alkylated MTX-analogues show promise as a drug delivery system, although the MTX-analogue needs to be more......Two lipophilic methotrexate analogues have been synthesized and evaluated for cytotoxicity against KATO III and HT-29 human colon cancer cells. Both analogues contained a C-16-alkyl chain attached to the gamma-carboxylic acid and one of the analogues had an additional benzyl group attached...... cytotoxicity was incorporated into liposomes that were designed to be particularly Susceptible to a liposome degrading enzyme, secretory phospholipase A(2) (sPLA(2)), which is found in high concentrations in tumors of several different cancer types. Liposome incorporation was investigated by differential...
Insulin analogues: have they changed insulin treatment and improved glycaemic control?
DEFF Research Database (Denmark)
Madsbad, Sten
2002-01-01
To improve insulin therapy, new insulin analogues have been developed. Two fast-acting analogues with a more rapid onset of effect and a shorter duration of action combined with a low day-to-day variation in absorption rate are now available. Despite this favourable time-action profile most studies....... This is probably the main explanation for the absence of improvement in overall glycaemic control when compared with regular human insulin. A tendency to a reduction in hypoglycaemic events during treatment with fast-acting analogues has been observed in most studies. Recent studies have indicated that NPH insulin...... administered several times daily at mealtimes can improve glycaemic control without increasing the risk of hypoglycaemia. The fast-acting analogues are now also available as insulin mixed with NPH. Insulin glargine is a new long-acting insulin which is soluble and precipitates after injection, resulting...
International Nuclear Information System (INIS)
Skagius, K.; Lindgren, M.; Boghammar, A.; Brandberg, F.; Pers, K.; Widen, H.
1993-08-01
The Koongarra Uranium Deposit in the Alligator Rivers Region in the Northern Territory of Australia is a natural analogue being investigated with the aim to contribute to the understanding of the scientific basis for the long term prediction of radionuclide migration within geological environments relevant to radioactive waste repositories. The dispersion of uranium and decay products in the weathered zone has been modelled with a simple advection-dispersion-reversible sorption model and with a model extended to also consider α-recoil and transfer of radionuclides between different mineral phases of the rock. The modelling work was carried out in several iterations, each including a review of available laboratory and field data, selection of the system to be modelled and suitable model, and a comparison of modelling results with field observations. Uranium concentrations in bulk rock calculated with the simple advection-dispersion- reversible sorption model were in fair agreement with observed data using parameter values within ranges recommended based on independent interpretations. The advection-dispersion-reversible sorption model is a large simplification of the system among other things because the partitioning of radionuclides between water and solid phase is described with a sorption equilibrium term only. Although the results from this study not are enough to validate simple performance assessment models in a strict sense, it has been shown that even simple models are able to describe the present day distribution of uranium in the weathered zone at Koongarra. 23 refs, 61 figs
Energy Technology Data Exchange (ETDEWEB)
Skagius, K; Lindgren, M; Boghammar, A; Brandberg, F; Pers, K; Widen, H [Kemakta, Stockholm (Sweden)
1993-08-01
The Koongarra Uranium Deposit in the Alligator Rivers Region in the Northern Territory of Australia is a natural analogue being investigated with the aim to contribute to the understanding of the scientific basis for the long term prediction of radionuclide migration within geological environments relevant to radioactive waste repositories. The dispersion of uranium and decay products in the weathered zone has been modelled with a simple advection-dispersion-reversible sorption model and with a model extended to also consider {alpha}-recoil and transfer of radionuclides between different mineral phases of the rock. The modelling work was carried out in several iterations, each including a review of available laboratory and field data, selection of the system to be modelled and suitable model, and a comparison of modelling results with field observations. Uranium concentrations in bulk rock calculated with the simple advection-dispersion- reversible sorption model were in fair agreement with observed data using parameter values within ranges recommended based on independent interpretations. The advection-dispersion-reversible sorption model is a large simplification of the system among other things because the partitioning of radionuclides between water and solid phase is described with a sorption equilibrium term only. Although the results from this study not are enough to validate simple performance assessment models in a strict sense, it has been shown that even simple models are able to describe the present day distribution of uranium in the weathered zone at Koongarra. 23 refs, 61 figs.
