WorldWideScience

Sample records for amylases

  1. Amylase - urine

    Science.gov (United States)

    ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps digest carbohydrates. It ... the pancreas and the glands that make saliva. Amylase may also be measured with a blood test .

  2. Amylase Test

    Science.gov (United States)

    ... be limited. Home Visit Global Sites Search Help? Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  3. Amylase - blood

    Science.gov (United States)

    ... amylase levels may occur due to: Acute pancreatitis Cancer of the pancreas , ovaries, or lungs Cholecystitis Gallbladder attack caused by ... open) Decreased amylase levels may occur due to: Cancer of the pancreas Damage to the pancreas Kidney disease Toxemia of ...

  4. Amylase - blood

    Science.gov (United States)

    Amylase is an enzyme that helps digest carbohydrates. It is made in the pancreas and the glands ... saliva. When the pancreas is diseased or inflamed, amylase releases into the blood. A test can be ...

  5. A normal paediatric amylase range.

    OpenAIRE

    Aggett, P J; Taylor, F.(Department of Physics, Massachusetts Institute of Technology, Cambridge, MA, United States of America)

    1980-01-01

    A normal paediatric range of plasma alpha-amylase activity was determined using the Phadebas blue starch method. The range for children over one year was 98--405 IU/l. Plasma amylase activity increased throughout infancy. Mature levels of activity were observed in some children by age 2 months and in most of them by 9 months.

  6. Concerted evolution of human amylase genes.

    OpenAIRE

    Gumucio, D L; Wiebauer, K; Caldwell, R M; Samuelson, L C; Meisler, M H

    1988-01-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, we have identified two pancreatic amylase genes and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, du...

  7. Amylase: sensitive tumor marker for amylase-producing lung adenocarcinoma

    OpenAIRE

    Jie ZHANG; Zhang, Lixia; Pan, Shiyang; Gu, Bing; Zhen, Yuping; Yan, Jiabin; Zhou, Yiqin

    2013-01-01

    Hyperamylasemia in patients with lung cancer is rarely, comprising 1% to 3% of all lung cancers. This report describes two cases of lung adenocarcinoma coexisting with hyperamylasemia in two women aged 77 and 57, respectively. In these two cases, CT revealed a normal pancreas. We monitored the serum and urine amylase levels during therapy and found it paralleled tumor response to chemotherapy and metastasis. We suggest that the amylase levels are related to the tumor size and might be a valua...

  8. ON THE ACTIVITY OF AMYLASES DACTYLIS GLOMERATA

    OpenAIRE

    Elena Ciornea; Gabriela Vasile

    2007-01-01

    The paper discusses the results of the investigation on the enzymatic activity of total amylase and, respectively, of α-amylase, in the caryopses of Dactylis glomerata, along 10 germination days. The results obtained evidenced a maximum enzymatic activity, recorded 240 hours after the initiation of germination, both in the case of total and of α- amylase.

  9. Exercise upregulates salivary amylase in humans (Review)

    OpenAIRE

    KOIBUCHI, ERI; Suzuki, Yoshio

    2014-01-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively ...

  10. Concerted evolution of human amylase genes

    Energy Technology Data Exchange (ETDEWEB)

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.

    1988-03-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  11. Test for endo-amylase activity in the presence of exo-amylases

    Energy Technology Data Exchange (ETDEWEB)

    McHale, R.H.

    1988-11-01

    Increased hydroxypropylation of potato starch or amylose reduced the susceptibility of these substrates to attack by alpha and beta-amylases. By limited hydroxpropyl substitution (molar substitution: 0.18) of starch or amylose, substrates were obtained which were specifically degraded by alpha-amylase. These modified substrates enabled alpha-amylase to be determined in the presence of beta-amylase in extracts of malted barley.

  12. Amylase action pattern on starch polymers

    OpenAIRE

    Bijttebier, Annabel; Goesaert, Hans; Delcour, Jan

    2008-01-01

    Several decades ago, the first reports on differences in action pattern between amylases from different sources indicated that the starch polymers are not degraded in a completely random manner. We here give an overview of different action patterns of amylases on amylose and amylopectin, focusing on the so-called multiple attack action of the enzymes. Nowadays, the multiple attack action is generally an accepted concept to explain the differences in amylase action pattern. However, the pancre...

  13. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide;

    2011-01-01

    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... polymerization DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  14. Production of amylases by Aspergillus tamarii

    OpenAIRE

    Moreira Fabiana Guillen; Lima Francieli Arrias de; Pedrinho Sophia Renata Fazzano; Lenartovicz Veridiana; Souza Cristina Giatti Marques de; Peralta Rosane Marina

    1999-01-01

    A strain of Aspergillus tamarii, a filamentous fungus isolated from soil, was able to produce both a-amylase and glucoamylase activities in mineral media supplemented with 1% (w/v) starch or maltose as the carbon source. Static cultivation led to significantly higher yields than those obtained using shaking culture. The production of amylases was tolerant to a wide range of initial culture pH values (from 4 to 10) and temperature (from 25 to 42oC). Two amylases, one a-amylase and one glucoamy...

  15. Exercise upregulates salivary amylase in humans (Review).

    Science.gov (United States)

    Koibuchi, Eri; Suzuki, Yoshio

    2014-04-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  16. Intracellular alpha-amylase of Streptococcus mutans.

    Science.gov (United States)

    Simpson, C L; Russell, R R

    1998-09-01

    Sequencing upstream of the Streptococcus mutans gene for a CcpA gene homolog, regM, revealed an open reading frame, named amy, with homology to genes encoding alpha-amylases. The deduced amino acid sequence showed a strong similarity (60% amino acid identity) to the intracellular alpha-amylase of Streptococcus bovis and, in common with this enzyme, lacked a signal sequence. Amylase activity was found only in S. mutans cell extracts, with no activity detected in culture supernatants. Inactivation of amy by insertion of an antibiotic resistance marker confirmed that S. mutans has a single alpha-amylase activity. The amylase activity was induced by maltose but not by starch, and no acid was produced from starch. S. mutans can, however, transport limit dextrins and maltooligosaccharides generated by salivary amylase, but inactivation of amy did not affect growth on these substrates or acid production. The amylase digested the glycogen-like intracellular polysaccharide (IPS) purified from S. mutans, but the amy mutant was able to digest and produce acid from IPS; thus, amylase does not appear to be essential for IPS breakdown. However, when grown on excess maltose, the amy mutant produced nearly threefold the amount of IPS produced by the parent strain. The role of Amy has not been established, but Amy appears to be important in the accumulation of IPS in S. mutans grown on maltose. PMID:9721315

  17. Glycosylation and secretion of human α-amylases

    OpenAIRE

    Junko Amano; Shou Takashima

    2012-01-01

    Three human α-amylases exist: Amy1 (salivary amylase), Amy2A (pancreatic amylase), and Amy2B (expressed in various tissues). These amylases share a 97% - 99% amino acid sequence identity, and two potential N-glycosylation sites (N427 and N476) are commonly found in the C-terminal region. In general, salivary amylase is more frequently glycosylated than pancreatic amylase, and it is still uncertain why differences in the glycosylation pattern among human amylase iso-zymes occur. In this study,...

  18. Production of alpha-amylase by yeast

    Energy Technology Data Exchange (ETDEWEB)

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  19. Intracellular α-Amylase of Streptococcus mutans

    OpenAIRE

    Simpson, Christine L.; Russell, Roy R. B.

    1998-01-01

    Sequencing upstream of the Streptococcus mutans gene for a CcpA gene homolog, regM, revealed an open reading frame, named amy, with homology to genes encoding α-amylases. The deduced amino acid sequence showed a strong similarity (60% amino acid identity) to the intracellular α-amylase of Streptococcus bovis and, in common with this enzyme, lacked a signal sequence. Amylase activity was found only in S. mutans cell extracts, with no activity detected in culture supernatants. Inactivation of a...

  20. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii

    OpenAIRE

    Nikitkova, A.E.; Haase, E.M.; Scannapieco, F A

    2012-01-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amyla...

  1. Inhibition of Sunn Pest, Eurygaster integriceps, α-Amylases by α-Amylase Inhibitors (T-αAI) from Triticale

    OpenAIRE

    Mehrabadi, Mohammad; Bandani, Ali R.; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity...

  2. Production of amylases by Aspergillus tamarii

    Directory of Open Access Journals (Sweden)

    Moreira Fabiana Guillen

    1999-01-01

    Full Text Available A strain of Aspergillus tamarii, a filamentous fungus isolated from soil, was able to produce both a-amylase and glucoamylase activities in mineral media supplemented with 1% (w/v starch or maltose as the carbon source. Static cultivation led to significantly higher yields than those obtained using shaking culture. The production of amylases was tolerant to a wide range of initial culture pH values (from 4 to 10 and temperature (from 25 to 42oC. Two amylases, one a-amylase and one glucoamylase, were separated by ion exchange chromatography. Both partially purified enzymes had optimal activities at pH values between 4.5 and 6.0 and were stable under acid conditions (pH 4.0-7.0. The enzymes exhibited optimal activities at temperatures between 50o and 60o C and were stable for more than ten hours at 55oC.

  3. Measuring human salivary amylase copy number variation

    OpenAIRE

    Dhar, Sugandha

    2010-01-01

    Copy number variations represent large scale genomic alterations varying from 1kb to 3Mb and are proposed as a driving force for genome evolution and variation. One such locus exhibiting copy number variation and genome evolution is salivary amylase, which is responsible for the digestion of starch in the human parotid glands. It was reported that since human salivary amylase gene (AMY1) copy numbers are correlated positively with protein levels, and also due to the correlation of high gene c...

  4. Expression of alpha-amylase in Bacillus licheniformis.

    OpenAIRE

    Rothstein, D. M.; Devlin, P E; Cate, R. L.

    1986-01-01

    In Bacillus licheniformis, alpha-amylase production varied more than 100-fold depending on the presence or absence of a catabolite-repressing carbon source in the growth medium. alpha-Amylase was produced during the growth phase and not at the onset of the stationary phase. Induction of alpha-amylase correlated with synthesis of mRNA initiating at the promoter of the alpha-amylase gene.

  5. Two Distinct Pancreatic Amylase Genes Are Active in Ybr Mice

    OpenAIRE

    Strahler, John R.; Meisler, Miriam,

    1982-01-01

    The genetic determinants of pancreatic amylase expression in YBR mice differ in two respects from those of other inbred strains. First, there are two nonallelic amylase isozymes present in YBR pancreas, while most mouse strains express a single pancreatic amylase protein. In addition, the in vivo rate of total pancreatic amylase synthesis is 50% of that in other strains. Both these traits are determined by genetic sites in the region of the Amy-2 locus on mouse chromosome 3. To determine the ...

  6. A monograph on amylases from Bacillus spp.

    OpenAIRE

    M. K. Sarath Josh; S. Sreedevi; Prakasan Priji; K. N. Unni; S Sajith; S.Pradeep; V. N. Jisha; R. B. Smitha; Sailas Benjamin

    2013-01-01

    Owing to the production of alpha, beta and gamma amylase subtypes; starch degrading microbes, especially bacteria have an invincible role in the food, fermentation, textile and paper industries. Of them, α-amylases from Bacillus spp. have contributed tremendous advancements in bio-industry, especially in starch, detergent and pharmaceutical arena. Though general reviews are seen in literature on amylases, no focused review is available yet solely on α-amylases produced by Bacillus spp. Hence...

  7. Bacillus Spp. Amylase: Production, Isolation, Characterisation and Its Application

    OpenAIRE

    Shivani Sachdev; Sanjay Kumar Ojha; Snehasish Mishra

    2016-01-01

    Amylase is one of the leading enzymes used in industry from decades. The preliminary function of this enzyme is the hydrolysis of the starch molecule into glucose units and oligosaccharides. Amylases have spectacular application in broad spectrum of industries such as food, detergent, pharmaceutical and fermentation industries. Among different type of amylases α- amylase is in utmost demand because of its striking features. This particular enzyme is a good substitute over the chemicals cataly...

  8. Radioimmunoassay for human pancreatic amylase: comparison of human serum amylase by measurement of enzymatic activity and by radioimmunoassay

    International Nuclear Information System (INIS)

    A radioimmunoassay (RIA) for human pancreatic amylase has been developed for the determination of human serum amylase content. The assay was shown to be sensitive (7 ng/mI), reproducible and specific, but human pancreatic amylase and salivary amylase could not be distinguished by the antiserum used. In normal subjects, the mean concentration of amylase determined by the RIA was found to be 122.1 ng/ml (range: 55-250 ng/ml). A good correlation was observed between the concentration of amylase and its enzymatic activity in normal subjects. In some instances with high amylase activity, however, the rise in enzymatic activity was not accompanied by increasing amount of amylase content. (Auth.)

  9. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    Science.gov (United States)

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation. PMID:26117761

  10. CHARACTERIZATION OF ALPHA - AMYLASE FROM THE SEEDS OF Mucuna pruriens

    OpenAIRE

    K S Chandrashekharaiah; Preethi; Shalini; V. Krishna murthy; M Narayanaswamy; K R Siddalinga Murthy; Ramachandra Swamy, N.

    2013-01-01

    Amylase s are hydrolytic enzymes which are widely distributed in nature, animals, plants and microorganisms. Amylases are of great significance in present - day biotechnology. In present study, amylases are isolated from the soaked seeds of Mucuna pruriens under extreme acidic conditions. Conventional protein purification techniques such as salt fractionation, ion exchange chromatography on CM - cellulose and sephadex G - 75 was employed for the pu...

  11. Possible mechanisms of normal amylase activity in hyperlipemic pancreatitis.

    Science.gov (United States)

    Mishkin, S.; Bates, J.; O'Hashi, J.; Schneider, P.; Sniderman, A. D.; Wolf, R. O.

    1976-01-01

    Lipemic serum from three patients with acute pancreatitis and type IV hyperlipemia was fractionated into very-low-density lipoproteins and clear serum. Amylase activity (determined by the Phadebas method) in the component fractions did not exceed that in the original lipemic serum. Addition of these fractions or VLDL and chylomicrons from asymptomatic patients with hyperlipemia to nonlipemic serum from patients with "routine acute pancreatitis" did not inhibit amylase activity or alter the electrophoretic mobility of amylase isoenzymes. Therefore the normal amylase activity often observed in hyperlipemic pancreatitis does not result from an inhibition of amylase activity by serum lipoproteins. Images FIG. 4 FIG. 5 PMID:206333

  12. Proteases involved in generation of beta- and alpha-amylases from a large amylase precursor in Bacillus polymyxa.

    OpenAIRE

    S. Takekawa; Uozumi, N; Tsukagoshi, N; Udaka, S

    1991-01-01

    The genes for extracellular neutral protease (Npr) and intracellular serine protease (Isp) were cloned from Bacillus polymyxa in order to elucidate the process involved in the generation of multiple beta-amylases and an alpha-amylase from a large amylase precursor. The npr gene was composed of 1,770 bp and 570 amino acids, while the isp gene was composed of 978 bp and 326 amino acids. Both proteases produced by E. coli cleaved the amylase precursor to generate beta- and alpha-amylases. Furthe...

  13. Amylase release from rat parotid glands. II

    International Nuclear Information System (INIS)

    The kinetics of 45Ca2+ uptake, efflux, and calcium potentiation of amylase release by slices of rat parotid glands were examined. Pretreatment of the tissue with 11.25 mM 45Ca2+ medium increased the total tissue 45calcium content. Lanthanum (1 mM) decreased tissue uptake, blocked the slow components of exchange and appeared to inhibit transcellular calcium movement. Neither dibutyryl cyclic AMP nor caffeine caused consistently significant effects on 45Ca2+ kinetics, or total 45calcium content. Carbamylcholine increased the initial rate of 45Ca2+ uptake, but had no effect on total uptake. Elevation of the extracellular Ca2+ concentration of 11.25 mM during stimulation of amylase release resulted in an initial decrease in the rate of amylase release followed by a potentiation of release which developed slowly, requiring 40-50 min to reach the maximal response. The inability to detect release-related changes in either calcium influx or mobilization, and the lengthy times and high Ca2+ concentrations required to achieve calcium potentiation suggests that calcium does not couple amylase release. (Auth.)

  14. Occupational asthma due to porcine pancreatic amylase

    OpenAIRE

    1997-01-01

    A case of occupational asthma in a 41 year old histopathology laboratory technician attributable to a powder preparation of the porcine pancreatic enzyme amylase is reported. The diagnosis was confirmed by a double blind, placebo controlled, inhalation challenge study which showed immediate and late asthmatic reactions associated with a significant increase in airway responsiveness to methacholine.

  15. Blood amylase - a biochemical radiation indicator?

    International Nuclear Information System (INIS)

    This study describes the suitability of the biological radiation indicator 'amylase in human blood serum' to identify, if previous irradiation has occurred. After 'in vivo' exposure, of the human body with organ doses > 0,5 Gy, high activities of the enzyme are found in serum. The important results of examinations from different work groups and from own experiments were summarized in tabular form and evaluated from the statistic point of view. The results show that in more than 90% of all cases, the amylase system is suitable to identify exposure beyond 0,5 to 1 Gy, approximately. However, this is only possible if the salivary glands were also exposed and blood samples are taken about 18 hours after exposure. For the differentiation between induced increase of amylase from disease and radiation induced increase, it is recommended to carry out the isoamylase test, which makes it possible to distinguish between the individual enzymes. The assessment of the total amylase is appropriate to detect, with a range of significance of P = 0,05 that radiation exposure has occurred. The increase of activity is dose dependent when the salivary glands lie in the radiation field, however, the variations of activity are very high. Therefore the radiation dose cannot be considered. Only in cases where a very high radiation induced increase of activity is observed, a rough estimation of dose at the parotid glands can be made. (orig./MG)

  16. Enhanced amylase production by fusarium solani in solid state fermentation

    International Nuclear Information System (INIS)

    The present study illustrates the investigation carried out on the production of amylase by Fusarium species under solid state fermentation. All the tested Fusarium species were capable of producing amylase. A selected F. solani isolate SY7, showed the highest amylase production in solid state fermentation. Different substrates were screened for enzyme production. Among the several agronomic wastes, wheat bran supported the highest yield of amylase (141.18 U/g of dry substrate) after 3 days of incubation. Optimisation of the physical parameters revealed the optimum pH, temperature and moisture level for amylase production by the isolate as 8.0, 25 C and 70%, respectively. The above results indicate that the production of amylase by F. solani isolate SY7 could be improved by a further optimisation of the medium and culture conditions. (author)

  17. Immunohistochemical analysis of amylase isoenzymes in thyroid cancer.

    OpenAIRE

    Higashiyama, M; Doi, S; Tomita, N; Monden, T.; Murotani, M.; Kawasaki, Y.; Kobayashi, T.; Shimano, T; Ogawa, M; Takai, S

    1991-01-01

    The expression of amylase in various histological types of thyroid cancer was studied by an immunohistochemical technique, using a polyclonal antiamylase antiserum and two monoclonal antibodies specific for salivary and pancreatic-type amylases, respectively. Amylase was expressed in 21 of 24 (88%) thyroid cancers by polyclonal antiserum analysis. Analysis by monoclonal antibodies, however, showed that only 13 (54%) cases and three (13%) cases contained salivary-type and pancreatic-type amyla...

  18. Value of repeating amylase levels in abdominal pain

    OpenAIRE

    Rajaraman Durai; Alexandras Uzkalnis

    2010-01-01

    Rajaraman Durai1, Alexandras Uzkalnis21Specialist registrar, 2Consultant surgeon, Department of Surgery, University Hospital Lewisham, London, SE13 6LH, UKSerum amylase and lipase are commonly used tests for diagnosing pancreatitis. Serum amylase level is usually high in the early days of pancreatitis which subsequently decreases. Serum lipase is not routinely available in every hospital. We report an unusual case of pancreatitis where amylase was normal initially then it began to rise.

  19. Relative effectiveness of mutagens on amylase production in Aspergillus wentii

    International Nuclear Information System (INIS)

    Three physical mutagens (UV light and γ- and X-rays) and 3 chemical mutagens (N-methyl-N-nitro-N-nitrosoguanidine, hydroxylamine and nitrous acid) were tested for their ability to produce mutants of A. wentii Wehmer (IMI 17295) having altered amylase activity. There was marked variation in amylase activity among the mutants, increase, decrease or complete absence of such activity was noticed. Nitrous acid was most effective in inducing high yielding amylase producing mutants. (author)

  20. Effect of tetracycline administration on serum amylase activity in calves

    OpenAIRE

    Zendehbad, Bamdad; Alipour, Adeleh; Zendehbad, Hussein

    2013-01-01

    Tetracycline and related compounds are used extensively as broad spectrum antibiotics in the treatment of bacterial infections in ruminants. Tetracycline may cause acute pancreatitis which may result in increased serum amylase activity. However, it has been shown that administration of oxytetracycline in human results in decrease serum amylase activity. In this study changes in serum amylase activity were measured in 20 clinically healthy calves following intravenous injection of oxytetracycl...

  1. Amylase catalyzed synthesis of glycosyl acrylates and their polymerization

    OpenAIRE

    Kloosterman, Wouter M. J.; Jovanovic, Danijela; Brouwer, Sander; Loos, Katja

    2014-01-01

    The enzymatic synthesis of novel (di)saccharide acrylates from starch and 2-hydroxyethyl acrylate, 2-hydroxyethyl methacrylate and 4-hydroxybutyl acrylate (2-HEA, 2-HEMA and 4-HBA) catalyzed by various commercially available amylase preparations is demonstrated. Both liquefaction and saccharification amylases were tested as biocatalysts. Transglycosidation products were only detected in reaction mixtures containing saccharification amylases. The glycoamylase from Aspergillus niger was found t...

  2. Culture Conditions for Production of Thermostable Amylase by Bacillus stearothermophilus

    OpenAIRE

    Srivastava, R. A. K.; Baruah, J. N.

    1986-01-01

    Bacillus stearothermophilus grew better on complex and semisynthetic medium than on synthetic medium supplemented with amino acids. Amylase production on the complex medium containing beef extract or corn steep liquor was higher than on semisynthetic medium containing peptone (0.4%). The synthetic medium, however, did not provide a good yield of extracellular amylase. Among the carbohydrates which favored the production of amylase are, in order starch > dextrin > glycogen > cellobiose > malto...

  3. Cloning and characterization of the beta-amylase gene from Bacillus polymyxa.

    OpenAIRE

    Friedberg, F; Rhodes, C.

    1986-01-01

    The gene for beta-amylase was isolated from Bacillus polymyxa by molecular cloning in B. subtilis. B. subtilis cells containing this gene express and secrete an amylase which resembles the B. polymyxa beta-amylase and barley beta-amylase in terms of the products it generates during carbohydrate hydrolysis. Starch hydrolysis with this beta-amylase produces maltose, not glucose, whereas maltotriose and cycloheptaose are resistant to the action of this beta-amylase. The enzyme has a molecular we...

  4. Production of Fungal Amylases Using Cheap, Readily Available Agriresidues, for Potential Application in Textile Industry

    OpenAIRE

    Shalini Singh; Sanamdeep Singh; Vrinda Bali; Lovleen Sharma; Jyoti Mangla

    2014-01-01

    The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL) in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL) and supernatant protein concent...

  5. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota

    OpenAIRE

    Yan, Shaomin; Wu, Guang

    2016-01-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, i...

  6. CHARACTERIZATION OF ALPHA - AMYLASE FROM THE SEEDS OF Mucuna pruriens

    Directory of Open Access Journals (Sweden)

    K S Chandrashekharaiah

    2013-11-01

    Full Text Available Amylase s are hydrolytic enzymes which are widely distributed in nature, animals, plants and microorganisms. Amylases are of great significance in present - day biotechnology. In present study, amylases are isolated from the soaked seeds of Mucuna pruriens under extreme acidic conditions. Conventional protein purification techniques such as salt fractionation, ion exchange chromatography on CM - cellulose and sephadex G - 75 was employed for the purification of amylase from the seeds of Mucuna pruriens . The amy lase activity was eluted in one peak. The specific activity and yield of the purified amylase was 6.25 and 29.99, respectively. Native PAGE, SDS - PAGE and gel electrofocussing were employed to establish homogeneity of the purified amylase. SDS - PAGE and gel - filtration chromatography on sephadex G - 75 was used to determine the molecular weight of the purified amylase. The purified amylase was nearly homogenous and its molecular weight was found to be 78.4 kDa. The optimum pH and temperature of th e purified amyl ase were 7.0 and 50 o C, respectively. The isolectric pH of the purified amylase was 7.2 and the activity was linear up to 60 minutes

  7. THE CELL-BOUND ALPHA-AMYLASES OF STREPTOCOCCUS BOVIS.

    Science.gov (United States)

    WALKER, G J

    1965-02-01

    1. The cell-bound alpha-amylase of Streptococcus bovis has been isolated from other carbohydrases in the cell extract by chromatography on DEAE-cellulose. The enzyme has been compared with the extracellular alpha-amylase produced by this organism. 2. The two amylases had similar action patterns on amylose, the main product being maltotriose with smaller amounts of maltose and a little glucose. 3. The cell-bound amylase hydrolysed maltopentaose and maltohexaose at a similar rate to the hydrolysis of amylose. Maltotetraose was hydrolysed six times more slowly, and maltotriose 280 times more slowly, than amylose. 4. Studies with end-labelled maltodextrins revealed that the cell-bound alpha-amylase preferentially hydrolysed the third linkage from the non-reducing end, liberating maltotriose. The linkage at the reducing end of maltotriose was more easily hydrolysed than the other. 5. Egg-white lysozyme and the extracellular enzymes of Streptomyces albus lysed the cell walls of Streptococcus bovis, releasing amylase into the medium. In the presence of 0.6 m-sucrose 10% of the maximal amylase activity was released by lysozyme. Suspension of the spheroplasts in dilute buffer caused the rupture of the cytoplasmic membrane and the liberation of amylase. 6. A sensitive method for determining the ability of amylases to degrade starch granules is described. PMID:14346085

  8. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii.

    Science.gov (United States)

    Nikitkova, A E; Haase, E M; Scannapieco, F A

    2012-08-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii. PMID:22759313

  9. Location of the alpha-amylase gene in rumen Streptococcus bovis strains distinguished by unstable amylase activity.

    Science.gov (United States)

    Mareková, M; Jonecová, Z; Kmeĭ, V

    1995-01-01

    Genetic stability of amylase activity after serial subcultivation experiments with amylolytic ruminal Streptococcus bovis strains was investigated. Two strains Amy+ and Amy- were obtained. Loss of amylase activity connected with the loss of plasmid DNA was not found in these strains. The presence of the gene responsible for the amylase activity in the chromosome of these strains was revealed by hybridization of the alpha-amylase gene on pJK108 against chromosomal DNA of S. bovis and Bacillus subtilis after a complete restriction with EcoRI. PMID:8851562

  10. a-Amylase activity during pullulan production and a-Amylase gene analyses of Aureobasidium pullulans

    Science.gov (United States)

    The fungus Aureobasidium pullulans is the source of commercially produced pullulan, a high molecular weight polysaccharide that is used in the manufacture of edible films. It has been proposed that alpha-amylase negatively affects the molecular weight of pullulan in late cultures. Based on a recen...

  11. Thermostable, Raw-Starch-Digesting Amylase from Bacillus stearothermophilus

    OpenAIRE

    Kim, Jaeyoung; Nanmori, Takashi; Shinke, Ryu

    1989-01-01

    An endospore-forming thermophilic bacterium, which produced amylase and was identified as Bacillus stearothermophilus, was isolated from soil. The amylase had an optimum temperature of 70°C and strongly degraded wheat starch granules (93%) and potato starch granules (80%) at 60°C.

  12. The Amylase Project: Creating a Classroom of Biotechnologists.

    Science.gov (United States)

    Sweeney, Diane

    1998-01-01

    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  13. Method for using a yeast alpha-amylase promoter

    Science.gov (United States)

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  14. Application of microbial α-amylase in industry - A review

    Directory of Open Access Journals (Sweden)

    Paula Monteiro de Souza

    2010-12-01

    Full Text Available Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  15. The activity of granulocyte alpha-amylase in acute appendicitis.

    Science.gov (United States)

    Zakrzewska, I; Gajda, R

    1994-01-01

    The activity of alpha-amylase was measured in isolated granulocytes, serum and urine of 35 patients with acute appendicitis. The measurements were performed before operation and on the 7th day after operation. Slightly increased activity of alpha-amylase was found in the serum and urine of 15 patients. On the 7th day after operation the activity of this enzyme reached normal value. The activity of granulocyte alpha-amylase was elevated in 22 patients. In 2 of them the increased activity still maintained on the 7th day after operation. Positive correlation between the serum and granulocyte alpha-amylase activities was found. These observations allow to conclude that granulocytes are the source of increased alpha-amylase activity in the serum of patients with acute appendicitis. PMID:7497089

  16. Adsorption of amylase enzyme on ultrafiltration membranes

    DEFF Research Database (Denmark)

    Beier, Søren; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios;

    2007-01-01

    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of an amylase-F has been measured on two different ultrafiltration membranes, both with a cut-off value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-mo...... cake-layer thickness, which is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects can not be neglected. Therefore stagnant film theory and the osmotic pressure model can describe the dependency between flux and bulk concentration....

  17. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji; Svensson, Birte

    2004-01-01

    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunit...

  18. Activity and storage of commercial amylases in the 2013 Louisiana grinding season

    Science.gov (United States)

    A current problem in the application of amylases at sugarcane factories is the existence of a wide variation in the activities and activity per unit cost of commercial amylases. The efficiency of amylase action to break down starch in the factory is related to the activity of the amylase used. Until...

  19. Alpha-amylase inhibition kinetics by caulerpenyne

    Directory of Open Access Journals (Sweden)

    S. CENGIZ

    2012-12-01

    Full Text Available Many algae have important secretions which are generally used for defensive purposes. These secretions take attentions of a lot of researchers who are wondering if these metabolites can be used for medical researches or not. Among these metabolites, caulerpenyne (CYN which is the main metabolite of Caulerpa species, have had an important place in Caulerpa researches since the results related to its determined properties such as cytotoxic, antiviral, antiproliferative and apoptotic effects have been proven by many scientific reports. In the present study, the inhibitory effect of CYN isolated from C. prolifera on alpha-amylase was investigated. The inhibition experiments were done with CYN by spectrophotometric determination method. In order to evaluate the type of inhibition Lineweaver–Burk plot was produced. The results obtained from enzyme kinetic studies exhibited an un-competitive type of inhibition, which is characterized by the difference of Vmax and KM from those of the free enzyme, of alpha-amylase in the presence of CYN. The present study showed that Caulerpa species can be a potential target for producing diabetic drugs in the light of the results obtained for CYN.

  20. Estimation of restraint stress in rats using salivary amylase activity.

    Science.gov (United States)

    Matsuura, Tetsuya; Takimura, Ryo; Yamaguchi, Masaki; Ichinose, Mitsuyuki

    2012-09-01

    The rat is an ideal model animal for studying physical and psychological stresses. Recent human studies have shown that salivary amylase activity is a useful biomarker of stress in our social life. To estimate the usefulness of amylase activity as a biomarker of stress in rats, we analyzed changes in physiological parameters including amylase activity and anatomical variables, which were induced by a mild restraint of paws (10 min, 3 times/week, 9 weeks). The quantities of food and water intake and excretion amount of the stress rats were smaller than those of the control rats during the experimental period (5-13 weeks). The body weight of the stress rats decreased compared with that of the control rats. Moreover, the enlargement of the adrenal gland was confirmed in the stress rats, indicating that the mild restraint caused a chronic stress response. The amylase activities of the stress rats were significantly greater than those of the control rats at 5 weeks of age. However, the amylase activity of the stress rats decreased compared with that of the control rats after 6 weeks of age. These results indicate that amylase activity is increased by acute stress and reduced by chronic stress, which is caused by repeated restraint stress. In conclusion, amylase activity is a useful biomarker of acute and chronic stresses in rats. PMID:22753135

  1. Antiviral Cystine Knot α-Amylase Inhibitors from Alstonia scholaris.

    Science.gov (United States)

    Nguyen, Phuong Quoc Thuc; Ooi, Justin Seng Geap; Nguyen, Ngan Thi Kim; Wang, Shujing; Huang, Mei; Liu, Ding Xiang; Tam, James P

    2015-12-25

    Cystine knot α-amylase inhibitors are cysteine-rich, proline-rich peptides found in the Amaranthaceae and Apocynaceae plant species. They are characterized by a pseudocyclic backbone with two to four prolines and three disulfides arranged in a knotted motif. Similar to other knottins, cystine knot α-amylase inhibitors are highly resistant to degradation by heat and protease treatments. Thus far, only the α-amylase inhibition activity has been described for members of this family. Here, we show that cystine knot α-amylase inhibitors named alstotides discovered from the Alstonia scholaris plant of the Apocynaceae family display antiviral activity. The alstotides (As1-As4) were characterized by both proteomic and genomic methods. All four alsotides are novel, heat-stable and enzyme-stable and contain 30 residues. NMR determination of As1 and As4 structures reveals their conserved structural fold and the presence of one or more cis-proline bonds, characteristics shared by other cystine knot α-amylase inhibitors. Genomic analysis showed that they contain a three-domain precursor, an arrangement common to other knottins. We also showed that alstotides are antiviral and cell-permeable to inhibit the early phase of infectious bronchitis virus and Dengue infection, in addition to their ability to inhibit α-amylase. Taken together, our results expand membership of cystine knot α-amylase inhibitors in the Apocynaceae family and their bioactivity, functional promiscuity that could be exploited as leads in developing therapeutics. PMID:26546678

  2. Amylase inhibits Neisseria gonorrhoeae by degrading starch in the growth medium.

    OpenAIRE

    Gregory, M R; Gregory, W W; Bruns, D.E.; Zakowski, J J

    1983-01-01

    Highly purified salivary alpha-amylase inhibited the growth of fresh isolates of Neisseria gonorrhoeae on GC agar base medium supplemented with 2% IsoVitaleX (BBL Microbiology Systems). Hydrolysis of starch in the medium by amylase resulted in a negative starch-iodine test. However, purified amylase did not inhibit gonococcal growth on agar plates that contained hemoglobin (chocolate agar). This effect was not caused by inhibition of amylase, since amylase activity was the same in the presenc...

  3. Mass Spectrometric Analysis of Whole Secretome and Amylase-precipitated Secretome Proteins from Streptococcus gordonii

    OpenAIRE

    Maddi, A; Haase, EM; Scannapieco, FA

    2014-01-01

    Oral biofilm (dental plaque) is formed by the initial adhesion of “pioneer species” to salivary proteins that form the dental pellicle on the tooth surface. One such pioneer species, Streptococcus gordonii, is known to bind salivary amylase through specific amylase-binding proteins such as amylase-binding protein A (AbpA). Recent studies have demonstrated that once bound, salivary amylase appears to modulate gene expression in S. gordonii. However, it is not known if this amylase-induced gene...

  4. [Production of mutants with an increased alpha-amylase synthesis].

    Science.gov (United States)

    Ostrikova, N A; Konovalov, S A

    1978-01-01

    A mutant characterized by elevated biosynthesis of alpha-amylase was obtained as a result of a three-stage induced selection using nitroso compounds. Changes of mutagens in the course of selection stages and the establishment of their effective doses causing the maximum accumulation of mutations yielded the mutant which produced 2.5 times more alpha-amylase than the parent strain of Aspergillus oryzae 762. The induced variability of the mutant can be registered on a solid growth medium and provides the high activity of alpha-amylase. PMID:309059

  5. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.;

    2005-01-01

    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active...

  6. Alpha-amylase gene transcription in tissues of normal dog.

    OpenAIRE

    Mocharla, H; Mocharla, R; Hodes, M E

    1990-01-01

    We studied the distribution of alpha-amylase mRNA in normal dog tissues by northern blotting (NB) and reverse transcription-polymerase chain reaction (RT-PCR) with human pancreatic (AMY2) and salivary (AMY1) alpha-amylase cDNA-specific primers. Analysis of poly(A+) RNA from various normal tissues by NB indicated the presence of detectable levels of alpha-amylase mRNA transcripts only in pancreas. Dot-blot analysis of DNA amplified with primers common to both (human) isoamylase mRNAs showed pr...

  7. Nanoactivator mediated modifications in thermostable amylase from Bacillus licheniformis.

    Science.gov (United States)

    Khairnar, Rajendra S; Mahabole, Megha P; Pathak, Anupama P

    2012-12-01

    Gram-positive rod-shaped thermophilic bacteria were isolated using samples collected from terrestrial natural thermal spring located at Unkeshwar (Longitude 78.22 degree East to 78.34 degree East, Latitude 19 degree 34' North to 19 degree 40' North), District Nanded, Maharashtra State, India. The isolates were then cultivated using selective media and identified using culture-dependent techniques. One prominent isolate (UN1) exhibited high temperature stability and remarkable amylase production and was identified as Bacillus licheniformis. Amylase production was carried out in starch media and the enzyme was partially purified and characterized for optimization of pH and temperature. Amylolytic activity of the enzyme was determined. Nanoactivator-mediated modifications were carried out to enhance amylolytic activity of the partially purified amylase. Three-fold increase in catalytic efficiency of amylase was obtained after modification. PMID:23350283

  8. Screening of marine actinobacteria for amylase enzymes inhibitors

    OpenAIRE

    Raja, S.; Ganesan, S.; Sivakumar, K.; Thangaradjou, T.

    2010-01-01

    Amylase inhibitor producing actinobacteria were isolated and characterized from terrestrial environment and there is no much report found from marine environment, hence in the present study, 17 strains isolated from the rhizosphere sediments of mangroves were tested for their amylase inhibition ability. Seawater requirement test for the growth of actinobacteria found that the strains SSR-3, SSR-12 and SSR-16 requires at least 50% and SSR-6 requires at least 25% seawater for their growth. The ...

  9. Coordination of murine parotid secretory protein and salivary amylase expression.

    OpenAIRE

    Poulsen, K; Jakobsen, B K; Mikkelsen, B M; Harmark, K; Nielsen, J T; Hjorth, J P

    1986-01-01

    PSP, parotid secretory protein, and salivary amylase are the major secretory proteins of mouse parotid gland where they appear in a constant ratio. Here we describe the isolation of the PSP gene and show through expression analysis on this and the salivary amylase gene that the two genes are transcribed in a coordinate fashion in adult animals, whereas the activation profiles are different during postnatal development. An explanation is put forward that involves activation of the genes at dif...

  10. Anaerobic Threshold and Salivary α-amylase during Incremental Exercise

    OpenAIRE

    Akizuki, Kazunori; Yazaki, Syouichirou; Echizenya, Yuki; Ohashi, Yukari

    2014-01-01

    [Purpose] The purpose of this study was to clarify the validity of salivary α-amylase as a method of quickly estimating anaerobic threshold and to establish the relationship between salivary α-amylase and double-product breakpoint in order to create a way to adjust exercise intensity to a safe and effective range. [Subjects and Methods] Eleven healthy young adults performed an incremental exercise test using a cycle ergometer. During the incremental exercise test, oxygen consumption, carbon d...

  11. The structure of two distinct pancreatic amylase genes in mouse strain YBR

    DEFF Research Database (Denmark)

    Mikkelsen, BM; Clark, ME; Christiansen, Gunna;

    1985-01-01

    The amylase complex on mouse chromosome 3 encodes both salivary and pancreatic amylase. It appears that one active gene is present for salivary amylase, whereas pancreatic amylase in some strains is coded by at least 4, and perhaps by more than 10, genes. Strain YBR is different from other strains...... in that it produces twice as much salivary amylase. Pancreatic amylase in YBR is present as two different protein forms, A beta and B beta, the sum of which amounts to only one-third of that in, for instance, strain A/J. YBR chromosomal DNA was cloned in phage gamma, followed by restriction and...... heteroduplex analysis of recombinant phages carrying amylase genes. Among 32 phage isolates, 5 carried parts of the salivary amylase sequence. The remaining phage isolates contained pancreatic amylase-like sequences and represented three nonoverlapping genomic regions, i.e., one of 34 kb containing a complete...