Synthesis of the 4-desmethoxy analogue of RU79115
Directory of Open Access Journals (Sweden)
MICHEL KLICH
2004-11-01
Full Text Available The synthesis, and biological activity in vitro of the 4-desmethoxy analogue (3 of RU 79115 (2 is described. Comparison of the biological activity of the two analogues clearly indicated the importance of the 4-methoxy group in conferring good gyrase B inhibitory activity as well as antibacterial activity.
DEFF Research Database (Denmark)
Sandrini, Michael; Clausen, Anders; On, Stephen L. W.
2007-01-01
To investigate the bactericidal activity of antiviral and anticancer nucleoside analogues against a variety of pathogenic bacteria and characterize the activating enzymes, deoxyribonucleoside kinases (dNKs). Several FDA-approved nucleoside analogue drugs were screened for their potential bacteric......-specific manner. Therefore, nucleoside analogues have a potential to be employed as antibiotics in the fight against emerging multiresistant bacteria....
Reasoning by analogy: rational foundation of natural analogue studies
International Nuclear Information System (INIS)
Petit, J.-C.
1992-01-01
Long-term extrapolations concerning the safety of a nuclear waste repository cannot be satisfactorily made on the sole basis of short-term laboratory investigations. Most nuclear countries have hence developed an approach relying on the following research directions: 1. laboratory experiments; 2. in situ testing; 3. modeling; and 4. natural analogues, which are the only means by which very slow mechanisms can be identified and by which long-term predictions of models can be tested for pertinence (if not truly validated). Although the field of natural analogues has grown very rapidly in recent years, receiving support from varied specialists and institutions involved in radioactive waste disposal, there is not yet a full consensus on their actual usefulness. More problematic is the criticism sometimes made that analogical reasoning is not ''true science'' and that information retrieved from the study of natural analogues will always remain questionable. The present paper gives some clues about the exact status of reasoning by analogy, compared to more ''scientific'' ways of deriving information from investigated systems. It is not a thorough discussion of this very complex, and by far too philosophical issue but we hope, at least, to present to readers of papers devoted to natural analogue studies arguments showing that this approach has some sound foundation. (author)
A Low-cost Multi-channel Analogue Signal Generator
Muller, F; Shen, W; Stamen, R
2009-01-01
A scalable multi-channel analogue signal generator is presented. It uses a commercial low-cost graphics card with multiple outputs in a standard PC as signal source. Each color signal serves as independent channel to generate an analogue signal. A custom-built external PCB was developed to adjust the graphics card output voltage levels for a specific task, which needed differential signals. The system furthermore comprises a software package to program the signal shape. The implementation of the signal generator is presented as well as an application where it was successfully utilized.
A regulator's perspective on the use of analogues for regulatory confidence
International Nuclear Information System (INIS)
Ruiz, Carmen
2008-01-01
The NAA Study, promoted and coordinated by the CSN, was carried out in collaboration with ENRESA by CIEMAT and three Spanish Universities UZ, UDC and UCM. The 3 year Study, included in the CSN's R and D Programme, started in 1999, is focussed on Deep Geological disposal (DGD). CSN motivation for NA Analogues arose in 1997 as result of the emerging approaches to increase the confidence in the Safety Assessment (SA) considering multiple lines of reasoning show in: some international documents and some national regulation. After a first preliminary (1997-1998) study, the CSN noticed the large amount and dispersion of the information about NNA, and decided to launch a deeper Study with the aims of: Collecting and reviewing the results of all the relevant studies on analogues developed in the last decades in systematic way; Reaching a better understanding of their potential and real application to the SA and for communication purposes. The results of the Analogue Study has been structured in several documents with different levels of detail and technical content addressed to different audiences. Analogue studies are a source of knowledge for the understanding of the long-term behavior of DGD systems. They represent a complementary method to increase Confidence Building within PA. In the majority of the cases, analogues have been used to transmit information on generic aspects of the geological concept an easily understood message. The need to simplify the content to facilitate their understanding may imply different information to different audiences. Analogue studies are: Considered within the multiple lines of reasoning to increase the confidence in the SA; A source of knowledge for the understanding of the long-term behavior of DGD systems. They represent a complementary method to increase Confidence Building within SA. There are few examples of the direct use of data from natural analogue projects in the consulted SA. They are promoted by International organisations
Reversible flowchart languages and the structured reversible program theorem
DEFF Research Database (Denmark)
Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert
2008-01-01
Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...