  12. Alcoholysis reactions from starch with alpha-amylases.

    Science.gov (United States)

    Santamaría, R I; Del Río, G; Saab, G; Rodríguez, M E; Soberón, X; López-Manguía, A

    1999-06-11

    The ability of alpha-amylases from different sources to carry out reactions of alcoholysis was studied using methanol as substrate. It was found that while the enzymes from Aspergillus niger and Aspergillus oryzae, two well-studied saccharifying amylases, are capable of alcoholysis reactions, the classical bacterial liquefying alpha-amylases from Bacillus licheniformis and Bacillus stearothermophilus are not. The effect of starch and methanol concentration, temperature and pH on the synthesis of glucosides with alpha-amylase from A. niger was studied. Although methanol may inactivate alpha-amylase, a 90% substrate relative conversion can be obtained in 20% methanol at a high starch concentration (15% w/v) due to a stabilizing effect of starch on the enzyme. As the products of alcoholysis are a series of methyl-oligosaccharides, from methyl-glucoside to methyl-hexomaltoside, alcoholysis was indirectly quantified by high performance liquid chromatography analysis of the total methyl-glucoside produced after the addition of glucoamylase to the alpha-amylase reaction products. More alcoholysis was obtained from intact soluble starch than with maltodextrins or pre-hydrolyzed starch. The biotechnological implications of using starch as substrate for the production of alkyl-glucosides is analyzed in the context of these results. PMID:10386619

  13. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    International Nuclear Information System (INIS)

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with 125I-labeled HSMSL or 125I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of [125I]alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch

  14. Some studies of alpha-amylase production using Aspergillus oryzae.

    Science.gov (United States)

    Esfahanibolandbalaie, Z; Rostami, K; Mirdamadi, S S

    2008-11-15

    The extracellular alpha-amylase production by Aspergillus oryzae was studied in submerged fermentation using an Adlof-Kuhner orbital shaker. The effect of initial pH values in the range of 4 to 7.5 on enzyme production was investigated and initial pH medium of 6.2 +/- 0.1 resulted in enhanced alpha-amylase production. The effect of carbon and nitrogen source and composition was examined and it has been observed that corn starch concentration of 15 g L(-1) has sound effect on enzyme production. The medium containing corn starch, sodium nitrate resulted in considerable higher enzyme production. Further, the yeast extract of 2.5 g L(-1) in the medium produced higher enzyme in view to other organic nitrogen sources. The effect of temperature on alpha-amylase production from 20 to 40 degrees C has been studied and at 35 +/- 1 degrees C higher alpha-amylase has been obtained. The effect of shaker's speed on alpha-amylase production from 50 to 200 rpm was investigated. And at about 180 rpm higher enzyme production has been observed. In the present study, it has been found that glucose has repressing effect on a-amylase production using A. oryzae PTCC5164. PMID:19260332

  15. Production of Alpha Amylase by Bacillus cereus in Submerged Fermentation

    Directory of Open Access Journals (Sweden)

    Helen H. Raplong

    2014-09-01

    Full Text Available Microorganisms have the ability to secrete enzymes when they are grown in the presence of certain substrates. Amylases are among the most important industrial enzymes and are of great significance in biotechnological studies. Bacteria belonging to the genus Bacillus were isolated using mannitol egg yolk polymyxin B (MYP agar a highly selective media for Bacillus cereus isolation. The isolates were tested for α-amylase production on nutrient agar supplemented with starch and in submerged fermentation. The bacteria isolated and identified (using the Microgen Bacillus identification kit were all Bacillus cereus and SB2 had the largest zone of hydrolysis of 12mm on nutrient agar supplemented with starch as well as the highest enzyme activity of 1.62U/ml. Amylase activity of 2.56U/ml was obtained after 24 hours incubation in submerged fermentation. When amylase enzyme production parameters where optimized, maximum amylase activity was obtained at a pH of 6.5, temperature of 350C, incubation time of 24 hours and 4% inoculums concentration. Bacillus cereus SB2 is a potential isolate for alpha-amylase production with soluble starch as the sole carbon source in submerged fermentation.

  16. Study of Serum Amylase and Serum Cholinesterase in Organophosphorus Poisoning

    Directory of Open Access Journals (Sweden)

    Sharan Badiger

    2016-04-01

    Full Text Available Background: Poisoning due to organophosphorus compounds is most commonly seen. Earlier plasma cholinesterase level was used to assess the severity of poisoning. Presently serum amylase is being recommended as a better indicator of severity. Aims and Objectives: To study plasma cholinesterase and serum amylase levels in acute organophosphorus and to correlate serum amylase levels with clinical severity and outcome. Material and Methods: A total of 80 patients in the study admitted to a tertiary care centre within 24 hours with a history of organophosphorus poisoning were included in study. Estimation of plasma cholinesterase and serum rd amylase was done at the time of admission, and on 3 th day and on 5 day. Results: Occurrence of organophosphorus poisoning was more common among age group 21-30 years and among males (57.5%. They were 25 (31.2% farmers, 23 (28.8% st u d e n ts, a n d 2 2 ( 2 7 . 5% h o u s ewi v e s. Monocrotophos (45.0% was commonly used compound. Mean value of plasma cholinesterase and serum amylase at admission are 3693 U/L, and 185.4 U/L. There was significant inhibition of plasma cholinesterase and elevation of serum amylase at th admission with return to normal values on 5 day. Conclusion: Plasma cholinesterase inhibition 200 U/L has been associated with poor prognosis and proneness to respiratory failure.

  17. Expression of the human amylase genes: recent origin of a salivary amylase promoter from an actin pseudogene.

    OpenAIRE

    Samuelson, L C; Wiebauer, K; Gumucio, D L; Meisler, M H

    1988-01-01

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. We have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at ...

  18. Study of total serum amylase, its salivary and pancreatic fraction and the pancreatic to salivary amylase ratio in testicular tumours.

    OpenAIRE

    Khanolkar M; Sirsat A; Deshmane V; Kamat M

    1991-01-01

    Serum levels of total amylase, its pancreatic fraction (P), salivary fraction (S), and the ratio of pancreatic to salivary fraction (P/S) were determined in 52 cases of histologically proved testicular germ cell tumours and 33 healthy controls. Total serum amylase remained unchanged, but the salivary fraction had a lower mean value. P/S ratio and the pancreatic fraction were significantly elevated in both seminomatous and non- seminomatous tumours. The ratio was more frequently raised in non-...

  19. Salivary alpha-amylase: More than an enzyme Investigating confounders of stress-induced and basal amylase activity

    OpenAIRE

    Strahler, Jana

    2010-01-01

    Summary: Salivary alpha-amylase: More than an enzyme - Investigating confounders of stress-induced and basal amylase activity (Dipl.-Psych. Jana Strahler) The hypothalamus-pituitary-adrenal (HPA) axis and the autonomic nervous system (ANS) are two of the major systems playing a role in the adaptation of organisms to developmental changes that threaten homeostasis. The HPA system involves the secretion of glucocorticoids, including cortisol, into the circulatory system. Numerous studies hav...

  20. THE DYNAMICS OF TOTAL AMYLASE\\'S ACTIVITY IN PANICUM MILIACEUM AND SETARIA GLAUCA DURING THE GERMINATION PERIOD

    OpenAIRE

    Elena Ciornea; Vlad Artenie; Cojocaru Dumitru; Gabriela Vasile

    2006-01-01

    : It was studied the dynamics of total amylase\\'s activity in millet (Panicum miliaceum) and bristle grass (Setaria glauca) during the germination period. The enzymatic activity was determined by the Noelting - Brenfeld method, the results obtained being expressed in M maltose / g. In both millet and bristle grass, it was evidenced that both parameters taken into study (the species and the germination time) do influence the enzymatic activity, although to a different extent.

  1. THE DYNAMICS OF TOTAL AMYLASE\\'S ACTIVITY IN PANICUM MILIACEUM AND SETARIA GLAUCA DURING THE GERMINATION PERIOD

    Directory of Open Access Journals (Sweden)

    Elena Ciornea

    2006-08-01

    Full Text Available : It was studied the dynamics of total amylase\\'s activity in millet (Panicum miliaceum and bristle grass (Setaria glauca during the germination period. The enzymatic activity was determined by the Noelting - Brenfeld method, the results obtained being expressed in M maltose / g. In both millet and bristle grass, it was evidenced that both parameters taken into study (the species and the germination time do influence the enzymatic activity, although to a different extent.

  2. Close relationship of a novel Flavobacteriaceae α-amylase with archaeal α-amylases and good potentials for industrial applications

    OpenAIRE

    Li, Chunfang; Du, Miaofen; Cheng, Bin; Wang, Lushan; Liu, Xinqiang; Ma, Cuiqing; Yang, Chunyu; Xu, Ping

    2014-01-01

    Background Bioethanol production from various starchy materials has received much attention in recent years. α-Amylases are key enzymes in the bioconversion process of starchy biomass to biofuels, food or other products. The properties of thermostability, pH stability, and Ca-independency are important in the development of such fermentation process. Results A novel Flavobacteriaceae Sinomicrobium α-amylase (FSA) was identified and characterized from genomic analysis of a novel Flavobacteriac...

  3. Interstrain Variation in Amylase Gene Copy Number and mRNA Abundance in Three Mouse Tissues

    OpenAIRE

    Meisler, Miriam H.; Antonucci, Tammy K.; Treisman, Laurelee O.; Gumucio, Deborah L.; Samuelson, Linda C.

    1986-01-01

    Amylase expression in strain YBR differs in several respects from the standard mouse phenotype. The synthesis of salivary amylase is elevated twofold in YBR mice and the synthesis of pancreatic amylase is reduced to one-half the normal rate. We have compared the concentrations of amylase mRNA in the parotid, liver and pancreas of YBR mice with those in strains A/J and C3H. We observed differences in amylase mRNA abundance which can account for the levels of amylase protein synthesis in the pa...

  4. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment

    OpenAIRE

    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng

    2016-01-01

    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using...

  5. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.

    Science.gov (United States)

    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L

    2016-01-01

    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result. PMID:27327179

  6. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota.

    Science.gov (United States)

    Yan, Shaomin; Wu, Guang

    2016-02-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, including 3118 α-amylases and 280 β-amylases from archaea, eukaryota and bacteria with fully documented taxonomic lineage. First, the phylogenetic tree was created to analyze the evolution of amylases with focus on individual amylases used in biofuel industry. Second, the average pairwise p-distance was computed for each kingdom, phylum, class, order, family and genus, and its diversity implies multi-time and multi-clan evolution. Finally, the variance was further partitioned into inter-clan variance and intra-clan variance for each taxonomic group, and they represent horizontal and vertical gene transfer. Theoretically, the results show a full picture on the evolution of amylases in manners of vertical and horizontal gene transfer, and multi-time and multi-clan evolution as well. Practically, this study provides the information on the surviving chance of desired amylase in a given taxonomic group, which may potentially enhance the successful rate of cloning and expression of amylase gene in different species. PMID:26745984

  7. PURIFICATION AND CHARACTERIZATION OF THERMOSTABLE AMYLASE FROM PSYCHROPHILE

    Directory of Open Access Journals (Sweden)

    Ankita Muwalia

    2014-03-01

    Full Text Available Soil is a complex, dynamic and living habitat for a large number of organisms. Bacteria are an important part of the soil micro-flora because of their abundance, species diversity and the multiplicity of their metabolic activities. Soil is the medium for a large variety of organisms and interacts closely with the wider biosphere; conversely, biological activity is a primary factor in the physical and chemical formation of soils. In the present study, Bacteria from soil samples were isolated and identified according to standard method. 71 isolates were isolated from different region of India. Different isolates were identified as Klebsiella sp., Micrococcus sp., Bacillus sp., Staphylococcus sp., Enterobacter sp., Citrobacter sp., Neisseria sp., Pseudomonas sp. and also screened for some enzymes of biotechnological importance. Isolates were screened for hydrolytic activity of amylase, protease and cellulase. All the isolates elaborated enzymatic activity which were rank as follow: amylase 40%, cellulase 30%, protease 21%. Isolates of soil samples were shown highest hydrolytic activity of amylase. This study revealed that isolates associated with soil samples and their ability to produces hydrolytic enzymes. Amylase is highly demanded industrial enzyme in various sectors such as pharmaceutical, food, textiles, detergent. WL-2 isolate was further characterized characterized by using MSA (mannitol salt agar. WL-2 show yellow colour halo on MSA. WL-2 isolate was selected as best amylase producer and identified as Staphylococcus aureus. WL-2 isolate was shown amylase positive results by producing clear halos in the TSA agar medium. AS-2 isolate was shown their enzyme activity at 0.879 absorbance which is corresponds to 24000 U of amylase production. Enzyme showed an optimum activity at pH 6.5 and highly stable at optimum temperature at 7.5.

  8. [Are amylases in bakery products and flour potential food allergens?].

    Science.gov (United States)

    Baur, X; Sander, I; Jansen, A; Czuppon, A B

    1994-05-21

    The enzyme alpha-amylase from the mould Aspergillus oryzae (Asp o II) routinely used for the production of bread, cakes and pastries has in recent years been identified as an inhalative allergen for occupational diseases (bakers' asthma). It is doubtful whether this amylase in the final product, i.e. after the baking procedure, can still be regarded as an allergen. To clarify this question, detailed case histories on 138 subjects were recorded (98 allergics, 20 patients suffering form chronic intestinal diseases, 20 healthy controls). The clinical examinations included prick skin test and IgE antibody determination using one of the customary enzyme preparations. EAST showed a few of these 138 bread consumers to be weakly sensitized to the enzyme. One of the subjects displayed a significant reaction to alpha-amylase heated to 200 degrees C. As expected, eleven bakers sensitized to alpha-amylase by inhaling it in the workplace (positive prick test, positive case history) predominantly exhibited specific IgE antibodies to the native enzyme. Apart from one weakly positive finding, heated alpha-amylase yielded negative results in this collective. Baking conditions vary widely, especially with regard to single components, temperature and duration. Thus, further investigations as to residual allergenicity or the feasible occurrence of new antigenic determinants during the production of bread, cake and pastries are required. 27% of bakers examined and 9% of atopics showed antibodies to a flour inherent enzyme, a beta-amylase. On the whole, the selected conditions hinted at a weakly sensitizing potential inherent in baking flour and in added amylase. PMID:8209207

  9. Optimization of α-amylase production by Bacillus amyloliquefaciens using response surfaces methodology

    Directory of Open Access Journals (Sweden)

    Hami Kaboosi

    2014-11-01

    α-amylase. The results showed that the RSM applied for optimizing parameters of submerged fermentation condition aimed at producing maximum quantities of α-amylase by B. amyloliquefaciens acts with high efficiency.

  10. Topographies of Organized Monolayer of α-Amylase Observed by Atomic Force Microscopy

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    In this paper, a-amylase organized monolayer was assembled on the surface of the PET-CO2- substrate in different conditions. The different topography of the a-amylase/PET monolayer was obtained by AFM in tapping mode.

  11. Effect of chemicals on fungal alpha-amylase activity.

    Science.gov (United States)

    Ali, F S; Abdel-Moneim, A A

    1989-01-01

    The effect of 8 growth regulators at concentrations of 1,000, 5,000 and 10,000 ppm on the activity of fungal (Aspergillus flavus var. columnaris) alpha-amylase was studied. Indol acetic acid (IAA) and naphthalene acetic acid (NAA) inhibited alpha-amylase activity by 2% and 7% at 1,000 ppm. The other 6 growth regulators, indol butyric acid (IBA), gibberellic acid, cumarin, cycocel (CCC), atonik-G and kylar, did not inhibit but stimulated alpha-amylase activity (0 to 9%) at 1,000 ppm. All growth regulators studied inhibited alpha-amylase activity at 5,000 and 10,000 ppm concentration except kylar. The effect of organic acids and formaldehyde at 0.01, 0.005, and 0.001 M was studied. Acetic acid stimulated alpha-amylase at all concentrations, but formic acid, oxalic acid, lactic acid and citric acid inhibited alpha-amylase activity by 91, 100, 100 and 79%, respectively, at a concentration of 0.01 M, while by 31, 100, 15 and 20%, respectively, at 0.005 M. Formaldehyde induced 7, 3 and 2% inhibition at 0.01, 0.005 and 0.001 M, respectively. At 0.01 M either sorbitol or fructose inhibited alpha-amylase by 8%, Maltose 7%, sucrose 6%, phenol, glucose and galactose each by 5%, ethanol, glycerol, arabinose and sodium benzoate each by 4%, isopropanol and mannitol 1%, but methanol and ammonium citrate dibasic did not inhibit alpha-amylase. The results indicate that CuCl2, SnCl2, AgNO3 and Fe2(SO4)3 were the strongest inhibitors, followed by Cd(C2H3O2), HgCl2, Na2-EDTA, Na2HPO4, and CaCl2 in decreasing order. NaCl, NaBr and Mn SO4 did not inhibit alpha-amylase at concentrations from 10 mM to 0.01 mM. PMID:2515680

  12. Amylase production by a Schwanniomyces occidentalis mutant in chemostat culture

    Energy Technology Data Exchange (ETDEWEB)

    Horn, C.H.; Du Preez, J.C.; Kilian, S.G. (Univ. of the Orange Free State, Bloemfontein (South Africa). Dept. of Microbiology and Biochemistry)

    1992-05-01

    In carbon-limited chemostat culture the cell yields of a Schwanniomyces occidentalis mutant increased slightly from 0.58 g cells.g{sup -1} starch at a dilution rate of 0.05 h{sup -1} to 0.64 at 0.2 h{sup -1}. The maintenance energy requirement was 0.012 g starch.g{sup -1} cells.h{sup -1} and the critical dilution rate was 0.22 h{sup -1} at 30deg C. Specific {alpha}-amylase activity decreased with an increase in dilution rate. The specific activities of glucoamylase and debranching activity initially increased with an increase in dilution rate up to 0.1 h{sup -1}, followed by a decrease in activity at higher dilution rates. Greatly higher levels of amylase activity were obtained in chemostat cultures than in batch cultures. The maximum temperature where a steady state was reached was 37deg C, but production of amylases decreased with an increase in temperature. Amylase production was very sensitive to the dissolved oxygen tension (DOT), exhibiting a dramatic decrease at DOT values below 40% saturation. The critical DOT for growth was 31% of air saturation. On subjecting the mutant to anoxic conditions, growth as well as amylase production was arrested, but these continued after aeration was resumed. (orig.).

  13. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    Science.gov (United States)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  14. Thermo Stability Study of Crude Amylase from Bacillus Isolate

    Directory of Open Access Journals (Sweden)

    Moti Lal

    2015-09-01

    Full Text Available An amylolytic strain was collected from rotten potato and its activity evaluated. The isolated strain was cultivated for amylase production in shake flasks at 35±2oC and the fermentation pattern was studied. Optimum temperature for maximum enzyme synthesis was observed at 35°C, when initial pH of fermentation medium was adjusted to 5.5. Maximum extracellular amylase activity of 7.9 U/mL and the maximum intracellular activity of 320 U/mL was recorded. Although maximum biomass was present at 12.6 g/L but highest growth rate was observed between 08 to 40h with maximum at 36h. The extracellular amylase present in the broth was partially purified with an overall yield of 44% through purification procedure of ammonium sulphate precipitation. After completed extraction and partial purification and stabilization, the stability of enzyme was observed in a range of temperature and pH between 60°C-90°C and 2-8 pH respectively. Maximum enzyme activity was demonstrated at 90°C, and pH of 5.5 and 6.5. The thermo stability of the amylases of this Bacillus species was comparable to that of amylases from other microbial sources.

  15. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    Science.gov (United States)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  16. Acquired amylase production induced by radiotherapy in a myeloma patient

    International Nuclear Information System (INIS)

    A 55-year-old patient with multiple myeloma (IgG-λ) diagnosed in November 1988 was admitted because of bone pain throughout the body. After plasmapheresis and several courses of chemotherapy, a massive tumor of the left thoracic wall involving the rib appeared. Radiotherapy was performed to ameliorate the severe chest pain, after which myelomatous pleural effusion appeared on the left side. The serum, urine and pleural effusion revealed increased activity of amylase of the salivary type. Amylase activity was also detected in the supernatant of myeloma cells cultured from pleural effusion. We reviewed 12 cases of ectopic amylase-producing multiple myeloma. All the cases except one have been reported from Japan, and hyperamylasemia in these cases was detected at diagnosis or during course of the illness. Moreover, cytogenetic analysis of myeloma cells of previous reports revealed structural abnormalities including chromosome 1, near the amylase gene locus. This case also showed t (1; 10) (q21?; q26) by examination of 8 metaphase derived from bone marrow. These observations suggested that ectopic amylase production was induced by irradiation to the plasmacytoma of thoracic wall. (author)

  17. Production of amylase in liquid culture by a strain of Aspergillus oryzae.

    Science.gov (United States)

    Kundu, A K; Das, S

    1970-04-01

    The effect of different media and pH on the formation of amylase by Aspergillus oryzae EI 212 is described. Depending upon the composition of the medium and growth conditions, the fungus was found to secrete alpha- or beta-amylase, or both. Some of the properties of the partially purified alpha-amylase were found to be different from alpha-amylases from other sources. PMID:5418942

  18. The use of the Rapignost strip for estimating urinary amylase levels.

    OpenAIRE

    Touquet, V. L.; Wilcox, A H

    1985-01-01

    The Rapignost-Amylase urinary test strip (Behringwerke Laboratories) provides an estimation of urine amylase which takes a few minutes and is easy to perform. During a period of 9 months, 84 patients had their urine tested with this strip by casualty officers in the Accident and Emergency Department of St George's Hospital, London. In addition, urine amylase, and plasma amylase and creatinine were measured in the chemical pathology laboratory. In all but one instance, the result of the strip ...

  19. Exposure-response relations of alpha-amylase sensitisation in British bakeries and flour mills

    OpenAIRE

    Nieuwenhuijsen, M.J.; Heederik, D.J.J.; Doekes, G; Venables, K M; Newman Taylor, A. J.

    1999-01-01

    OBJECTIVES: To describe the levels of exposure to fungal alpha-amylase in British bakeries and flour mills, and to describe the relation between exposure to alpha-amylase and sensitisation to fungal alpha- amylase. METHODS: 495 personal flour dust samples were taken in seven British bakeries and flour mills and analysed for alpha-amylase with an immunoassay. Workers at the sites were asked to fill out questionnaires on work related symptoms, smoking history, and work history, and they w...

  20. General Biochemical Characterization of Thermostable Extracellular β-Amylase from Clostridium thermosulfurogenes

    OpenAIRE

    Hyun, H H; Zeikus, J G

    1985-01-01

    Clostridium thermosulfurogenes, an anaerobic bacterium which ferments starch into ethanol at 62°C, produced an active extracellular amylase and contained intracellular glucoamylase but not pullulanase activity. The extracellular amylase was purified 2.4-fold, and its general physicochemical and catalytic properties were examined. The extracellular amylase was characterized as a β-amylase (1,4-α-d-glucan maltohydrolase) based on demonstration of exocleavage activity and the production of malto...

  1. Regulation and genetic enhancement of beta-amylase production in Clostridium thermosulfurogenes.

    OpenAIRE

    Hyun, H H; Zeikus, J G

    1985-01-01

    We studied the general mechanism for regulation of beta-amylase synthesis in Clostridium thermosulfurogenes. beta-Amylase was expressed at high levels only when the organism was grown on maltose or other carbohydrates containing maltose units. Three kinds of mutants altered in beta-amylase production were isolated by using nitrosoguanidine treatment, enrichment on 2-deoxyglucose, and selection of colonies with large clear zones on iodine-stained starch-glucose agar plates. beta-Amylase was pr...

  2. Identification and characterization of amylase binding protein C (AbpC) from Streptococcus mitis NS51

    OpenAIRE

    Vorrasi, John; Chaudhuri, Biswendu; Haase, Elaine M.; Scannapieco, Frank A.

    2010-01-01

    A substantial proportion of the streptococcal species found in dental plaque biofilms are able to interact with the abundant salivary enzyme α-amylase. These streptococci produce proteins that specifically bind amylase. An important plaque species, Streptococcus mitis, secretes a 36-kDa amylase binding protein into the extracellular milieu. Proteins precipitated from S. mitis NS51 cell culture supernatant by the addition of purified salivary amylase were separated by SDS-PAGE, transferred to ...

  3. Impact of calcium on salivary α-amylase activity, starch paste apparent viscosity and thickness perception

    OpenAIRE

    Morris, Cecile

    2011-01-01

    Thickness perception of starch-thickened products during eating has been linked to starch viscosity and salivary amylase activity. Calcium is an essential cofactor for α-amylase and there is anecdotal evidence that adding extra calcium affects amylase activity in processes like mashing of beer. The aims of this paper were to (1) investigate the role of salivary calcium on α-amylase activity and (2) to measure the effect of calcium concentration on apparent viscosity and thic...

  4. Studies on the production of alkaline α-amylase from Bacillus subtilis CB-18

    OpenAIRE

    Ogbonnaya Nwokoro; Odiase Anthonia

    2015-01-01

    Background. Amylases are among the main enzymes used in food and other industries. They hydrolyse starch molecules into polymers composing glucose units. Amylases have potential applications in a number of industrial processes including foods and pharmaceutical industries. Alkaline α-amylase has the potential of hydrolysing starch under alkaline pH and is useful in the starch and textile industries and as an ingredient of detergents. Amylases are produced from plants, however, microbial...

  5. Application of microbial α-amylase in industry – A review

    OpenAIRE

    Paula Monteiro de Souza; Pérola de Oliveira e Magalhães

    2010-01-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential f...

  6. Evaluation of Traditional Indian Antidiabetic Medicinal Plants for Human Pancreatic Amylase Inhibitory Effect In Vitro

    OpenAIRE

    Ameeta Ravi Kumar; Shobha Bhargava; Smita Zinjarde; Remya Ravindran; Sudha Ponnusamy

    2010-01-01

    Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post prandial hyperglycemia via control of starch breakdown. Eleven Ayurvedic Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evaluate their inhibitory potential on pancreatic α-amylase. Analysis of 91 extracts, showed that 10 exhibited strong Human Pancreatic Amylase (HPA) inhibitory potential...

  7. Production of Thermostable α-amylases by Solid State Fermentation-A Review

    OpenAIRE

    Rahul Regulapati; Prem N. Malav; Gummadi, Sathyanarayana N

    2007-01-01

    α-amylases are digestive enzymes which hydrolyze α-1,4-glycosidic bonds in starch. α-amylases have a lot of potential applications in food processing industries such as sugar, baking, brewing and preparation of digestive aids. Thermostable α-amylases have received a lot of importance because of their usage under harsh industrial conditions. α-amylases can be produced by microorganisms using submerged and solid state fermentation. However, solid state fermentation is attractive because of usag...

  8. The role of α-amylase in the perception of oral texture and flavour in custards

    NARCIS (Netherlands)

    Wijk, R.A.de; Prinz, J.F.; Engelen, L.; Weenen, H.

    2004-01-01

    The role of salivary α-amylase in odour, flavour, and oral texture sensations was investigated in two studies in which the activity of salivary amylase present in the mouth of human subjects was either increased by presenting custards with added α-amylase or decreased by presenting custards with add

  9. [The β-amylase polymorphism of winter common wheat grains].

    Science.gov (United States)

    Netsvetaev, V P; Akinshina, O V; Bondarenko, L S; Motorina, I P

    2012-02-01

    The polymorphism of winter common wheat with respect to β-amylase isoenzymes has been analyzed using electrophoresis in polyacrylamide gel (PAAG) buffered with a Tris-glycine system (pH 8.3). Seven β-amylase isoenzymes have been found in wheat cultivars and the breeding stock. Isoenzymes A, B, and C are the most frequent in Russian and Ukrainian cultivars (51.7 4.7, 30.7 3.8, and 11.9 2.5%, respectively). Two alleles of the β-Amy-D1 locus of the long arm of chromosome 4D have been identified. The substrate-enzyme affine effect can be used to locate the zones of activity of this enzyme by means of staining for proteins. It has been determined that β-amylase zymotypes may play a role in the aggregating capacity of the grain protein complex via the formation of S-S bonds. PMID:22567995

  10. Culture medium for amylase production by toxigenic fungi

    Directory of Open Access Journals (Sweden)

    Figueira Edson Luiz Zangrando

    2000-01-01

    Full Text Available Mycelial growth and amylase production by a mycotoxigenic strain of Fusarium moniliforme and Aspergillus flavus were evaluated in a culture medium containing starch, glycerol, wheat bran or corn. With emphasis on corn, different fractions composed by germ, degermed seed, starch, milky stage corn and the respective starch or supernatant fraction were analyzed for F. moniliforme growth . The medium composed of milky stage corn supernatant promoted the best mycelial growth (p<0.05, and it was used to prepare amylase production medium in the next step. The medium composed with 2% ground corn in milky stage corn supernatant (350g of milky stage corn blended with 250mL water and centrifuged promoted the highest amylase production, which was at the 10th day of fermentation, both for F. moniliforme (42.32U/mL and A. flavus (4,745.54U/mL.

  11. THE INFLUENCE OF ALPHA AMYLASE ON THE QUALITY OF BREAD

    OpenAIRE

    CAPRITA RODICA; CRETESCU IULIANA; CHEREJI RODICA

    2013-01-01

    This study determined the quality of bread obtained from the control sample flour (M) and the quality of bread obtained from flour with addition of 3 different percentages of alpha amylase (P1-280000 U.SKB/ 100kg flour; P2-560000 U.SKB/ 100kg flour;P3-840000 U.SKB/ 100kg flour). Fungal alpha amylase was used in these concentrations in order to establish which one is the most suitable to be added in flour in order to obtain superior quality characteristics for bread: superior volume of bread, ...

  12. Thermo Stability Study of Crude Amylase from Bacillus Isolate

    OpenAIRE

    Moti Lal; Shiv Kumar Verma; Vipin Mishra; Mira Debnath

    2015-01-01

    An amylolytic strain was collected from rotten potato and its activity evaluated. The isolated strain was cultivated for amylase production in shake flasks at 35±2oC and the fermentation pattern was studied. Optimum temperature for maximum enzyme synthesis was observed at 35°C, when initial pH of fermentation medium was adjusted to 5.5. Maximum extracellular amylase activity of 7.9 U/mL and the maximum intracellular activity of 320 U/mL was recorded. Although maximum biomass was present at 12...

  13. Immobilization of Trichoderma harzianum α-Amylase on Treated Wool: Optimization and Characterization

    OpenAIRE

    Saleh A. Mohamed; Khan, Jalaluddin A; Omar A.M. Al-Bar; El-Shishtawy, Reda M.

    2014-01-01

    α-Amylase from Trichoderma harzianum was covalently immobilized on activated wool by cyanuric chloride. Immobilized α-amylase exhibited 75% of its initial activity after 10 runs. The soluble and immobilized α-amylases exhibited maximum activity at pH values 6.0 and 6.5, respectively. The immobilized enzyme was more thermally stable than the soluble one. Various substrates were hydrolyzed by immobilized α-amylase with high efficiencies compared to those of soluble α-amylase. The inhibition of ...

  14. Effect of therapeutic irradiation on serum amylase levels of cancer patients

    International Nuclear Information System (INIS)

    Serum amylase levels were estimated in forty cancer patients treated by radiotherapy. Amylase levels of normal controls and cancer patients did not reveal any significant differences. Amylase levels in cases with oral cancer were in the lower range as compared to the levels in cancer cases of other sites. Significant rise of levels in oral cancer cases after first sitting of 200 rads was attributed to hyperamylasia, produced in salivary glands by irradiation. Other amylase contributing organs showed the changes in the levels by irradiation but to a lesser extent. Pre- and post-radiotherapy amylase levels in most of the cancer cases were not significantly different. (author). 3 tables, 5 refs

  15. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji;

    2004-01-01

    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors....

  16. Extraction, Purification and Characterization of Thermostable, Alkaline Tolerant α-Amylase from Bacillus cereus

    OpenAIRE

    Annamalai, N.; Thavasi, R.; Vijayalakshmi, S.; Balasubramanian, T.

    2011-01-01

    Thermostable alkaline α-amylase producing bacterium Bacilluscereus strain isolated from Cuddalore harbour waters grew maximally in both shake flask and fermentor, and produced α-amylase at 35°C, pH 7.5 and 1.0% of substrate concentrations. α-Amylase activity was maximum at 65°C, pH 8.0, 89% of its activity was sustained even at pH 11.0. Added with MnCl2, α-amylase activity showed 4% increase but it was inhibited by EDTA. The molecular weight of the purified α-amylase is 42 kDa.

  17. Characterization of a new cell-bound alpha-amylase in Bacillus subtilis 168 Marburg that is only immunologically related to the exocellular alpha-amylase.

    OpenAIRE

    Haddaoui, E; Petit-Glatron, M F; Chambert, R

    1995-01-01

    Immunoblot analysis of Bacillus subtilis cell extracts with polyclonal antibodies, raised against purified exocellular alpha-amylase, revealed one protein species of 82,000 Da. This protein was found even in cells in which the amyE gene, encoding exocellular alpha-amylase, was disrupted. Isolated from the membrane fraction, the 82,000-M(r) protein displayed an alpha-amylase activity in vitro.

  18. Interaction of Salivary alpha-Amylase and Amylase-Binding-Protein A (AbpA) of Streptococcus gordonii with Glucosyltransferase of S. gordonii and Streptococcus mutans

    OpenAIRE

    Tanzer Jason M; Vickerman M; Rojek Jennifer; Chaudhuri Biswendu; Scannapieco Frank A

    2007-01-01

    Abstract Background Glucosyltransferases (Gtfs), enzymes that produce extracellular glucans from dietary sucrose, contribute to dental plaque formation by Streptococcus gordonii and Streptococcus mutans. The alpha-amylase-binding protein A (AbpA) of S. gordonii, an early colonizing bacterium in dental plaque, interacts with salivary amylase and may influence dental plaque formation by this organism. We examined the interaction of amylase and recombinant AbpA (rAbpA), together with Gtfs of S. ...

  19. The influence of nitrogen sources on the alpha-amylase productivity of Aspergillus oryzae in continuous cultures

    DEFF Research Database (Denmark)

    Pedersen, Henrik; Nielsen, Jens

    2000-01-01

    The influence of the nitrogen source on the cc-amylase productivity of Aspergillus oryzae was quantified in continuous cultivations. Both inorganic and complex nitrogen sources were investigated and glucose was used as the carbon and energy sources. For production of alpha-amylase, nitrate was...... cc-amylase productivity. The higher alpha-amylase productivity during growth on casein hydrolysate was not caused by increased transcription of the alpha-amylase genes but was caused by a faster secretion of alpha-amylase or by a lower binding of alpha-amylase to the biomass....

  20. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    Science.gov (United States)

    Brisman, J; Belin, L

    1991-09-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme. PMID:1832939

  1. Characterization of a new bacillus stearothermophilus isolate: a highly thermostable [alpha]-amylase-producing strain

    Energy Technology Data Exchange (ETDEWEB)

    Wind, R.D. (Agrotechnological Research Inst., Wageningen (Netherlands)); Buitelaar, R.M. (Agrotechnological Research Inst., Wageningen (Netherlands)); Eggink, G. (Agrotechnological Research Inst., Wageningen (Netherlands)); Huizing, H.J. (Agrotechnological Research Inst., Wageningen (Netherlands)); Dijkhuizen, L. (Dept. of Microbiology, Groningen Univ. (Netherlands))

    1994-04-01

    A novel strain of Bacillus stearothermophilus was isolated from samples of a potato-processing industry. Comapred to known [alpha]-amylases from other B. stearothermophilus strains, the isolate was found to produce a highly thermostable [alpha]-amylase. The half-time of inactivation of this [alpha]-amylase was 5.1 h at 80 C and 2.4 h at 90 C. The temperature optimum for activity of the [alpha]-amylase was 70 C; the pH optimum for activity was relatively low, in the range 5.5-6.0 [alpha]-Amylase synthesis was regulated by induction and repression mechanisms. An inverse relationship was found between growth rate and [alpha]-amylase production. Low starch concentrations and low growth temperatures were favourable for enzyme production by the organism. At the optimal temperature for growth, 65 C, the [alpha]-amylase was a growth-associated enzyme. The optimal temperature for [alpha]-amylase production, however, was 40 C, with [alpha]-amylase increasing from 3.9 units (U)/ml to 143 U/ml when lowering the growth temperature from 65 C to 40 C. Maximal [alpha]-amylase production in a batch fermentor run at 65 C was 102 U/ml, which was 26-fold higher than in erlenmeyer flasks at 65 C. The dissolved O[sub 2] concentration was found to be a critical factor in production of the [alpha]-amylase. (orig.)

  2. High-resolution α-amylase assay combined with high-performance liquid chromatography−solid-phase extraction−nuclear magnetic resonance spectroscopy for expedited identification of α-amylase inhibitors – proof of concept and α-amylase inhibitor in cinnamon

    DEFF Research Database (Denmark)

    Okutan, Leyla; Kongstad, Kenneth Thermann; Jäger, Anna;

    2014-01-01

    -resolution α-amylase inhibition profiles allowed detection of sub-microgram amounts of the α-amylase inhibitors. Furthermore, the high-resolution α-amylase inhibition assay/HPLC–HRMS–SPE–NMR platform allowed identification of cinnamaldehyde as the α-amylase inhibitor in cinnamon (Cinnamomum verum Presl.)....

  3. Drosophila melanogaster larvae control amylase secretion according to the hardness of food.

    Science.gov (United States)

    Sakaguchi, Honami; Suzuki, Masataka G

    2013-01-01

    Drosophila melanogaster larvae excrete amylase and perform external digestion of their food. In this study, to investigate whether their external digestion ability varies in response to changes in the external environment, we measured the relative amount of amylase excreted by larvae using a new method: the iodine starch agar method (ISAM). Analysis using this method revealed that the amount of amylase excreted by larvae increased in accordance with the increase in the agar concentration. In addition, we investigated the effect on the larval growth rate of adding amylase to the diet. Pupation occurred 24 h later in food containing 1% amylase than in food containing no amylase. These results suggest that the larvae adjust their amylase excretion in response to changes in the external environment, and that its level has a marked influence on the larval growth rate. PMID:23964241

  4. Drosophila melanogaster larvae control amylase secretion according to the hardness of food

    Directory of Open Access Journals (Sweden)

    HonamiSakaguchi

    2013-08-01

    Full Text Available Drosophila melanogaster larvae excrete amylase and perform external digestion of their food. In this study, to investigate whether their external digestion ability varies in response to changes in the external environment, we measured the relative amount of amylase excreted by larvae using a new method: the iodine starch agar method (ISAM. Analysis using this method revealed that the amount of amylase excreted by larvae increased in accordance with the increase in the agar concentration. In addition, we investigated the effect on the larval growth rate of adding amylase to the diet. Pupation occurred 24 h later in food containing 1% amylase than in food containing no amylase. These results suggest that the larvae adjust their amylase excretion in response to changes in the external environment, and that its level has a marked influence on the larval growth rate.

  5. 21 CFR 862.1070 - Amylase test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  6. Recommendations for Amylase Application in the 2008 Louisiana Grinding Season

    Science.gov (United States)

    Unfortunately, the application of amylase (an enzyme) to break down long chains of unwanted starch in U.S. sugarcane factories is still not optimized because of misinformation about which enzyme to use, and how to add the enzyme. Two large factory trials were conducted at a Louisiana factory to opti...

  7. Production and properties of alpha-amylase from Citrobacter species

    Directory of Open Access Journals (Sweden)

    Ebuta N. Etim-Osowo

    2009-04-01

    Full Text Available Amylase production by Citrobacter sp. isolated from potato was optimized in batch culture studies under shake flask conditions. Effects and interactions of best sources and levels of carbon and nitrogen estimated by 4 x 5 and 4 x 4 factorial experimental arrangements were significant (P < 0.01 on amylase production. Optimal alpha-amylase yield was obtained in a medium containing sorghum flour (2.0 % w/v and a mixture of (NH42SO4 + soybean meal (1.5% w/v with an initial medium pH of 8.0. Under optimum conditions, amylase yield was maximal (0.499 U/ml after 60h incubation at room temperature (28oC ± 2oC. Characterization studies showed that the enzyme had maximum activity at 60oC, retained 100% of its original activities at 60oC for 2h, was maximally active at pH 7.0 and retained 100% of original activities at pH 9.0 for 2h. Enzyme activity was stimulated by urea, Mg2+, Ca2+ and Zn2+ but inhibited by Hg2+.

  8. Kinetics of alpha-amylase secretion in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Henriksen, Anne Laurence Santerre; Carlsen, Morten; Bang de, H.;

    1999-01-01

    indicated that there are two pools of intracellular alpha-amylase: a fast secreted and a slow secreted. The secretion of those two pools were described with a kinetic model, which was fitted to the pulse chase experiments. (C) 1999 John Wiley & Sons, Inc. Biotechnol Bioeng 65: 76-82, 1999....

  9. Activity and cellular localization of amylases of rabbit cecal bacteria

    Czech Academy of Sciences Publication Activity Database

    Sirotek, Kamil; Marounek, Milan; Suchorská, O.

    2006-01-01

    Roč. 51, č. 4 (2006), s. 309-312. ISSN 0015-5632 R&D Projects: GA MŠk OC 848.001 Institutional research plan: CEZ:AV0Z50450515 Keywords : amylases Subject RIV: GH - Livestock Nutrition Impact factor: 0.963, year: 2006

  10. A comparative immunohistochemical study on amylase localization in the rat and human exocrine pancreas

    International Nuclear Information System (INIS)

    Objective was to localize amylase enzyme immunohistochemically in the pancreatic acinar cells of rats and humans using polyclonal sheep anti-human amylase antibody, and to compare between the intensities of their amylase-immunostaining. Indirect immunofluorescence method was applied on formaldehyde-fixed, and paraffin-embedded pancreatic sections obtained from adult male Wistar rats and autopsied human samples. Primary incubation was performed using sheep anti-amylase antibody followed by secondary incubation with fluorescein isothiocyanate-labeled rabbit anti-sheep IgG serum. Control tests of amylase immunospecificity were also undertaken either by incubation with primary antibodies previously pre-adsorbed with an excess of human pancreatic amylase, or only with secondary antibodies. The amylase immunofluorescence was positively and homogenously detected in all acinar cells of both rat and human pancreatic stained sections. The immunostaining was clearly demonstrated in the cell apices and peri-nuclear areas, but it was consistently brighter and more intense in the human acinar cells compared with that of the rat pancreas. Control tests of amylase immunofluorescence revealed the specificity of the antibodies applied for amylase localization in rat and human pancreas. Although many previous immunohisto- and cytochemical reports have successfully localized amylase in the pancreas of different mammalian species, but all of them have used locally prepared anti-amylase antibodies. The present report successfully illustrates immuno-localization of amylase in the pancreatic acinar cells of rats and humans using commercial polyclonal sheep anti-human pancreatic amylase antibodies, and also suggests their useful application in the immunochemical studies on various mammalian species. Additionally, the results indicate a structural similarity between the human and rat pancreatic amylases, a concept required further exploration. (author)

  11. A 78-kilobase region of mouse chromosome 3 contains salivary and pancreatic amylase genes and a pseudogene.

    OpenAIRE

    Wiebauer, K; Gumucio, D L; Jones, J M; Caldwell, R M; Hartle, H T; Meisler, M H

    1985-01-01

    Genetic studies have demonstrated that salivary and pancreatic amylase genes are closely linked in human and mouse. To analyze the arrangement of genes within the amylase cluster, a library of YBR mouse genomic DNA was cloned in the cosmid vector pJB8. Clones containing amylase genes were identified by hybridization with amylase cDNA probes. Salivary and pancreatic amylase genes were isolated on separate cosmid clones, but no overlapping clones were evident from the initial screening. A strat...

  12. A Study on Effect of different culture media on amylase enzyme production by a native strain of Bacillus subtilis

    OpenAIRE

    ziba Akbari; Hashem Nayeri; Keivan Beheshtimaal

    2015-01-01

    Introduction: Amylases are among the most important enzymes and have great significance in present-day biotechnology. Amylase with commercial applications is mainly derived from the genus Bacillus. The main purpose of this study is identification and isolatation amylase enzyme producer Bacillus, determining the amylase enzyme activity and affecting a number of culture medium on amylase enzyme production. Materials and methods: Soil, water and wastewater samples were collected from agricul...

  13. Expression of the human amylase genes: Recent origin of a salivary amylase promoter from an actin pseudogene

    Energy Technology Data Exchange (ETDEWEB)

    Samuelson, L.C.; Gumucio, D.L.; Meisler, M.H. (Univ. of Michigan, Ann Arbor (USA)); Wiebauer, K. (Friedrich Miescher Institut, Basel (Switzerland))

    1988-09-12

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. The authors have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5{prime} regions of the five human amylase genes contain a processed {gamma}-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3{prime} untranslated region of {gamma}-actin. In addition, insertion of an endogenous retrovirus has interrupted the {gamma}-actin pseudogene in four of the five amylase genes.

  14. Characterization of a Hydrophobic Amylase Inhibitor from Corn (Zea mays) Seeds with Activity Against Amylase from Fusarium verticillioides.

    Science.gov (United States)

    Figueira, Edson L Z; Hirooka, Elisa Y; Mendiola-Olaya, Elizabeth; Blanco-Labra, Alejandro

    2003-08-01

    ABSTRACT A hydrophobic 19.7-kDa amylase inhibitor (AI) was purified from corn kernels by 95% ethanol extraction and anionic exchange chromatography. The AI has an isoelectric point of 3.6 and was very stable at different pH values and high temperatures, maintaining 47.6% activity after heating to 94 degrees C for 60 min. Amino acid analysis indicated high valine, leucine, glycine, alanine, and glutamic acid/glutamine content, and especially high valine content (41.2 mol%). This inhibitor is not a glycoprotein. It required 30-min preincubation to maximize complex enzyme-inhibitor formation when the amylase from Fusarium verticillioides was tested. The optimal pH of interaction was 6.5. It showed broad-spectrum activity including the following amylases: human saliva, porcine pancreas, F. verticillioides, as well as those from some insects of agricultural importance (Acanthoscelides obtectus, Zabrotes subfasciatus, Sitophilus zeamais, and Prostephanus truncatus). This novel hydrophobic protein not only inhibited the amylase from F. verticillioides but also decreased the conidia germination. Thus, this protein represents an approach to decrease the production of fumonisin in corn, either by using it as a molecular marker to detect fungal resistance or through genetic engineering. PMID:18943857

  15. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    Science.gov (United States)

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats. PMID:24319124

  16. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera)

    Science.gov (United States)

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  17. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents

    Science.gov (United States)

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-01-01

    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  18. Is There Consistency between the Binding Affinity and Inhibitory Potential of Natural Polyphenols as α-amylase Inhibitors?

    Science.gov (United States)

    Xu, Wei; Shao, Rong; Xiao, Jianbo

    2016-07-26

    The inhibitory potential of natural polyphenols for α-amylases has attracted great interests among researchers. The structure-affinity properties of natural polyphenols binding to α-amylase and the structure-activity relationship of dietary polyphenols inhibiting α-amylase were deeply investigated. There is a lack of consistency between the structure-affinity relationship and the structure-activity relationship of natural polyphenols as α-amylase inhibitors. Is it consistent between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors? It was found that the consistency between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors is not equivocal. For example, there is no consistency between the binding affinity and the inhibitory potential of quercetin and its glycosides as α-amylase inhibitors. However, catechins with higher α-amylase inhibitory potential exhibited higher affinity with α-amylase. PMID:25748632

  19. Preparation of a highly purified antibody and a solid-state immunoassay for porcine pancreatic α-amylase

    International Nuclear Information System (INIS)

    Porcine pancreas and parotid cell suspensions provide model systems in which to study the mechanism of induction of a specific protein, α-amylase, by hormones acting via cAMP. A highly purified antibody against porcine pancreatic α-amylase was prepared using affinity chromatography of the total IgG fraction derived from rabbit anti-α-amylase antiserum and was used to develop a radioimmunoassay for α-amylase. The antigen--antibody complex was separated from unbound α-amylase using either glutaraldehyde gelled α-amylase or a second antibody technique; a linear standard curve was achieved over a 100- to 1000-fold range of α-amylase concentration. Tissue homogenates did not interfere with this assay, and assayed levels of α-amylase in porcine pancreas were linear using 10 to 200 μg of homogenate. No levels or very low levels of α-amylase were detected in control tissues. (U.S.)

  20. Interaction of Salivary alpha-Amylase and Amylase-Binding-Protein A (AbpA of Streptococcus gordonii with Glucosyltransferase of S. gordonii and Streptococcus mutans

    Directory of Open Access Journals (Sweden)

    Tanzer Jason M

    2007-06-01

    Full Text Available Abstract Background Glucosyltransferases (Gtfs, enzymes that produce extracellular glucans from dietary sucrose, contribute to dental plaque formation by Streptococcus gordonii and Streptococcus mutans. The alpha-amylase-binding protein A (AbpA of S. gordonii, an early colonizing bacterium in dental plaque, interacts with salivary amylase and may influence dental plaque formation by this organism. We examined the interaction of amylase and recombinant AbpA (rAbpA, together with Gtfs of S. gordonii and S. mutans. Results The addition of salivary alpha-amylase to culture supernatants of S. gordonii precipitated a protein complex containing amylase, AbpA, amylase-binding protein B (AbpB, and the glucosyltransferase produced by S. gordonii (Gtf-G. rAbpA was expressed from an inducible plasmid, purified from Escherichia coli and characterized. Purified rAbpA, along with purified amylase, interacted with and precipitated Gtfs from culture supernatants of both S. gordonii and S. mutans. The presence of amylase and/or rAbpA increased both the sucrase and transferase component activities of S. mutans Gtf-B. Enzyme-linked immunosorbent assay (ELISA using anti-Gtf-B antibody verified the interaction of rAbpA and amylase with Gtf-B. A S. gordonii abpA-deficient mutant showed greater biofilm growth under static conditions than wild-type in the presence of sucrose. Interestingly, biofilm formation by every strain was inhibited in the presence of saliva. Conclusion The results suggest that an extracellular protein network of AbpA-amylase-Gtf may influence the ecology of oral biofilms, likely during initial phases of colonization.

  1. Induction and repression of alpha-amylase production in batch and continuous cultures of Aspergillus oryzae.

    Science.gov (United States)

    Mørkeberg, R; Carlsen, M; Nielsen, J

    1995-10-01

    The intra- and extracellular concentrations of alpha-amylase in Aspergillus oryzae have been measured during batch culture of a wild-type strain and two recombinant strains. The mean intracellular level for the two recombinant strains was about four to five times the level of the wild-type strain. The recombinant strains also had a higher alpha-amylase productivity, whereas the residence time of the intracellular alpha-amylase pool was approximately the same for the three strains. At high glucose concentrations there was a low constitutive synthesis of alpha-amylase, whereas at low glucose concentrations derepression resulted in an increased production rate. Shifts from a glucose- to a maltose-limited chemostat showed that maltose induces both the production and secretion of alpha-amylase. Finally, from immunoblots, both a glycosylated and an unglycosylated alpha-amylase have been detected. PMID:7582005

  2. Stabilization of α-amylase by using anionic surfactant during the immobilization process

    International Nuclear Information System (INIS)

    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher kcat/Km and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems

  3. Stabilization of α-amylase by using anionic surfactant during the immobilization process

    Science.gov (United States)

    El-Batal, A. I.; Atia, K. S.; Eid, M.

    2005-10-01

    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10 mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher k/K and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

  4. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    Science.gov (United States)

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed. PMID:23320956

  5. Efficient production of Taka-amylase A by Trichoderma viride.

    Science.gov (United States)

    Cheng, C; Udaka, S

    1991-07-01

    An efficient heterologous protein production system was developed in Trichoderma viride, a very efficient cellulase producer. An expression vector containing the Taka-amylase A gene from Aspergillus oryzae, which was fused to the strong promoter and signal peptide sequence of the cellobiohydrolase 1 gene (cbh1) of T. viride, and the hygromycin B resistance gene was used to transform protoplasts of T. viride. Using hygromycin B resistance, a frequency of 3 transformants per microgram DNA on average was obtained. One transformant showed highly elevated alpha-amylase production, 1.0 g/l, which was shown to be under the control of the cbh1 gene promoter. Analysis of the chromosomal DNA of the transformant showed the integration of more than one copy of the vector. PMID:1368719

  6. Study of fluorescence quenching of Barley α-amylase

    Science.gov (United States)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.

    2012-05-01

    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  7. Amylase polymorphism affects growth in the cupped oyster Crassostrea gigas

    OpenAIRE

    Huvet, Arnaud; Samain, Jean-francois; Boudry, Pierre; Bedier, Edouard; Ropert, Michel; Van Wormhoudt, A

    2005-01-01

    The better understanding of physiological and environmental factors that determine optimal food conversion efficiencies is of major interest for the cupped oyster Crassostrea gigas for which the strong increase of aquaculture has been correlated in France with a decrease in productivity due to competition between aquatic species for limited food supplies at grow-out sites. To investigate the non-neutrality of the polymorphism of amylase, a key enzyme for carbohydrate assimilation, in oyster p...

  8. Raw starch conversion by Saccharomyces cerevisiae expressing Aspergillus tubingensis amylases

    OpenAIRE

    Viktor, Marko J; Rose, Shaunita H.; van Zyl, Willem H; Viljoen-Bloom, Marinda

    2013-01-01

    Background Starch is one of the most abundant organic polysaccharides available for the production of bio-ethanol as an alternative transport fuel. Cost-effective utilisation of starch requires consolidated bioprocessing (CBP) where a single microorganism can produce the enzymes required for hydrolysis of starch, and also convert the glucose monomers to ethanol. Results The Aspergillus tubingensis T8.4 α-amylase (amyA) and glucoamylase (glaA) genes were cloned and expressed in the laboratory ...

  9. Salivary Cortisol, Salivary Alpha Amylase, and the Dental Anxiety Scale

    OpenAIRE

    Sadi, Hana; Finkelman, Matthew; Rosenberg, Morton

    2013-01-01

    The aim of this study was to investigate the correlation between dental anxiety, salivary cortisol, and salivary alpha amylase (sAA) levels. Furthermore, the aim was to look into individual differences such as age, race, gender, any existing pain, or traumatic dental experience and their effect on dental anxiety. This study followed a cross-sectional design and included a convenience sample of 46. Every patient was asked to complete the Dental Anxiety Scale (DAS) and a basic demographic/denta...

  10. Microbial Alpha-Amylases and their Industrial Applications: A Review

    OpenAIRE

    Mojsov, Kiro

    2012-01-01

    The biotechnological potential of α-amylases from microorganisms has drawn a great deal of attention from various researchers worldwide as likely biological catalysts in a variety of industrial processes. The rapid developments in the field of genetic engineering have given a new impetus to the biotechnology. Biotechnology also offers the potential for new industrial processes that require less energy and are based on renewable raw materialsand environmentally healthy practices.This work repr...

  11. Culture medium for amylase production by toxigenic fungi

    OpenAIRE

    Figueira Edson Luiz Zangrando; Hirooka Elisa Yoko

    2000-01-01

    Mycelial growth and amylase production by a mycotoxigenic strain of Fusarium moniliforme and Aspergillus flavus were evaluated in a culture medium containing starch, glycerol, wheat bran or corn. With emphasis on corn, different fractions composed by germ, degermed seed, starch, milky stage corn and the respective starch or supernatant fraction were analyzed for F. moniliforme growth . The medium composed of milky stage corn supernatant promoted the best mycelial growth (p

  12. Production of Fungal Amylases Using Cheap, Readily Available Agriresidues, for Potential Application in Textile Industry

    Directory of Open Access Journals (Sweden)

    Shalini Singh

    2014-01-01

    Full Text Available The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL and supernatant protein concentration (9.7 mg/mL for incubation period (6 days, temperature (35°C, initial pH (6.0, nutrient salt solution as moistening agent, and beef extract as nitrogen source. Pomegranate peel produced maximum amylase activity, but wheat bran (only slightly lesser amylase activity as compared to that of pomegranate peel was chosen for further studies, keeping in mind the seasonal availability of pomegranate peel. TLC confirmed the amylase produced to be α-type and 60 kDa was the molecular weight of the partially purified amylase. The enzyme showed maximum enzyme activity at pH 6.0, temperature of 55°C, and incubation time of 60 minutes. UV (616.0 U/mL and chemical (814.2 U/mL mutation enhanced amylase activity as compared to wild test strain. The study indicates that Aspergillus fumigatus NTCC1222 can be an important source of amylase and the crude enzyme, hence obtained, can be cost effectively applied in multiple sections of textile wet processing.

  13. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii

    OpenAIRE

    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M Margaret; Gill, Steven R.; Scannapieco, Frank A.

    2012-01-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were di...

  14. Drosophila melanogaster larvae control amylase secretion according to the hardness of food

    OpenAIRE

    Sakaguchi, Honami; Suzuki, Masataka G.

    2013-01-01

    Drosophila melanogaster larvae excrete amylase and perform external digestion of their food. In this study, to investigate whether their external digestion ability varies in response to changes in the external environment, we measured the relative amount of amylase excreted by larvae using a new method: the iodine starch agar method (ISAM). Analysis using this method revealed that the amount of amylase excreted by larvae increased in accordance with the increase in the agar concentration. In ...

  15. COMPARING TRADITIONAL SERUM AMYLASE WITH RELATIVELY NEW LIPASE IN ACUTE PANCREATITIS

    OpenAIRE

    Roopa Murgod; Gladys Soans; Bindu CM

    2014-01-01

    Acute pancreatitis is most often diagnosed clinically and by blood tests rather than expensive radiological methods. Among the blood tests, amylase and lipase are frequently used to diagnose acute pancreatitis. In this retrospective study, we compare amylase versus lipase in terms of sensitivity and specificity with ROC curve analysis.40 established cases of acute pancreatitis were chosen. Day 1 measurements of serum amylase and lipase were noted. Values ≥3 times the upper limit of normal wer...

  16. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.

    OpenAIRE

    Kitamoto, N; Yamagata, H; Kato, T; Tsukagoshi, N; Udaka, S

    1988-01-01

    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosu...

  17. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270) Using Solid State Fermentation

    OpenAIRE

    Koel Saha; Sujan Maity; Sudeshna Roy; Koustav Pahan; Rishija Pathak; Susmita Majumdar; Suvroma Gupta

    2014-01-01

    Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270). In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca+2), Nitrate (NO3 −), and chloride ions (Cl−) as well as in the presen...

  18. Eliminating Amylase Testing from the Evaluation of Pancreatitis in the Emergency Department

    OpenAIRE

    Volz, Kathryn A.; McGillicuddy, Daniel C.; Gary L Horowitz; Wolfe, Richard E.; Joyce, Nina; Sanchez, Leon D.

    2010-01-01

    Background: Alterations in serum biomarkers have been used to evaluate for pancreatitis in the emergency department (ED). Studies have shown lipase to be as sensitive and more specific than amylase in diagnosing pancreatitis and that amylase plus lipase does not improve accuracy over lipase alone. Objective: To determine effects of interventions to decrease ordering of amylase in the evaluation of pancreatitis. Methods: We conducted a pre- and post-cohort study. The number o...

  19. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation

    OpenAIRE

    Nakajima, Kei

    2016-01-01

    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may ...

  20. Fluid and amylase secretion by perfused parotid gland: physio-morphological approach.

    OpenAIRE

    Murakami, M.; Yoshimura, K.; H. Sugiya; Segawa, A; Loffredo, F; Testa-Riva, F; Riva, A.

    2000-01-01

    Whole gland perfusion technique was applied to rat parotid glands to assess whether amylase affects fluid secretion. Control perfusion without any secretagogue evoked no spontaneous secretion. Carbachol (CCh 1 microM) induced both amylase and fluid secretion with distinctive kinetics. Fluid secretion occurred constantly around 60 microL/g-min, whereas amylase secretion exhibited an initial peak, followed by a rapid decrease to reach a plateau. Isoproterenol (Isop 1 microM) alone did not induc...

  1. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts

    OpenAIRE

    Mahsa Rahimzadeh; Samaneh Jahanshahi; Soheila Moein; Mahmood Reza Moein

    2014-01-01

    Objective(s): One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Materials and Methods: Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhi...

  2. Starch-Binding Domain Affects Catalysis in Two Lactobacillus α-Amylases

    OpenAIRE

    Rodríguez-Sanoja, R.; Ruiz, B; Guyot, J P; Sanchez, S.

    2005-01-01

    A new starch-binding domain (SBD) was recently described in α-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus α-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to b...

  3. PRODUCTION OF α-AMYLASE FROM ASPERGILLUS FLAVUS UNDER SOLID STATE FERMENTATION WITH OPTIMUM CONDITIONS

    OpenAIRE

    Mamatha J; Suresh V; Vedamurthy AB; Shilpi B; Shruthi SD

    2012-01-01

    α-amylases are ubiquitous enzymes produced by plants, animals and microbes, where they play a dominant role in carbohydrate metabolism. In spite of the wide distribution of amylases, microbial sources, namely fungal and bacterial amylases, are used for the industrial production due to advantages such as cost effectiveness, consistency, less time and space required for production and ease of process modification and optimization. Filamentous fungi are known to be prolific producers of extracel...

  4. Phylogenetic and biochemical characterization of a novel cluster of intracellular fungal alpha-amylase enzymes

    OpenAIRE

    van der Kaaij, R.M.; Janecek, S.; van der Maarel, M. J. E. C.; Dijkhuizen, L; Janeček, Š.

    2007-01-01

    Currently known fungal alpha-amylases are well-characterized extracellular enzymes that are classified into glycoside hydrolase subfamily GH13_1. This study describes the identification, and phylogenetic and biochemical analysis of novel intracellular fungal a-amylases. The phylogenetic analysis shows that they cluster in the recently identified subfamily GH13_5 and display very low similarity to fungal a-amylases of family GH13_1. Homologues of these intracellular enzymes are present in the ...

  5. Isolation and some properties of extracellular amylases from Fusarium martii var. minus f.2

    OpenAIRE

    Joanna Boguszewska

    2014-01-01

    α-amylase and glucoamylase were isolated from the liquid culture medium of Fusarium martii. At 10-3 M concentrations PCMB inhibited the activity of both enzymes, which indicated that they require SH groups for enzymatic activity, α-amylase was also inhibited by DFP at 10-3 M. One may thus assume that serine is present in the active center of the examined amylase.

  6. Production, purification, and characterization of a-amylase by Bacillus subtilis and its mutant derivates

    OpenAIRE

    DEMİRKAN, Elif

    2011-01-01

    The effects of various carbon and nitrogen sources on production of a-amylase by Bacillus subtilis and its mutant derivates were investigated. The maximum production of a-amylase by all strains was obtained in the presence of mesoinositol as the carbon source. There was no more significant increase in enzyme yield in the case of the supplementation of nitrogen sources, whereas malt extract and tryptone were preferred nitrogen sources for amylase production by Bacillus subtilis and mutant U 2-...

  7. Isolation and some properties of extracellular amylases from Fusarium martii var. minus f.2

    Directory of Open Access Journals (Sweden)

    Joanna Boguszewska

    2014-08-01

    Full Text Available α-amylase and glucoamylase were isolated from the liquid culture medium of Fusarium martii. At 10-3 M concentrations PCMB inhibited the activity of both enzymes, which indicated that they require SH groups for enzymatic activity, α-amylase was also inhibited by DFP at 10-3 M. One may thus assume that serine is present in the active center of the examined amylase.

  8. Performance Comparison of α- and β-Amylases on Chitosan Hydrolysis

    OpenAIRE

    Nur Rokhati; Prita Widjajanti; Bambang Pramudono; Heru Susanto

    2013-01-01

    The low solubility in common solvent and high viscosity resulting from its high molecular weight (MW) with fiber-like structure prevents a more widespread use of chitosan. This paper presents a performance comparison of nonspecific, commercially available enzymes, α- and β-amylases, for the hydrolysis of chitosan to lower its MW. The results showed that both enzymes demonstrate the ability to be used as catalysts in chitosan hydrolysis with β-amylase having better performance than α-amylase. ...

  9. Eliminating Amylase Testing from the Evaluation of Pancreatitis in the Emergency Department

    Directory of Open Access Journals (Sweden)

    Volz, Kathryn A

    2010-09-01

    Full Text Available Background: Alterations in serum biomarkers have been used to evaluate for pancreatitis in the emergency department (ED. Studies have shown lipase to be as sensitive and more specific than amylase in diagnosing pancreatitis and that amylase plus lipase does not improve accuracy over lipase alone.Objective: To determine effects of interventions to decrease ordering of amylase in the evaluation of pancreatitis.Methods: We conducted a pre- and post-cohort study. The number of amylase and lipase tests ordered in the ED was recorded prior to intervention to establish a baseline. We introduced an educational intervention to order lipase without amylase. A second intervention involved removing amylase from bedside order entry forms. We introduced a third intervention that included deleting amylase from trauma order forms, and decoupling amylase and lipase in the computer ordering system. We recorded the number of lipase and amylase tests in weekly aggregates for comparison to the baseline. Data analysis using students t-test, standard deviation and p values are reported.Results: Before interventions 93% of patients had both tests ordered. Educational interventions resulted in a decrease to 91% (p=0.06 of co-ordering. Further interventions decreased the percentage of patients evaluated with both tests to 14.3%. This translates into a decrease in patient charges of approximately $350,000 a year.Conclusion: Using simple structured interventions in the ED can reduce amylase ordering. Educational programming alone was not effective in significantly decreasing amylase ordering; however, education plus system-based interventions decreased amylase ordering. [West J Emerg Med. 2010; 11(4:344-347.

  10. Kinetic studies of amylase and biomass production by Calvatia gigantea

    Energy Technology Data Exchange (ETDEWEB)

    Kekos, D.; Macris, B.J.

    1987-01-01

    Production of alpha-amylase (alpha-4, glucan 4-glucanohydrolase, EC 3.2.1.1) by microorganisms has been practiced for many years in small and large scale operations and the literature on this enzyme is voluminous. Aspergillus niger and Aspergillus oryzae have been reported as the main fungal species used for commercial production of the enzyme. On the other hand, large volumes of low-cost agricultural products such as acorn (the perisperm-free dry seed contains approximately 60% starch) are wasted in many countries and provide a challenge to biotechnology to efficiently utilize these rich sources of starch for the production of high added value products like enzymes. C. gigantea is an edible puffball excreting high levels of alpha-amylase when cultivated on different sources of starch containing elevated quantities of toxic tannic compounds. This fungus has been employed for the production of microbial protein from wastes and acorns containing high levels of toxic tannic compounds. The same fungus was also reported to grow on both hydrolyzable and condensed tannins as sole carbon sources. The present work was undertaken to investigate certain kinetic characteristics of alpha-amylase and biomass production by C. gigantea grown on soluble and acorn starch in a lab fermenter. (Refs. 18).

  11. Thermal stability of -amylase in aqueous cosolvent systems

    Indian Academy of Sciences (India)

    Jay Kant Yadav; V Prakash

    2009-09-01

    The activity and thermal stability of -amylase were studied in the presence of different concentrations of trehalose, sorbitol, sucrose and glycerol. The optimum temperature of the enzyme was found to be 50 ± 2°C. Further increase in temperature resulted in irreversible thermal inactivation of the enzyme. In the presence of cosolvents, the rate of thermal inactivation was found to be significantly reduced. The apparent thermal denaturation temperature ()app and activation energy () of -amylase were found to be significantly increased in the presence of cosolvents in a concentration-dependent manner. In the presence of 40% trehalose, sorbitol, sucrose and glycerol, increments in the ()app were 20°C, 14°C, 13°C and 9°C, respectively. The of thermal denaturation of -amylase in the presence of 20% (w/v) trehalose, sorbitol, sucrose and glycerol was found to be 126, 95, 90 and 43 kcal/mol compared with a control value of 40 kcal/mol. Intrinsic and 8-anilinonaphathalene-1-sulphonic acid (ANS) fluorescence studies indicated that thermal denaturation of the enzyme was accompanied by exposure of the hydrophobic cluster on the protein surface. Preferential interaction parameters indicated extensive hydration of the enzyme in the presence of cosolvents.

  12. [Optimal conditions of alpha-amylase production by Aspergillus oryzae in liquid media].

    Science.gov (United States)

    Vallier, P; Bata, J; Colobert, L

    1977-10-01

    The alpha-amylase secretion in a mineral culture medium containing starch and glucose follow the lysis of mycelium. This lysis seems to result from the hydrolysing action of dextranase and levulanase on cell wall. Cell lysis and amylase secretion are greatly enhanced by pH elevation of culture medium (optimal pH 8,8). In such conditions of production the amylase is not stable but can be stabilized by addition of starch. A method is described using pH and starch content modifications, which allows to obtain an amylase production three times greater than in standard culture medium. PMID:23718

  13. Paper-based α-amylase detector for point-of-care diagnostics.

    Science.gov (United States)

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar

    2016-04-15

    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase. PMID:26655186

  14. Salivary type alpha-amylase activity in serum and in urine of patients with lung adenocarcinoma

    International Nuclear Information System (INIS)

    Total alpha-amylase activity in sera and urine of 30 patients with lung adenocarcinoma has been tested. The results were compared with control group of 30 healthy voluntaries. The activity of pancreatic type was differentiated from salivary alpha amylase. Salivary type was inhibited selectively by Triticum aestivum. Higher levels of total and salivary type amylase were noted in patients with lung adenocarcinoma in comparison to healthy control. The increase was significant (p<0.005). Correlation was observed between the activity of salivary type amylase and the stage of adenocarcinoma. (author)

  15. Determination of amylase activity in cotyledons of Phaseolus vulgaris L. cv. carioca

    OpenAIRE

    Glaucia Almeida de Morais; Massanori Takaki

    1998-01-01

    Determination of α- and β-amylase activity in the extracts of cotyledons of Phaseolus vulgaris L. cv. cariocawas done using selective inactivation of α-amylase by lowering the pH of the incubation medium or by the use of EDTA as inhibitor or selective inactivation of β-amylase by the use of HgCl2 or by heating to 70ºC in the presence of CaCl2; and still by using the reagent starch azure for specific determination of α-amylase. Results indicated that the methods used w...

  16. Cloning and Expression of a Schwanniomyces occidentalis α-Amylase Gene in Saccharomyces cerevisiae

    OpenAIRE

    Wang, Tsung Tsan; Lin, Long Liu; Hsu, Wen Hwei

    1989-01-01

    An α-amylase gene (AMY) was cloned from Schwanniomyces occidentalis CCRC 21164 into Saccharomyces cerevisiae AH22 by inserting Sau3AI-generated DNA fragments into the BamHI site of YEp16. The 5-kilobase insert was shown to direct the synthesis of α-amylase. After subclones containing various lengths of restricted fragments were screened, a 3.4-kilobase fragment of the donor strain DNA was found to be sufficient for α-amylase synthesis. The concentration of α-amylase in culture broth produced ...

  17. Expression and Localization of α-amylase in the Submandibular and Sublingual Glands of Mice

    International Nuclear Information System (INIS)

    In the major salivary glands of mice, acinar cells in the parotid gland (PG) are known to be the main site for the production of the digestive enzyme α-amylase, whereas α-amylase production in the submandibular gland (SMG) and sublingual gland (SLG), as well as the cell types responsible for α-amylase production, has been less firmly established. To clarify this issue, we examined the expression and localization of both the mRNA and protein of α-amylase in the major salivary glands of male and female mice by quantitative and histochemical methods. α-amylase mRNA levels were higher in the order of PG, SMG, and SLG. No sexual difference was observed in α-amylase mRNA levels in the PG and SLG, whereas α-amylase mRNA levels in the female SMG were approximately 30% those in the male SMG. Using in situ hybridization and immunohistochemistry, signals for α-amylase mRNA and protein were found to be strongly positive in acinar cells of the PG, serous demilune cells of the SLG, and granular convoluted tubule (GCT) cells of the male SMG, weakly positive in seromucous acinar cells of the male and female SMG, and negative in mucous acinar cells of the SLG. These results clarified that α-amylase is produced mainly by GCT cells and partly by acinar cells in the SMG, whereas it is produced exclusively by serous demilune cells in the SLG of mice

  18. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    OpenAIRE

    Brisman, J.; Belin, L

    1991-01-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase p...

  19. Expression and Localization of α-amylase in the Submandibular and Sublingual Glands of Mice

    OpenAIRE

    Yamagishi, Ryoko; Wakayama, Tomohiko; Nakata, Hiroki; Adthapanyawanich, Kannika; Kumchantuek, Tewarat; Yamamoto, Miyuki; Iseki, Shoichi

    2014-01-01

    In the major salivary glands of mice, acinar cells in the parotid gland (PG) are known to be the main site for the production of the digestive enzyme α-amylase, whereas α-amylase production in the submandibular gland (SMG) and sublingual gland (SLG), as well as the cell types responsible for α-amylase production, has been less firmly established. To clarify this issue, we examined the expression and localization of both the mRNA and protein of α-amylase in the major salivary glands of male an...

  20. AMYLASE PRODUCTION BY ASPERGILLUS NIGER UNDER SOLID STATE FERMENTATION USING AGROINDUSTRIAL WASTES

    Directory of Open Access Journals (Sweden)

    Suganthi

    2011-02-01

    Full Text Available Solid state fermentation holds tremendous potentials for the production of the enzyme amylase by Aspergillus niger. Different solid substrates like rice bran, wheat bran, black gram bran, coconut oil cake, gingely oil cake and groundnut oil cake are rich in starch. These agro industrial residues are cheap raw materials for amylase production. Aspergillus niger BAN3E was identified to be the best producer of amylase. When A. niger BAN3E was incubated for 6 days at 37°C it showed high yield of amylase in groundnut oil cake substratein solid state fermentation. Sucrose and nitrogen improved the yield in the same medium.

  1. Unique features of several microbial α-amylases active on soluble and native starch

    OpenAIRE

    Sarian, Fean Davisunjaya

    2016-01-01

    Starch is the main energy store of major agricultural crops such as corn, potato, rice and wheat. Various amylase type enzymes are used to convert cooked starch to glucose that goes into bioethanol fermentation. Only a few amylase type enzymes have been described that can act on the starch granule itself. Granular starch has a complex crystalline structure that prevents most amylases to directly act on it. In this PhD thesis the action of several amylases on native granular starch was studied...

  2. The Effect of Colloidal Silica Nanoparticles on the Activity of α-Amylase

    Directory of Open Access Journals (Sweden)

    G. R. Behbehani

    2012-12-01

    Full Text Available The effect of silica nanoparticles on the activity of α-amylase is determinations using isothermal titration calorimetry. It was found that the immobilized enzyme activity increased as evidenced by the stability parameters recovered from the extended solvation theory. The stability indexes of the immobilized α-amylase was less than of the free enzyme, thereby the activity of the enzyme was increased as a result of its interaction with silica nanoparticles. The present report shows that silica nanoparticles are activator of -amylase, as the complexes of silica+ -amylase are less stable than the free enzyme.

  3. Influence of addition of amylase preparation to dough on fermentative activity of baker's yeast

    Directory of Open Access Journals (Sweden)

    Dodić Jelena M.

    2005-01-01

    Full Text Available Dough samples with different content of amylases were investigated immediately after mixing and after 7, 14 and 30 days of frozen storage. The obtained results show that the fermentation time is shorter, both in fresh and frozen samples, when amylase sample 1 was added, compared to dough without enzymes. The addition of amylase 2 to dough resulted in minimal decrease of "rising" time, both is frozen and fresh dough samples. The rising time of fresh samples was shorter when amylase 3 was added to dough. The specific fermentative activity of fresh dough samples is increasing by about 10% compared to the control sample, for all amounts of amylase 1 and 2 added to the do- ugh. The fermentative activity of yeast in frozen samples increased by 5-10%, after keeping of dough with the addition of amylase 1 for 14 days. The specific fermentative activity of fresh dough samples increased compared to the control, for all amounts of added amylase 3 to the dough. In frozen dough samples the fermentative activity of yeast decreased by 10% for all added amounts of amylase 3. Baked goods made of fresh and frozen dough, prepared with the addition of amylase 1, are better than the ones made of control dough sample, considering all evaluated parameters.

  4. Chemical synthesis of a dual branched malto-decaose: A potential substrate for alpha-amylases

    DEFF Research Database (Denmark)

    Damager, Iben; Jensen, Morten; Olsen, Carl Erik; Blennow, Andreas; Møller, Birger Lindberg; Svensson, Birte; Motawia, Saddik

    2005-01-01

    . Using this chemically defined branched oligosaccharide as a substrate, the cleavage pattern of seven different alpha-amylases were investigated. alpha-Amylases from human saliva, porcine pancreas, barley alpha-amylose 2 and recombinant barley alpha-amylase 1 all hydrolysed the decasaccharide selectively....... This resulted in a branched hexasaccharide and a branched tetrasoccharide. alpha-Amylases from Asperagillus oryzae, Bacillus licheniformis and Bacillus sp. cleaved the decasoccharide at two distinct sites, either producing two branched pentasoccharides, or a branched hexasoccharide and a branched...

  5. Production and characterization of amylases from Zea mays malt

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus

    2009-08-01

    Full Text Available In this work the α and β-amylase enzymes were obtained from maize (Zea mays malt and were biochemistry characterized. A germination study to obtain the maize malt with good amylase activity was made. The maize seeds were germinated in laboratory and the enzymatic activity was measured daily. Activity dependence to germination time were fitted to an exponential model (A=A0eµt, which showed that the behaviour of enzymatic activity in the germination process was similar to the growth of the microorganism. Its model could be applied to describe the mechanism of α-amylase production for each maize varieties and others cereals. Maize malt characterization showed that α and β-amylase had optimal pH between 4-6.5, optimal temperature 50 and 90ºC, and molecular weight of 67.4 and 47.5kDa, respectively. This work contributed with the advances in biotechnology generating of conditions for application of a new and of low price amylases source.Neste trabalho as enzimas α e β-amilases foram obtidas de malte de milho e depois foram caracterizadas bioquimicamente. Um estudo da germinação foi feito para obtenção do malte com boa atividade amilásica. A germinação ocorreu em escala laboratorial e a atividade enzimática foi medida diariamente. Um modelo exponencial do tipo A=A0eµt foi ajustado a dependência do tempo de germinação com a atividade, mostrando que o comportamento da atividade enzimática no processo de germinação é semelhante ao crescimento de microorganismos. Este modelo pode ser aplicado para descrever o mecanismo de produção da α-amilase para cada variedade de milho e de outros cereais. A caracterização do malte de milho mostrou que as α e β-amilase têm pH ótimo entre 4,0-6,5, temperatura ótima de 50 e 90ºC, e massa molar de 67,4 e 47,5 kDa, respectivamente. Este trabalho contribuiu com os avanços da biotecnologia gerando condições de emprego de uma nova e barata fonte de amilases.

  6. Mutational analysis of the β-trefoil fold protein barley α-amylase/subtilisin inhibitor probes hot spots for the interaction with barley α-amylase

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine; Nielsen, P. K.; Abou Hachem, Maher;

    2005-01-01

    The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics of...