THE PENA BLANCA NATURAL ANALOGUE PERFORMANCE ASSESSMENT MODEL
Energy Technology Data Exchange (ETDEWEB)
G.J. Saulnier Jr; W. Statham
2006-03-10
The Nopal I uranium mine in the Sierra Pena Blanca, Chihuahua, Mexico serves as a natural analogue to the Yucca Mountain repository. The Pena Blanca Natural Analogue Performance Assessment Model simulates the mobilization and transport of radionuclides that are released from the mine and transported to the saturated zone. the Pena Blanca Natural Analogue Model uses probabilistic simulations of hydrogeologic processes that are analogous to the processes that occur at the Yucca Mountain site. The Nopal I uranium deposit lies in fractured, welded, and altered rhyolitic ash flow tuffs that overlie carbonate rocks, a setting analogous to the geologic formations at the Yucca Mountain site. The Nopal I mine site has the following characteristics as compared to the Yucca Mountain repository site. (1) Analogous source: UO{sub 2} uranium ore deposit = spent nuclear fuel in the repository; (2) Analogous geologic setting: fractured, welded, and altered rhyolitic ash flow tuffs overlying carbonate rocks; (3) Analogous climate: Semiarid to arid; (4) Analogous geochemistry: Oxidizing conditions; and (5) Analogous hydrogeology: The ore deposit lies in the unsaturated zone above the water table. The Nopal I deposit is approximately 8 {+-} 0.5 million years old and has been exposed to oxidizing conditions during the last 3.2 to 3.4 million years. The Pena Blanca Natural Analogue Model considers that the uranium oxide and uranium silicates in the ore deposit were originally analogous to uranium-oxide spent nuclear fuel. The Pena Blanca site has been characterized using field and laboratory investigations of its fault and fracture distribution, mineralogy, fracture fillings, seepage into the mine adits, regional hydrology, and mineralization that shows the extent of radionuclide migration. Three boreholes were drilled at the Nopal I mine site in 2003 and these boreholes have provided samples for lithologic characterization, water-level measurements, and water samples for laboratory
THE PENA BLANCA NATURAL ANALOGUE PERFORMANCE ASSESSMENT MODEL
International Nuclear Information System (INIS)
G.J. Saulnier Jr; W. Statham
2006-01-01
The Nopal I uranium mine in the Sierra Pena Blanca, Chihuahua, Mexico serves as a natural analogue to the Yucca Mountain repository. The Pena Blanca Natural Analogue Performance Assessment Model simulates the mobilization and transport of radionuclides that are released from the mine and transported to the saturated zone. the Pena Blanca Natural Analogue Model uses probabilistic simulations of hydrogeologic processes that are analogous to the processes that occur at the Yucca Mountain site. The Nopal I uranium deposit lies in fractured, welded, and altered rhyolitic ash flow tuffs that overlie carbonate rocks, a setting analogous to the geologic formations at the Yucca Mountain site. The Nopal I mine site has the following characteristics as compared to the Yucca Mountain repository site. (1) Analogous source: UO 2 uranium ore deposit = spent nuclear fuel in the repository; (2) Analogous geologic setting: fractured, welded, and altered rhyolitic ash flow tuffs overlying carbonate rocks; (3) Analogous climate: Semiarid to arid; (4) Analogous geochemistry: Oxidizing conditions; and (5) Analogous hydrogeology: The ore deposit lies in the unsaturated zone above the water table. The Nopal I deposit is approximately 8 ± 0.5 million years old and has been exposed to oxidizing conditions during the last 3.2 to 3.4 million years. The Pena Blanca Natural Analogue Model considers that the uranium oxide and uranium silicates in the ore deposit were originally analogous to uranium-oxide spent nuclear fuel. The Pena Blanca site has been characterized using field and laboratory investigations of its fault and fracture distribution, mineralogy, fracture fillings, seepage into the mine adits, regional hydrology, and mineralization that shows the extent of radionuclide migration. Three boreholes were drilled at the Nopal I mine site in 2003 and these boreholes have provided samples for lithologic characterization, water-level measurements, and water samples for laboratory analysis
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
Accumulation of radium in relation to some chemical analogues in Dicranopteris linearis
International Nuclear Information System (INIS)
Chao, J.H.; Chuang, C.Y.