  7. ISOLATION AND IDENTIFICATION OF AMYLASE PRODUCING YEASTS IN ‘TELLA’ (ETHIOPIAN LOCAL BEER) AND THEIR AMYLASE CONTRIBUTION FOR ‘TELLA’ PRODUCTION

    OpenAIRE

    Berhanu Andualem; Amare Gessesse

    2013-01-01

    ‘Tella’ is local beer which is used in most part of Ethiopia. It is made from cereals, such as barley, wheat, maize and other crops. Rhamnus prinoides is also used to provide a special aroma and flavor as well as antiseptic agent. The objective of this study is to determine the contribution of amylases from tella yeast isolates and compare with the role of amylase from malt. House hold ‘tella’ samples were collected and plated on starch agar and then amylase positive isolates of yeast were id...

  8. Biochemical properties of alpha-amylase from peel of Citrus sinensis cv. Abosora.

    Science.gov (United States)

    Mohamed, Saleh Ahmed; Drees, Ehab A; El-Badry, Mohamed O; Fahmy, Afaf S

    2010-04-01

    alpha-Amylase activity was screened in the peel, as waste fruit, of 13 species and cultivars of Egyptian citrus. The species Citrus sinensis cv. Abosora had the highest activity. alpha-Amylase AI from Abosora peel was purified to homogeneity using anion and cation-exchange, and gel filtration chromatographies. Molecular weight of alpha-amylase AI was found to be 42 kDa. The hydrolysis properties of alpha-amylase AI toward different substrates indicated that corn starch is the best substrate. The alpha-amylase had the highest activity toward glycogen compared with amylopectin and dextrin. Potato starch had low affinity toward alpha-amylase AI but it did not hydrolyze beta-cyclodextrin and dextran. Apparent Km for alpha-amylase AI was 5 mg (0.5%) starch/ml. alpha-Amylase AI showed optimum activity at pH 5.6 and 40 degrees C. The enzyme was thermally stable up to 40 degrees C and inactivated at 70 degrees C. The effect of mono and divalent metal ions were tested for the alpha-amylase AI. Ba2+ was found to have activating effect, where as Li+ had negligible effect on activity. The other metals caused inhibition effect. Activity of the alpha-amylase AI was increased one and half in the presence of 4 mM Ca2+ and was found to be partially inactivated at 10 mM Ca2+. The reduction of starch viscosity indicated that the enzyme is endoamylase. The results suggested that, in addition to citrus peel is a rich source of pectins and flavanoids, alpha-amylase AI from orange peel could be involved in the development and ripening of citrus fruit and may be used for juice processing. PMID:19941088

  9. GA Enhanced a-Amylase Synthesis in Halved Grains of Barley (Hordeum vulgare): A Simple Laboratory Demonstration

    Science.gov (United States)

    Freeland, P. W.

    1972-01-01

    A laboratory demonstration is suggested for the formation of a-amylase enzyme in halved grains of barley. Data presented in the article provide some information of the pattern of a- and b-amylase activity during germination. (PS)

  10. Alpha-amylase activity in blood increases after pharmacological, but not psychological, activation of the adrenergic system

    OpenAIRE

    Nater, Urs M.; Roberto La Marca; Katja Erni; Ulrike Ehlert

    2015-01-01

    BACKGROUND & AIM: Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separat...

  11. Individual Differences in AMY1 Gene Copy Number, Salivary α-Amylase Levels, and the Perception of Oral Starch

    OpenAIRE

    Abigail L Mandel; Peyrot des Gachons, Catherine; Plank, Kimberly L.; Alarcon, Suzanne; Breslin, Paul A.S.

    2010-01-01

    Background The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of star...

  12. Dimerization Mediates Thermo-Adaptation, Substrate Affinity and Transglycosylation in a Highly Thermostable Maltogenic Amylase of Geobacillus thermoleovorans

    OpenAIRE

    Mehta, Deepika; Satyanarayana, Tulasi

    2013-01-01

    Background Maltogenic amylases belong to a subclass of cyclodextrin-hydrolyzing enzymes and hydrolyze cyclodextrins more efficiently than starch unlike typical α-amylases. Several bacterial malto-genic amylases with temperature optima of 40–60°C have been previously characterized. The thermo-adaption, substrate preferences and transglycosylation aspects of extremely thermostable bacterial maltogenic amylases have not yet been reported. Methodology/Principal Findings The recombinant monomeric ...

  13. Growth temperature of different local isolates of Bacillus sp. in the solid state affects production of raw starch digesting amylases

    OpenAIRE

    Šokarda-Slavić Marinela; Božić Nataša; Vujčić Z.

    2014-01-01

    Natural amylase producers, wild type strains of Bacillus sp., were isolated from different regions of Serbia. Strains with the highest amylase activity based on the starch-agar plate test were grown on solid-state fermentation (SSF) on triticale. The influence of the substrate and different cultivation temperature (28 and 37°C) on the production of amylase was examined. The tested strains produced α-amylases when grown on triticale grains both at 28 and at ...

  14. Predictive value of serum amylase level in outcome of multiple trauma patients

    Directory of Open Access Journals (Sweden)

    Arezu Nejabatian

    2016-05-01

    Full Text Available Introduction: The early detection of injury in multiple trauma patients can lead to decreased mortality, length of stay, and improved clinical status of the patient. It is shown that there is a relation between increased level of serum amylase and pancreatic injury in trauma patients. The aim of this study is to evaluate serum amylase level in hospital outcomes of patients with abdominal blunt trauma. Methods: This study was a cross-sectional survey that was conducted at the emergency room of Imam Reza (AS Medical and Educational Center in Tabriz, Iran, during a year (April 2014-April 2015 on 101 patients with blunt abdominal trauma. Serum amylase levels were measured 6 hours after injury. The outcome of patients during hospitalization including the need for laparotomy and mortality were followed. Data were analyzed by SPSS software. P < 0.050 was considered significant. Results: A significant relationship between elevated serum amylase level by laparotomy and mortality was observed (P < 0.001. 15 patients had serum amylase higher than 100 U/L. All patients with abnormal serum amylase died. Conclusion: Determination of serum amylase level can be valuable in the prognosis of patients with blunt abdominal trauma, especially in determining mortality and proceed to laparotomy. However, studies with larger research community are required to investigate the precise role of amylase in the diagnosis and prognosis of patients with blunt abdominal trauma.

  15. Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

    Science.gov (United States)

    Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

    2009-11-01

    Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae. PMID:19897917

  16. Use of activated carbons to remove undesirable residual amylase from factory and refinery streams

    Science.gov (United States)

    In recent years, there has been increased world-wide concern over residual (carry-over) activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were develope...

  17. Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations

    DEFF Research Database (Denmark)

    Spohr, Anders Bendsen; Carlsen, Morten; Nielsen, Jens Bredal;

    1997-01-01

    Three alpha-amylase producing strains of Aspergillus oryzae used for recombinant protein production have been studied with respect to growth and protein production. By comparing the three strains with respect to morphology and protein production it is shown that a morphological mutant with a more...... dense mycelium is more efficient in producing alpha-amylase....

  18. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    Science.gov (United States)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  19. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Science.gov (United States)

    2010-04-01

    ... accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies are available from the National Academy Press, 2101... 21 Food and Drugs 3 2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase...

  20. Draft genome sequences of 18 oral streptococcus strains that encode amylase-binding proteins.

    Science.gov (United States)

    Sabharwal, Amarpreet; Liao, Yu-Chieh; Lin, Hsin-Hung; Haase, Elaine M; Scannapieco, Frank A

    2015-01-01

    A number of commensal oral streptococcal species produce a heterogeneous group of proteins that mediate binding of salivary α-amylase. This interaction likely influences streptococcal colonization of the oral cavity. Here, we present draft genome sequences of several strains of oral streptococcal species that bind human salivary amylase. PMID:25999552

  1. NMR assignment of the amylase-binding protein A from Streptococcus parasanguinis.

    Science.gov (United States)

    Liu, Bing; Zhu, Fan; Wu, Hui; Matthews, Stephen

    2015-04-01

    Streptococcus parasanguinis is a primary colonizer of tooth surfaces in the oral cavity. Amylase-binding protein A (AbpA) from S. parasanguinis is responsible for the recruitment of salivary amylase to bacterial surface, which plays an important role in the development of oral biofilms. Here, we describe the essentially complete NMR assignments for AbpA. PMID:25016927

  2. Draft Genome Sequences of 18 Oral Streptococcus Strains That Encode Amylase-Binding Proteins

    OpenAIRE

    Sabharwal, Amarpreet; Liao, Yu-Chieh; Lin, Hsin-Hung; Haase, Elaine M.; Scannapieco, Frank A.

    2015-01-01

    A number of commensal oral streptococcal species produce a heterogeneous group of proteins that mediate binding of salivary α-amylase. This interaction likely influences streptococcal colonization of the oral cavity. Here, we present draft genome sequences of several strains of oral streptococcal species that bind human salivary amylase.

  3. Physico-chemical studies on amylases from fermented cassava waste water

    International Nuclear Information System (INIS)

    Waste water from cassava mash fermented with pure strain of Saccharomycees cerevisae together with Lactobacillus delbruckii and Lactobacillus coryneformis (3 days) was assayed for amylase activity. The result of the study indicated that the fermentation waste water had amylase activity, the unit activity and the specific activity of the amylase in the waste water was 0.22μmole/min and 0.06μmole/min/mg, respectively. The amylase was partially purified using Gel filtration (Sephadex-G150). The partially purified enzyme was maximally activity at pH 6.0 and 60 deg. C temperature. It had its maximum stability between pH 6-7 for 4hr, and 30 deg. C for 50 mins. NaCl, NH4Cl, FeCl3, KCl, NaNO3 activates the enzyme activity while CUSO4 and HgCl2 inhibit the activity of the amylase. It could be concluded that these amylases from the fermented cassava waste amylase were active at wide temperature and pH ranges, this quality could be explored in the industrial sector (most especially food industry) as a source of industrial amylase that requires a wide range of conditions (temperature and pH). (author)

  4. Unique features of several microbial α-amylases active on soluble and native starch

    NARCIS (Netherlands)

    Sarian, Fean Davisunjaya

    2016-01-01

    Starch is the main energy store of major agricultural crops such as corn, potato, rice and wheat. Various amylase type enzymes are used to convert cooked starch to glucose that goes into bioethanol fermentation. Only a few amylase type enzymes have been described that can act on the starch granule i

  5. Isolation of Alpha-amylase Producing Thermophilic Bacillus Strains and Partial Characterization of the Enzymes

    Directory of Open Access Journals (Sweden)

    Celal Türker

    2015-03-01

    Full Text Available In the present study, we isolated three thermophilic Bacillus strains from the soil samples collected from the coast sediments of the Burnaz Stream located in Erzin. The isolates were entitled as Bacillus sp. CT1, CT2, and CT3, respectively. The maximum α-amylase production was revealed at 60°C for CT1 strain, and at 80°C for CT2 and CT3 strains, respectively. The optimum enzyme activity was observed at 90°C for CT1 α-amylase, whereas at 60°C for CT2 and CT3 α-amylases. On the other hand, optimum pH value for CT2 α-amylase was 7.0, whereas 8.0 for CT1 and CT3 α-amylases. The specific activities of CT1, CT2, and CT3 amylases were 317.6, 113.3 and 362.7 U/mg at 55°C, respectively. The estimated molecular weight of CT1 and CT3 α-amylase was 65 kDa, and for CT2 α-amylase was 38 kDa by zymogram analysis.

  6. Binding of carbohydrates and protein inhibitors to the surface of alpha-amylases

    DEFF Research Database (Denmark)

    Bozonnet, Sophie; Bønsager, Birgit Christine; Kramhoft, B.;

    2005-01-01

    This review on barley alpha-amylases 1 (AMY1) and 2 (AMY2) addresses rational mutations at distal subsites to the catalytic site, polysaccharide hydrolysis, and interactions with proteinaceous inhibitors. Subsite mapping of barley alpha-amylases revealed 6 glycone and 4 aglycone substrate subsite...

  7. Binding of carbohydrates and protein inhibitors to the surface of alpha-amylases

    DEFF Research Database (Denmark)

    Bozonnet, Sophie; Bønsager, Birgit Christine; Kramhoft, B.; Mori, H.; Abou Hachem, Maher; Willemoes, Martin; Jensen, M.T.; Fukuda, Kenji; Nielsen, P.K.; Juge, N.; Aghajari, N.; Tranier, S.; Robert, X.; Haser, R.; Svensson, Birte

    2005-01-01

    This review on barley alpha-amylases 1 (AMY1) and 2 (AMY2) addresses rational mutations at distal subsites to the catalytic site, polysaccharide hydrolysis, and interactions with proteinaceous inhibitors. Subsite mapping of barley alpha-amylases revealed 6 glycone and 4 aglycone substrate subsites...

  8. High-Molecular-Weight Amylase Activities from Bacteria Degrading Starch-Plastic Films

    OpenAIRE

    Burgess-Cassler, Anthony; Imam, Syed H; Gould, J. Michael

    1991-01-01

    Amylases having unusually high molecular weights (Mr, >150,000) were found in culture supernatants of an environmentally derived microbial mixed culture selected for its ability to utilize starch-containing plastic films as sole carbon sources. The mixed culture produced amylases active at pHs 5.5 and 8.0.

  9. Further Experiments on Gibberellin-Stimulated Amylase Production in Cereal Grains

    Science.gov (United States)

    Coppage, Jo; Hill, T. A.

    1973-01-01

    Experiments conducted on wheat and barley grains to analyze activities of alpha- and beta-amylase enzymes. Gibberellins were used exogenously. Techniques are described in detail. Results on different cultivars revealed that beta-amylase was not an invariable result of imbibition. Techniques employed can be used by school students. (PS)

  10. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    OpenAIRE

    Kuhn, H; Fietzek, P P; Lampen, J. O.

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  11. alpha-Amylase production in high cell density submerged cultivation of Aspergillus oryzae and A. nidulans.

    Science.gov (United States)

    Agger, T; Spohr, A B; Nielsen, J

    2001-01-01

    The effect of biomass concentration on the formation of Aspergillus oryzae alpha-amylase during submerged cultivation with A. oryzae and recombinant A. nidulans strains has been investigated. It was found that the specific rate of alpha-amylase formation in chemostats decreased significantly with increasing biomass concentration in the range of approx. 2-12 g dry weight kg(-1). When using a recombinant A. nidulans strain in which the gene responsible for carbon catabolite repression of the A. oryzae alpha-amylase gene (creA) was deleted, no significant decrease in the specific rate of alpha-amylase formation was observed. On the basis of the experimental results, it is suggested that the low value of the specific alpha-amylase productivity observed at high biomass concentration is caused by slow mixing of the concentrated feed solution in the viscous fermentation medium. PMID:11234963

  12. Interactions between Barley a-Amylases, Substrates, Inhibitors and Regulatory Proteins

    DEFF Research Database (Denmark)

    Hachem, Maher Abou; Bozonnet, Sophie; Willemoës, Martin;

    2006-01-01

    Barley a-amylase binds sugars at two sites on the enzyme surface in addition to the active site. Crystallography and site-directed mutagenesis highlight the importance of aromatic residues at these surface sites as demonstrated by Kd values determined for ß-cyclodextrin by surface plasmon resonance...... is studied by mutagenesis, crystallography and microcalorimetry. Further improvement of recombinant AMY2 production allows future direct mutational analysis in this isozyme. Specific proteinaceous inhibitors act on a-amylases of different origin. In the complex of barley a-amylase...... are targets of the disulphide reductase thioredoxin h that attacks a specific disulphide bond in BASI and, remarkably, reduces two different disulphide bonds in the barley monomeric and dimeric amylase inhibitors that both belong to the CM-proteins and inhibit animal a-amylase....

  13. Clinical Performance of a Salivary Amylase Activity Monitor During Hemodialysis Treatment

    Directory of Open Access Journals (Sweden)

    Masaru Shimazaki

    2008-01-01

    Full Text Available The hemodialysis procedure is thought to be a physical stressor in the majority of hemodialyzed patients. Previous studies suggest that elevated salivary amylase level may correlate with increased plasma norepinephrine level under psychological and physical stress conditions. In this study, we investigated biological stress reactivity during hemodialysis treatment using salivary amylase activity as a biomarker. Seven patients (male/female = 5/2, age:67.7+ /− 5.9 years who had been receiving regular 4 h hemodialysis were recruited. Salivary amylase activity was measured using a portable analyzer every hour during the hemodialysis session. Salivary amylase activity was shown to be relatively stable and constant throughout hemodialysis, whereas there were significant changes in systolic blood pressure and pulse rate associated with blood volume reduction. Our results show that hemodialysis treatment per se dose not affect salivary amylase activity.

  14. Clinical significance of elevated serum and urine amylase levels in patients with appendicitis.

    Science.gov (United States)

    Swensson, E E; Maull, K I

    1981-12-01

    During the 45 month period beginning January 1977, 251 patients with a pathologically confirmed diagnosis of acute appendicitis underwent celiotomy at the Medical College of Virginia Hospital. A preoperative serum or urine amylase determination was recorded in 155 of the patients (62 percent). Of this group, 15 patients (10 percent) had elevation of serum amylase or 2 hour urine amylase. Hyperamylasemia or hyperamylasuria directly led to misdiagnosis or treatment delay in 5 of the 15 patients. Appendiceal rupture occurred in three patients, two of whom had prolonged (greater than 1 month) hospitalizations directly attributable to the misdiagnosis. As a result of this study, we conclude that (1) acute appendicitis and elevated amylase levels may occur concurrently, (2) hyperamylasemia or hyperamylasuria should not dissuade the surgeon from early operation if other clinical features suggest appendicitis, and (3) abdominal pain and elevation of amylase level define significant intraabdominal disease, not specifically pancreatic disease. PMID:6172043

  15. Amylase production by endophytic fungi Cylindrocephalum sp. isolated from medicinal plant Alpinia calcarata (Haw. Roscoe

    Directory of Open Access Journals (Sweden)

    V. H. Sunitha.

    2012-09-01

    Full Text Available Amylases are among the most important enzymes used in modern biotechnology particularly in the process involving starch hydrolysis. Fungal amylase has large applications in food and pharmaceutical industries. Considering these facts, endophytic fungi isolated from the plant Alpinia calcarata (Haw. Roscoe were screened for amylolytic activity on glucose yeast extract peptone agar (GYP medium. Among thirty isolates of endophytic fungi, isolate number seven identified as Cylindrocephalum sp. (Ac-7 showed highest amylolytic activity and was taken for further study. Influence of various physical and chemical factors such as pH, temperature, carbon and nitrogen sources on amylase production in liquid media were studied. The maximal amylase production was found to be at 30ºC and at pH 7.0 of the growth medium. Among the various carbon and nitrogen sources tested, maltose at 1.5% and Sodium nitrate at 0.3% respectively gave optimum amylase production.

  16. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    OpenAIRE

    Long, C M; Virolle, M J; Chang, S Y; Chang, S.; Bibb, M.J.

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  17. Studies on amylase activity of pancreatin obtained from bovine pancreas

    International Nuclear Information System (INIS)

    The main objective of this study was to prepare pancreatin in liquid and powder form and to determine its amylase activity in crude homogenate of animal tissue. Different conditions were optimized for estimation of maximal activity including pH, temperature and substrate concentration. The optimum pH was found to be 6.8. The enzyme was optimally active at 50 degree C. The effect of substrate concentration on enzyme activity was also studied and Km was found to be 0.5%. (author)

  18. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.

    Science.gov (United States)

    Houba, R; Heederik, D J; Doekes, G; van Run, P E

    1996-07-01

    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers. PMID:8680668

  19. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation.

    Science.gov (United States)

    Nakajima, Kei

    2016-03-25

    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations (CNVs) in the salivary amylase gene (AMY1), which range more broadly than the pancreatic amylase gene (AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent (minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance (major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome. PMID:27022442

  20. Characterization of two coleopteran α-amylases and molecular insights into their differential inhibition by synthetic α-amylase inhibitor, acarbose.

    Science.gov (United States)

    Channale, Sonal M; Bhide, Amey J; Yadav, Yashpal; Kashyap, Garima; Pawar, Pankaj K; Maheshwari, V L; Ramasamy, Sureshkumar; Giri, Ashok P

    2016-07-01

    Post-harvest insect infestation of stored grains makes them unfit for human consumption and leads to severe economic loss. Here, we report functional and structural characterization of two coleopteran α-amylases viz. Callosobruchus chinensis α-amylase (CcAmy) and Tribolium castaneum α-amylase (TcAmy) along with their interactions with proteinaceous and non-proteinaceous α-amylase inhibitors. Secondary structural alignment of CcAmy and TcAmy with other coleopteran α-amylases revealed conserved motifs, active sites, di-sulfide bonds and two point mutations at spatially conserved substrate or inhibitor-binding sites. Homology modeling and molecular docking showed structural differences between these two enzymes. Both the enzymes had similar optimum pH values but differed in their optimum temperature. Overall, pattern of enzyme stabilities were similar under various temperature and pH conditions. Further, CcAmy and TcAmy differed in their substrate affinity and catalytic efficiency towards starch and amylopectin. HPLC analysis detected common amylolytic products like maltose and malto-triose while glucose and malto-tetrose were unique in CcAmy and TcAmy catalyzed reactions respectively. At very low concentrations, wheat α-amylase inhibitor was found to be superior over the acarbose as far as complete inhibition of amylolytic activities of CcAmy and TcAmy was concerned. Mechanism underlying differential amylolytic reaction inhibition by acarbose was discussed. PMID:27132147

  1. ISOLATION AND IDENTIFICATION OF AMYLASE PRODUCING YEASTS IN ‘TELLA’ (ETHIOPIAN LOCAL BEER AND THEIR AMYLASE CONTRIBUTION FOR ‘TELLA’ PRODUCTION

    Directory of Open Access Journals (Sweden)

    Berhanu Andualem

    2013-08-01

    Full Text Available ‘Tella’ is local beer which is used in most part of Ethiopia. It is made from cereals, such as barley, wheat, maize and other crops. Rhamnus prinoides is also used to provide a special aroma and flavor as well as antiseptic agent. The objective of this study is to determine the contribution of amylases from tella yeast isolates and compare with the role of amylase from malt. House hold ‘tella’ samples were collected and plated on starch agar and then amylase positive isolates of yeast were identified by folding iodine solution over the starch agar. Amylase assay and activities were investigated by standard methods and compared with amylase from malt. According to this study, the activity of amylases which was extracted from yeast isolates was very low and may have no contribution in the conversion of starch into fermentable sugars. Thus, it is better to avoid such organisms from ‘tella’ fermentation in order to discriminate unwanted bio-products. In conclusion, the substrates and ingredients should be sterilized and introduced into the fermentation system aseptically.

  2. Effects of dietary amylase and sucrose on productivity of cows fed low-starch diets.

    Science.gov (United States)

    Vargas-Rodriguez, C F; Engstrom, M; Azem, E; Bradford, B J

    2014-07-01

    Recent studies have observed positive effects of both sucrose and exogenous amylase on the productivity of dairy cattle. Our objective was to evaluate direct effects and interactions of amylase and sucrose on dry matter intake (DMI), milk production, and milk components. Forty-eight multiparous Holstein cows between 70 and 130 d in milk were randomly assigned to each of 4 pens (12 cows/pen). Pens were randomly assigned to treatment sequence in a 4 × 4 Latin square design, balanced for carryover effects. Treatment periods were 28 d, with 24 d for diet adaptation and 4d for sample and data collection. The treatments were a control diet (36% NDF and 21% starch), the control diet with amylase [0.5 g/kg of DM; Ronozyme RumiStar 600 (CT); DSM Nutritional Products Ltd., Basel, Switzerland], a diet with sucrose replacing corn grain at 2% of DM, and the sucrose diet with amylase (0.5 g/kg of DM). All data were analyzed with mixed models, including the fixed effects of sugar, amylase, and their interaction, and the random effects of period and pen. Milk data included the random effects of cow nested within pen and pen × period to provide the error term for the pen-level analysis. Dry matter intake was not affected by treatments. Milk yield and milk composition were not altered by the inclusion of sucrose or amylase; however, a tendency for an amylase × sucrose interaction was observed for milk protein content, reflecting slightly lower milk protein concentrations for amylase and sucrose treatments (3.00 and 2.99 ± 0.03%) compared with the control and amylase + sucrose treatments (3.02 and 3.03 ± 0.03%). Solids-corrected and fat-corrected milk yields were not significantly altered by treatment, although the direct effect of amylase approached significance for both variables, suggesting possible small increases with amylase supplementation (~0.5 kg/d). Feed efficiency (energy-corrected milk divided by dry matter intake) numerically increased with either amylase (1.57 ± 0

  3. Antidiabetic Indian Plants: A Good Source of Potent Amylase Inhibitors

    Directory of Open Access Journals (Sweden)

    Menakshi Bhat

    2011-01-01

    Full Text Available Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG. Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L. Sprengel; Ocimum tenuflorum (L. (syn: Sanctum; Syzygium cumini (L. Skeels (syn: Eugenia jambolana; Linum usitatissimum (L. and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor.

  4. Circadian rhythm of alpha-amylase in rat parotid gland.

    Science.gov (United States)

    Bellavía, S L; Sanz, E G; Chiarenza, A P; Sereno, R; Vermouth, N T

    1990-01-01

    The circadian rhythm of alpha-amylase, E.C. 3.2.1.1. (alpha-1,4-glucan-4-glucanohydrolase) in parotid gland of 25 day old rats was studied under different experimental conditions (fast, reversed photoperiod, constant light or darkness and treatment with reserpine and alpha-methyl-p-tyrosine). The rhythm of rats fasted or exposed for 7 days to constant darkness did not change. There were modifications in the rhythm of rats submitted to a reversed photoperiod and it disappeared in animals submitted to constant light or darkness for 15 days or treated with reserpine or alpha-methyl-p-tyrosine. The rhythm persisted, with minor changes in the acrophase, in parotids of rats kept during their gestation and post-natal life in constant light or darkness. Results suggest that the circadian rhythm of alpha-amylase in parotid gland of young rats is endogenous, synchronized by the photoperiod, under autonomous nervous system control and maternal coordination. This model appears to be useful in the study of sympathetic nervous system control of target organs and circadian rhythms in general. PMID:2076161

  5. Amylase in the saliva and in the gastric aspirates of premature infants: its potential role in glucose polymer hydrolysis.

    Science.gov (United States)

    Hodge, C; Lebenthal, E; Lee, P C; Topper, W

    1983-12-01

    Amylase activity was found in saliva from 13 infants, 26-42 wk corrected gestational age. The levels of salivary amylase activity increased with advancing age. In 10 infants, 31-38 wk corrected gestational age (estimated gestational age in wk plus age in wk after birth), gastric aspirates collected before a feeding and sequentially at 30-min intervals after two consecutive feedings were analyzed for amylase activity and pH. Two different postprandial patterns were obtained. For six of the 10 infants, both the pH and amylase activities of their gastric aspirates showed a distinct maxima at about 60 min after a feeding and a minima at 180 min just before the second feeding. In the remaining four infants, the pHs of their gastric aspirates remained relatively high (5.0-6.0) for the entire postprandial period. In these infants, there was a persistently high level of the amylase activity. In all 10 infants, amylase activity was found in their gastric aspirate samples when the pH was above 3.0. Comparison of the amylase in the gastric aspirate with purified pancreatic and salivary amylases by polyacrylamide gel electrophoresis showed that the amylase in the gastric aspirate has an electrophoretic mobility similar to that of salivary amylase, which suggests a salivary origin. This study supports the possibility that salivary amylase could enter the stomach and retain a significant amount of its activity in premature infants. PMID:6197692

  6. The influence of nitrogen sources on the alpha-amylase productivity of Aspergillus oryzae in continuous cultures.

    Science.gov (United States)

    Pedersen, H; Nielsen, J

    2000-03-01

    The influence of the nitrogen source on the alpha-amylase productivity of Aspergillus oryzae was quantified in continuous cultivations. Both inorganic and complex nitrogen sources were investigated and glucose was used as the carbon and energy sources. For production of alpha-amylase, nitrate was shown to be inferior to ammonia as a nitrogen source. A mixture of ammonia and complex nitrogen sources, such as yeast extract or casein hydrolysate, was better than with ammonia as the sole nitrogen source. Even a low concentration of casein hydrolysate (0.05 g l(-1)) resulted in a 35% increase in the alpha-amylase productivity. The higher alpha-amylase productivity during growth on casein hydrolysate was not caused by increased transcription of the alpha-amylase genes but was caused by a faster secretion of alpha-amylase or by a lower binding of alpha-amylase to the biomass. PMID:10772466

  7. α-Amylase: an enzyme specificity found in various families of glycoside hydrolases

    DEFF Research Database (Denmark)

    Janeček, Štefan; Svensson, Birte; MacGregor, E. Ann

    2014-01-01

    α-Amylase (EC 3.2.1.1) represents the best known amylolytic enzyme. It catalyzes the hydrolysis of α-1,4-glucosidic bonds in starch and related α-glucans. In general, the α-amylase is an enzyme with a broad substrate preference and product specificity. In the sequence-based classification system of...... all carbohydrate-active enzymes, it is one of the most frequently occurring glycoside hydrolases (GH). α-Amylase is the main representative of family GH13, but it is probably also present in the families GH57 and GH119, and possibly even in GH126. Family GH13, known generally as the main α-amylase...... family, forms clan GH-H together with families GH70 and GH77 that, however, contain no α-amylase. Within the family GH13, the α-amylase specificity is currently present in several subfamilies, such as GH13_1, 5, 6, 7, 15, 24, 27, 28, 36, 37, and, possibly in a few more that are not yet defined. The α-amylases...

  8. β-amylase in developing apple fruits: activities, amounts and subcellular localization

    Institute of Scientific and Technical Information of China (English)

    ZHANG; Dapeng; (张大鹏); WANG; Yongzhang(王永章)

    2002-01-01

    Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuberous roots, and fleshy fruit development. Based on previously reported in vitro assays, β-amylase is considered one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was shown often extrachloroplastic in living cells. The present experiment showed that β-amylase activity was progressively increasing concomitantly with decreasing starch concentrations during apple (Malus domestica Borkh cv. Starkrimson) fruit development. The apparent amount of β-amylase assessed by Western blotting also increased during the fruit development, which is consistent with the seasonal changes in the enzyme activity. The subcellular-localization studies via immunogold electron-microscopy technique showed that β-amylase visualized by gold particles was predominantly located in plastids especially at periphery of starch granules, but the gold particles were scarcely found in other subcellular compartments. These data proved for the first time that the enzyme is compartmented in its functional sites in plant living cells. The predominantly plastid-distributed pattern of β-amylase in cells was shown unchanged throughout the fruit development. The density of gold particles (β-amylase) in plastids was increasing during the fruit development, which is consistent with the results of Western blotting. So it is considered that β-amylase is involved in starch hydrolysis in plastids of the fruit cells.

  9. Studies on the Thermodenaturation Behavior of Bacillus subtilis α-Amylase on Chromatographic Media

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The thermodenaturation behavior of Bacillus subtilis α-amylase on some chromatographic media was studied by determining their adsorption parameters with frontal analysis. The experimental results show that on a RP-C18 reversed-phase medium, a Chelating Sepharose Fast-Flow chelated by Zn2+ affinity medium and a WCX-1 cation-exchange medium, a stable conformation of a-amylase molecule separately exists below or over 30℃; while on a PEG-400 hydrophobic medium and a modified PEG-400 medium, a stable conformation of α-amylase mole-cule separately exists below 40 and 30℃, and when the experimental temperatures are separately over 40 and 30℃,a drastically conformational change of α-amylase molecules can continuously take place. And by combining the in-trinsic fluorescence emission spectrum and thermal inactivation profile of α-amylase in free solution and on the PEG-400 and modified PEG-400 hydrophobic media, it can be concluded that in liquid chromatographic procedure,chromatographic media can induce the conformational change of a-amylase molecules and promote their ther-modenaturation; and in hydrophobic interaction chromatography, the higher the hydrophobicity of chromatographicmedium, the lower the conformational change temperature of a-amylase molecules on the chromatographic me-dium.

  10. The Prognostic Value of Drain Amylase on Post-Operative Day One after the Whipple Procedure

    Directory of Open Access Journals (Sweden)

    Kristina Hasselgren

    2016-03-01

    Full Text Available Introduction For patients with periampullary tumors, the only treatment with curative intention is resection. One potentially serious complication is a postoperative pancreatic fistula. The reported risk factors are a soft pancreas and a small pancreatic duct as well as overweight/ obesity. The aim of this study was to investigate the prognostic value for a postoperative pancreatic fistula of elevated drain amylase (>3 times the upper limit in serum on postoperative day 1. Results In total, 170 patients underwent a pancreaticoduodenectomy at Linköping University Hospital between 2011 and 2014; 27 patients (16% had a postoperative complication ≥ grade 3b, and the postoperative mortality was 3%. The patients with elevated drain amylase on postoperative day one (n=65 had more complications (≥3b than the patients without elevated levels (n=80, although the difference was not significant (p=0.054. Two patients (3% without elevated amylase on postoperative day 1 developed postoperative pancreatic fistula (p<0.001 compared to 29 patients (45% with elevated amylase. Conclusion Normal drain amylase on postoperative day 1 is associated with a lower risk of postoperative complications than is elevated drain amylase. Elevated amylase in the drain fluid on postoperative day 1 is significantly correlated with POPF and is associated with an increased risk of postoperative complications.

  11. Gene knockout of the intracellular amylase gene by homologous recombination in Streptococcus bovis.

    Science.gov (United States)

    Brooker, J D; McCarthy, J M

    1997-09-01

    Streptococcus bovis expresses two different amylases, one intracellular and the other secreted. A suicide vector containing part of the intracellular alpha-amylase gene from Streptococcus bovis WI-1 was recombined into the S. bovis WI-1 chromosome to disrupt the endogenous gene. Recombination was demonstrated by Southern blot, and zymogram analysis confirmed the loss of the intracellular amylase. Amylase activity in cell-free extracts of the recombinant grown in the presence of 1% starch was only 7% of wild type. The rate of logarithmic growth of the recombinant was 15-20% of the wild type in medium containing either 1% glucose, starch, or cellobiose. Revertants and non-amylase control recombinants had logarithmic growth rates that were the same as wild type. Plasmid transformants containing multiple copies of the cloned gene expressed up to threefold higher levels of intracellular amylase activity than wild type but did not demonstrate elevated growth rates. These results suggest that a critical level of expression of the intracellular amylase gene may be important for rapid growth of the bacterium. PMID:9236293

  12. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    Energy Technology Data Exchange (ETDEWEB)

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. (Georg-August-Univ., Gottingen (Germany))

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  13. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch

    International Nuclear Information System (INIS)

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. Km values were 0.26 and 0.87 mM and Vmax values were 0.36 IU mg−1 and 22.32 IU mg−1 for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70–80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. - Highlights: ► Developing to prepare nanoprotein particles carrying α-amylase ► Characterization of nanostructured α-amylase ► Usability of α-amylase nanoparticles in hydrolysis of starch

  14. Spectroscopic study on the interaction of Bacillus subtilis α-amylase with cetyltrimethylammonium bromide

    International Nuclear Information System (INIS)

    The interaction between α-amylase from Bacillus subtilis and cetyltrimethylammonium bromide (CTAB) has been investigated at various temperature conditions using fluorescence and circular dichroism (CD) spectroscopic methods. Fluorescence data revealed that the fluorescence quenching of α-amylase by CTAB is the result of complex formation between CTAB and α-amylase. The thermodynamic analysis on the binding interaction data shows that the interactions are strongly exothermic (ΔHo=-17.92 kJ mol-1) accompanied with increase in entropy (ΔSo between 109 to 135 J mol-1 K-1). Thus the binding of CTAB to α-amylase is both enthalpic and entropic driven, which represent the predominate role of both electrostatic and hydrophobic interactions in complex formation process. The values of 2.17x10-3 M-1 and 1.30 have been obtained from associative binding constant (Ka) and stoichiometry of binding number (n), from analysis of fluorescence data, respectively. Circular dichroism spectra showed the substantial conformational changes in secondary structure of α-amylase due to binding of CTAB, which represents the complete destruction of both secondary and tertiary structure of α-amylase by CTAB. - Research highlights: → The Fluorescence quenching effect of α-amylase by CTAB is a consequence of formation α-amylase-CTAB complex. → The α-helical analyzing from the CD spectra in the various concentration of CTAB shows strongly deformation of α-amylase. → Thermodynamic analysis of quenching verify that the interactions are both enthalpy and entropic driven.

  15. Spectroscopic study on the interaction of Bacillus subtilis {alpha}-amylase with cetyltrimethylammonium bromide

    Energy Technology Data Exchange (ETDEWEB)

    Omidyan, R., E-mail: r.omidyan@sci.ui.ac.i [Department of Chemistry, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of); Kazemi, S.H. [Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of); Bordbar, A.K. [Department of Chemistry, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Zaynalpour, S. [Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of)

    2011-06-15

    The interaction between {alpha}-amylase from Bacillus subtilis and cetyltrimethylammonium bromide (CTAB) has been investigated at various temperature conditions using fluorescence and circular dichroism (CD) spectroscopic methods. Fluorescence data revealed that the fluorescence quenching of {alpha}-amylase by CTAB is the result of complex formation between CTAB and {alpha}-amylase. The thermodynamic analysis on the binding interaction data shows that the interactions are strongly exothermic ({Delta}H{sup o}=-17.92 kJ mol{sup -1}) accompanied with increase in entropy ({Delta}S{sup o} between 109 to 135 J mol{sup -1} K{sup -1}). Thus the binding of CTAB to {alpha}-amylase is both enthalpic and entropic driven, which represent the predominate role of both electrostatic and hydrophobic interactions in complex formation process. The values of 2.17x10{sup -3} M{sup -1} and 1.30 have been obtained from associative binding constant (K{sub a}) and stoichiometry of binding number (n), from analysis of fluorescence data, respectively. Circular dichroism spectra showed the substantial conformational changes in secondary structure of {alpha}-amylase due to binding of CTAB, which represents the complete destruction of both secondary and tertiary structure of {alpha}-amylase by CTAB. - Research highlights: {yields} The Fluorescence quenching effect of {alpha}-amylase by CTAB is a consequence of formation {alpha}-amylase-CTAB complex. {yields} The {alpha}-helical analyzing from the CD spectra in the various concentration of CTAB shows strongly deformation of {alpha}-amylase. {yields} Thermodynamic analysis of quenching verify that the interactions are both enthalpy and entropic driven.

  16. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch

    Energy Technology Data Exchange (ETDEWEB)

    Say, R. [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Şenay, R. Hilal [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Akgöl, Sinan, E-mail: sinanakgol@yahoo.co.uk [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Denizli, Adil [Hacettepe University, Faculty of Science, Chemistry Department, 06532 Ankara (Turkey)

    2013-05-01

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. K{sub m} values were 0.26 and 0.87 mM and V{sub max} values were 0.36 IU mg{sup −1} and 22.32 IU mg{sup −1} for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70–80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. - Highlights: ► Developing to prepare nanoprotein particles carrying α-amylase ► Characterization of nanostructured α-amylase ► Usability of α-amylase nanoparticles in hydrolysis of starch.

  17. Seeking new mutation clues from Bacillus licheniformis amylase by molecular dynamics simulations

    Science.gov (United States)

    Lu, Tao

    2009-07-01

    Amylase is one of the most important industrial enzymes in the world. Researchers have been searching for a highly thermal stable mutant for many years, but most focus on point mutations of one or few nitrogenous bases. According to this molecular dynamic simulation of amylase from Bacillus licheniformis (BLA), the deletion of some nitrogenous bases would be more efficacious than point mutations. The simulation reveals strong fluctuation of the BLA structure at optimum temperature. The fluctuation of the outer domains of BLA is stronger than that of the core domain. Molecular simulation provides a clue to design thermal stable amylases through deletion mutations in the outer domain.

  18. Changes of amylase and trypsin activities in pancreas of rats after γ-irradiation

    International Nuclear Information System (INIS)

    The activities of amylase and trypsin in pancreas of rats decreased significantly after irradiation. The degree of changes in both amylase and trypsin was identical, depending on radiation doses and varying with the weight of pancreas. Within a certain range of doses the weight and enzymic activity of pancreas decreased gradually. The amylase and trypsin activities of pancreas decreased markedly after 6 Gy exposure. These enzymic activities varied with time after exposure and fluctuated around low level for a long time. The recovery of enzymic activity occurred later than that of pancreas weight. These results indicated that the mechanism of decrease and recovery of pancreatic enzyme was complex

  19. Regulation of amylase messenger RNA concentration in rat pancreas by food content.

    OpenAIRE

    Giorgi, D; Bernard, J P; Lapointe, R.; Dagorn, J C

    1984-01-01

    Regulation of the expression of pancreatic amylase genes was studied by comparing groups of rats fed diets with high (75%), intermediate (20%) and low (11%) carbohydrate content. Animals on the high carbohydrate diet had nine times as much amylase mRNA as those on low carbohydrate diet, and twice as much as the intermediate group, as determined by filter hybridization of equal amounts of total pancreatic RNA to an excess of a cloned rat amylase cDNA probe. Parallel results were obtained when ...

  20. Measurements of amylase isoenzymes in sera and saliva of patients after radiotherapy because of larynx carcinoma

    International Nuclear Information System (INIS)

    Serum and salivary alpha-amylase were measured for controls and patients with laryngeal carcinoma before and after localized irradiation including salivary glands. A significant increase in amylasemia was observed after irradiation. Alpha-amylase activity in saliva was decreased after irradiation but differences were not statistically significant due to the significant decrease of protein in saliva of irradiated group. An increase of salivary isoenzyme S activity was observed while pancreatic isoenzyme activity was not altered. This method allows easy differentiation of hyperamylasemia due to irradiation of parothyroid gland and disorders of the pancreas. Alpha-amylase activity measurements may detect metabolic changes in salivary glands after irradiation. (author)

  1. Effects of irradiation with conventional and multiple daily fractionation on serum amylase activity

    International Nuclear Information System (INIS)

    The behaviour of serum α-amylase activity was determined in patients with head and neck cancer treated by radiation therapy. The levels of serum α-analyse activity during conventional and multiple daily fractionation were compared. Starting from the second day of treatment an increase of serum α-amylase activity was observed. The increase and its duration depended on the total daily dose: after the first day of treatment a linear correlation between serum levels and total daily dose could be observed. The size of the amylase increase correlated to the proportion of salivary gland tissue included in the irradiated volume. (orig.)

  2. Variations of salivary amylase as a test of internal irradiation in man

    Energy Technology Data Exchange (ETDEWEB)

    Zamfirescu-Gheorghiu, M.; Cheta, N.; Funduc, I.; Ciobanu, F.

    1975-01-01

    The hypothesis of the parotid gland radiosensitivity has suggested to the authors to follow up the effect of therapeutic internal irradiation on the serum, urine and salivary ..cap alpha..-amylasee activity in man. The assay and visualization of ..cap alpha..-amylase isoenzymes on agar gel zymograms by using the ''Phadebas amylase test'' tablets has demonstrated in some cases increases of salivary ..cap alpha..-amylase activity expressed by the ratio of the optical density after internal irradiation to that before administration of radioisotopes.

  3. Effect of Cerium on Activity of α-Amylase from Porcine Pancreas

    Institute of Scientific and Technical Information of China (English)

    王雪峰; 洪法水; 沈颂东; 苏国兴; 潘兴法

    2002-01-01

    The activity of α-amylase from porcine pancreas was enhanced under the treatment by Ce3+ of low concentration (0.5~10 μmol*L-1), but was inhibited by Ce3+ of high concentration (>10 μmol*L-1). Ce3+ at high concentration displaced Ca2+ from α-amylase competitively. The equilibrium dialysis demonstrates that α-amylase has five Ca2+-binding sites with different affinities. The fluorescence titration shows that Ce3+ can bind to Ca2+-binding sites.

  4. Adrenergic effects on secretion of amylase from the rat salivary glands

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1988-01-01

    The present study was undertaken to investigate the effect of adrenergic agents on secretion of amylase from the salivary glands in vivo. Saliva was collected from the distal oesophagus in conscious rats. Adrenaline increased the concentration of amylase in saliva and serum significantly. The...... result of infusion of alpha- and beta-adrenergic antagonists as well as noradrenaline and isoproterenol showed that secretion of salivary amylase is predominantly mediated by stimulation of beta-adrenergic receptors, especially of the beta 1-subtype. Investigation of the isoenzyme pattern in saliva...

  5. AMYLASE PRODUCTION BY ASPERGILLUS NIGER UNDER SOLID STATE FERMENTATION USING AGROINDUSTRIAL WASTES

    OpenAIRE

    Suganthi; R., Benazir,; J.F., Santhi,; R., Ramesh Kumar,; V., Anjana Hari,; Nitya Meenakshi; Nidhiya; K. A., Kavitha,; G., Lakshmi, R.

    2011-01-01

    Solid state fermentation holds tremendous potentials for the production of the enzyme amylase by Aspergillus niger. Different solid substrates like rice bran, wheat bran, black gram bran, coconut oil cake, gingely oil cake and groundnut oil cake are rich in starch. These agro industrial residues are cheap raw materials for amylase production. Aspergillus niger BAN3E was identified to be the best producer of amylase. When A. niger BAN3E was incubated for 6 days at 37°C it showed high yield of ...

  6. Isolation of Alpha-amylase Producing Thermophilic Bacillus Strains and Partial Characterization of the Enzymes

    OpenAIRE

    Celal Türker; Bahri Devrim Özcan

    2015-01-01

    In the present study, we isolated three thermophilic Bacillus strains from the soil samples collected from the coast sediments of the Burnaz Stream located in Erzin. The isolates were entitled as Bacillus sp. CT1, CT2, and CT3, respectively. The maximum α-amylase production was revealed at 60°C for CT1 strain, and at 80°C for CT2 and CT3 strains, respectively. The optimum enzyme activity was observed at 90°C for CT1 α-amylase, whereas at 60°C for CT2 and CT3 α-amylases. On the other hand, opt...

  7. Structural and mechanistic studies of chloride induced activation of human pancreatic α-amylase

    OpenAIRE

    Maurus, Robert; Begum, Anjuman; Kuo, Hsin-Hen; Racaza, Andrew; Numao, Shin; Andersen, Carsten; Tams, Jeppe W.; Vind, Jesper; Overall, Christopher M.; Withers, Stephen G.; Brayer, Gary D

    2005-01-01

    The mechanism of allosteric activation of α-amylase by chloride has been studied through structural and kinetic experiments focusing on the chloride-dependent N298S variant of human pancreatic α-amylase (HPA) and a chloride-independent TAKA-amylase. Kinetic analysis of the HPA variant clearly demonstrates the pronounced activating effect of chloride ion binding on reaction rates and its effect on the pH-dependence of catalysis. Structural alterations observed in the N298S variant upon chlorid...

  8. Purification and characterization of α-Amylase from Miswak Salvadora persica

    OpenAIRE

    Mohamed, Saleh A; Yaaser Q. Almulaiky; Ahmed, Youssri M; Al-Bar, Omar AM; Ibrahim, Ibrahim H

    2014-01-01

    Background The miswak (Salvadora persica) is a natural toothbrush. It is well known that very little information has been reported on enzymes in miswak as medicinal plant. Recently, we study peroxidase in miswak. In the present study, the main goal of this work is to purify and characterize α-amylase from miswak. The second goal is to study the storage stability of α-amylase in toothpaste. Method The purification method included chromatographaphy of miswak α-amylase on DEAE-Sepharose column a...

  9. Comparative Analysis on the Purified Amylases from Healthy and Diseased Sugarcane Juice

    OpenAIRE

    M. Habibur Rahman; Md. Salim Uddin; Nural Islam; Farjana Nikkon; M. Fida Hasan

    2001-01-01

    Amylase was purified from the juice of healthy and diseased sugarcane, Ishurdi (Isd)-20 by successive chromatographies on DEAE-Sephadex A-50 and Sephadex G-150 to a homogeneous state as confirmed by polyacrylamide disc gel electrophoresis (PAGE). The molecular weights of the enzyme from healthy and diseased sugarcane juices were estimated as 55.8 and 56.3 kDa, respectively by gel filtration. The purified amylases were of -type and not a glycoprotein in nature. The purified amylases showed the...

  10. Purification of a novel α-amylase inhibitor from local Himalayan bean (Phaseolus vulgaris) seeds with activity towards bruchid pests and human salivary amylase.

    Science.gov (United States)

    Gupta, Mridu; Sharma, Pratima; Nath, Amarjit K

    2014-07-01

    Six bean (Phaseolus vulgaris L.) cultivars of Himalayan region were analysed for α- amylase inhibitor activity. The α-amylase inhibitor from seeds of screened bean cultivar KR-9, showing maximum inhibitory activity was purified using ammonium sulfate precipitation, gel filtration chromatography (Sephadex G-100) and ion exchange chromatography (DEAE-Sephadex). The inhibitor was purified to homogeneity as judged by native-PAGE with 14.22 fold purification and 71.66% recovery. Purified inhibitor consisted of three subunits of molecular weight 15,488, 18,620 and 26,302 daltons, respectively as determined by SDS-PAGE. It was found to be heat stable up to 30 °C-40 °C and had two pH optima of 5.0 and 6.9. Nature of inhibition was found to be of non-competitive type. The purified inhibitor was found to be effective against α-amylases extracted from larvae of Callosobruchus chinensis, Tribolium castaneum and gut enzyme of Spodoptera littoralis. Larvae of Tribolium castaneum fed on flour mixed with purified inhibitor for 5 days showed 100% larval mortality. Purified α-amylase inhibitor was also found to inhibit human salivary α-amylase, suggesting its potential in prevention and therapy of obesity and use as drug design targets for treatment of diabetes. The gene encoding the inhibitor may be used to develop transgenic plants resistant against insect pests. PMID:24966421

  11. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.; Svensson, Birte; Aghajari, N.

    2005-01-01

    insight into the substrate binding by describing residues defining 9 subsites, namely -7 through +2. These structures support that the pseudotetrasaccharide inhibitor acarbose is hydrolyzed by the active enzymes. Moreover, sugar binding was observed to the starch granule-binding site previously determined...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active...... active site for polysaccharide chains. Moreover, the sugar tongs surface site could also perform the unraveling of amylose chains, with the aid of Tyr-380 acting as "molecular tweezers"....

  12. Characterization of extracellular amylase produced by haloalkalophilic strain Kocuria sp. HJ014.

    Science.gov (United States)

    Soto-Padilla, Marisela Y; Gortáres-Moroyoqui, Pablo; Cira-Chávez, Luis A; Levasseur, Anthony; Dendooven, Luc; Estrada-Alvarado, María Isabel

    2016-08-01

    The haloalkaliphilic bacterium Kocuria sp. (HJ014) has the ability to produce extracellular amylase. The aim of this study was to purify and characterize this protein. The amylase enzyme with a specific activity of 753,502 U/mg was purified 5.7- fold using Sepharose 4B and Sephacryl S-300 gel filtration columns. The molecular weight of the enzyme was 45,000 Da as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The amylase showed maximum activity at pH 9 and 50°C in the presence of 3.5 M NaCl. The Km was 3.0 mg/ml and Vmax 90.09 U/ml. It was found that extracellular amylase from Kocuria sp. has a high industrial potential. PMID:26813880

  13. Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations

    DEFF Research Database (Denmark)

    Møller, Kasper; Sharif, M.Z.; Olsson, Lisbeth

    2004-01-01

    Heterologous protein production by the yeast Saccharomyces kluyveri was investigated under aerobic glucose-limited conditions. alpha-Amylase from Aspergillus oryzae was used as model protein and the gene was expressed from a S. cerevisiae 2 mu plasmid. For comparison, strains of both S. kluyveri...... and S. cerevisiae were transformed with the same plasmid, which led to secretion of active alpha-amylase in both cases. The S. cerevisiae 2 mu plasmid was found to be stable in S. kluyveri as evaluated by a constant alpha-amylase productivity in a continuous cultivation for more than 40 generations. S....... kluyveri and S. cerevisiae secreted alpha-amylase with similar yields during continuous cultivations at dilution rates of 0.1 and 0.2 h(-1) (4.8-5.7 mg (g dry weight)(-1)). At a dilution rate of 0.3 h(-1) the metabolism of S. kluyveri was fully respiratory, whereas S. cerevisiae produced significant...

  14. Effect of 60Co-gamma whole-body irradiation on serum amylase level

    International Nuclear Information System (INIS)

    Changes of serum amylase activity in rats, after several doses of acut 60Co-gamma irradiation as a function of time were investigated. These changes proved to be of no diagnostic value in early radiation damage. (author)

  15. Plasma amylase activity as a biochemical indicator of radiation injury to salivary glands

    International Nuclear Information System (INIS)

    Irradiation of the salivary glands produces a rapid increase of salivary amylase in serum, released by the highly radiation sensitive serous cells of the glands. Serial assays of salivary amylase in serum were performed in patients treated by radiation to the upper neck region. The changes observed were compared with the amount of salivary gland mass irradiated and with the dose fractionation modality used. The irradiated volume included either the entire salivary gland mass or less than 50 per cent of the gland. Two fractionation modalities were used: a conventional fractionation of 2 Gy per day, 5 times a week, or a multiple daily fractionation of 2 Gy, 3 times a day in two series of 4 days with a 4-day interval. Both parameters (salivary gland mass irradiated and fractionation modality used) significantly influenced the shape of the amylase curve in the serum. Serum amylase may therefore be considered a reliable biologic indicator of early injury to the salivary glands. (Auth.)

  16. Augmentation of cholinergic-mediated amylase release by forskolin in mouse parotid gland

    International Nuclear Information System (INIS)

    Cholinergic-mediated amylase release in mouse parotid acini was augmented by forskolin; the potency but not the maximal response to carbachol was altered. Amylase released by carbachol plus forskolin was dependent on extracellular calcium and was mimicked by the calcium ionophore, A23187 plus forskolin. Forskolin was also shown to enhance carbachol-stimulated 45Ca2+ uptake into isolated acini. Hydroxylamine, nitroprusside, and 8-bromo-c-GMP each in combination with forskolin mimicked the effects of carbachol plus forskolin on amylase release. In the presence of carbachol (10-8M) forskolin did not augment c-AMP levels. However, in the presence of carbachol (5 x 10-7 M) or hydroxylamine (50 μM) forskolin did significantly augment c-AMP accumulation. These results suggest that calcium and c-GMP may mediate the augmentation of cholinergic-mediated amylase release by effects on c-AMP metabolism. 21 references, 1 figure, 3 tables

  17. Increased serum amylase in patients after radiotherapy as a probable bioindicator for radiation exposure

    International Nuclear Information System (INIS)

    The radiation-induced increase of serum amylase is investigated in 41 patients following either whole body irradiation or irradiation of the head- and neck-region. The radiation treatment caused a dose-independent serum amylase increase up to 80 times of the preirradiation measured in controls. This increase can only be induced if the salivary glands are within the radiation field. An isoenzyme analysis differentiated between salivary and pancreatic amylase. It was shown that also in case of whole body irradiation (wbi) pancreatic proteins either contribute only to a small extent to the increase or show no recognizable change. Although great variations in radiation response remain, the increase of serum amylase produced by salivary glands is highly significant and serves as a bioindicator for radiation exposures. (orig.)

  18. Influence of carbon source on alpha-amylase production by Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens

    2001-01-01

    The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol and...... on sucrose, fructose, glycerol, mannitol and acetate. During growth on acetate there was no production of alpha -amylase, whereas addition of small amounts of glucose resulted in alpha -amylase production. A possible induction by alpha -methyl-D-glucoside during growth on glucose was also...... investigated, but this compound was not found to be a better inducer of alpha -amylase production than glucose. The results strongly indicate that besides acting as a repressor via the CreA protein, glucose acts as an inducer....

  19. The synergetic effect of starch and alpha amylase on the biodegradation of n-alkanes.

    Science.gov (United States)

    Karimi, M; Biria, D

    2016-06-01

    The impact of adding soluble starch on biodegradation of n-alkanes (C10-C14) by Bacillus subtilis TB1 was investigated. Gas chromatography was employed to measure the residual hydrocarbons in the system. It was observed that the efficiency of biodegradation improved with the presence of starch and the obtained residual hydrocarbons in the system were 53% less than the samples without starch. The produced bacterial enzymes were studied through electrophoresis and reverse zymography for explaining the observations. The results indicated that the produced amylase by the bacteria can degrade hydrocarbons and the same was obtained by the application of a commercial alpha amylase sample. In addition, in silico docking of alpha-amylase with n-alkanes with different molecular weights was studied by Molegro virtual docker which showed high negative binding energies and further substantiated the experimental observations. Overall, the findings confirmed the catalytic effect of alpha amylase on n-alkanes degradation. PMID:26971168

  20. Effect of oilseed cakes on alpha-amylase production by Bacillus licheniformis CUMC305.

    Science.gov (United States)

    Krishnan, T; Chandra, A K

    1982-08-01

    The effects of oilseed cakes on extracellular thermostable alpha-amylase production by Bacillus licheniformis CUMC305 was investigated. Each oilseed cake was made of groundnut, mustard, sesame, linseed, coconut copra, madhuca, or cotton. alpha-Amylase production was considerably improved in all instances and varied with the oilseed cake concentration in basal medium containing peptone and beef extract. Maximum increases were effected by a low concentration (0.5 to 1.0%) of groundnut or coconut, a high concentration (3%) of linseed or mustard, and an Rintermediate concentration (2%) of cotton, madhuca, or sesame. The oilseed cakes made of groundnut or mustard could completely replace the conventional peptone-beef extract medium as the fermentation base for the production of alpha-amylase by B. licheniformis. The addition of corn steep liquor to cotton, linseed, sesame, or madhuca cake in the medium improved alpha-amylase production. PMID:6181738

  1. Plasma amylase activity as a biochemical indicator of radiation injury to salivary glands

    Energy Technology Data Exchange (ETDEWEB)

    Becciolini, A.; Giannardi, G.; Cionini, L.; Porciani, S.; Fallai, C.; Pirtoli, L. (Florence Univ. (Italy). Ist. di Radiologia)

    1984-01-01

    Irradiation of the salivary glands produces a rapid increase of salivary amylase in serum, released by the highly radiation sensitive serous cells of the glands. Serial assays of salivary amylase in serum were performed in patients treated by radiation to the upper neck region. The changes observed were compared with the amount of salivary gland mass irradiated and with the dose fractionation modality used. The irradiated volume included either the entire salivary gland mass or less than 50 per cent of the gland. Two fractionation modalities were used: a conventional fractionation of 2 Gy per day, 5 times a week, or a multiple daily fractionation of 2 Gy, 3 times a day in two series of 4 days with a 4-day interval. Both parameters (salivary gland mass irradiated and fractionation modality used) significantly influenced the shape of the amylase curve in the serum. Serum amylase may therefore be considered a reliable biologic indicator of early injury to the salivary glands.

  2. Ontogenesis of alpha-amylase in rat parotid gland during postnatal development.

    Science.gov (United States)

    Bellavia, S L; Sanz, E G; Vermouth, N T; Rins, L; Aoki, A

    1981-01-01

    Changes in alpha-amylase (alpha-1,4-glucan-4-glucanohydrolase, EC 3.2.1.1) of parotid gland were investigated during postnatal development of the rat. Modifications in amylase activity after birth allow the distinction of three stages which can be correlated with the morphologic development of the parotid gland. Significant sexual differences in the evolution of alpha-amylase activity were found. During the first stage (from birth to the 20th day) there is a higher increase in females, while males have a more pronounced increment in the second stage (from the 20th to the 30th day). By means of gel electrophoresis of parotid extracts, four molecular forms of amylase can be separated. The slowest migrating band (Form 1) is not detected at the initial stage. PMID:6164673

  3. Isolation of Amylase Producing Bacteria from Solar Salterns of Nellore District, Andhra Pradesh, India

    Directory of Open Access Journals (Sweden)

    Shameer Syed

    2013-03-01

    Full Text Available α-Amylases are a class of starch degrading enzymes catalyzing the hydrolysis of internal α-1,4-O-glycosidic bonds in polysaccharides. The following investigation were carried out to isolate haloalkaliphilic bacteria, a group of organisms with twin extremities of pH and salinity, capable of producing α-amylases from an artificial solar saltern. A total of 25 discrete colonies were isolated, 21 isolates showed amylase production. Among these 7 isolates produced amylase at extreme conditions such as salt, alkalinity and temperature. The isolates were characterized biochemically and also for other enzymes. From the results it is imperative that these isolates can be further studied to exploit them up to industrial scale.

  4. Amylase inhibitors as insecticides and pesticides - perspectives in GM-crop storage

    Czech Academy of Sciences Publication Activity Database

    Hubert, J.; Dolečková, Lucie; Pravcová, Michaela; Horn, Martin; Hýblová, J.; Kluh, Ivan; Stejskal, V.; Mareš, Michael

    Praha, 2003. s. 29. [Ecological Impact of Genetically Modified Organisms. 26.11.2003-29.11.2003, Praha] Institutional research plan: CEZ:AV0Z4055905 Keywords : storage-grain * pest * amylase inhibitor Subject RIV: CE - Biochemistry

  5. Spatio-temporal profiling and degradation of α-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, S.; Østergaard, O.;

    2007-01-01

    Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... identified only by immunostaining. Mass spectrometry identified 12 full-length forms and 12 fragments from the cultivar Barke. Products of both alpha-amylase 2 entries co-migrated in five full-length and one fragment spot. The alpha-amylase abundance and the number of fragments increased during germination...... only products of the above three genes appeared by germination also of 15 other barley cultivars, the cultivars had distinct repertoires of charge and molecular mass variant forms. These patterns appeared not to be correlated with malt quality....

  6. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  7. Effect of Static Magnetic Field on α-Amylase Activity and Enzymatic Reaction

    Institute of Scientific and Technical Information of China (English)

    JIA Shaoyi; LIU Yong; WU Songhai; WANG Zhibin

    2009-01-01

    The effect of magnetic field on α-amylase was studied. Under the experimental conditions, α-amylase solution was treated by 0.15 T, 0.30 T and 0.45 T static magnetic fields for a known period of time, then the activ-ity, kinetic parameters, and the secondary conformation were investigated. The results showed that there was a con-siderable effect of the magnetic exposure on the α-amylase. The activity was increased by 27%, 34.1%, 37.8% compared with the control. It was also found that both kinetic parameters Km and Vm could be decreased due to the increasing magnetic field, Km decreased from 2.20×102 to 0.87×102, whereas Vm decreased from 2.0×103 g/min to 1.1×103g/min. At the same time, there were some irregular changes in α-amylase secondary conformation.

  8. Amylase Production by the Marine Yeast Aureobasidium pullulans N13d

    Institute of Scientific and Technical Information of China (English)

    LI Haifeng; CHI Zhenming; WANG Xiaohong; MA Chunling

    2007-01-01

    The marine yeast strain N13d, producing an extracellular amylase, was isolated from the deep sea sediments of the Pacific Ocean. This strain was identified to be Aureobasidium pullulans by 18S rRNA gene sequence analysis and routine yeast identification methods. The optimal sea water medium for amylase production by this yeast strain was 1.0% peptone and 1.0% soluble starch with pH 4.0. The optimal conditions for amylase production by this yeast strain were with temperature 28 ℃, aeration rate 6Lmin-1 and agitation speed 250 rmin-1. Under these conditions, 58.5 units of amylase activity per mg protein were produced within 56h of fermentation.

  9. Spatio-temporal profiling and degradation of alpha-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, Sabrina; Østergaard, Ole;

    2007-01-01

    Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... increased during germination. Assessing the fragment minimum chain length by peptide mass fingerprinting suggested that alpha-amylase 2 ( gi vertical bar 4699831) initially was cleaved just prior to domain B that protrudes from the (beta alpha)(8)-barrel between beta-strand 3 and alpha-helix 3, followed...... essentially only full-length alpha-amylase forms. While only products of the above three genes appeared by germination also of 15 other barley cultivars, the cultivars had distinct repertoires of charge and molecular mass variant forms. These patterns appeared not to be correlated with malt quality....

  10. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds.

    Science.gov (United States)

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C

    2015-01-01

    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds. PMID:26345793

  11. From carbohydrates to drug-like fragments: Rational development of novel α-amylase inhibitors.

    Science.gov (United States)

    Al-Asri, Jamil; Fazekas, Erika; Lehoczki, Gábor; Perdih, Andrej; Görick, Cornelia; Melzig, Matthias F; Gyémánt, Gyöngyi; Wolber, Gerhard; Mortier, Jérémie

    2015-10-15

    Starch catabolism leading to high glucose level in blood is highly problematic in chronic metabolic diseases, such as type II diabetes and obesity. α-Amylase catalyzes the hydrolysis of starch, increasing blood sugar concentration. Its inhibition represents a promising therapeutic approach to control hyperglycaemia. However, only few drug-like molecule inhibitors without sugar moieties have been discovered so far, and little information on the enzymatic mechanism is available. This work aims at the discovery of novel small α-amylase binders using a systematic in silico methodology. 3D-pharmacophore-based high throughput virtual screening of small compounds libraries was performed to identify compounds with high α-amylase affinity. Twenty-seven compounds were selected and biologically tested, revealing IC50 values in the micromolar range and ligand efficiency higher than the one of the bound form of acarbose, which is used as a reference for α-amylase inhibition. PMID:26395057

  12. Biochemical features and kinetic properties of α-amylases from marine organisms.

    Science.gov (United States)

    Homaei, Ahmad; Ghanbarzadeh, Mehri; Monsef, Ferial

    2016-02-01

    Marine organisms have the ability of producing enzymes with unique properties compared to those of the same enzymes from terrestrial organisms. α-Amylases are among the most important extracellular enzymes found in various groups of organisms such as plants, animals and microorganisms. They play important roles in their carbohydrates metabolism of each organism. Microbial production of α-amylases is more effective than other sources of the enzyme. Many microorganisms are known to produce α-amylase including bacteria, yeasts, fungi and actinomycetes. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. This review deals with what is known about the kinetics, biochemical properties and applications of these enzymes that have only been found in them and not in other α-amylases, and discussing their mechanistic and regulatory implications. PMID:26657843

  13. High-resolution α-amylase assay combined with high-performance liquid chromatography-solid-phase extraction-nuclear magnetic resonance spectroscopy for expedited identification of α-amylase inhibitors: proof of concept and α-amylase inhibitor in cinnamon.

    Science.gov (United States)

    Okutan, Leyla; Kongstad, Kenneth T; Jäger, Anna K; Staerk, Dan

    2014-11-26

    Type 2 diabetes affects millions of people worldwide, and new improved drugs or functional foods containing selective α-amylase inhibitors are needed for improved management of blood glucose. In this article the development of a microplate-based high-resolution α-amylase inhibition assay with direct photometric measurement of α-amylase activity is described. The inhibition assay is based on porcine pancreatic α-amylase with 2-chloro-4-nitrophenyl-α-D-maltotriose as substrate, which this gives a stable, sensitive, and cheap inhibition assay as requested for high-resolution purposes. In combination with HPLC-HRMS-SPE-NMR, this provides an analytical platform that allows simultaneous chemical and biological profiling of α-amylase inhibitors in plant extracts. Proof-of-concept with an artificial mixture of six compounds-of which three are known α-amylase inhibitors-showed that the high-resolution α-amylase inhibition profiles allowed detection of sub-microgram amounts of the α-amylase inhibitors. Furthermore, the high-resolution α-amylase inhibition assay/HPLC-HRMS-SPE-NMR platform allowed identification of cinnamaldehyde as the α-amylase inhibitor in cinnamon (Cinnamomum verum Presl.). PMID:25368916

  14. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    Directory of Open Access Journals (Sweden)

    Alex Chi Wu

    Full Text Available Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (biosynthesis of the chain-length distribution (CLD of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  15. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation

    OpenAIRE

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital invest...

  16. Effect of decoyinine on the regulation of alpha-amylase synthesis in Bacillus subtilis.

    OpenAIRE

    Nicholson, W L; Chambliss, G H

    1987-01-01

    Decoyinine, an inhibitor of GMP synthetase, allows sporulation in Bacillus subtilis to initiate and proceed under otherwise catabolite-repressing conditions. The effect of decoyinine on alpha-amylase synthesis in B. subtilis, an event which exhibits regulatory features resembling sporulation initiation, was examined. Decoyinine did not overcome catabolite repression of alpha-amylase synthesis in a wild-type strain of B. subtilis but did cause premature and enhanced synthesis in a mutant strai...

  17. Isolation, characterization and partial purification of alpha-amylase from a marine bacillus NH-25

    International Nuclear Information System (INIS)

    Total 399 marine strains were isolated from the sea water sample and screened for thermostable amylase production. Out of these 52 were to have amylogenic activity. Among them 2 isolates were able to grow and produce amylase at 55 degree C. Strain NH-25 tolerates 30% salt, a wide j-H range (4-8) and retained 64% activity at 50 degree C after 60 minutes. (author)

  18. Accuracy of Alpha Amylase in Diagnosing Microaspiration in Intubated Critically-Ill Patients

    OpenAIRE

    Florent Dewavrin; Farid Zerimech; Alexandre Boyer; Patrice Maboudou; Malika Balduyck; Alain Duhamel; Saad Nseir

    2014-01-01

    OBJECTIVES: Amylase concentration in respiratory secretions was reported to be a potentially useful marker for aspiration and pneumonia. The aim of this study was to determine accuracy of α-amylase in diagnosing microaspiration in critically ill patients. METHODS: Retrospective analysis of prospectively collected data collected in a medical ICU. All patients requiring mechanical ventilation for at least 48 h, and included in a previous randomized controlled trial were eligible for this study,...

  19. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    OpenAIRE

    Gaurav Sapra; Yogesh Kumar Vyas; Rahul Agarwal; Ashish Aggarwal; Chandrashekar, K. T.; Kanika Sharma

    2013-01-01

    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice...

  20. Effects of alpha-amylase on in vitro growth of Legionella pneumophila.

    OpenAIRE

    Bortner, C A; Miller, R D; Arnold, R.R.

    1983-01-01

    Sterile parotid saliva inhibited growth of Legionella pneumophila on solid media, and the salivary component involved in this inhibition has been shown to be amylase. Disk diffusion and well plate assays were used to study possible mechanisms for this effect. The amylolytic activity of saliva copurified with inhibitory activity, and both activities were sensitive to proteinase K digestion and heat treatment. In addition, purified alpha-amylase from several sources (bacteria, fungi, porcine pa...

  1. Clinical Performance of a Salivary Amylase Activity Monitor During Hemodialysis Treatment

    OpenAIRE

    Masaru Shimazaki; Takayuki Matsuki; Kazuaki Yamauchi; Michihiro Iwata; Hiroshi Takahashi; Kenichi Sakamoto; Junichi Ohata; Yuichi Nakamura; Yusuke Okazaki

    2008-01-01

    The hemodialysis procedure is thought to be a physical stressor in the majority of hemodialyzed patients. Previous studies suggest that elevated salivary amylase level may correlate with increased plasma norepinephrine level under psychological and physical stress conditions. In this study, we investigated biological stress reactivity during hemodialysis treatment using salivary amylase activity as a biomarker. Seven patients (male/female = 5/2, age:67.7+ /− 5.9 years) who had been receiving...

  2. SALIVARY ALPHA-AMYLASE AS A BIOMARKER OF DENTAL FEAR AND ANXIETY IN CHILDREN

    OpenAIRE

    Réka GYERGYAY; Béla KOVÁCS; Nagy, Előd; Krisztina MÁRTHA; Cristina BICĂ; Melinda SZÉKELY

    2015-01-01

    Dental treatment represents a stress factor for most children. The aim of the study was to analyse the variation of salivary alpha-amylase concentration in children after a video viewing on dental treatments. In this study, 7 to 10 year-old school children were evaluated (n=119). Unstimulated whole saliva was collected before and after viewing a 15 min video on dental treatments performed on children. Changes in salivary alpha-amylase levels have been assessed. Video viewing on dental ...

  3. Amplification, Sequencing and Cloning of Iranian Native Bacillus subtilis Alpha-amylase Gene in Saccharomyces cerevisiae

    OpenAIRE

    Fahimeh Afzal-Javan; Mohsen Mobini-Dehkordi

    2013-01-01

    Background: Alpha-amylases are digestive enzymes which hydrolyze starch glycosidic bonds to glucose, maltose, maltotriose and dextrin which have diverse applications in a wide range of industries such as food, textile, paper, detergents representing approximately 30% of the world enzyme production.Objectives: In this study, the gene encoding the alpha-amylase enzyme of native isolated Bacillus subtilis was amplified with specific primers containing of NotI and AscI restriction sites by PCR and...

  4. Application of decolourized and partially purified polygalacturonase and α-amylase in apple juice clarification

    OpenAIRE

    Tapati Bhanja Dey; Rintu Banerjee

    2014-01-01

    Polygalacturonase and α-amylase play vital role in fruit juice industry. In the present study, polygalacturonase was produced by Aspergillus awamori Nakazawa MTCC 6652 utilizing apple pomace and mosambi orange (Citrus sinensis var mosambi) peels as solid substrate whereas, α-amylase was produced from A. oryzae (IFO-30103) using wheat bran by solid state fermentation (SSF) process. These carbohydrases were decolourized and purified 8.6-fold, 34.8-fold and 3.5-fold, respectively by activated ch...

  5. Biosynthesis of rice seed alpha-amylase: proteolytic processing and glycosylation of precursor polypeptides by microsomes

    OpenAIRE

    1983-01-01

    Microsomes prepared from the rice seed scutellum were incubated in wheat germ extracts (S-100 fraction) to direct the synthesis of alpha- amylase, a secretory protein subject to proteolytic processing (cleavage of the N-terminal signal sequence) as well as glycosylation during its biosynthesis. The characterization and identification of the immunoprecipitable products synthesized were performed by SDS gel electrophoresis and subsequent fluorography. The molecular weight of the alpha-amylase s...

  6. Effect of oilseed cakes on alpha-amylase production by Bacillus licheniformis CUMC305.

    OpenAIRE

    Krishnan, T.; Chandra, A. K.

    1982-01-01

    The effects of oilseed cakes on extracellular thermostable alpha-amylase production by Bacillus licheniformis CUMC305 was investigated. Each oilseed cake was made of groundnut, mustard, sesame, linseed, coconut copra, madhuca, or cotton. alpha-Amylase production was considerably improved in all instances and varied with the oilseed cake concentration in basal medium containing peptone and beef extract. Maximum increases were effected by a low concentration (0.5 to 1.0%) of groundnut or coconu...

  7. Potent α-amylase inhibitory activity of Indian Ayurvedic medicinal plants

    OpenAIRE

    Bhargava Shobha Y; Zinjarde Smita S; P Sudha; Kumar Ameeta R

    2011-01-01

    Abstract Background Indian medicinal plants used in the Ayurvedic traditional system to treat diabetes are a valuable source of novel anti-diabetic agents. Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post-prandial hyperglycemia via control of starch breakdown. In this study, seventeen Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evalu...

  8. Modulatory Effect of Citrate Reduced Gold and Biosynthesized Silver Nanoparticles on α-Amylase Activity

    OpenAIRE

    Kantrao Saware; Ravindra Mahadappa Aurade; Kamala Jayanthi, P. D.; Venkataraman Abbaraju

    2015-01-01

    Amylase is one of the important digestive enzymes involved in hydrolysis of starch. In this paper, we describe a novel approach to study the interaction of amylase enzyme with gold nanoparticles (AuNPs) and silver nanoparticles (AgNPs) and checked its catalytic function. AuNPs are synthesized using citrate reduction method and AgNPs were synthesized using biological route employing Ficus benghalensis and Ficus religiosa leaf extract as a reducing and stabilizing agent to reduce silver nitrate...

  9. Development of an amylolytic Lactobacillus plantarum silage strain expressing the Lactobacillus amylovorus alpha-amylase gene.

    OpenAIRE

    Fitzsimons, A.; Hols, P; Jore, J; Leer, R J; O'Connell, M; Delcour, J.

    1994-01-01

    An amylolytic Lactobacillus plantarum silage strain with the starch-degrading ability displayed by Lactobacillus amylovorus was developed. An active fragment of the gene coding for alpha-amylase production in L. amylovorus was cloned and integrated into the chromosome of the competitive inoculant strain L. plantarum Lp80 at the cbh locus. The alpha-amylase gene fragment was also introduced into L. plantarum Lp80 on an autoreplicative plasmid. Both constructions were also performed in the labo...

  10. Halophiles as a source of polyextremophilic α-amylase for industrial applications

    OpenAIRE

    Sumit Kumar; Jasneet Grewal; Ayesha Sadaf; R. Hemamalini; Khare, Sunil K.

    2016-01-01

    Halophiles are perceived as an excellent source of novel enzymes possessing inherent ability to function under saline and hypersaline environment conditions. The article covers and puts in perspective the structural and biocatalytic features of α-amylases from halophilic sources. The choice of α-amylase as the target enzyme is based on the fact that this is among the largest selling enzymes. Oligosaccharide synthesis is favored in presence of organic solvents and at high temperature. For this...

  11. An Overview of Cold-active Microbial a-amylase: Adaptation Strategies and Biotechnological Potentials

    OpenAIRE

    Ramteke, Pramod W.; Jamal M. Arif; Roohi; Mohammed Kuddus

    2011-01-01

    Absolutely the largest proportion of the Earth's biosphere is comprised of organisms that thrive in cold environments are known as psychrophiles and psychrotrophs. Their ability to proliferate in the cold is predicated on a capacity to synthesize cold-adapted enzymes like amylases, proteases, lipases, pectinases, cellulases, etc. that could be used in low-energy processes. Amylases have most widely been reported to occur in microorganisms, although they are also found in plants and animals. C...

  12. Ability to bind salivary alpha-amylase discriminates certain viridans group streptococcal species.

    OpenAIRE

    Kilian, M.; Nyvad, B

    1990-01-01

    A collection of 144 viridans group streptococcal strains recently characterized as part of a taxonomic study was examined for the ability to bind salivary alpha-amylase. This property was found in most strains of Streptococcus gordonii and Streptococcus mitis and in occasional strains of Streptococcus anginosus and Streptococcus salivarius. In contrast, all strains of Streptococcus sanguis, Streptococcus oralis, Streptococcus vestibularis, and Streptococcus mutans lacked alpha-amylase-binding...

  13. Production and Characteristics of Raw-Potato-Starch-Digesting α-Amylase from Bacillus subtilis 65

    OpenAIRE

    Hayashida, Shinsaku; Teramoto, Yuji; Inoue, Takehiro

    1988-01-01

    A newly isolated bacterium, identified as Bacillus subtilis 65, was found to produce raw-starch-digesting α-amylase. The electrophoretically homogeneous preparation of enzyme (molecular weight, 68,000) digested and solubilized raw corn starch to glucose and maltose with small amounts of maltooligosaccharides ranging from maltotriose to maltoheptaose. This enzyme was different from other amylases and could digest raw potato starch almost as fast as it could corn starch, but it showed no adsorb...

  14. [Cloning the alpha-amylase gene of Streptococcus bovis and its expression in Bacillus subtilis cells].

    Science.gov (United States)

    Iakorski, P; Kuntsova, M M; Loseva, E F; Khasanov, F K

    1991-06-01

    The gene coding for alpha-amylase from the ruminant bacterium Streptococcus bovis was cloned on the plasmid pMX39 in Bacillus subtilis cells. An alpha-amylase positive colony was isolated in the initial screening of 3900 colonies on the medium containing insoluble starch. The size of the insert was approximately 2.8 kb. The recombinant plasmid was stably maintained in Bacillus subtilis cells under the nonselective conditions. PMID:1944323

  15. Effect of culture conditions on the activity of amylase used for alcoholic fermentation

    Energy Technology Data Exchange (ETDEWEB)

    Lee, S.D.; Ryu, Y.H.