2011-01-01
This study elucidates the uptake and accumulation of radium in the field-growing fern Dicranopteris linearis by relating the radium concentration to some potential chemical analogues, including alkaline earth metals, rare earth elements, and some important heavy metals. Time-dependent accumulation of radium and these chemical analogues for D. linearis were described by the 228 Th/ 228 Ra activity ratio, an index for inferring plant age. The correlation between radium and these elements was assessed by statistical analysis and used as a reference to elucidate the uptake and accumulation of radium in relation to the chemical analogues. Analytical and statistical results showed that the concentrations of alkaline earth metals (except for Mg) rare earth elements and some heavy metals in D. linearis increased linearly with plant age. These elements, exhibiting a similar accumulation pattern to radium and significant correlation coefficients with radium, were considered as the chemical analogues to radium. Additionally, the plant/soil concentration ratios (CRs) for radium and most of these analogues in D. linearis exceeded 1, consistent with the definition of hyper-accumulator plants.
Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid
Directory of Open Access Journals (Sweden)
Patrick Rabe
2014-08-01
Full Text Available Tropodithietic acid (TDA is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed.
Somatostatin analogues labelled with 99mTc
International Nuclear Information System (INIS)
Obenaus, Esteban R.; Crudo, Jose L.; Edreira, Martin M.; Castiglia, Silvia G.
1999-01-01
Biological and radiochemical studies have been carried out on two labelled somatostatin analogues, the peptide RC-150 and the Tyr 3 -Octreotide. Both analogues have been labelled with 99m Tc using the direct and the indirect method and MAG-3 and HYNIC as chelating agents. By the direct method RC-150 was labelled using sodium ascorbate and dithionite as reducing agents. The radiochemical purity was 70%. By the indirect method, in the case of RC-160 with MAG-3 a radiochemical purity higher than 70% was attained while a purity of 100% was reached in the case of Tyr 3 -Octreotide with HYNIC. The biological distribution of HYNIC-Tyr 3 -Octreotide has been studied in rats. (author)
Boron hydride analogues of the fullerenes
International Nuclear Information System (INIS)
Quong, A.A.; Pederson, M.R.; Broughton, J.Q.
1994-01-01
The BH moiety is isoelectronic with C. We have studied the stability of the (BH) 60 analogue of the C 60 fullerene as well as the dual-structure (BH) 32 icosahedron, both of them being putative structures, by performing local-density-functional electronic calculations. To aid in our analysis, we have also studied other homologues of these systems. We find that the latter, i.e., the dual structure, is the more stable although the former is as stable as one of the latter's lower homologues. Boron hydrides, it seems, naturally form the dual structures used in algorithmic optimization of complex fullerene systems. Fully relaxed geometries are reported as well as electron affinities and effective Hubbard U parameters. These systems form very stable anions and we conclude that a search for BH analogues of the C 60 alkali-metal supeconductors might prove very fruitful
Carbene supported dimer of heavier ketenimine analogue with p and si atoms.
Roy, Sudipta; Dittrich, Birger; Mondal, Totan; Koley, Debasis; Stückl, A Claudia; Schwederski, Brigitte; Kaim, Wolfgang; John, Michael; Vasa, Suresh Kumar; Linser, Rasmus; Roesky, Herbert W
2015-05-20
A cyclic alkyl(amino) carbene (cAAC) stabilized dimer [(cAAC)Si(P-Tip)]2 (2) (Tip = 2,4,6-triisopropylphenyl) is reported. 2 can be considered as a dimer of the heavier ketenimine (R2C═C═N-R) analogue. The dark-red rod-shaped crystals of 2 were synthesized by reduction of the precursor, cAAC-dichlorosilylene-stabilized phosphinidene (cAAC)SiCl2→P-Tip with sodium napthalenide. The crystals of 2 are storable at room temperature for several months and stable up to 215 °C under an inert atmosphere. X-ray single-crystal diffraction revealed that 2 contains a cyclic nonplanar four-membered SiPSiP ring. Magnetic susceptibility measurements confirmed the singlet spin ground state of 2. Cyclic voltammetry of 2 showed a quasi-reversible one-electron reduction indicating the formation of the corresponding radical anion 2(•-), which was further characterized by EPR measurements in solution. The electronic structure and bonding of 2 and 2(•-) were studied by theoretical calculations. The experimentally obtained data are in good agreement with the calculated values.