    1973-01-01

    A wheat bran culture was used for media for the mold strains: Aspergillus oryzae, A. kawachii, A. usamii, and Rhizopus javanicus, to determine in which strain the amylase activity could be increased the most. The wheat bran media provided 47, 51, and 55% starch for each strain. To the media were added 3 nitrogen sources, viz.: (NH/sub 4/)/sub 2/SO/sub 4/, casein, and (NH/sub 4/)/sub 2/SO/sub 4/ - casein mixture. Each nitrogen source was made available at 2, 4, and 6% levels except only 2% (NH/sub 4/)/sub 2/SO/sub 4/ was used. The results obtained were as follows: (1) The ..cap alpha..-amylase activity was highest in media with 47% starch and 6% casein. (2) The ..beta..-amylase activity was highest in media with 51% starch and 2% (NH/sub 4/)/sub 2/SO/sub 4/ - casein. (3) Both ..cap alpha..- and ..beta..-amylase activities in A. usamii were highest in the media with 47% starch and no additional nitrogen source. (4) Of the 4 strains examined the ..cap alpha..- and ..beta..-amylase activities in R. javanicus were both relatively the highest. (5) The ..cap alpha..- and ..beta..-amylase activities of the strains examined decreased as the percentage of starch was increased except in R. javanicus.

  16. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].

    Science.gov (United States)

    Wüthrich, B; Baur, X

    1990-03-31

    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed. PMID:2326614

  17. Changes in serum and salivary amylase during radiotherapy for head and neck cancer

    International Nuclear Information System (INIS)

    The changes in serum amylase that occur when radiotherapy is given in the treatment of head and neck cancer has been studied in 41 patients, 29 treated by CHART and 12 by conventionally fractionated radiotherapy. The peak rise in serum amylase following the start of treatment is seen earlier and is greater in the patients receiving continuous hyperfractionated accelerated radiotherapy (CHART). The serum amylase returns to normal earlier in the CHART patients so that the area under the curve is the same for both groups. The difference probably reflects the more rapid delivery of treatment to the patients receiving CHART. A close correlation between the peak rise in serum amylase and the amount of parotid tissue in the treatment volume is demonstrated. For six patients the total amount of amylase secreted by the parotid gland during CHART was measured and found to decline rapidly within a few days of the start of radiotherapy. The rise in serum amylase that results from the irradiation of salivary tissue provides a unique biochemical measure of an early radiation effect in a normal tissue. This probably reflects the interphase cell death of serous salivary cells. Although these immediate changes are of considerable interest they may not relate to the late effects of radiation on salivary gland function. (author). 13 refs.; 4 figs

  18. Research on the mechanism of penicillin induction of α-amylase biosynthesis in wheat endosperm

    International Nuclear Information System (INIS)

    Penicillin induced the synthesis of α-amylase in wheat-endosperm (embryoless half-seeds) was studied. Of concentrations tried, 500 mg/L penicillin was the most effective, which increased the enzyme activity by 46.7∼75.3%. Penicillin also stimulated the content of the soluble protein (increased by 27.66%∼111.59%), which had significant positive correlation with the activity of α-amylase. The analysis of α-amylase isoenzymogram showed that a band was added with penicillin treatment. And tracing 3H-L-Leu showed the radioactivity of α-amylase with penicillin was 39.0% higher than that of the control. Penicillin induction of α-amylase could be prevented by the transcription inhibitor (AMD) and the translation inhibitor (CHI), indicating that the biosynthesis of α-amylase promoted by penicillin occurred in the transcriptional and translational levels. The contents of endogenous gibberellin in whole and embryoless half seeds were determined with high performance liquid chromatography (HPLC). The results showed that the contents of gibberellin in penicillin-treated seeds were 84.40% and 180.22% higher than that of the control, respectively, which indicated that penicillin probably induced gibberellin biosynthesis, which in turn regulated opening and transcription of gene

  19. Cholecystokinin receptors: disparity between phosphoinositide breakdown and amylase releasing activity of CCK analogues in pancreas

    International Nuclear Information System (INIS)

    Cholecystokinin (CCK) peptides are a family of hormones which also occur in brain. In pancreas CCK stimulates the release of amylase, a process that is dependent on the mobilization of intracellular Ca2+. Recent evidence suggests that inositol 1,4,5-trisphosphate, the breakdown product of phosphatidylinositol 4,5-bisphosphate, is responsible for the rise in intracellular Ca2+. Their laboratory has developed assays to study synthetic CCK analogues using radioligand binding, PI breakdown and amylase release. They have shown that there are good correlations among these three assay systems for the carboxy terminal fragments of CCK8. Recently, they have discovered synthetic analogues of CCK4 that are full agonists in amylase release but are ineffective in causing PI breakdown. In particular, A-61576, Boc-5-amino-2-indolemethylene-pent-2-ene-1-oyl-Leu-Asp-Phe-NH2, is a full agonist in the amylase releasing assay, but is devoid of PI stimulating activity. A-61576 completely reverses the stimulation of PI response induced by CCK8, indicative of an antagonist. Since a mechanism other than the PI breakdown is responsible for amylase release by A-61576, they suggest that separate receptors are responsible for PI breakdown and amylase release

  20. Oral intercourse or secondary transfer? A Bayesian approach of salivary amylase and foreign DNA findings.

    Science.gov (United States)

    Breathnach, Michelle; Moore, Elizabeth

    2013-06-10

    The Bayesian Approach allows forensic scientists to evaluate the significance of scientific evidence in light of two conflicting hypothesis. This aids the investigator to calculate a numerical value of the probability that the scientific findings support one hypothesis over conflicting opinions. In the case where oral intercourse is alleged, α-amylase, an indicator of saliva, is detected on penile swabs. The value of this finding is unknown as it may indicate the presence of saliva resulting from oral intercourse however it may also represent the presence of saliva due to innocent means such as background levels of salivary-α-amylase in the male population due to secondary transfer. Therefore, it is difficult to attach significance to this finding without background information and knowledge. A population study of the background levels of salivary-α-amylase was performed by analysing items of underwear worn under normal circumstances by 69 male volunteers. The Phadebas press test was used to screen the garments for amylase-containing stains and the positive areas were subjected to further confirmation of saliva by the RSID-Saliva kit. 44% of underwear screened had stains containing amylase. This study determined the background level of salivary-α-amylase and DNA on the inside front of male underwear which has potential implications on the interpretation of evidence in alleged oral intercourse. PMID:23683908

  1. Amylase activity of aquatic actinomycetes isolated from the sediments of mangrove forests in south of Iran

    Directory of Open Access Journals (Sweden)

    Farshid Kafilzadeh

    2015-01-01

    Full Text Available In this study amylase producing actinomycetes were isolated from the sediments of mangrove forests in the south of Iran and the rate of amylase activity was measured. The samples of sediments were collected from one hundred different places in mangrove forests of the south of Iran. Collected samples were diluted then they were purified on the starch (casein agar culture and Woodruff. After that they were examined in terms of amylase production on agar–starch culture. The activity of the produced amylase by the isolated aquatic actinomycetes was measured by dinitrosalicylic acid (DNS method. The results showed that aquatic actinomycetes were isolated from 86 per 100 places in spring (86% and from 61 per 100 places in summer (61%. The highest rates of producing enzyme were related to isolated samples in spring (62.97 U/ml. Biochemical and Bergey’s book tests showed that the most isolated aquatic actinomycetes belonged to Streptomyces genus. As regards this, it is economical and easy to isolate the aquatic actinomycetes which produce amylase that is used in different industries in Iran from the sediments of mangrove forests of the south of Iran. So the isolated strains in this study can be suitable candidates for amylase production after genetic manipulation.

  2. Purification and characterization of. alpha. -amylases of an alkalopsychrotrophic Micrococcus sp

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, Takuhei; Horikoshi, Koki (Institute of Physical and Chemical Research, Wako, Saitama (Japan))

    1990-10-01

    Two amylases of an alkalopsychrotrophic Micrococcus were purified by chromatographies of DEAE-Toyopearl, Butyl-Toyopearl and Shodex WS-2003. Molecular weights and pI values of the purified enzymes, I and II, were 185 000 and 125 000 by SDS-PAGE and 4.8 and 4.3 by isoelectric focusing, respectively. Enzyme I had not only amylase but also pullulanase activity. In the presence of Ca{sup 2+} ions, other properties of both enzymes were very similar: Optimum temperature 55-60deg C, optimum pH 7.5-8.0 k{sub m} value for maltopentaose 0.09 mM. Both amylases were completely inactivated after incubation with EDTA at 30deg C and thereafter, could be reactivated by an addition of CaCl{sub 2}. In the absence of Ca{sup 2+} ions, amylase I became thermoresistant, while the thermostability of amylase II decreased. Neither amylase activity of enzyme I nor enzyme II was inhibited by pullulan. (orig.).

  3. Purification and biochemical properties of a salivary α-amylase in Andrallus spinidens Fabricius (Hemiptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    M Fazeli-Dinan

    2012-03-01

    Full Text Available α-amylase is one of the enzymes that has crucial role in extra-oral digestion (EOD of hemipteran insects. An α-amylase was purified and biochemically characterized from the salivary glands of Andrallus spinidens showing its considerable role in EOD process. It was found an enzyme by specific activity of 4.22 U/mg protein, recovery of 14.67 % and purification fold of 13.83-fold as well as molecular weight of 26 kDa. By using two buffer solutions, optimal pH of the purified α-amylase was found to be 9 for both universal and Tris-HCl buffers. Our findings revealed that the purified α-amylase had the highest activity at the temperatures of 35 and 40 °C, and were stable for 96 h at these temperatures. Kinetic parameters of the purified enzyme show that both starch and glycogen, are the suitable substrates for the enzymatic assay, but a lower Km demonstrated glycogen as a more appropriate substrate. Among the cations used to show their possible involvement in active site of the enzyme, Ca2+2+, Mg and one concentration of Cu2+ increased the α-amylase activity but Na+ decreased the enzyme activity. Triton X-100 increased the enzyme activity but SDS, EDTA, EGTA and TTHA decreased it, indicating involvement of metal ions in the active site of the purified α-amylase.

  4. Purification, characterization, and nucleotide sequence of an intracellular maltotriose-producing alpha-amylase from Streptococcus bovis 148.

    Science.gov (United States)

    Satoh, E; Uchimura, T; Kudo, T; Komagata, K

    1997-12-01

    An intracellular alpha-amylase from Streptococcus bovis 148 was purified and characterized. The enzyme was induced by maltose and soluble starch and produced about 80% maltotriose from soluble starch. Maltopentaose was hydrolyzed to maltotriose and maltose and maltohexaose was hydrolyzed mainly to maltotriose by the enzyme. Maltotetraose, maltotriose, and maltose were not hydrolyzed. This intracellular enzyme was considered to be a maltotriose-producing enzyme. The enzymatic characteristics and hydrolysis product from soluble starch were different from those of the extracellular raw-starch-hydrolyzing alpha-amylase of strain 148. The deduced amino acid sequence of the intracellular alpha-amylase was similar to the sequences of the mature forms of extracellular liquefying alpha-amylases from Bacillus strains, although the intracellular alpha-amylase did not contain a signal peptide. No homology between the intracellular and extracellular alpha-amylases of S. bovis 148 was observed. PMID:9406414

  5. Evaluation of α-amylase inhibitory potential of three medicinally important traditional wild food plants of India

    OpenAIRE

    K.S.N Jyothi; Hemalatha, P.; Suresh Challa

    2011-01-01

    Naturally available α-amylase inhibitors from medicinally important plants are shown to be effective in managing postprandial hyperglycemia (PPHG) which is of major concern in Type -2 diabetes. Three wild food plants namely Oxalis corniculata, Basella rubra , and Cocculus hirsutus with known traditional medicinal values were tested for α-amylase inhibition in order to evaluate their inhibitory potential on porcine pancreatic α-amylase. A total of 15 extracts obtained from three plants by aque...

  6. Association among growth, food consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas

    OpenAIRE

    Huvet, Arnaud; Jeffroy, F; Fabioux, C; Daniel, Jean-Yves; Quillien, Virgile; Van Wormhoudt, A; Moal, Jeanne; Samain, Jean-francois; Boudry, Pierre; Pouvreau, Stephane

    2008-01-01

    To examine further a previously reported association between amylase gene polymorphism and growth in the Pacific oyster Crassostrea gigas, ecophysiological parameters and biochemical and molecular expression levels of alpha-amylase were studied in Pacific oysters of different amylase genotypes. Genotypes that previously displayed significantly different growth were found to be significantly different for ingestion and absorption efficiency. These estimated parameters, used in a dynamic energy...

  7. Dissociation of beta-adrenoceptor-induced effects on amylase secretion and cyclic adenosine 3', 5' monophosphate accumulation.

    OpenAIRE

    Carlsöö, B.; Danielsson, A; Henriksson, R.; Idahl, L A

    1982-01-01

    By using a multi-channel microperifusion system the effects of noradrenaline, the beta1-adrenoceptor agonist prenalterol, and the beta2-selective agonist terbutaline were studied on amylase pig submandibular glands. 2 Noradrenaline caused significant amylase discharge and cyclic AMP accumulation. 3 Prenalterol was as effective as noradrenaline in causing amylase release but did not significantly affect the cyclic AMP content. 4 Terbutaline stimulated cyclic AMP accumulation, but had little ef...

  8. A Study on Effect of different culture media on amylase enzyme production by a native strain of Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    ziba Akbari

    2015-12-01

    Full Text Available Introduction: Amylases are among the most important enzymes and have great significance in present-day biotechnology. Amylase with commercial applications is mainly derived from the genus Bacillus. The main purpose of this study is identification and isolatation amylase enzyme producer Bacillus, determining the amylase enzyme activity and affecting a number of culture medium on amylase enzyme production. Materials and methods: Soil, water and wastewater samples were collected from agricultural area, choghakhor lake in chahar mahal e bakhtiari province and from food factory in Esfahan. Bacillus isolates were screened for amylolytic properties by starch hydrolysis test on starch agar plate. Amylase producing Bacillus were identified biochemical tests and molecular experiments. Amylase enzyme activity of isolates was measured using di-nitro salicylic acid (DNS method. Enzyme production was studied in variose medium culture TSB, NB, Yeast extract, molases and milk medium. Results: The enzyme amylase-producing strains, one sample showed was the highest amylase activity. The Bacillus has been detected as a member of Bacillus subtilis according to Bergey's Manual of Systematic Bacteriology and molecular recognition. The enzyme activity of Bacillus subtilis was measured 7/21 (U/ml in production media. Trough medium culture maximum amylase production for Bacillus subtilis was achieved in molases medium. Discussion and conclusion: In this study, Bacillus subtilis strains isolated from wastewater of a significant amount of enzyme producing 7/21 (U/ml as indicated. Among the medium-amylase from Bacillus subtilis highest enzyme activity was observed in beet molasses. According to this study, the use of Bacillus strains is an efficient way to achieve the amylase enzyme.

  9. Role of Streptococcus gordonii Amylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation

    OpenAIRE

    Rogers, Jeffrey D.; Palmer, Robert J.; Kolenbrander, Paul E; Scannapieco, Frank A.

    2001-01-01

    Interactions between bacteria and salivary components are thought to be important in the establishment and ecology of the oral microflora. α-Amylase, the predominant salivary enzyme in humans, binds to Streptococcus gordonii, a primary colonizer of the tooth. Previous studies have implicated this interaction in adhesion of the bacteria to salivary pellicles, catabolism of dietary starches, and biofilm formation. Amylase binding is mediated at least in part by the amylase-binding protein A (Ab...

  10. Study on Salivary Glands α-amylase In Wheat Bug Eurygaster maura (Hemiptera: Scutelleridae)

    OpenAIRE

    Mohammad Mehrabadi; Ali R. Bandani

    2009-01-01

    α-amylase activity in the salivary glands of Eurygaster maura was determined by biochemical experiments. Some of adult insect was collected and their salivary glands isolated and characterized. Enzyme samples from salivary glands of adults were prepared by the method of Cohen with slight modifications. α-Amylase activity was assayed based on Bernfeld method by the dinitrosalicylic acid (DNS) procedure. The activity of α-amylase in salivary glands was 0.050 U/insect. The optimum...

  11. The relationship between the level of salivary alpha amylase activity and pain severity in patients with symptomatic irreversible pulpitis

    OpenAIRE

    Ahmadi-Motamayel, Fatemeh; Shahriari, Shahriar; Goodarzi, Mohammad Taghi; Moghimbeigi, Abbas; Jazaeri, Mina; Babaei, Parisa

    2013-01-01

    Objectives Assessment of dental pain severity is very challenging in dentistry. Previous studies have suggested that elevated salivary alpha amylase may contribute to increased physical stresses. There is a close association between salivary alpha amylase and plasma norepinephrine under stressful physical conditions. The aim of this study was to evaluate the relationship between pain severity and salivary alpha amylase levels in patients with symptomatic irreversible pulpitis. Materials and M...

  12. Microencapsulation of Purified Amylase Enzyme from Pitaya (Hylocereus polyrhizus) Peel in Arabic Gum-Chitosan using Freeze Drying

    OpenAIRE

    Mehrnoush Amid; Yazid Manap; Nor Khanani Zohdi

    2014-01-01

    Amylase is one of the most important enzymes in the world due to its wide application in various industries and biotechnological processes. In this study, amylase enzyme from Hylocereus polyrhizus was encapsulated for the first time in an Arabic gum-chitosan matrix using freeze drying. The encapsulated amylase retained complete biocatalytic activity and exhibited a shift in the optimum temperature and considerable increase in the pH and temperature stabilities compared to the free enzyme. Enc...

  13. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus

    Science.gov (United States)

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  14. The Effect of Trans-Chalcone on Amylase Activity, Blood Glucose and Lipid Levels in Diabetic and Non Diabetic Rats

    OpenAIRE

    Najafian, M.; Ebrahim-Habibi, A.; P Yaghmaei; Parivar, K.; Larijani, B.

    2011-01-01

    Introduction & Objective: Alpha amylase is the most important decomposing enzyme in starch. Digestion and absorption of starch in the intestine can be prevented and also the blood sugar levels can be controlled by restrain and control of alpha amylase. The aim of this study was to evaluate the effect of trans-chalcone on amylase activity, blood glucose and lipid levels in diabetic and non diabetic rats. Materials & Methods: This experimental study was conducted in 1388 at Tehran Universit...

  15. Codon Optimization Significantly Improves the Expression Level of α -Amylase Gene from Bacillus licheniformis in Pichia pastoris

    OpenAIRE

    Jian-Rong Wang; Yang-Yuan Li; Dan-Ni Liu; Jing-Shan Liu; Peng Li; Li-Zhi Chen; Shu-De Xu

    2015-01-01

    α-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant α-amylase from Bacillus licheniformis (B. licheniformis), the α-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris) and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C con...

  16. Cloning of a Gene Encoding Raw-Starch-Digesting Amylase from a Cytophaga sp. and Its Expression in Escherichia coli

    OpenAIRE

    Jeang, Chii-Ling; Chen, Li-Shien; Chen, Ming-yu; Shiau, Rong-Jen

    2002-01-01

    A raw-starch-digesting amylase (RSDA) gene from a Cytophaga sp. was cloned and sequenced. The predicted protein product contained 519 amino acids and had high amino acid identity to α-amylases from three Bacillus species. Only one of the Bacillus α-amylases has raw-starch-digesting capability, however. The RSDA, expressed in Escherichia coli, had properties similar to those of the enzyme purified from the Cytophaga sp.

  17. Structure based protein engineering of Bacillus stearothermophilus α-amylase: toward a new substrate specificity

    International Nuclear Information System (INIS)

    Full text. Structural similarity is observed in all members of α-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to α-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus α-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated α-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacillus stearothermophilus α-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to α-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus α-amylase (using Bacillus

  18. α-amylase assay and action pattern determination using radioactive substrate, HPLC, and a radioactive flow detector

    International Nuclear Information System (INIS)

    A new assay system is presented for the analysis of α-amylase. The disappearance of 14C-labeled starch substrate and the appearance of its radioactive degradation products were monitored by HPLC and a radioactive flow detector/integrator. The hydrolysis of radioactive substrate was proportional to enzyme concentration when two commercially available α-amylase preparations of Bacillus subtilis origin were studied. The method demonstrated an average recovery of 101.7 +/- 6.5% when modified food starch was spiked with amylase and analyzed. In addition, the method was shown to be useful for predicting detailed action patterns of various types of amylases

  19. Two-step purification and partial characterization of an extra cellular α-amylase from Bacillus licheniformis

    OpenAIRE

    Zare Mirakabadi, A.; M. Ghorbanpour; Sadeghi, A.; Sarzaeem, A.

    2012-01-01

    The aim of this study was production and partial purification of α-amylase enzyme by Bacillus licheniformis. B. Licheniformis was allowed to grow in broth culture for purpose of inducing α-amylase enzyme. Optimal conditions for amylase production by B. Licheniformis are incubation period of 120 h, temperature of 37 °C and pH 7.0. The α-amylase enzyme was purified by ion exchange chromatography on DEAE-sepharose CL-6B and sephadex G-100 gel filtration with a 19.1-fold increase in specific acti...

  20. Cloning of the beta-amylase gene from Bacillus cereus and characteristics of the primary structure of the enzyme.

    OpenAIRE

    Nanmori, T; M. Nagai; Shimizu, Y.; Shinke, R; Mikami, B

    1993-01-01

    The gene encoding the beta-amylase of Bacillus cereus BQ10-S1 (SpoII) was cloned into Escherichia coli JM 109. A sequenced DNA fragment of 2,001 bp contains the beta-amylase gene. The N-terminal sequences (AVNGKG MNPDYKAYLMAPLKKI), the C-terminal sequences (SHTSSW), and the amino acid sequences of the five regions in the beta-amylase molecules were determined. The mature beta-amylase contains 514 amino acid residues with a molecular mass of 57,885 Da. The amino acid sequence homology with tho...

  1. Directed evolution of a bacterial alpha-amylase : towards enhanced pH-performance and higher specific activity

    OpenAIRE

    Bessler, Cornelius; Schmitt, Jutta; Maurer, Karl-Heinz; Schmid, Rolf D.

    2003-01-01

    Alpha-Amylases, in particular, microbial Alpha-amylases are used widely in industrial processes such as starch liquefaction and pulp processes and more recently in detergency. Following the need for Alpha-amylases adapted to latter, we enhanced the alkali-activity of the Alpha-amylase from Bacillus amyloliquefaciens (BAA). The genes coding for the wild type BAA and the mutants BAA S201N and BAA N297D were subjected to error prone PCR and gene shuffling. For the screening of mutants we develop...

  2. Directed evolution of a bacterial α-amylase: Toward enhanced pH-performance and higher specific activity

    OpenAIRE

    Bessler, Cornelius; Schmitt, Jutta; Maurer, Karl-Heinz; Schmid, Rolf D.

    2003-01-01

    α-Amylases, in particular, microbial α-amylases, are widely used in industrial processes such as starch liquefaction and pulp processes, and more recently in detergency. Due to the need for α-amylases with high specific activity and activity at alkaline pH, which are critical parameters, for example, for the use in detergents, we have enhanced the α-amylase from Bacillus amyloliquefaciens (BAA). The genes coding for the wild-type BAA and the mutants BAA S201N and BAA N297D were subjected to e...

  3. Structural elucidation and molecular characterization of Marinobacter sp. α-amylase.

    Science.gov (United States)

    Kumar, Sumit; Khan, Rizwan Hasan; Khare, S K

    2016-04-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Marinobacter sp. EMB8 α-amylase was found to be active and stable in salt and organic solvents. A study was carried out using circular dichroism (CD), fluorescence spectroscopy, and bioinformatics analysis of similar protein sequence to ascertain molecular basis of salt and solvent adaptability of α-amylase. Structural changes recorded in the presence of varying amounts of NaCl exhibited an increase in negative ellipticity as a function of salt, confirming that salt stabilizes the protein and increases the secondary structure, making it catalytically functional. The data of intrinsic and extrinsic fluorescence (using 1-anilinonaphthalene 8-sulfonate [ANS] as probe) further confirmed the role of salt. The α-amylase was active in the presence of nonpolar solvents, namely, hexane and decane, but inactivated by ethanol. The decrease in the activity was correlated with the loss of tertiary structure in the presence of ethanol. Guanidine hydrochloride and pH denaturation indicated the molten globule state at pH 4.0. Partial N-terminal amino acid sequence of the purified α-amylase revealed the relatedness to Pseudoalteromonas sp. α-amylase. "FVHLFEW" was found as the N-terminal signature sequence. Bioinformatics analysis was done using M. algicola α-amylase protein having the same N-terminal signature sequence. The three-dimensional structure of Marinobacter α-amylase was deduced using the I-TASSER server, which reflected the enrichment of acidic amino acids on the surface, imparting the stability in the presence of salt. Our study clearly indicate that salt is necessary for maintaining the secondary and tertiary structure of halophilic protein, which is a necessary prerequisite for catalysis. PMID:26192048

  4. Production, Purification, and Characterization of Thermostable α-Amylase Produced by Bacillus licheniformis Isolate AI20

    Directory of Open Access Journals (Sweden)

    Yasser R. Abdel-Fattah

    2013-01-01

    Full Text Available An optimization strategy, based on statistical experimental design, is employed to enhance the production of thermostable α-amylase by a thermotolerant B. licheniformis AI20 isolate. Using one variant at time (OVAT method, starch, yeast extract, and CaCl2 were observed to influence the enzyme production significantly. Thereafter, the response surface methodology (RSM was adopted to acquire the best process conditions among the selected variables, where a three-level Box-Behnken design was employed to create a polynomial quadratic model correlating the relationship between the three variables and α-amylase activity. The optimal combination of the major constituents of media for α-amylase production was 1.0% starch, 0.75% yeast extract, and 0.02% CaCl2. The predicted optimum α-amylase activity was 384 U/mL/min, which is two folds more than the basal medium conditions. The produced α-amylase was purified through various chromatographic techniques. The estimated enzyme molecular mass was 55 kDa and the α-amylase had an optimal temperature and pH of 60–80°C and 6–7.5, respectively. Values of Vmax and Km for the purified enzyme were 454 mU/mg and 0.709 mg/mL. The α-amylase enzyme showed great stability against different solvents. Additionally, the enzyme activity was slightly inhibited by detergents, sodium dodecyl sulphate (SDS, or chelating agents such as EDTA and EGTA. On the other hand, great enzyme stability against different divalent metal ions was observed at 0.1 mM concentration, but 10 mM of Cu2+ or Zn2+ reduced the enzyme activity by 25 and 55%, respectively.

  5. Relationship between post-ERCP pancreatitis and the change of serum amylase level after the procedure

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To clarify the relationship between the change of serum amylase level and post-ERCP pancreatitis.METHODS: Between January 1999 and December 2002, 1291 ERCP-related procedures were performed.Serum amylase concentrations were measured before the procedure and 3, 6, and 24 h afterward. The frequency and severity of post-ERCP pancreatitis and the relationship between these phenomena and the change in amylase level were estimated.RESULTS: Post-ERCP pancreatitis occurred in 47 patients (3.6%). Pancreatitis occurred in 1% of patients with normal amylase levels 3 h after ERCP, and in 1%,5%, 20%, 31% and 39% of patients with amylase levels elevated 1-2 times, 2-3 times, 3-5 times, 5-10 times and over 10 times the upper normal limit at 3 h after ERCP,respectively (level < 2 times vs ≥ 2 times, P < 0.001).Of the 143 patients with levels higher than the normal limit at 3 h after ERCP followed by elevation at 6 h,pancreatitis occurred in 26%. In contrast, pancreatitis occurred in 9% of 45 patients with a level higher than two times the normal limit at 3 h after ERCP followed by a decrease at 6 h (26% vs 9%, P < 0.05).CONCLUSION: Post-ERCP pancreatitis is frequently associated with an increase in serum amylase level greater than twice the normal limit at 3 h after ERCP with an elevation at 6 h. A decrease in amylase level at 6 h after ERCP suggests the unlikelihood of development of post-ERCP pancreatitis.

  6. Chemical constituents of Swertia longifolia Boiss. with α-amylase inhibitory activity

    Directory of Open Access Journals (Sweden)

    Soodabeh Saeidnia

    2016-01-01

    Full Text Available α-Amylase inhibitors play a critical role in the control of diabetes and many of medicinal plants have been found to act as α-amylase inhibitors. Swertia genus, belonging to the family Gentianaceae, comprises different species most of which have been used in traditional medicine of several cultures as antidiabetic, anti-pyretic, analgesic, liver and gastrointestinal tonic. Swertia longifolia Boiss. is the only species of Swertia growing in Iran. In the present investigation, phytochemical study of S. longifolia was performed and α-amylase inhibitory effects of the plant fractions and purified compounds were determined. Aerial parts of the plant were extracted with hexane, chloroform, methanol and water, respectively. The components of the hexane and chloroform fractions were isolated by different chromatographic methods and their structures were determined by 1 H NMR and 13 C NMR data. α-Amylase inhibitory activity was determined by a colorimetric assay using 3,5-dinitro salysilic acid. During phytochemical examination, α-amyrin, β-amyrin and β-sitosterol were purified from the hexane fraction,while ursolic acid, daucosterol and swertiamarin were isolated from chloroform fraction. The results of the biochemical assay revealed α-amylase inhibitory activity of hexane, chloroform, methanol and water fractions, of which the chloroform and methanol fractions were more potent (IC 50 16.8 and 18.1 mg/ml, respectively. Among examined compounds, daucosterol was found to be the most potent α-amylase inhibitor (57.5% in concentration 10 mg/ml. With regard to α-amylase inhibitory effects of the plant extracts, purified constituents, and antidiabetic application of the species of Swertia genus in traditional medicine of different countries, S. longifolia seems more appropriate species for further mechanistic antidiabetic evaluations.

  7. Salivary amylase and stress during stressful environment: three Mars analog mission crews study.

    Science.gov (United States)

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H

    2012-06-14

    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment. PMID:22554904

  8. Immobilization of diastase α-amylase on nano zinc oxide.

    Science.gov (United States)

    Antony, Navya; Balachandran, S; Mohanan, P V

    2016-11-15

    Diastase α-amylase extracted from malt, catalyses break down of starch into maltose. It is commonly used in food and fermentation industry. In the present study nano zinc oxide is used as support for this starch hydrolyzing enzyme. IR study revealed that the enzyme got adsorbed via electrostatic interaction with the functional groups on the support. The immobilized enzyme possessed a better heat-resistance than free enzyme. The kinetic parameters were determined using Lineweaver-Burk plot. The immobilized enzyme showed higher Km 2.08mg/ml than the free enzyme whose Km is 0.45±.05mg/ml. The Vmax of immobilized enzyme was about 2.92±.02mg/ml/min and that of free enzyme was 7.14±.02mg/ml/min, showing decrease in activity after immobilization. The immobilized enzyme showed 70% activity after 30days of storage while free enzyme lost its activity within 7days. About 80% of enzyme retained activity after 4 cycles of reuse. PMID:27283676

  9. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    Science.gov (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522

  10. Characterization of purified α-amylase produced by Aspergillus terreus NCFT 4269.10 using pearl millet as substrate

    Directory of Open Access Journals (Sweden)

    Bijay Kumar Sethi

    2016-12-01

    Full Text Available α-amylase was produced by Aspergillus terreus NCFT 4269.10 using both liquid static surface (LSSF and solid-state fermentation using pearl millet residues as substrate. The maximum production of α-amylase was noticed at 30°C incubated for 96h. The crude α-amylase was purified to electrophoretic homogeneity and characterized. Characterization of amylase confirmed that the purified α-amylase was found to be most stable at pH 5.0, 60°C temperature, and a substrate concentration of 1.25%. The enzyme was active for 40 min at 70°C with an optimum enzyme–substrate reaction time of 60 min. Amylase was compatible with all detergents tested having highest activity with Surf excel followed by Henko and Ariel. SDS and Tween 20 reduced the activity. Among the metal ions tested, the maximum α-amylase activity was attained in the presence of Ca2+, followed by Mg2+ and Mn2+. The activity of α-amylase was not considerably affected in the presence of ethylenediaminetetraacetic acid and Triton X-100. Amylase activity was accelerated in the presence of sodium lauryl sulfate and phenylmethylsulfonyl fluoride did not significantly (or slightly affect the activity and stability. Tween 20, urea (5%, and the reducing agent, β-mercaptoethanol significantly inhibited the activity of α-amylase. Owing to its noteworthy stability in the presence of detergents, additives, inhibitors, and metal ions, this α-amylase could be an impending enzyme for significant industrial exploitations.

  11. Individual differences in AMY1 gene copy number, salivary α-amylase levels, and the perception of oral starch.

    Directory of Open Access Journals (Sweden)

    Abigail L Mandel

    Full Text Available BACKGROUND: The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. PRINCIPAL FINDINGS: Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. CONCLUSIONS: By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status.

  12. Effects of germination on the activities of amylases and phenolic enzymes in sorghum varieties grouped according to food end-use properties

    NARCIS (Netherlands)

    Dicko, M.H.; Gruppen, H.; Zouzouho, O.C.; Traore, A.S.; Berkel, van W.J.H.; Voragen, A.G.J.

    2006-01-01

    Fifty sorghum varieties were screened to determine the effects of germination on levels of starch, -amylase, -amylase, phenylalanine ammonia lyase (PAL), peroxidase (POX) and polyphenol oxidase (PPO). Germination decreased starch content, with amylose being more degraded than amylopectin. In germina

  13. SALIVARY ALPHA-AMYLASE AS A BIOMARKER OF DENTAL FEAR AND ANXIETY IN CHILDREN

    Directory of Open Access Journals (Sweden)

    Réka GYERGYAY

    2015-03-01

    Full Text Available Dental treatment represents a stress factor for most children. The aim of the study was to analyse the variation of salivary alpha-amylase concentration in children after a video viewing on dental treatments. In this study, 7 to 10 year-old school children were evaluated (n=119. Unstimulated whole saliva was collected before and after viewing a 15 min video on dental treatments performed on children. Changes in salivary alpha-amylase levels have been assessed. Video viewing on dental procedures led to a significant increase of the alpha-amylase level in the whole sample group. This was noticeable in terms of gender as well as age groups. From the viewpoint of age and gender, girls displayed significantly higher levels of amylase in all age groups, while this could be observed only in younger boys. In conclusion, analysis of salivary alpha-amylase revealed that the sight of dental treatment represents a significant source of stress among children.

  14. Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations.

    Science.gov (United States)

    Møller, Kasper; Sharif, Mostafa Z; Olsson, Lisbeth

    2004-08-01

    Heterologous protein production by the yeast Saccharomyces kluyveri was investigated under aerobic glucose-limited conditions. Alpha-amylase from Aspergillus oryzae was used as model protein and the gene was expressed from a S. cerevisiae 2 micro plasmid. For comparison, strains of both S. kluyveri and S. cerevisiae were transformed with the same plasmid, which led to secretion of active alpha-amylase in both cases. The S. cerevisiae 2 micro plasmid was found to be stable in S. kluyveri as evaluated by a constant alpha-amylase productivity in a continuous cultivation for more than 40 generations. S. kluyveri and S. cerevisiae secreted alpha-amylase with similar yields during continuous cultivations at dilution rates of 0.1 and 0.2 h(-1) (4.8-5.7 mg (g dry weight)(-1)). At a dilution rate of 0.3 h(-1) the metabolism of S. kluyveri was fully respiratory, whereas S. cerevisiae produced significant amounts of ethanol. A fed-batch cultivation was carried out with S. kluyveri where the biomass concentration reached 85 g l(-1) and the alpha-amylase concentration reached 320 mg l(-1). Even though S. kluyveri could be grown to high cell density, it was also observed that it has a high maintenance coefficient, which resulted in low biomass yields at the low specific growth rates prevailing towards the end of the fed-batch cultivation. PMID:15246667

  15. PRODUCTION OF α-AMYLASE FROM ASPERGILLUS FLAVUS UNDER SOLID STATE FERMENTATION WITH OPTIMUM CONDITIONS

    Directory of Open Access Journals (Sweden)

    Mamatha J

    2012-08-01

    Full Text Available α-amylases are ubiquitous enzymes produced by plants, animals and microbes, where they play a dominant role in carbohydrate metabolism. In spite of the wide distribution of amylases, microbial sources, namely fungal and bacterial amylases, are used for the industrial production due to advantages such as cost effectiveness, consistency, less time and space required for production and ease of process modification and optimization. Filamentous fungi are known to be prolific producers of extracellular proteins; they are widely exploited for the production of different enzymes including a-amylase. SSF is generally defined as the growth of microorganisms on moist solid substrates with negligible free water, which is preferred than SmF because of simple technique, low capital investment, lower levels of catabolite repression, end- product inhibition, low waste water output, better product recovery and high quality production. Different substrates such as wheat bran, mollasses bran, rice bran, maize meal and sugarcane bagasse were used; out of which sugarcane bagasse has been reported to produce promising results. Different carbon and nitrogen supplements were given which increased the yield of the enzyme and optimized the pH as 6.0 and temperature 300C. Thus the maximum production of amylase was observed at optimized conditions, which can be employed in large scale.

  16. Antioxidant and α-amylase inhibition activities of phenolic compounds in the extracts of Indian honey

    Institute of Scientific and Technical Information of China (English)

    Subashini Devarajan; Subhashree Venugopal

    2012-01-01

    AIM:To evaluate the antioxidant and α-amylase inhibition potential of phenolic compounds in the extracts of Indian honey.METHODS:Phenolic compounds were extracted from Indian honey through column chromatography.The antioxidant potential of extracted phenolic compounds was measured by two different biochemical assays:ferric reducing antioxidant power (FRAP)assay and scavenging activity on 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals.Moreover,α-amylase inhibition assay of phenolic compounds of honey was also evaluated.RESULTS:The scavenging inhibition rate varied from 86.8% to 78.6% from the highest (6mg·mL-1) to the lowest (1.5 mg·mL-1) concentration,whereas,reducing power assay varied from 0.89 Abs to 0.19 Abs from the highest to the lowest concentration.Butylated hydroxytoluene (BHT) was used as reference compound for antioxidant assays.α-amylase inhibition assay is reported from the phenolic honey extracts for the first time.The inhibition rate for α-amylase varied from 88.8% to 30.5% from the highest (20 μg·mL-1) to the lowest concentration (4.μg·mL-1).CONCLUSION:Honey phenolic extract possessed antioxidant and α-amylase inhibition activity,thus increasing its potential therapeutic property.

  17. The Effect of an Intraperitoneal Injection of Melatonin on Serum Amylase Levels in Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    Cavit Çöl

    2009-05-01

    Full Text Available Context Several experimental studies have been carried out to explain the ph ysiopathological mechan isms and to introduce endocrinological, enzymatic, biochemical and histopathol ogical changes in organism s during acute pancreatitis. Objective To evaluate the effect of an intraperitoneal injection of melatonin on serum amylase levels. Design Experimental acut e pancreatitis was experimentally caused through panc reatic duct ligation in 20 Winstar Albino rats . The rats were then divided into two groups: control and melatonin groups. Intervention The serum amylase level was measured on the 7 th day after acute pancreatitis had developed. In the melatonin group, an intraperitoneal injecti on of melatonin (20 mg/kg/day was performed starting from the 2 nd day after pancreatic duct ligation. Main outcome measure The levels of serum amylase were measured with an auto analyzer. Results It was found that the mean (±SD level of serum amylase in th e control group was 947±182 IU/mL wh ile it was 358±177 IU/mL in the experimental group (P<0.001. Conclusions The 20 mg/kg/day intraperitoneal injection of melatonin which was carried out for one week attenuated the serum amylase levels to a statistically si gnificant degree. The researchers believe that intraperitoneal in jections of melatonin decrease the severity of acute pancreatitis.

  18. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    Science.gov (United States)

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities. PMID:15640201

  19. Existence of hydroxylated MWCNTs demotes the catalysis effect of amylases against starch degradation.

    Science.gov (United States)

    Sekar, Gajalakshmi; Sivakumar, Amaravathy; Mukherjee, Amitava; Chandrasekaran, Natarajan

    2016-05-01

    Possible interaction between amylase and Multi Walled Carbon Nanotubes (MWCNTs) has been elucidated with spectroscopic methods. Hyperchromism of the UV-visible spectra of amylase-CNT conjugates suggested ground state complex formation between them. On contrary, the decreasing fluorescence emission spectra revealed the fate of quenching mechanism to be static. Stoke shift observed from the synchronous and 3D spectra suggested the possibilities of disturbances to the aromatic micro-environment of amylases by OH-MWCNTS. FTIR and FT-Raman spectra showed alteration in the amide I band, that corresponds to their effect on alpha-helical structures. Loss of alpha-helical structures and alteration in the dichroic band again revealed possible conformational change and effect towards the stability of polypeptide backbone structures. In addition, the shift observed in the SPR band and FTIR peaks of CNTs-amylase conjugates suggested possible alteration in their optical and structural properties. On the functional aspect, amylase activity on starch degradation and hydrolysis were found to be decreased in the presence of CNTs. PMID:26812109

  20. Taking the Starch out of Oral Biofilm Formation: Molecular Basis and Functional Significance of Salivary α-Amylase Binding to Oral Streptococci

    OpenAIRE

    Nikitkova, Anna E.; Haase, Elaine M.; Scannapieco, Frank A.

    2013-01-01

    α-Amylase-binding streptococci (ABS) are a heterogeneous group of commensal oral bacterial species that comprise a significant proportion of dental plaque microfloras. Salivary α-amylase, one of the most abundant proteins in human saliva, binds to the surface of these bacteria via specific surface-exposed α-amylase-binding proteins. The functional significance of α-amylase-binding proteins in oral colonization by streptococci is important for understanding how salivary components influence or...

  1. Breeding of high yield strain producing acid-stable α-amylase by N+ ion beam irradiation

    International Nuclear Information System (INIS)

    Bacillus subtilis BF7658, which produces medium-temperature α-amylase,was implanted with N+ ion beam to breed mutants. Under the optimal fluence of 1 x 1016 cm-2, a mutant TCCC 11525 producing the acid-stable and medium-temperature α-amylase was obtained. The activity of the mutagenised enzyme is 207 U/mL. (authors)

  2. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222

    Directory of Open Access Journals (Sweden)

    Shalini Singh

    2015-06-01

    Full Text Available Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best of production conditions. This study evaluates the influence of varying concentration of Ferrous sulphate (Fe2+ on microbial growth and amylase production for Aspergillus, Aspergillus fumigatus NTCC1222. Ferrous sulphate enhanced growth (concentration of 100mg/L by 1.83%, compared to the control. In contrast, it decreased amylase activity at all concentrations tested. As the concentration of ferrous sulphate increased, the amylase activity decreased. Amylases are metalloenzymes and the inhibition in amylase activity observed in the presence of ferrous ions may be due to competition between the exogenous cation and the protein associated cation, resulting in reduced metalloenzyme activity. Further studies will aim to evaluate the effect of different ferrous salts and different forms of iron on amylase production by Aspergillus fumigatus NTCC1222.

  3. Estimation of Salivary Amylase in Diabetic Patients and Saliva as a Diagnostic Tool in Early Diabetic Patients

    OpenAIRE

    Malathi, L.; Masthan, K. M. K.; Balachander, N.; Babu, N. Aravindha; Rajesh, E.

    2013-01-01

    Aim: The aim of this study was to estimate the salivary amylase levels in non-insulin dependent diabetes mellitus patients and to correlate these findings with those in normal individuals, in order to provide salivary amylase level as a bio-chemical indicator for diagnosing and monitoring the glucose levels.

  4. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    Science.gov (United States)

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylase that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization,...

  5. General Subject 1. Report to ICUMSA on the determination of commercial alpha-amylase activity by a spectrophotometric method

    Science.gov (United States)

    A report is given on a new industrial method for the determination of the activity or strength of commercial alpha-amylase at a sugarcane factory or refinery, as well as a recommendation. At the present time, the activities or strengths of commercial alpha-amylases cannot be directly compared becau...

  6. Development of an industrial method to quantitatively measure carry-over amylase activity in raw and refined sugars

    Science.gov (United States)

    In recent years, there has been increased concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food manufacturing industries and other end-users. HT and VHT stable amylases were developed...

  7. Identification of serum and urine proteins responsible for enhanced pigment production by group B streptococci as amylases.

    OpenAIRE

    Rosa-Fraile, M.; Sampedro, A.; Ruiz-Bravo, A; Sanbonmatsu, S; Gimenez-Gallego, G

    1996-01-01

    The serum and urine proteins responsible for enhanced pigment production in Streptococcus agalactiae in culture media were purified by chromatography and were identified as amylases by comparison of their amino acid composition with that calculated for proteins with known sequences. Similar pigment-enhancing activity was displayed by other amylases of nonanimal origin and by maltooligosaccharides.

  8. The need for and development of a method to measure carry-over amylase activity in raw and refined sugars

    Science.gov (United States)

    In recent years, there has been increased world-wide concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in refined sugars to various food and end-user industries. HT and VHT stable amylases were developed for much larger markets than the...

  9. The influence of nitrogen sources on the alpha-amylase productivity of Aspergillus oryzae in continuous cultures

    DEFF Research Database (Denmark)

    Pedersen, Henrik; Nielsen, Jens

    2000-01-01

    The influence of the nitrogen source on the cc-amylase productivity of Aspergillus oryzae was quantified in continuous cultivations. Both inorganic and complex nitrogen sources were investigated and glucose was used as the carbon and energy sources. For production of alpha-amylase, nitrate was...

  10. Metabolism of glycosylated human salivary amylase: in vivo plasma clearance by rat hepatic endothelial cells and in vitro receptor mediated pinocytosis by rat macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Niesen, T.E.; Alpers, D.H.; Stahl, P.D.; Rosenblum, J.L.

    1984-09-01

    Salivary-type amylase normally comprises about 60% of the amylase activity in human serum, but only a small fraction is a glycosylated isoenzyme (amylase A). In contrast, 1/3 of amylase in human saliva is glycosylated. Since glycosylation can affect circulatory clearance, we studied the clearance of amylase A in rats and its uptake by rat alveolar macrophages. Following intravenous injection, /sup 125/I-labeled amylase A disappeared rapidly from plasma (t 1/2 . 9 min) and accumulated in the liver. Simultaneous injection of mannose-albumin slowed its clearance to a rate comparable to that of /sup 125/I-labeled nonglycosylated salivary amylase (t 1/2 . 45 min). In contrast, galactose-albumin had no effect. Electron microscope autoradiography of the liver following injection of /sup 125/I-labeled amylase A revealed a localization of grains over the hepatic endothelial cells. In vitro studies indicated that amylase A is taken up by alveolar macrophages via receptor-mediated pinocytosis. Uptake was linear over time, saturable, and inhibited by mannan and mannose-albumin, but not by galactose-albumin. We conclude that amylase A, which is a naturally occurring human glycoprotein with at most three terminal L-fucose residues per molecule, is recognized in rats by a mannose receptor located on hepatic endothelial cells. We speculate that this receptor, by rapidly clearing circulating amylase A, may be responsible for the low level of amylase A in human serum.

  11. Spatio-temporal appearance of α-amylase and limit dextrinase in barley aleurone layer in response to gibberellic acid, abscisic acid and salicylic acid

    DEFF Research Database (Denmark)

    Shahpiri, Azar; Talaei, Nasim; Finnie, Christine

    2015-01-01

    Release of LD was found to differ from that of amylase and was suggested to depend on programmed cell death (PCD). Despite detection of intracellular amylase in untreated aleurone layers or aleurone layers treated with ABA or SA, α-amylase was not released from these samples. Nevertheless, the re...

  12. Heterologous expression, biochemical characterization, and overproduction of alkaline α-amylase from Bacillus alcalophilus in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Li Jianghua

    2011-10-01

    Full Text Available Abstract Background Alkaline α-amylases have potential applications for hydrolyzing starch under high pH conditions in the starch and textile industries and as ingredients in detergents for automatic dishwashers and laundries. While the alkaline α-amylase gains increased industrial interest, the yield of alkaline α-amylases from wild-type microbes is low, and the combination of genetic engineering and process optimization is necessary to achieve the overproduction of alkaline α-amylase. Results The alkaline α-amylase gene from Bacillus alcalophilus JN21 (CCTCC NO. M 2011229 was cloned and expressed in Bacillus subtilis strain WB600 with vector pMA5. The recombinant alkaline α-amylase was stable at pH from 7.0 to 11.0 and temperature below 40°C. The optimum pH and temperature of alkaline α-amylase was 9.0 and 50°C, respectively. Using soluble starch as the substrate, the Km and Vmax of alkaline α-amylase were 9.64 g/L and 0.80 g/(L·min, respectively. The effects of medium compositions (starch, peptone, and soybean meal and temperature on the recombinant production of alkaline α-amylase in B. subtilis were investigated. Under the optimal conditions (starch concentration 0.6% (w/v, peptone concentration 1.45% (w/v, soybean meal concentration 1.3% (w/v, and temperature 37°C, the highest yield of alkaline α-amylase reached 415 U/mL. The yield of alkaline α-amylase in a 3-L fermentor reached 441 U/mL, which was 79 times that of native alkaline α-amylase from B. alcalophilus JN21. Conclusions This is the first report concerning the heterologous expression of alkaline α-amylase in B. subtilis, and the obtained results make it feasible to achieve the industrial production of alkaline α-amylase with the recombinant B. subtilis.

  13. Agrobacterium-mediated transformation of chickpea with -amylase inhibitor gene for insect resistance

    Indian Academy of Sciences (India)

    S Ignacimuthu; S Prakash

    2006-09-01

    Chickpea is the world’s third most important pulse crop and India produces 75% of the world’s supply. Chickpea seeds are attacked by Callosobruchus maculatus and C. chinensis which cause extensive damage. The -amylase inhibitor gene isolated from Phaseolus vulgaris seeds was introduced into chickpea cultivar K850 through Agrobacterium-mediated transformation. A total of 288 kanamycin resistant plants were regenerated. Only 0.3% of these were true transformants. Polymerase chain reaction (PCR) analysis and Southern hybridization confirmed the presence of 4.9 kb -amylase inhibitor gene in the transformed plants. Western blot confirmed the presence of -amylase inhibitor protein. The results of bioassay study revealed a significant reduction in the survival rate of bruchid weevil C. maculatus reared on transgenic chickpea seeds. All the transgenic plants exhibited a segregation ratio of 3:1.

  14. Kinetic studies of acid inactivation of alpha-amylase from Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens Bredal; Villadsen, John

    1996-01-01

    The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on-line by a...... regains part of its activity, and the reactivation process also follows first-order kinetics. The irreversible loss of activity is found not to result from a protease contamination of the protein samples. A proposed model, where irreversibly inactivated a-amylase is formed both directly from the active...

  15. Peptide-evoked release of amylase from isolated acini of the rat parotid gland

    DEFF Research Database (Denmark)

    Goll, R; Poulsen, J H; Schmidt, P;

    1994-01-01

    Investigations of the effects of the neuropeptides, substance P (SP), neurokinin A (NKA), neuropeptide K (NPK), gastrin releasing peptide (GRP), calcitonin gene related peptide (CGRP) and vasoactive intestinal peptide (VIP), and of acetylcholine on amylase secretion have been carried out on...... amylase release. VIP, however, with a rather low potency (EC50 at 155 nmol/l). Simultaneous stimulation with two compounds elicited additive responses, except for VIP and acetylcholine which elicited an effect significantly above additive response. Only SP, NKA, VIP and CGRP could be identified in...... NK1-receptors. Thus, the results of the present study support previous suggestions that the tachykinins and VIP are likely to be involved in amylase secretion in the rat parotid gland....

  16. The effect of gamma irradiation on the formation of alpha-amylase isoenzymes in germinating wheat

    International Nuclear Information System (INIS)

    The biosynthesis of alpha-amylase during seedling growth commenced after a prolonged lag-period in wheat (cv. Vijay), irradiated at a high dose (200 krad). Also, a different requirement for exogenous gibberellins (GA) to stimulate the enzyme synthesis was noted in control and irradiated seeds. Further, the developmental patterns of three major isoenzymes of alpha-amylase (designated as α1, α2- and α3) during germination were different. It was observed that α1-isoenzyme which appeared on the fourth day of germination of control seeds, was delayed in its development and was undetectable up to 4 days in samples irradiated with 200 krad. However, α1-isoenzyme appeared after 6 days or after 4 days in GA-treated samples in germinating seeds exposed to a high dose. These results suggested that two systems differing in their radiosensitivity and response to GA application were operating in germinating wheat for the synthesis of functional alpha-amylase molecules. (author)

  17. Changes in serum amylase and its isoenzymes after whole body irradiation

    International Nuclear Information System (INIS)

    A study was carried out to assess the effect of total body irradiation on pancreatic and parotid isoenzymes of amylase in patients about to undergo bone-marrow transplantation who had received high-dose cyclophosphamide. Twelve patients were studied, enzyme activity being measured before and at various times after total body irradiation. Serum total amylase activity rose rapidly within 12 hours of irradiation to a maximum at 36 hours, returning to normal by six days; most of the increase was derived from salivary damage, with a much smaller pancreatic component. These results confirm that radiation produces acute changes in amylase activity, which may be of use in assessing radiation-induced damage. (author)

  18. A high yield of amylase from Aspergillus niger by the effect of gamma irradiation

    International Nuclear Information System (INIS)

    When irradiated rice was used as a media for Aspergillus niger a noticeable increase of amylase production was observed. Molecular degradation of starch molecules did occure, and an increase in starch acidity and solubility was noticed, whereas a marked decrease in viscosity as well as swelling capacity was observed. Gelatinization time and temperature of irradiated starch became shorter or lower resp. These results showed that internal changes in irradiated starch molecules and an alteration in its molecular configuration occured. They may affect the pathway of the growth of the fungi Aspergillus niger. When the amount of amylase was determined by measuring enzyme activity, it was observed that amylases in the irradiated media were higher than in the control media. (orig.)

  19. Immunohistochemical and quantitative changes in salivary EGF, amylase and haptocorrin following radiotherapy for oral cancer

    DEFF Research Database (Denmark)

    Christensen, M E; Hansen, H S; Poulsen, Steen Seier;

    1996-01-01

    . The concentration of EGF in saliva before treatment was significantly higher in patients than in the control group (p alternatively that the oral tumors contribute with EGF to the saliva. In conclusion we have demonstrated......Epidermal growth factor (EGF), amylase and haptocorrin are molecules produced in the salivary glands. The aim of the present study was to determine immunohistochemical and quantitative alterations in EGF as compared with haptocorrin and amylase following radiotherapy for oral cancer. Changes...... were observed in the staining for haptocorrin. Analysis on stimulated whole saliva samples collected from 20 healthy individuals and from 20 patients prior to, and 1, 2 and 3 weeks following radiotherapy showed significant reduction in salivary contents of EGF and amylase after treatment as expressed...

  20. Thermal stability of alpha-amylase from Aspergillus oryzae entrapped in polyacrylamide gel.

    Science.gov (United States)

    Raviyan, Patcharin; Tang, Juming; Rasco, Barbara A

    2003-08-27

    To determine the suitability as a time-temperature indicator for dielectric pasteurization processes, the thermal stability (50-75 degrees C) of Aspergillus oryzae alpha-amylase immobilized in polyacrylamide gel in phosphate buffer, mashed potatoes, and minced shrimp was examined. Changing the cross-linking agent concentration from 3.3 to 5.3% and adding 2% salt did not markedly affect the thermal stability of the immobilized alpha-amylase. Thermal inactivation was first order, and immobilization generally improved the thermal stability of alpha-amylase. z values of the immobilized system in test food systems were 10.2 degrees C (phosphate buffer), 8.45 degrees C (minced shrimp), and 7.78 degrees C (mashed potatoes). PMID:12926898

  1. Effect of sexual steroids upon ontogeny of alpha-amylase of rat parotid gland.

    Science.gov (United States)

    Bellavia, S L; Sanz, E G; Vermouth, N T; Blanco, A

    1982-04-30

    The effect of gonadectomy (at the 10th day of life) and treatment with sexual steroids (during the first month) upon development of alpha-amylase activity in rat parotid gland has been studied. Alpha-amylase specific activity of parotid glands from 20-day-old orchidectomized rats and from 25-day-old ovariectomized animals was significantly higher than that of intact male and female rats of the same age respectively. Spayed males treated with testosterone (10 microgram/day on the 13th, 15th, and 17th day) and ovariectomized rats treated with oestradiol (2.5 microgram/day from the 16th to the 22nd day) showed values of enzymic activity similar to those of normal animals. Results indicate that oestradiol and testosterone have an inhibitory effect upon the increase of alpha-amylase activity in parotid gland during a very defined period of development. PMID:6178953

  2. ANTICARIES AND α-AMYLASE INHIBITORY ACTIVITY OF JASMINUM ARBORESCENS ROXB. (OLEACEAE LEAVES EXTRACT

    Directory of Open Access Journals (Sweden)

    Bhagath K

    2013-12-01

    Full Text Available The aim of the present study was to determine anti caries and α-amylase inhibitory activity of leaf extract of Jasminum arborescens Roxb. (Oleaceae. Anti caries activity was determined by Agar well diffusion assay against seven clinical isolates of Streptococcus mutans (Sm-01 to Sm-07 recovered from dental caries subjects. Enzyme inhibitory activity was tested against α-amylase by spectrophometric method using starch as substrate. The extract exhibited dose dependent inhibition against cariogenic isolates. Among seven isolates, isolate Sm-04 and Sm-06 were inhibited to higher and least extent respectively. The extract was found to cause inhibition of α-amylase activity in a dose dependent manner and its IC50 value was found to be 17.45 mg/ml. The inhibitory activity could be attributed to the presence of secondary metabolites. The plant may be a potential source for development of agents which are active against dental caries pathogens and for diabetes mellitus.

  3. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications

    Science.gov (United States)

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications. PMID:27516755

  4. Study on Salivary Glands α-amylase In Wheat Bug Eurygaster maura (Hemiptera: Scutelleridae

    Directory of Open Access Journals (Sweden)

    Mohammad Mehrabadi

    2009-01-01

    Full Text Available α-amylase activity in the salivary glands of Eurygaster maura was determined by biochemical experiments. Some of adult insect was collected and their salivary glands isolated and characterized. Enzyme samples from salivary glands of adults were prepared by the method of Cohen with slight modifications. α-Amylase activity was assayed based on Bernfeld method by the dinitrosalicylic acid (DNS procedure. The activity of α-amylase in salivary glands was 0.050 U/insect. The optimum pH and temperature for the enzyme activity was determined to be 6.5-7 and 30-35°C, respectively. The enzyme activity was inhibited by addition of EDTA (Ethylenediamine tetraacetic acid urea, CaCl2, MgCl2 and SDS but Mg2+, NaCl and KCl enhanced enzyme activity.

  5. Heterologous expression and secretion of Lactobacillus amylovorus alpha-amylase in Leuconostoc citreum.

    Science.gov (United States)

    Eom, Hyun-Ju; Moon, Jin-Seok; Seo, Eun-Young; Han, Nam Soo

    2009-11-01

    To develop a gene expression system for Leuconostoc genus, construction of expression vector and expression of a heterologus protein in Leuconostoc was performed. Alpha-amylase gene from Lactobacillus amylovorus was cloned into a Leuconostoc cloning vector, pLeuCM, with its own signal peptide. pLeuCMamy was introduced into Leuconostoc citreum CB2567 and a successful expression of alpha-amy gene was confirmed by enzyme activity assays. About 90% of alpha-amylase activity was detected in the culture broth, revealing most of expressed alpha-amylase was secreted out cells. The signal sequence of alpha-amy gene is a good candidate for the secretion of heterologous protein by using Leuconostoc host-vector system. PMID:19618275

  6. Effect of radioactive isotope 32P upon alpha amylase activity and glucose concentration in chickens

    International Nuclear Information System (INIS)

    An attempt has been made to investigate whether alpha amylase activity and glucose concentration in blood plasma can serve as the help in establishing on early diagnosis of organic or functional damage caused by ionizing radiation in chickens. Fifty day old hybrid chickens of heavy 'Jata' breeds of both sexes, were treated by 32P administered intramusculary as sodium orthophosphate in a single dose of 333 MBq per kilogram of body weight. Blood samples was taken from the wing vein on day 1, 3, 5, 7 and 10 after administration of 32P. Alpha amylase activity and glucose concentration were determined spectrophotometrically using kits produced by 'Radonja', Sisak. Alpha amylase activity was decreased and glucose concentration was increased during investigated period. Yet, the further investigations are needed to find out whether these two parameters can be used for early diagnosis of injury in chicken organism by ionizing radiation. (author)

  7. The amylase inhibitor montbretin A reveals a new glycosidase inhibition motif.

    Science.gov (United States)

    Williams, Leslie K; Zhang, Xiaohua; Caner, Sami; Tysoe, Christina; Nguyen, Nham T; Wicki, Jacqueline; Williams, David E; Coleman, John; McNeill, John H; Yuen, Violet; Andersen, Raymond J; Withers, Stephen G; Brayer, Gary D

    2015-09-01

    The complex plant flavonol glycoside montbretin A is a potent (Ki = 8 nM) and specific inhibitor of human pancreatic α-amylase with potential as a therapeutic for diabetes and obesity. Controlled degradation studies on montbretin A, coupled with inhibition analyses, identified an essential high-affinity core structure comprising the myricetin and caffeic acid moieties linked via a disaccharide. X-ray structural analyses of the montbretin A-human α-amylase complex confirmed the importance of this core structure and revealed a novel mode of glycosidase inhibition wherein internal π-stacking interactions between the myricetin and caffeic acid organize their ring hydroxyls for optimal hydrogen bonding to the α-amylase catalytic residues D197 and E233. This novel inhibitory motif can be reproduced in a greatly simplified analog, offering potential for new strategies for glycosidase inhibition and therapeutic development. PMID:26214255

  8. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide

    Science.gov (United States)

    2016-01-01

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides. PMID:27066537

  9. Purification and crystallization of α-amylases from mucoid and non-mucoid B. amyloliquefaciens strains

    Science.gov (United States)

    Sarikaya, Elif; Mikami, Bunzo

    2001-11-01

    The purified α-amylases from mucoid and non-mucoid B. amyloliquefaciens strains were crystallized in forms suitable for X-ray diffraction analysis. Crystals were grown by the hanging-drop vapor diffusion method. Very thin crystals of α-amylase of non-mucoid strain were obtained in the presence 15% propanol, 12% PEG 6000 and 0.1 M PIPES (pH: 7.1) at the end of 3 months and these were not suitable for X-ray diffraction analysis. Crystals of the mucoid strain of B. amyloliquefaciens α-amylase were obtained with 30% PEG 6000, 0.2 M (NH 4) 2SO 4 and 0.1 M PIPES (pH: 6.5) at the end of 3 months and these were suitable for X-ray diffraction analysis.

  10. Stress affects salivary alpha-Amylase activity in bonobos.

    Science.gov (United States)

    Behringer, Verena; Deschner, Tobias; Möstl, Erich; Selzer, Dieter; Hohmann, Gottfried

    2012-01-18

    Salivary alpha-Amylase (sAA) is a starch digesting enzyme. In addition to its function in the context of nutrition, sAA has also turned out to be useful for monitoring sympathetic nervous system activity. Recent studies on humans have found a relationship between intra-individual changes in sAA activity and physical and psychological stress. In studies on primates and other vertebrates, non-invasive monitoring of short-term stress responses is usually based on measurements of cortisol levels, which are indicative of hypothalamic-pituitary-adrenal activity. The few studies that have used both cortisol levels and sAA activity indicate that these two markers may respond differently and independently to different types of stress such that variation in the degree of the activation of different stress response systems might reflect alternative coping mechanisms or individual traits. Here, we present the first data on intra- and inter-individual variation of sAA activity in captive bonobos and compare the results with information from other ape species and humans. Our results indicate that sAA activity in the bonobo samples was significantly lower than in the human samples but within the range of other great ape species. In addition, sAA activity was significantly higher in samples collected at times when subjects had been exposed to stressors (judged by changes in behavioral patterns and cortisol levels) than in samples collected at other times. Our results indicate that bonobos possess functioning sAA and, as in other species, sAA activity is influenced by autonomic nervous system activity. Monitoring sAA activity could therefore be a useful tool for evaluating stress in bonobos. PMID:21945369

  11. Optimization of the growth conditions for amylase production by bacillus licheniformis 208 isolated from local hotsprings of karachi

    International Nuclear Information System (INIS)

    Studies on the optimum conditions for the production of extracellular amylase were carried out with a newly isolated strain of Bacillus 208 from the hotsprings in Karachi. The optimum temperature, initial medium pH and incubation period for amylase production were 50 degree C, 7.0 and 24 hrs respectively. Furthermore, cells when grown in the complex media showed high amylase production compared to the minimal medium. Effect of different carbon sources revealed that soluble starch (1%) increased the amylase yield significantly. Peptone (as nitrogen source) gave higher yield as compared to other nitrogen sources tested. Under optimized conditions, the organism entered the stationary phase after 12 hrs and amylase production was observed to be maximum at 24th hrs of cultivation. Enzyme production regulation is influenced by catabolite repression. Reduction in enzyme production was observed in the presence of EDTA while addition of tween 20 and CaCl/sub 2/ helped to enhance the enzyme production. (author)

  12. Effect of low energy N+ ion beam implantation on the secondary structure and activity of α-amylase

    International Nuclear Information System (INIS)

    Samples of the α-amylase were treated with 1015-1016 ions/cm2 of 20 keV N+. The secondary structure of the ion-implanted α-amylase was studied by circular dichroism, and activity change of the α-amylase was analyzed. The results showed that in the dose range under investigation, the N+ implantation affected the relative contents of α-helix, β-sheet, β-turn and random coil of the α-amylase, but no significant differences were found between the samples implanted to different doses. The activity of the N+-implanted α-amylase changed, with a relationship between the activity increase and the conformation change. (authors)

  13. a-淀粉酶的应用研究进展%Research Progress of the a-amylase Application

    Institute of Scientific and Technical Information of China (English)

    丁皓; 王冠; 徐丽; 程瑛

    2012-01-01

    Amylase is the general term for a class of catalytic decomposition of starch, glycogen, dextrin, the glycosidic bond enzymes. Amylase included a-amylase, β-amylase and glucoamylase enzymes. This article focused on the research progress application, detection methods, and enzymatic properties of the a-amylase.%淀粉酶是指一类能催化分解淀粉(糖原、糊精)的糖苷键的酶总称,包括a-淀粉酶、β-淀粉酶、葡萄糖淀粉酶等。文章综述了a-淀粉酶的研究进展、应用、检测方法以及酶争陛质。

  14. Two-step purification and partial characterization of an extra cellular α-amylase from Bacillus licheniformis

    Directory of Open Access Journals (Sweden)

    Zare Mirakabadi, A.

    2012-11-01

    Full Text Available The aim of this study was production and partial purification of α-amylase enzyme by Bacillus licheniformis. B. Licheniformis was allowed to grow in broth culture for purpose of inducing α-amylase enzyme. Optimal conditions for amylase production by B. Licheniformis are incubation period of 120 h, temperature of 37 °C and pH 7.0. The α-amylase enzyme was purified by ion exchange chromatography on DEAE-sepharose CL-6B and sephadex G-100 gel filtration with a 19.1-fold increase in specific activity as compared to the concentrated supernatant and with a specific activity of 926.47 U/mg. The α-amylase had the highest activity at pH 7.0 and 65 °C. According to the data on native polyacrylamide gel electrophoresis, the molecular weight of the purified enzyme was 72 kDa.

  15. Isolation, characterization and inhibition by acarbose of the alpha-amylase from Lactobacillus fermentum: comparison with Lb. manihotivorans and Lb. plantarum amylases.

    Science.gov (United States)

    Talamond, P; Desseaux, V; Moreau, Y; Santimone, M; Marchis-Mouren, G

    2002-11-01

    Extracellular alpha-amylase from Lactobacillus fermentum (FERMENTA) was purified by glycogen precipitation and ion exchange chromatography. The purification was approximately 28-fold with a 27% yield. The FERMENTA molecular mass (106,000 Da) is in the same range as the ones determined for L. amylovorus (AMYLOA), L. plantarum (PLANTAA) and L. manihotivorans (MANIHOA) alpha-amylases. The amino acid composition of FERMENTA differs from the other lactobacilli considered here, but however, indicates that the peptidic sequence contains two equal parts: the N-terminal catalytic part; and the C-terminal repeats. The isoelectric point of FERMENTA, PLANTAA, MANIHOA are approximately the same (3.6). The FERMENTA optimum pH (5.0) is slightly more acidic and the optimum temperature is lower (40 degrees C). Raw starch hydrolysis catalyzed by all three amylases liberates maltotriose and maltotretaose. Maltose is also produced by FERMENTA and MANIHOA. Maltohexaose FERMENTA catalyzed hydrolysis produces maltose and maltotriose. Finally, kinetics of FERMENTA, PLANTAA and MANIHOA using amylose as a substrate and acarbose as an inhibitor, were carried out. Statistical analysis of kinetic data, expressed using a general velocity equation and assuming rapid equilibrium, showed that: (1) in the absence of inhibitor k(cat)/Km are, respectively, 1x10(9), 12.6x10(9) and 3.2x10(9) s(-1) M(-1); and (2) the inhibition of FERMENTA is of the mixed non-competitive type (K(1i)=5.27 microM; L(1i)=1.73 microM) while the inhibition of PLANTAA and MANIHOA is of the uncompetitive type (L(1i)=1.93 microM and 1.52 microM, respectively). Whatever the inhibition type, acarbose is a strong inhibitor of these Lactobacillus amylases. These results indicate that, as found in porcine and barley amylases, Lactobacillus amylases contain in addition to the active site, a soluble carbohydrate (substrate or product) binding site. PMID:12431403

  16. [Alpha-amylase as an occupational allergen in baking industry employees].

    Science.gov (United States)

    De Zotti, R; Larese, F; Molinari, S

    1994-01-01

    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8072442

  17. Identification of a new oat β-amylase by functional proteomics.

    Science.gov (United States)

    Ben Halima, Nihed; Khemakhem, Bassem; Fendri, Imen; Ogata, Hiroyuki; Baril, Patrick; Pichon, Chantal; Abdelkafi, Slim

    2016-01-01

    Oat (Avena sativa L.) seed extracts exhibited a high degree of catalytic activity including amylase activities. Proteins in the oat seed extracts were optimized for their amylolytic activities. Oat extract with amylolytic activity was separated by SDS-PAGE and a major protein band with an apparent molecular mass of 53 kDa was subjected to tryptic digestion. The generated amino acid sequences were analyzed by liquid chromatography–tandem mass spectrometry (LC/ESI/MS/MS) and database searches. These sequences were used to identify a partial cDNA from expressed sequence tags (ESTs) of A. sativa L. Based upon EST sequences, a predicted full-length gene was identified, with an open reading frame of 1464 bp encoding a protein of 488 amino acid residues (AsBAMY), with a theoretical molecular mass of 55 kDa identified as a β-amylase belonging to the plant β-amylase family. Primary structure of oat β-amylase (AsBAMY) protein indicated high similarity with other β-amylase from other cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare), and rye (Secale cereale) with two conserved Glu residues (E184 and E378) assigned as the “putative” catalytic residues which would act as an acid and base pair in the catalytic process. In addition, a 3D-model of AsBAMY was built from known X-ray structures and sequence alignments. A similar core (β/α)8-barrel architecture was found in AsBAMY like the other cereal β-amylases with a specific location of the active site in a pocket-like cavity structure made at one end of this core (β/α)8-barrel domain suggesting an accessibility of the non-reducing end of the substrate and thus confirming the results of AsBAMY exo-acting hydrolase. PMID:26455400

  18. Cloning, Purification and Characterization of a Highly Thermostable Amylase Gene of Thermotoga petrophila into Escherichia coli.

    Science.gov (United States)

    Zafar, Asma; Aftab, Muhammad Nauman; ud Din, Zia; Aftab, Saima; Iqbal, Irfana; ul Haq, Ikram

    2016-02-01

    A putative α-amylase gene of Thermotoga petrophila was cloned and expressed in Escherichia coli BL21 (DE3) using pET-21a (+), as an expression vector. The growth conditions were optimized for maximal expression of the α-amylase using various parameters, such as pH, temperature, time of induction and addition of an inducer. The optimum temperature and pH for the maximum expression of α-amylase were 22 °C and 7.0 pH units, respectively. Purification of the recombinant enzyme was carried out by heat treatment method, followed by ion exchange chromatography with 34.6-fold purification having specific activity of 126.31 U mg(-1) and a recovery of 56.25%. Molecular weight of the purified α-amylase, 70 kDa, was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 100 °C temperature and at pH of 7.0. The enzyme activity was increased in the presence of metal ions especially Ca(+2) and decreased in the presence of EDTA indicating that the α-amylase was a metalloenzyme. However, addition of 1% Tween 20, Tween 80 and β-mercaptoethanol constrained the enzyme activity to 87, 96 and 89%, respectively. No considerable effect of organic solvents (ethanol, methanol, isopropanol, acetone and n-butanol) was observed on enzyme activity. With soluble starch as a substrate, the enzyme activity under optimized conditions was 73.8 U mg(-1). The α-amylase enzyme was active to hydrolyse starch forming maltose. PMID:26526464

  19. [Protease and alpha-amylase synthesis by washed cells of Aspergillus oryzae 251-90].

    Science.gov (United States)

    Ustiuzhanina, S V; Iarovenko, V L; Voĭnarskiĭ, I N

    1985-01-01

    Regularities of protease and alpha-amylase production by washed cells of Aspergillus oryzae 251-90 were being studied. The results obtained enabled us to assume a constitutive character of the both enzymes synthesis by the given producer. Sources of carbon, nitrogen and sulphur take part in regulation of the protease production, whereas in the case of the alpha-amylase synthesis only carbon sources that are important. Elimination of phosphorus from the medium affects the synthesis of both enzymes. Celatin stimulates the production of the two enzymes, being a supplier of amino acids. PMID:3885211

  20. Componential profile and amylase inhibiting activity of phenolic compounds from Calendula officinalis L. leaves.

    Science.gov (United States)

    Olennikov, Daniil N; Kashchenko, Nina I

    2014-01-01

    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6'-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6''-acetyl)-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase. PMID:24683352

  1. Influence of cysteamine on plasmatic amylase and S.G.O.T. activities in irradiated rats

    International Nuclear Information System (INIS)

    Alterations in plasmatic amylase and SGOT (Serum Glutamic Oxalacetic Transaminase) activities were determined in rats after exposure to gamma radiation at two doses: 900 R (LD50/30) and 1200 R (LF100/30). These determinations were carried out 6 and 24 hours after irradiation. The rats were given intraperitoneal injection of cysteamine (100 mg/kg) 15 minutes before irradiation. A comparative study with non protected rats was performed. It was observed that plasmatic amylase activity was not affected either by irradiation or by cysteamine. Lethal or semi-lethal irradiation increased plasmatic SGOT activity. But no correlation was established between this increase and rat survival time

  2. Amylosucrase, a glucan-synthesizing enzyme from the alpha-amylase family

    DEFF Research Database (Denmark)

    Skov, L K; Mirza, Osman Asghar; Henriksen, A;

    2001-01-01

    Amylosucrase (E.C. 2.4.1.4) is a member of Family 13 of the glycoside hydrolases (the alpha-amylases), although its biological function is the synthesis of amylose-like polymers from sucrose. The structure of amylosucrase from Neisseria polysaccharea is divided into five domains: an all helical N...... amylosucrase is at the bottom of a pocket at the molecular surface. A substrate binding site resembling the amylase 2 subsite is not found in amylosucrase. The site is blocked by a salt bridge between residues in the second and eight loops of the (beta/alpha)(8)-barrel. The result is an exo-acting enzyme. Loop...

  3. Salivary a-amylase protects enamel surface against acid induced softening

    DEFF Research Database (Denmark)

    Lazovic, Maja Bruvo; Moe, Dennis; Kirkeby, Svend;

    -TOF mass fingerprinting following trypsin digestion. Each persistent peak in the HPLC chromatograms was related to the protective effect against acid-induced enamel softening obtained by the corresponding saliva sample by multiple regression analysis. Results: One peak identified as a-amylase had an...... explanatory power of 39% in the analysis with high concentrations being most protective (p<0.001). In addition, a smaller peak retrieved later in the chromatograms also had a strong protective effect. Inclusion of this peak in the analysis increased the explanatory power of amylase on protective effect to 65...

  4. Serum amylase as a semiquantitative indicator of an exposure to ionizing radiation

    International Nuclear Information System (INIS)

    Quantitative aspects of amylase-activity increase in serum after a single irradiation of the salivary glands in man are considered. The threshold is about 0,4 Gy; in the range 0,4 - 5 Gy the dose can be estimated semi-quantitatively after 24 hours if the salivary glands were irradiated completely and homogeneously. To obtain a (pre-irradiation) reference level the 72-hour value is used. Non-complete and inhomogeneous irradiation of the glands and fractionated irradiation invalidate the dose assessment. It is concluded that at present serum amylase measurement is the only available biochemical indicator of irradiation dose in man. 7 refs., 2 figs. (qui)

  5. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    OpenAIRE

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also co...

  6. Different agroresidues used in solid substrate fermentation for alpha- amylase production by bacillus subtilis-329

    International Nuclear Information System (INIS)

    The best mass ratio for agroresidue fermentation for a-amylase production by locally isolated Bacillus subtilis-239 was found to be wheat bran to rice bran 2:1 with 70% initial moisture content for 60 h incubation time. Among different inorganic nitrogen sources supplemented, sodium nitrate and ammonium chloride (0.5% w/w) increased the enzyme yield upto 178 U/ml and 176 U/ml, respectively, whereas all the organic nitrogen sources decreased the enzyme production. Addition of glucose (1% w/w) as a carbon source enhanced a-amylase synthesis to 185 U/ml as compared to the control (134 U/ml). (author)

  7. Amylase-Binding Protein B of Streptococcus gordonii Is an Extracellular Dipeptidyl-Peptidase▿

    OpenAIRE

    Chaudhuri, Biswendu; Paju, Susanna; Haase, Elaine M.; Vickerman, M. Margaret; Tanzer, Jason M; Scannapieco, Frank A.

    2008-01-01

    The oral commensal bacterium Streptococcus gordonii interacts with salivary amylase via two amylase-binding proteins, AbpA and AbpB. Based on sequence analysis, the 20-kDa AbpA protein is unique to S. gordonii, whereas the 82-kDa AbpB protein appears to share sequence homology with other bacterial dipeptidases. The aim of this study was to verify the peptidase activity of AbpB and further explore its potential functions. The abpB gene was cloned, and histidine-tagged AbpB (His-AbpB) was expre...

  8. Salivary α-amylase levels as a biomarker of experienced fear

    OpenAIRE

    Buchanan, Tony W.; Bibas, David; Adolphs, Ralph

    2010-01-01

    We recently reported data related to emotions collected in conjunction with a museum exhibit on emotion (Goose Bumps!—The Science of Fear).1 In this addendum, we present additional data collected as part of that study. We collected two commonly measured indices of emotional arousal, salivary cortisol and α-amylase, before and after participants had gone through a realistic fear challenge course as part of the exhibit. We found that α-amylase, but not cortisol, showed a highly specific increas...