Wu, Menghao; Zeng, Xiao Cheng
2016-05-11
Phosphorene and phosphorene analogues such as SnS and SnSe monolayers are promising nanoelectronic materials with desired bandgap, high carrier mobility, and anisotropic structures. Here, we show first-principles calculation evidence that these monolayers are potentially the long-sought two-dimensional (2D) materials that can combine electronic transistor characteristic with nonvolatile memory readable/writeable capability at ambient condition. Specifically, phosphorene is predicted to be a 2D intrinsic ferroelastic material with ultrahigh reversible strain, whereas SnS, SnSe, GeS, and GeSe monolayers are multiferroic with coupled ferroelectricity and ferroelasticity. Moreover, their low-switching barriers render room-temperature nonvolatile memory accessible, and their notable structural anisotropy enables ferroelastic or ferroelectric switching readily readable via electrical, thermal, optical, mechanical, or even spintronic detection upon the swapping of the zigzag and armchair direction. In addition, it is predicted that the GeS and GeSe monolayers as well as bulk SnS and SnSe can maintain their ferroelasticity and ferroelectricity (anti-ferroelectricity) beyond the room temperature, suggesting high potential for practical device application.
In vitro and in vivo potency of insulin analogues designed for clinical use.
Vølund, A; Brange, J; Drejer, K; Jensen, I; Markussen, J; Ribel, U; Sørensen, A R; Schlichtkrull, J
1991-11-01
Analogues of human insulin designed to have improved absorption properties after subcutaneous injection have been prepared by recombinant DNA technology. Five rapidly absorbed analogues, being predominantly in mono- or di-meric states in the pharmaceutical preparation, and a hexameric analogue with very low solubility at neutral pH and slow absorption, were studied. Receptor binding assays with HEP-G2 cells showed overall agreement with mouse free adipocyte assays. Two analogues, B28Asp and A21Gly + B27Arg + B30Thr-NH2, had nearly the same molar in vitro potency as human insulin. Another two showed increased adipocyte potency and receptor binding, B10Asp 194% and 333% and A8His + B4His + B10Glu + B27His 575% and 511%, while B9Asp + B27Glu showed 29% and 18% and the B25Asp analogue only 0.12% and 0.05% potency. Bioassays in mice or rabbits of the analogues except B25Asp showed that they had the same in vivo potency as human insulin 1.00 IU = 6.00 nmol. Thus the variation had the same in vivo potency as human insulin 1.00 IU = 6.00 nmol. Thus the variation in in vivo potency reflects the differences in receptor binding affinity. Relative to human insulin a low concentration is sufficient for a high affinity analogue to produce a given receptor complex formation and metabolic response. In conclusion, human insulin and analogues with markedly different in vitro potencies were equipotent in terms of hypoglycaemic effect. This is in agreement with the concept that elimination of insulin from blood and its subsequent degradation is mediated by insulin receptors.
Prussian Blue Analogues of Reduced Dimensionality
Gengler, Regis Y. N.; Toma, Luminita M.; Pardo, Emilio; Lloret, Francesc; Ke, Xiaoxing; Van Tendeloo, Gustaaf; Gournis, Dimitrios; Rudolf, Petra
2012-01-01
Mixed-valence polycyanides (Prussian Blue analogues) possess a rich palette of properties spanning from room-temperature ferromagnetism to zero thermal expansion, which can be tuned by chemical modifications or the application of external stimuli (temperature, pressure, light irradiation). While
Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro ...
Indian Academy of Sciences (India)
(50 U) of reverse transcriptase. This cDNA pool ... reverse primers for each and 0.2 μL Taq polymerase (1 U). The initial ..... learned from B.t. toxin genes; in Genetic engineering (ed) JK ... KO 2007 Improved drought tolerance without undesired.
Short Telomere Length and Ischemic Heart Disease
DEFF Research Database (Denmark)
Madrid, Alexander Scheller; Rode, Line; Nordestgaard, Børge Grønne
2016-01-01
are associated with high risk of ischemic heart disease using a Mendelian randomization approach free of reverse causation and of most confounding. METHODS: We genotyped 3 genetic variants in OBFC1 (oligonucleotide/oligosaccharide binding fold containing 1), TERT (telomerase reverse transcriptase), and TERC...
Receptor-isoform-selective insulin analogues give tissue-preferential effects
DEFF Research Database (Denmark)
Vienberg, Sara Gry; Bouman, Stephan D; Sørensen, Heidi
2011-01-01
The relative expression patterns of the two IR (insulin receptor) isoforms, +/- exon 11 (IR-B/IR-A respectively), are tissue-dependent. Therefore we have developed insulin analogues with different binding affinities for the two isoforms to test whether tissue-preferential biological effects can...... be attained. In rats and mice, IR-B is the most prominent isoform in the liver (> 95%) and fat (> 90%), whereas in muscles IR-A is the dominant isoform (> 95%). As a consequence, the insulin analogue INS-A, which has a higher relative affinity for human IR-A, had a higher relative potency [compared with HI...... (human insulin)] for glycogen synthesis in rat muscle strips (26%) than for glycogen accumulation in rat hepatocytes (5%) and for lipogenesis in rat adipocytes (4%). In contrast, the INS-B analogue, which has an increased affinity for human IR-B, had higher relative potencies (compared with HI...
Energy Technology Data Exchange (ETDEWEB)
Li, Weixin [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wu, Mingchai [Department of Pharmacy, The Third Affiliated Hospital of Wenzhou Medical University, Wenzou, Zhejiang (China); Tang, Longguang; Pan, Yong; Liu, Zhiguo [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Zeng, Chunlai [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Wang, Jingying [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wei, Tiemin, E-mail: lswtm@sina.com [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Liang, Guang, E-mail: wzmcliangguang@163.com [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China)
2015-01-15
Background: Alleviating the oxidant stress associated with myocardial ischemia reperfusion has been demonstrated as a potential therapeutic approach to limit ischemia reperfusion (I/R)-induced cardiac damage. Curcumin, a natural compound with anti-oxidative activity, exerts beneficial effect against cardiac I/R injury, but poor chemical and metabolic stability. Previously, we have designed and synthesized a series of mono-carbonyl analogues of curcumin (MACs) with high stability. This study aims to find new anti-oxidant MACs and to demonstrate their effects and mechanisms against I/R-induced heart injury. Methods: H9c2 cells challenged with H{sub 2}O{sub 2} or TBHP were used for in vitro bio-screening and mechanistic studies. The MDA, H{sub 2}O{sub 2} and SOD levels in H9C2 cells were determined, and the cell viability was assessed by MTT assay. Myocardial I/R mouse models administrated with or without the compound were used for in vivo studies. Results: The in vitro cell-based screening showed that curcumin analogues 8d and 14p exhibited strong anti-oxidative effects. Pre-treatment of H9c2 cells with 14p activated Nrf2 signaling pathway, attenuated H{sub 2}O{sub 2}-increased MDA and SOD level, followed by the inhibition of TBHP-induced cell death and Bax/Bcl-2–caspase-3 pathway activation. Silencing Nrf2 significantly reversed the protective effects of 14p. In in vivo animal model of myocardial I/R, administration of low dose 14p (10 mg/kg) reduced infarct size and myocardial apoptosis to the same extent as the high dose curcumin (100 mg/kg). Conclusion: These data support the novel curcumin analogue 14p as a promising antioxidant to decrease oxidative stress and limit myocardial ischemia reperfusion injury via activating Nrf2. - Highlights: • Mono-carbonyl analogue of curcumin, 14p, exhibited better chemical stability. • Compound 14p inhibited TBHP-induced apoptosis through activating Nrf2 in vitro. • Compound 14p limited myocardial ischemia
The Valles natural analogue project
International Nuclear Information System (INIS)
Stockman, H.; Krumhansl, J.; Ho, C.; McConnell, V.
1994-12-01
The contact between an obsidian flow and a steep-walled tuff canyon was examined as an analogue for a highlevel waste repository. The analogue site is located in the Valles Caldera in New Mexico, where a massive obsidian flow filled a paleocanyon in the Battleship Rock tuff. The obsidian flow provided a heat source, analogous to waste panels or an igneous intrusion in a repository, and caused evaporation and migration of water. The tuff and obsidian samples were analyzed for major and trace elements and mineralogy by INAA, XRF, X-ray diffraction; and scanning electron microscopy and electron microprobe. Samples were also analyzed for D/H and 39 Ar/ 4O isotopic composition. Overall,the effects of the heating event seem to have been slight and limited to the tuff nearest the contact. There is some evidence of devitrification and migration of volatiles in the tuff within 10 meters of the contact, but variations in major and trace element chemistry are small and difficult to distinguish from the natural (pre-heating) variability of the rocks
Leung, K. C.
1989-01-01
Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.
Pavlova, L. A.; Komarova, T. V.; Davidovich, Yurii A.; Rogozhin, S. V.
1981-04-01
The results of studies on the biochemistry of the sweet taste are briefly reviewed. The methods of synthesis of "aspartame" — a sweet dipeptide — are considered, its structural analogues are described, and quantitative estimates are made of the degree of sweetness relative to sucrose. Attention is concentrated mainly on problems of the relation between the structure of the substance and its taste in the series of aspartyl derivatives. The bibliography includes 118 references.
Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H
2017-02-01
Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.
Analogue studies at the french atomic commission (CEA)
International Nuclear Information System (INIS)
Petit, J.C.
1986-06-01
The different research activities of the French Atomic Energy Commission in the analogue study field are presented. Most of them are conducted in collaboration with major research organisations, both french and international. In fact, the scientific community has been associated to these programmes at different steps of their realisation. The brief description presented illustrates the great diversity and complementarity of actions conducted by CEA for better understanding, through the study of natural analogues, the basic processes that will rule the long term behaviour of high level radwaste materials in a repository and hence contributing to hopefully guaranty disposal safety
Song, Yue; Shen, Keng; He, Chun-Xia
2007-09-01
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells
Trehalose Analogues: Latest Insights in Properties and Biocatalytic Production
Directory of Open Access Journals (Sweden)
Maarten Walmagh
2015-06-01
Full Text Available Trehalose (α-d-glucopyranosyl α-d-glucopyranoside is a non-reducing sugar with unique stabilizing properties due to its symmetrical, low energy structure consisting of two 1,1-anomerically bound glucose moieties. Many applications of this beneficial sugar have been reported in the novel food (nutricals, medical, pharmaceutical and cosmetic industries. Trehalose analogues, like lactotrehalose (α-d-glucopyranosyl α-d-galactopyranoside or galactotrehalose (α-d-galactopyranosyl α-d-galactopyranoside, offer similar benefits as trehalose, but show additional features such as prebiotic or low-calorie sweetener due to their resistance against hydrolysis during digestion. Unfortunately, large-scale chemical production processes for trehalose analogues are not readily available at the moment due to the lack of efficient synthesis methods. Most of the procedures reported in literature suffer from low yields, elevated costs and are far from environmentally friendly. “Greener” alternatives found in the biocatalysis field, including galactosidases, trehalose phosphorylases and TreT-type trehalose synthases are suggested as primary candidates for trehalose analogue production instead. Significant progress has been made in the last decade to turn these into highly efficient biocatalysts and to broaden the variety of useful donor and acceptor sugars. In this review, we aim to provide an overview of the latest insights and future perspectives in trehalose analogue chemistry, applications and production pathways with emphasis on biocatalysis.
Martin-Odoom, Alexander; Adiku, Theophilus; Delgado, Elena; Lartey, Margaret; Ampofo, William K
2017-03-01
Access to antiretroviral therapy in Ghana has been scaled up across the country over the last decade. This study sought to determine the occurrence of transmitted HIV-1 drug resistance in pregnant HIV-1 positive women yet to initiate antiretroviral therapy at selected HIV Care Centres in Ghana. Plasma specimens from twenty-six (26) HIV seropositive pregnant women who were less than 28weeks pregnant with their first pregnancy and ART naïve were collected from selected HIV care centres in three (3) regions in Ghana. Genotypic testing was done for the reverse transcriptase gene and the sequences generated were analyzed for HIV-1 drug resistance mutations using the Stanford University HIV Drug Resistance Database. Resistance mutations associated with the reverse transcriptase gene were detected in 4 (15.4%) of the participants. At least one major drug resistance mutation in the reverse transcriptase gene was found in 3 (11.5%) of the women. The detection of transmitted HIV-1 drug resistance in this drug-naïve group in two regional HIV care sites is an indication of the need for renewed action in monitoring the emergence of transmitted HIV-1 drug resistance in Ghana. None declared.
Superconductive analogue of spin glasses
International Nuclear Information System (INIS)
Feigel'man, M.; Ioffe, L.; Vinokur, V.; Larkin, A.
1987-07-01
The properties of granular superconductors in magnetic fields, namely the existence of a new superconductive state analogue of the low-temperature superconductive state in spin glasses are discussed in the frame of the infinite-range model and the finite-range models. Experiments for elucidation of spin-glass superconductive state in real systems are suggested. 30 refs
Neurochemical binding profiles of novel indole and benzofuran MDMA analogues.
Shimshoni, Jakob A; Winkler, Ilan; Golan, Ezekiel; Nutt, David
2017-01-01
3,4-Methylenedioxy-N-methylamphetamine (MDMA) has been shown to be effective in the treatment of post-traumatic stress disorder (PTSD) in numerous clinical trials. In the present study, we have characterized the neurochemical binding profiles of three MDMA-benzofuran analogues (1-(benzofuran-5-yl)-propan-2-amine, 5-APB; 1-(benzofuran-6-yl)-N-methylpropan-2-amine, 6-MAPB; 1-(benzofuran-5-yl)-N-methylpropan-2-amine, 5-MAPB) and one MDMA-indole analogue (1-(1H-indol-5-yl)-2-methylamino-propan-1-ol, 5-IT). These compounds were screened as potential second-generation anti-PTSD drugs, against a battery of human and non-human receptors, transporters, and enzymes, and their potencies as 5-HT 2 receptor agonist and monoamine uptake inhibitors determined. All MDMA analogues displayed high binding affinities for 5-HT 2a,b,c and NE α2 receptors, as well as significant 5-HT, DA, and NE uptake inhibition. 5-APB revealed significant agonist activity at the 5-HT 2a,b,c receptors, while 6-MAPB, 5-MAPB, and 5-IT exhibited significant agonist activity at the 5-HT 2c receptor. There was a lack of correlation between the results of functional uptake and the monoamine transporter binding assay. MDMA analogues emerged as potent and selective monoamine oxidase A inhibitors. Based on 6-MAPB favorable pharmacological profile, it was further subjected to IC 50 determination for monoamine transporters. Overall, all MDMA analogues displayed higher monoamine receptor/transporter binding affinities and agonist activity at the 5-HT 2a,c receptors as compared to MDMA.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
The Algebra of a q-Analogue of Multiple Harmonic Series
Directory of Open Access Journals (Sweden)
Yoshihiro Takeyama
2013-10-01
Full Text Available We introduce an algebra which describes the multiplication structure of a family of q-series containing a q-analogue of multiple zeta values. The double shuffle relations are formulated in our framework. They contain a q-analogue of Hoffman's identity for multiple zeta values. We also discuss the dimension of the space spanned by the linear relations realized in our algebra.
Naturally occurring crystalline phases: analogues for radioactive waste forms
International Nuclear Information System (INIS)
Haaker, R.F.; Ewing, R.C.
1981-01-01
Naturally occurring mineral analogues to crystalline phases that are constituents of crystalline radioactive waste forms provide a basis for comparison by which the long-term stability of these phases may be estimated. The crystal structures and the crystal chemistry of the following natural analogues are presented: baddeleyite, hematite, nepheline; pollucite, scheelite;sodalite, spinel, apatite, monazite, uraninite, hollandite-priderite, perovskite, and zirconolite. For each phase in geochemistry, occurrence, alteration and radiation effects are described. A selected bibliography for each phase is included
Naturally occurring crystalline phases: analogues for radioactive waste forms
Energy Technology Data Exchange (ETDEWEB)
Haaker, R.F.; Ewing, R.C.
1981-01-01
Naturally occurring mineral analogues to crystalline phases that are constituents of crystalline radioactive waste forms provide a basis for comparison by which the long-term stability of these phases may be estimated. The crystal structures and the crystal chemistry of the following natural analogues are presented: baddeleyite, hematite, nepheline; pollucite, scheelite;sodalite, spinel, apatite, monazite, uraninite, hollandite-priderite, perovskite, and zirconolite. For each phase in geochemistry, occurrence, alteration and radiation effects are described. A selected bibliography for each phase is included.
Managing Reverse Logistics or Reversing Logistics Management?
Brito, Marisa
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...
Design, Synthesis and Cytotoxic Evaluation of o-Carboxamido Stilbene Analogues
Directory of Open Access Journals (Sweden)
Mohamad Nurul Azmi
2013-11-01
Full Text Available Resveratrol, a natural stilbene found in grapes and wines exhibits a wide range of pharmacological properties. Resveratrol is also known as a good chemopreventive agent for inhibiting carcinogenesis processes that target kinases, cyclooxygenases, ribonucleotide reductase and DNA polymerases. A total of 19 analogues with an amide moiety were synthesized and the cytotoxic effects of the analogues on a series of human cancer cell lines are reported. Three compounds 6d, 6i and 6n showed potent cytotoxicity against prostate cancer DU-145 (IC50 = 16.68 µM, colon cancer HT-29 (IC50 = 7.51 µM and breast cancer MCF-7 (IC50 = 21.24 µM, respectively, which are comparable with vinblastine. The resveratrol analogues were synthesized using the Heck method.
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.