  9. Production of α-Amylase by the Ruminal Anaerobic Fungus Neocallimastix frontalis

    OpenAIRE

    Mountfort, Douglas O.; Asher, Rodney A.

    1988-01-01

    α-Amylase production was examined in the ruminal anaerobic fungus Neocallimastix frontalis. The enzyme was released mainly into the culture fluid and had temperature and pH optima of 55°C and 5.5, respectively, and the apparent Km for starch was 0.8 mg ml−1. The products of α-amylase action were mainly maltotriose, maltotetraose, and longer-chain oligosaccharides. No activity of the enzyme was observed towards these compounds or pullulan, but activity on amylose was similar to starch. Evidenc...

  10. Partial Purification of Alpha-Amylase Produced by Brevibacillus Borstelensis R1

    OpenAIRE

    K.Suribabu*; K.P.J Hemalatha2

    2014-01-01

    Ideal purification should optimize both the purity and the concentration of the metabolite. Alpha-amylase is an extracellular enzyme. The precipitate collected from 70% (NH4)2SO4 salting-out was dissolved in required amount of 0.1M phosphate buffer (pH 6.8). The dialysis was conducted to get rid of the ions in the protein. After dialysis in the buffer for 24hrs, the sample was subjected to gel filtration. The fraction number 38th had shown highest α-amylase activity (3793±12U/...

  11. Thermostable a-amylase from moderately halophilic Halomonas sp. AAD21

    OpenAIRE

    UZYOL, Kamil Serkan; Akbulut, Berna Sariyar; DENİZCİ, Aziz Akın; KAZAN, Dilek

    2012-01-01

    The moderately halophilic Halomonas sp. strain AAD21, which produces extracellular thermostable a-amylase, was isolated from the Çamaltı Saltern area located in İzmir, Turkey. NaCl, carbon, and nitrogen sources in the growth medium were optimized to enhance a-amylase yield. The highest enzyme yield was measured in the presence of 20% NaCl with peptone as the nitrogen and starch as the carbon sources in the fermentation broth. This microorganism was also found to utilize waste potato peel as a...

  12. Increase of the a-amylase yield by Some Bacillus Strains

    OpenAIRE

    SARIKAYA, Elif

    2000-01-01

    In order to obtain high amounts of a-amylase enzyme from Bacillus bacteria a new medium was developed. In this medium, three strains of Bacillus bacteria were grown in the presence of different carbon, nitrogen and metal ions. The highest a-amylase yield was obtained by addition of Na-citrate, strach and sucrose for the strains of B. subtilis, B. amyloliquefaciens I and B. amyloliquefaciens II, respectively. As a nitrogen source, yeast extract was found to be effective on enzyme yield for...

  13. Amylase production by solid-state fermentation of agro-industrial wastes using Bacillus sp.

    OpenAIRE

    Saxena, Rajshree; Singh, Rajni

    2011-01-01

    Solid state fermentation was carried out using various agro- industrial wastes with the best amylase producing strain isolated from soil. Different physicochemical conditions were varied for maximum enzyme production. The strain produced about 5400 units/g of amylase at 1:3 moisture content, 20% inoculum, after 72 h of incubation with Mustard Oil seed cake as the substrate. The optimum temperature and pH of the enzyme activity were found to be 50°C and 6 respectively. The enzyme was found to ...

  14. Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations

    DEFF Research Database (Denmark)

    Møller, Kasper; Sharif, M.Z.; Olsson, Lisbeth

    2004-01-01

    Heterologous protein production by the yeast Saccharomyces kluyveri was investigated under aerobic glucose-limited conditions. alpha-Amylase from Aspergillus oryzae was used as model protein and the gene was expressed from a S. cerevisiae 2 mu plasmid. For comparison, strains of both S. kluyveri...... amounts of ethanol. A fed-batch cultivation was carried out with S. kluyveri where the biomass concentration reached 85 g l(-1) and the alpha-amylase concentration reached 320 mg l(-1). Even though S. kluyveri could be grown to high cell density, it was also observed that it has a high maintenance...

  15. Characteristics of Two Forms of α-Amylases and Structural Implication

    OpenAIRE

    Ohdan, Kohji; Kuriki, Takashi; Kaneko, Hiroki; Shimada, Jiro; Takada, Toshikazu; Fujimoto, Zui; Mizuno, Hiroshi; Okada, Shigetaka

    1999-01-01

    Complete (Ba-L) and truncated (Ba-S) forms of α-amylases from Bacillus subtilis X-23 were purified, and the amino- and carboxyl-terminal amino acid sequences of Ba-L and Ba-S were determined. The amino acid sequence deduced from the nucleotide sequence of the α-amylase gene indicated that Ba-S was produced from Ba-L by truncation of the 186 amino acid residues at the carboxyl-terminal region. The results of genomic Southern analysis and Western analysis suggested that the two enzymes originat...

  16. Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase

    OpenAIRE

    Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C.; Santelia, Diana

    2013-01-01

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble s...

  17. Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes

    OpenAIRE

    Huma, Tayyaba; Maryam, Arooma; Rehman, Shahid Ur; Qamar, Muhammad Tahir ul; Shaheen, Tayyaba; Haque, Asma; Shaheen, Bushra

    2014-01-01

    Alpha amylase family is generally defined as a group of enzymes that can hydrolyse and transglycosylase α-(1, 4) or α-(1, 6) glycosidic bonds along with the preservation of anomeric configuration. For the comparative analysis of alpha amylase family, nucleotide sequences of seven thermo stable organisms of Kingdom Archea i.e. Pyrococcus furiosus (100-105°C), Kingdom Prokaryotes i.e. Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C), Bacillus amyloliquefaciens (72°C), Bac...

  18. In silico approach for alpha-amylase inhibitory activity of diosmetin and galangin

    OpenAIRE

    Arumugam Madeswaran; Kuppusamy Asokkumar; Muthuswamy Umamaheswari; Thirumalaisamy Sivashanmugam; Varadharajan Subhadradevi

    2014-01-01

    Objective: The objective of the current study is to evaluate the α-amylase inhibitory activity of diosmetin and galangin using in silico docking studies.Methods: In this perspective, diosmetin and galangin were prepared for the docking evaluation. Acarbose, a known α-amylase inhibitor was used as the standard. In silico docking studies were carried out using recent version of AutoDock 4.2, which has the basic principle of Lamarckian genetic algorithm.Results: The results showed that the selec...

  19. Evaluation of amylase and lipase levels in blunt trauma abdomen patients

    Directory of Open Access Journals (Sweden)

    Subodh Kumar

    2012-01-01

    Full Text Available Background: There are studies to prove the role of amylase and lipase estimation as a screening diagnostic tool to detect diseases apart from acute pancreatitis. However, there is sparse literature on the role of serum and urine amylase, lipase levels, etc to help predict the specific intra-abdominal injury after blunt trauma abdomen (BTA. Aim: To elucidate the significance of elevation in the levels of amylase and lipase in serum and urine samples as reliable parameters for accurate diagnosis and management of blunt trauma to the abdomen. Materials and Methods: A prospective analysis was done on the trauma patients admitted in Jai Prakash Narayan Apex Trauma Center, AIIMS, with blunt abdomen trauma injuries over a period of six months. Blood and urine samples were collected on days 1, 3, and 5 of admission for the estimation of amylase and lipase, liver function tests, serum bicarbonates, urine routine microscopy for red blood cells, and complete hemogram. Clinical details such as time elapsed from injury to admission, type of injury, trauma score, and hypotension were noted. Patients were divided into groups according to the single or multiple organs injured and according to their hospital outcome (dead/discharged. Wilcoxon′s Rank sum or Kruskal-Wallis tests were used to compare median values in two/three groups. Data analysis was performed using STATA 11.0 statistical software. Results: A total of 55 patients with median age 26 (range, 6-80 years, were enrolled in the study. Of these, 80% were males. Surgery was required for 20% of the patients. Out of 55 patients, 42 had isolated single organ injury [liver or spleen or gastrointestinal tract (GIT or kidney]. Patients with pancreatic injury were excluded. In patients who suffered liver injuries, urine lipase levels on day 1, urine lipase/amylase ratio along with aspartate aminotransferase (AST, alanine aminotransferase (ALT, and alkaline phosphatase (ALP on days 1, 3, and 5, were found to

  20. Effects of Carbon Sources and Various Chemicals on the Production of a Novel Amylase from a Thermophilic Bacillus sp. K-12

    OpenAIRE

    KIRAN, Özlem; ÇÖMLEKÇİOĞLU, Uğur; Arikan, Burhan

    2005-01-01

    The amylase producer thermophilic Bacillus sp. K-12 was isolated from soil samples from Zeytinli hot spring in Kahramanmaraş. Enzyme synthesis occurred at 20-55 ºC with an optimum of 42 ºC. There was a slight variation in amylase synthesis within the pH range 4.5-10.5. Effects of various carbon sources and chemicals on a-amylase production were examined and maximum a-amylase production was obtained in a medium containing 1% starch in 60 h. MnSO4, ZnSO4 and EDTA inhibited a-amylase production ...

  1. Assessment of salivary amylase as a stress biomarker in pregnant patients. : Salivary alpha-amylase: a stress biomarker in pregnant patients

    OpenAIRE

    Guglielminotti, Jean; Dehoux, Monique; Mentré, France; Bedairia, Ennoufous; Montravers, Philippe; Desmonts, Jean-Marie; Longrois, Dan

    2012-01-01

    BACKGROUND: Chronic stress during pregnancy has been associated with worsened maternal and fetal outcomes. Acute stress immediately before spinal anaesthesia for caesarean section may contribute to hypotension. Therefore objective measures of acute stress may help identify women at risk of adverse outcomes. Salivary alpha-amylase is a stress biomarker that has so far been poorly investigated during pregnancy. The reference change value is the difference between two sequential results that mus...

  2. 大豆β-淀粉酶在生产麦芽糖浆上的优势%Advantages of soybeanβ-amylase in maltose production

    Institute of Scientific and Technical Information of China (English)

    许永苗; 李惠安; 伍伯良; 黄玉新; 黄智钧

    2014-01-01

    介绍了β-淀粉酶和α-淀粉酶的酶种来源及其在生产麦芽糖浆中的作用机理,并对大豆β-淀粉酶、大麦β-淀粉酶、小麦β-淀粉酶、真菌α-淀粉酶、普鲁兰酶的适用条件、失活条件进行了比较,得出大豆β-淀粉酶在生产麦芽糖浆上的优势。%This paper summarized the resources and mechanisms ofβ-amylase and α-amylase. Optimum condi-tions and inactivated conditions of the soybeanβ-amylase, barleyβ-amylase, wheatβ-amylase, fungalα-amylase, and pullulanase were compared. Advantage of soybeanβ-amylase in maltose production was pointed out.

  3. Advantages of soybeanβ-amylase in maltose production%大豆β-淀粉酶在生产麦芽糖浆上的优势

    Institute of Scientific and Technical Information of China (English)

    许永苗; 李惠安; 伍伯良; 黄玉新; 黄智钧

    2014-01-01

    介绍了β-淀粉酶和α-淀粉酶的酶种来源及其在生产麦芽糖浆中的作用机理,并对大豆β-淀粉酶、大麦β-淀粉酶、小麦β-淀粉酶、真菌α-淀粉酶、普鲁兰酶的适用条件、失活条件进行了比较,得出大豆β-淀粉酶在生产麦芽糖浆上的优势。%This paper summarized the resources and mechanisms ofβ-amylase and α-amylase. Optimum condi-tions and inactivated conditions of the soybeanβ-amylase, barleyβ-amylase, wheatβ-amylase, fungalα-amylase, and pullulanase were compared. Advantage of soybeanβ-amylase in maltose production was pointed out.

  4. Physiological characterisation of recombinant Aspergillus nidulans strains with different creA genotypes expressing A. oryzae alpha-amylase.

    Science.gov (United States)

    Agger, Teit; Petersen, Jesper B; O'Connor, Susan M; Murphy, Rachael L; Kelly, Joan M; Nielsen, Jens

    2002-01-18

    The physiology of three strains of Aspergillus nidulans was examined--a creA deletion strain, a wild type creA genotype and a strain containing extra copies of the creA gene, all producing Aspergillus oryzae alpha-amylase. The strains were cultured in batch and continuous cultivations and the biomass formation and alpha-amylase production was characterised. Overexpression of the creA gene resulted in a lower maximum specific growth rate and a slightly higher repression of the alpha-amylase production during conditions with high glucose concentration. No expression of creA also resulted in a decreased maximum specific growth rate, but also in drastic changes in morphology. Furthermore, the expression of alpha-amylase was completely derepressed and creA thus seems to be the only regulatory protein responsible for glucose repression of alpha-amylase expression. The effect of different carbon sources on the alpha-amylase production in the creA deletion strain was investigated and it was found that starch was the best inducer. The degree of induction by starch increased almost linearly with the concentration of starch in starch/glucose mixtures. High-density batch cultivation was performed with the creA deletion strain and a final titre of 6.0 g l(-1) of alpha-amylase was reached after 162 h of cultivation. PMID:11689252

  5. Production of α-Amylase by Aspergillus terreus NCFT 4269.10 Using Pearl Millet and Its Structural Characterization

    Science.gov (United States)

    Sethi, Bijay K.; Jana, Arijit; Nanda, Prativa K.; DasMohapatra, Pradeep K.; Sahoo, Santi L.; Patra, Jayanta Kumar

    2016-01-01

    In this investigation, Aspergillus terreus NCFT4269.10 was employed in liquid static surface (LSSF) and solid state (SSF) fermentation to assess the optimal conditions for α-amylase biosynthesis. One-variable-at-a-time approach (quasi-optimum protocol) was primarily used to investigate the effect of each parameter on production of amylase. The maximum amylase production was achieved using pearl millet (PM) as substrate by SSF (19.19 ± 0.9 Ug−1) and also in presence of 1 mM magnesium sulfate, 0.025% (w/v) gibberellic acid, and 30 mg/100 ml (w/v) of vitamin E (~60-fold higher production of amylase) with the initial medium pH of 7.0 and incubation at 30 °C for 96 h. In addition, maltose, gelatin and isoleucine also influenced the α-amylase production. Amylase was purified to homogeneity with molecular mass around 15.3 kDa. The enzyme comprised of a typical secondary structure containing α-helix (12.2%), β-pleated sheet (23.6%), and β-turn (27.4%). Exploitation of PM for α-amylase production with better downstream makes it the unique enzyme for various biotechnological applications. PMID:27242841

  6. High-throughput hydrolysis of starch during permeation across α-amylase-immobilized porous hollow-fiber membranes

    International Nuclear Information System (INIS)

    Two kinds of supporting porous membranes, ethanolamine (EA) and phenol (Ph) fibers, for immobilization of α-amylase were prepared by radiation-induced graft polymerization of an epoxy-group-containing monomer, glycidyl methacrylate, onto a porous hollow-fiber membrane, and subsequent ring-opening with EA and Ph, respectively. An α-amylase solution was forced to permeate radially outward through the pores of the EA and Ph fibers. α-Amylase was captured at a density of 0.15 and 6.6 g/L of the membrane by the graft chain containing 2-hydroxyethylamino and phenyl groups, respectively. A permeation pressure of 0.10 MPa provided a space velocity of 780 and 1500 h-1 for the α-amylase-immobilized EA and Ph fibers, respectively. Quantitative hydrolysis of starch during permeation of a 20 g/L starch solution in the buffer across the α-amylase-immobilized Ph fiber was attained up to a space velocity of about 2000 h-1; this was achieved because of negligible diffusional mass-transfer resistance of the starch to the α-amylase due to convective flow/ whereas an enzyme reaction-controlled system was observed for the α-amylase-immobilized EA fiber.

  7. Polyaniline-graphene based α-amylase biosensor with a linear dynamic range in excess of 6 orders of magnitude.

    Science.gov (United States)

    Teixeira, Sofia Rodrigues; Lloyd, Catherine; Yao, Seydou; Andrea Salvatore Gazze; Whitaker, Iain S; Francis, Lewis; Conlan, R Steven; Azzopardi, Ernest

    2016-11-15

    α-amylase is an established marker for diagnosis of pancreatic and salivary disease, and recent research has seen a substantial expansion of its use in therapeutic and diagnostic applications for infection, cancer and wound healing. The lack of bedside monitoring devices for α-amylase detection has hitherto restricted the clinical progress of such applications. We have developed a highly sensitive α-amylase immunosensor platform, produced via in situ electropolymerization of aniline onto a screen-printed graphene support (SPE). Covalently binding an α-amylase specific antibody to a polyaniline (PANI) layer and controlling device assembly using electrochemical impedance spectroscopy (EIS), we have achieved a highly linear response against α-amylase concentration. Each stage of the assembly was characterized using a suite of high-resolution topographical, chemical and mechanical techniques. Quantitative, highly sensitive detection was demonstrated using an artificially spiked human blood plasma samples. The device has a remarkably wide limit of quantification (0.025-1000IU/L) compared to α-amylase assays in current clinical use. With potential for simple scale up to volume manufacturing though standard semiconductor production techniques and subsequently clinical application, this biosensor will enable clinical benefit through early disease detection, and better informed administration of correct therapeutic dose of drugs used to treat α-amylase related diseases. PMID:27196256

  8. Amylase activity is associated with AMY2B copy numbers in dog: implications for dog domestication, diet and diabetes.

    Science.gov (United States)

    Arendt, Maja; Fall, Tove; Lindblad-Toh, Kerstin; Axelsson, Erik

    2014-10-01

    High amylase activity in dogs is associated with a drastic increase in copy numbers of the gene coding for pancreatic amylase, AMY2B, that likely allowed dogs to thrive on a relatively starch-rich diet during early dog domestication. Although most dogs thus probably digest starch more efficiently than do wolves, AMY2B copy numbers vary widely within the dog population, and it is not clear how this variation affects the individual ability to handle starch nor how it affects dog health. In humans, copy numbers of the gene coding for salivary amylase, AMY1, correlate with both salivary amylase levels and enzyme activity, and high amylase activity is related to improved glycemic homeostasis and lower frequencies of metabolic syndrome. Here, we investigate the relationship between AMY2B copy numbers and serum amylase activity in dogs and show that amylase activity correlates with AMY2B copy numbers. We then describe how AMY2B copy numbers vary in individuals from 20 dog breeds and find strong breed-dependent patterns, indicating that the ability to digest starch varies both at the breed and individual level. Finally, to test whether AMY2B copy number is strongly associated with the risk of developing diabetes mellitus, we compare copy numbers in cases and controls as well as in breeds with varying diabetes susceptibility. Although we see no such association here, future studies using larger cohorts are needed before excluding a possible link between AMY2B and diabetes mellitus. PMID:24975239

  9. α-Amylase sensor based on the degradation of oligosaccharide hydrogel films monitored with a quartz crystal sensor.

    Science.gov (United States)

    Gibbs, Martin John; Biela, Anna; Krause, Steffi

    2015-05-15

    α-Amylase hydrolyses starch molecules to produce smaller oligosaccharides and sugars. Amylases are of great importance in biotechnology and find application in fermentation, detergents, food and the paper industry. The measurement of α-amylase activity in serum and urine has been used in the diagnosis of acute pancreatitis. Salivary amylase has also been shown to be a stress indicator. Sensor coatings suitable for the detection of α-amylase activity have been developed. Oligosaccharides such as glycogen and amylopectin were spin-coated onto gold coated quartz crystals with a base frequency of 10 MHz. The films were subsequently cross-linked with hexamethylene diisocyanate. Film degradation was monitored with a quartz crystal microbalance (QCM) and electrochemical impedance measurements. The films were shown to be stable in phosphate buffered saline (PBS). Addition of α-amylase to the solution resulted in the rapid degradation of the films. The maximum rate of degradation was found to be strongly dependent on the amylase activity in the range typically found in serum when diagnosing pancreatitis (0.08-8 U/ml). Sensor responses in serum were found to be very similar to those obtained in buffer indicating the absence of non-specific binding. PMID:25266253

  10. Molecular cloning and expression of two alpha-amylase genes from Streptococcus bovis 148 in Escherichia coli.

    Science.gov (United States)

    Satoh, E; Niimura, Y; Uchimura, T; Kozaki, M; Komagata, K

    1993-11-01

    The alpha-amylase genes of Streptococcus bovis 148 were cloned in Escherichia coli MC1061, using pBR322. The recombinant plasmids were classified into two groups on the basis of their restriction maps. Southern blot analysis did not show homology between the two types of alpha-amylase genes, and the two alpha-amylase genes existed on the chromosomal DNA of S. bovis 148. The enzymatic properties and N-terminal amino acid sequences of the two purified enzymes produced by the cloned E. coli strains were quite different from each other. Particularly, one alpha-amylase (Amy I) was adsorbed on raw corn starch and hydrolyzed raw corn starch, and another (Amy II) was not adsorbed on raw corn starch and did not hydrolyze raw corn starch. Amy I was considered to be the same as the extracellular alpha-amylase of S. bovis 148 in raw starch absorbability, ability to hydrolyze raw corn starch, enzymatic characteristics, N-terminal amino acid sequence, and mode of action on soluble starch. Amy II showed a unique pattern of oligosaccharide production from soluble starch compared with the extracellular alpha-amylase of S. bovis 148. Amy II was suggested to be an intracellular alpha-amylase of S. bovis 148. PMID:8285674

  11. Dual feeding strategy for the production of alpha-amylase by Bacillus caldolyticus using complex media.

    Science.gov (United States)

    Schwab, Karima; Bader, Johannes; Brokamp, Christian; Popović, Milan K; Bajpai, Rakesh; Berovic, Marin

    2009-10-01

    In this study, the objective was to investigate an exponential feeding strategy for fed-batch production of thermostable alpha-amylase (E.C. 3.2.1.1.) from the Bacillus caldolyticus (DSM405). The parameters for establishing compositions of feed media and feeding rate were obtained by statistical analysis of batch and continuous shake flask experiments. These parameters were casitone to starch ratio of 2.67g(casitone)g(starch)(-1), maintenance coefficient 0.174g(casitone)g(DW)(-1)h(-1), cell yield 0.62g(DW)g(casitone)(-1) and mu(opt)=0.2h(-1). The exponentially fed fermentation resulted in yield of 120Uml(-1) alpha-amylase that was thermostable up to 105 degrees C. Results of the exponentially fed fermentation have been discussed in the light of a feed-back controlled fed-batch fermentation reported earlier by the authors. A comparison of the temperature and pH effects on amylase produced by B. caldolyticus and on several other commercially available amylases has also been presented. PMID:19439206

  12. Pigment and amylase production in Penicillium sp NIOM-02 and its radical scavenging activity

    Digital Repository Service at National Institute of Oceanography (India)

    Dhale, M.A.; VijayRaj, A.S.

    scavenged 72-88% of DPPH radical. During solid-state fermentation on wheat (S1), the fungus produced more pigment (9.232 OD Units). Penicillium sp NIOM-02 grown on sugarcane bagasse scavenged 91% of DPPH radicals. It secreted more amylase (246 U mg sup(-1...

  13. Influence of carbon source on alpha-amylase production by Aspergillus oryzae.

    Science.gov (United States)

    Carlsen, M; Nielsen, J

    2001-10-01

    The influence of the carbon source on alpha-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol and acetate. A. oryzae did not grow on galactose as the sole carbon source, but galactose was co-metabolized together with glucose. Relative to that on low glucose concentration (below 10 mg/l), productivity was found to be higher during growth on maltose and maltodextrins, whereas it was lower during growth on sucrose, fructose, glycerol, mannitol and acetate. During growth on acetate there was no production of alpha-amylase, whereas addition of small amounts of glucose resulted in alpha-amylase production. A possible induction by alpha-methyl-D-glucoside during growth on glucose was also investigated, but this compound was not found to be a better inducer of a-amylase production than glucose. The results strongly indicate that besides acting as a repressor via the CreA protein, glucose acts as an inducer. PMID:11759683

  14. Expression of Vitreoscilla hemoglobin enhances growth and levels of alpha-amylase in Schwanniomyces occidentalis.

    Science.gov (United States)

    Suthar, Devesh H; Chattoo, Bharat B

    2006-08-01

    A metabolic engineering approach was exploited to improve growth and protein secretion in the non-conventional yeast, Schwanniomyces occidentalis. Vitreoscilla hemoglobin (VHb) gene was expressed in S. occidentalis under the control of the native alpha-amylase (AMY1) promoter. Expression of VHb was confirmed by reverse transcriptase polymerase chain reaction and Western blot hybridization analysis. Effect of VHb on growth and protein secretion was studied in synthetic medium under both limiting and non-limiting dissolved oxygen conditions. Under both conditions, VHb-expressing cells exhibited higher oxygen uptake and higher specific growth rates. Levels of extracellular alpha-amylase were also elevated in the VHb-transformed strain relative to the control strain. In amylase production medium, VHb-expressing cells showed 3-fold elevated levels of alpha-amylase and a 31% increase in the total secreted protein under oxygen-limiting environment. VHb was found to localize in the mitochondria in addition to its cytoplasmic location. Inhibition of respiration by antimycin A resulted in the loss of the growth-enhancing effects of VHb. A 2.5-fold increase in the cytochrome c oxidase (COX) activity was observed in VHb-expressing cells relative to the control. In addition to this, exogenously added VHb in the assay mixture augmented COX activity. PMID:16642333

  15. Characterization of two closely related α-amylase paralogs in the bark beetle, Ips typographus (L.)

    Czech Academy of Sciences Publication Activity Database

    Viktorinová, I.; Kučerová, Lucie; Böhmová, Marta; Henry, I.; Jindra, Marek; Doležal, Petr; Žurovcová, Martina; Žurovec, Michal

    2011-01-01

    Roč. 77, č. 4 (2011), s. 179-198. ISSN 0739-4462 EU Projects: European Commission(CZ) FP7/2007-2013 Institutional research plan: CEZ:AV0Z50070508 Keywords : bark beetle * intron polymorphism * α-amylase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.361, year: 2011

  16. Occurrence of toxicity among protease, amylase, and color mutants of a nontoxic soy sauce koji mold

    Energy Technology Data Exchange (ETDEWEB)

    Kalayanamitr, A.; Bhumiratana, A.; Flegel, T.W.; Glinsukon, T.; Shinmyo, A.

    1987-08-01

    A soy sauce koji mold, Aspergillus flavus var. columnaris Raper and Fennel (ATCC 44310), was treated with UV irradiation to obtain mutant strains possessing high protease activities, high amylase activities, and light-colored conidia. Selected mutant strains were tested for toxicity, and some were found acutely toxic to weanling rats, although all were negative for aflatoxin production.

  17. Serum-amylase - a semiquantitative indicator of exposure to ionizing radiation

    International Nuclear Information System (INIS)

    Earlier works by Kashima et al. and Chen et al. have shown that it might be possible to use the radiation induced activity changes in s-amylase as an indicator of exposure to ionizing radiation. It is the aim of our investigations to check and possibly make more precise the results these authors arrived at. (orig.)

  18. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    Science.gov (United States)

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  19. Kinetic Analysis of Amylase Using Quantitative Benedict's and Iodine Starch Reagents

    Science.gov (United States)

    Cochran, Beverly; Lunday, Deborah; Miskevich, Frank

    2008-01-01

    Quantitative analysis of carbohydrates is a fundamental analytical tool used in many aspects of biology and chemistry. We have adapted a technique developed by Mathews et al. using an inexpensive scanner and open-source image analysis software to quantify amylase activity using both the breakdown of starch and the appearance of glucose. Breakdown…

  20. The studies on radiation mutation breeding of Bacillus subtilis with high-yield of amylase

    International Nuclear Information System (INIS)

    The mutagenesis effects on the yield of amylase have been investigated with Bacillus subtilis irradiated by γ-rays and fast neutrons in once or twice irradiation at various dose rates and total irradiation doses. Several parameters such as flat transparent circle, colony diameter, transparent circle diameter and the ratio of flat transparent circle to colony diameter (HC) are used to estimate the radiation mutation of Bacillus subtilis. A series of results has been obtained as (1) Irradiation both with neutrons and γ-rays could make Bacillus subtilis mutationed to produce high-yield amylase effectively. (2) The average colony diameter of Bacillus subtilis irradiated by γ-rays or fast neutrons is smaller than that of control group at various total doses and dose rates. And their colony diameter becomes smaller slightly with the increment of γ-rays irradiation dose. (3) After the second neutrons irradiation, the values of average colony diameter, the biggest colony diameter, average transparent circle diameter and the biggest transparent circle diameter of all mutationed Bacillus subtilis exceed that of original strains greatly. (4) Three kinds of mutationed Bacillus subtilis strains with high-yield amylase have been screened out, in which two strains can produce high-yield amylase steadily after 15 times breeding. Their biggest colony diameter, the biggest transparent circle diameter and the biggest HC value are up to 8.32 mm, 22.38 mm and 5.39 respectively. (authors)

  1. Occurrence of toxicity among protease, amylase, and color mutants of a nontoxic soy sauce koji mold

    International Nuclear Information System (INIS)

    A soy sauce koji mold, Aspergillus flavus var. columnaris Raper and Fennel (ATCC 44310), was treated with UV irradiation to obtain mutant strains possessing high protease activities, high amylase activities, and light-colored conidia. Selected mutant strains were tested for toxicity, and some were found acutely toxic to weanling rats, although all were negative for aflatoxin production

  2. ALPHA-AMYLASE ACTIVITY IN VARIOUS CONCENTRATIONS OF THE IONIC LIQUID, 1-BUTYL-3-METHYLIMIDAZOLIUM CHLORIDE

    Science.gov (United States)

    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  3. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    Science.gov (United States)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  4. Effects of calcium ion concentration on starch hydrolysis of barley α-amylase isozymes

    DEFF Research Database (Denmark)

    Yuk, Jeong-Bin; Choi, Seung-Ho; Lee, Tae-Hee;

    2008-01-01

    Barley (x-amylase genes, amyl and amy2, were separately cloned into the expression vector of pPICZ alpha A and recombinant Pichia strains were established by homologous recombination. Both AMYs from Pichia shared almost identical hydrolysis patterns on short maltooligosaccharides to result in...

  5. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase

    Science.gov (United States)

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.

    2010-01-01

    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  6. Radiation immobilization of α-amylase on poly methyl methacrylate Pt. 2

    International Nuclear Information System (INIS)

    Bacterial α-amylase Bacillus substilis has been immobilized by the method of emulsion polymerization of methyl methacrylate initiated with γ60Co radiation; a product of high activity and stability has been obtained. Optimum process parameters have been established. (author)

  7. Validation of an assay for quantification of alpha-amylase in saliva of sheep.

    Science.gov (United States)

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-07-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep. PMID:27408332

  8. Radiation immobilization of α-amylase on poly methyl methacrylate Pt. 1

    International Nuclear Information System (INIS)

    The effect of γ60Co radiation on bacterial α-amylase Bacillus substilis and on the bacterial post-culture fluid has been studied. IR spectrum analysis has been carried out and the concentration of free radicals formed on irradiation and the degree on enzyme inactivation have been determined. (author)

  9. Enhancing Maritime Education and Training: Measuring a Ship Navigator's Stress Based on Salivary Amylase Activity

    Science.gov (United States)

    Murai, Koji; Wakida, Shin-Ichi; Miyado, Takashi; Fukushi, Keiichi; Hayashi, Yuji; Stone, Laurie C.

    2009-01-01

    Purpose: The purpose of this paper is to propose that the measurement of salivary amylase activity is an effective index to evaluate the stress of a ship navigator for safe navigation training and education. Design/methodology/approach: Evaluation comes from the simulator and actual on-board experiments. The subjects are real captains who have…

  10. Identification a Novel Raw-Starch-Degrading-α-Amylase from a Tropical Marine Bacterium

    Directory of Open Access Journals (Sweden)

    Zeily Nurachman

    2010-01-01

    Full Text Available Problem statement: Bacteria from the surface of the tropical marine hard coral Acropora sp. were screened for producing raw-starch-degrading-á-amylase. Approach: Based on its 16s rDNA sequence, a bacterium that produced the highest amylolitic activity was identified as Bacillus amyloliquifaciens ABBD. The bacterial isolate secreted a á-amylase extracellularly and then the enzyme was partially purified by ammonium sulfate precipitation followed by anion exchange chromatography. Results: Electrophoresis results both SDS-PAGE and native PAGE suggested that the enzyme was a heterodimeric protein (97 kDa consisting of 45 and 55 kDa subunits. The á-amylase had an optimum pH of 7.0 and temperature of 60°C. More than 80% activity of the enzyme was retained under high salt conditions (up to 20% NaCl. The enzyme remained stable at 50°C for 1 h. Starch hydrolysis by the enzyme at 70°C yielded oligosaccharides (G2-G4 and at room temperature yielded glucose/maltose (G1 and G2. Conclusion: The B. amyloliquifaciens ABBD á-amylase was capable of degrading various raw starch granules from corn, rice, cassava and sago at room temperature.

  11. How Do Detergents Work? A Qualitative Assay to Measure Amylase Activity

    Science.gov (United States)

    Novo, M. Teresa; Casanoves, Marina; Garcia-Vallvé, Santi; Pujadas, Gerard; Mulero, Miquel; Valls, Cristina

    2016-01-01

    We present a practical activity focusing on two main goals: to give learners the opportunity to experience how the scientific method works and to increase their knowledge about enzymes in everyday situations. The exercise consists of determining the amylase activity of commercial detergents. The methodology is based on a qualitative assay using a…

  12. Identification of amylase inhibitor deficient mutants in pigeonpea (Cajanus cajan (L.) Millisp.).

    Science.gov (United States)

    Chougule, N P; Giri, A P; Hivrale, V K; Chhabda, P J; Kachole, M S

    2004-06-01

    We have developed and analyzed several mutant lines (M6 generation) of pigeonpea (Cajanus cajan (L.) Millsp.) for the content of defensive proteins and antinutritional factors. Inhibitors of proteinase and of amylase, lectins, and raffinose family oligosaccharides were analyzed in mature seeds of different pigeonpea accessions (untreated) and compared with mutant lines. Proteinase inhibitor profiles were similar in terms of number and intensities of activity bands but they differ marginally in the activity units in pigeonpea accessions and mutants. Pigeonpea mutants showed significant differences in amylase inhibitor profiles as well as activity units from those of pigeonpea accessions. Interestingly, two mutants (A6-5-1 and A7-3-2) were identified to have absence of amylase inhibitor isoforms. Hemagglutinating activity and raffinose family oligosaccharides content were found to be significantly higher in mutants than in accessions. It is evident from the results that proteinase inhibitors of pigeonpea are stable while amylase inhibitors, lectins, and raffinose family oligosaccharides show altered expression upon mutagen treatments. These mutants will be ideal candidates for further evaluation. PMID:15260142

  13. Salivary alpha-amylase as a marker for stress response, caused by laryngoscopy and endotracheal intubation

    OpenAIRE

    Nataļja Jakušenko

    2011-01-01

    Salivary alpha-amylase as a marker for stress response, caused by laryngoscopy and endotracheal intubation Annotation Endotracheal intubation by the direct laryngoscopy during anaesthesia is the anaesthesiologists’ routine practice. Industries of medical technology are working at the manufacturing of alternative and much safer intubation appliances, for instance, firobronchoscope, videolaryngoscope, etc. In order to estimate various intubation appliances, one has to assess the pat...

  14. Salivary Amylase Level in Bronchoalveolar Fluid as a Marker of Chronic Pulmonary Aspiration in Children

    OpenAIRE

    Abu-Hasan, Mutasim; Elmallah, Mai; Neal, Dan; Brookes, James

    2014-01-01

    Background: Chronic pulmonary aspiration is a common cause of chronic respiratory symptoms in children. However, there is no gold standard diagnostic test for aspiration. In this study, we explore the diagnostic value of measuring salivary amylase in bronchoalveolar lavage (BAL) fluid as a marker of chronic aspiration in children with different chronic respiratory illnesses.

  15. Ontogeny of alpha-amylase circadian rhythms in rat parotid gland.

    Science.gov (United States)

    Sanz, E G; Vermouth, N T; Bellavia, S L

    1986-01-01

    The content of alpha-amylase (alpha-1,4-glucan-4-glucanohydrolase, EC 3.2.1.1.) and total soluble proteins of parotid glands (from rats exposed to a photoperiod of 14 hr light: 10 hr dark), have been determined every 2 or 3 hr over 24 hr periods in 15, 25 and 90-day-old rats. In 35-, 45- and 72-day-old rats, determinations were performed only at 0100 and 1400 hr. The alpha-amylase and total soluble protein contents from 90-day-old rats show a circadian variation, with a maximum value at 2200 hr and a minimum at 1400 hr. Parotids from 15- and 25-day-old rats also show a circadian rhythm. The minimum value is recorded at 0100 hr and the maximum at 1400 hr. At day 35 and after, there is an inversion of the amylase rhythm. In immature rats, it appears that alpha-amylase and soluble protein are under the influence of another synchronizer, whose timing is independent of that imposed by mastication of solid food. PMID:2878787

  16. Enhanced starch hydrolysis using α-amylase immobilized on cellulose ultrafiltration affinity membrane.

    Science.gov (United States)

    Konovalova, Viktoriia; Guzikevich, Kateryna; Burban, Anatoliy; Kujawski, Wojciech; Jarzynka, Karolina; Kujawa, Joanna

    2016-11-01

    In order to prepare ultrafiltration membranes possessing biocatalytic properties, α-amylase has been immobilized on cellulose membranes. Enzyme immobilization was based on a covalent bonding between chitosan and a surface of cellulose membrane, followed by an attachment of Cibacron Blue F3G-A dye as affinity ligand. Various factors affecting the immobilization process, such as enzyme concentration, pH of modifying solution, zeta-potential of membrane surface, and stability of immobilized enzyme were studied. The applicability of immobilized α-amylase has been investigated in ultrafiltration processes. The immobilization of α-amylase on membrane surface allows to increase the value of mass transfer coefficient and to decrease the concentration polarization effect during ultrafiltration of starch solutions. The enzyme layer on the membrane surface prevents a rapid increase of starch concentration due to the amylase hydrolysis of starch in the boundary layer. The presented affinity immobilization technique allows also for the regeneration of membranes from inactivated enzyme. PMID:27516322

  17. Evaluation of Ten Wild Nigerian Mushrooms for Amylase and Cellulase Activities

    OpenAIRE

    Jonathan, Segun Gbolagade; Adeoyo, Olusegun Richard

    2011-01-01

    Amylases and cellulases are important enzymes that can be utilized for various biological activities. Ten different wild Nigerian mushrooms (Agaricus blazei, Agaricus sp., Corilopsis occidentalis, Coriolus versicolor, Termitomyces clypeatus, Termitomyces globulus, Pleurotus tuber-regium, Podoscypha bolleana, Pogonomyces hydnoides, and Nothopanus hygrophanus) were assayed for production of these secondary metabolites. The results revealed that most of the tested wild fungi demonstrated very go...

  18. Optimization of Amylase Application in Raw Sugar Manufacture. Part II: Factory Trials

    Science.gov (United States)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to 85 de...

  19. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion.

    Science.gov (United States)

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng

    2015-11-01

    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits. PMID:25976786

  20. Improvement of Starch Digestion Using α-Amylase Entrapped in Pectin-Polyvinyl Alcohol Blend

    Directory of Open Access Journals (Sweden)

    Maurício Cruz

    2015-01-01

    Full Text Available Polyvinyl alcohol (PVA and pectin blends were used to entrap α-amylase (Termamyl using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25% on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM, tensile strength (TS, elongation, and rate of dissolution in water (pH 5.7, ruminal buffering solution (pH 7.0, and reactor containing 0.1 mol L−1 sodium phosphate buffer (pH 6.5, were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h, in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications.

  1. Scandium Stimulates the Production of Amylase and Bacilysin in Bacillus subtilis▿

    OpenAIRE

    Inaoka, Takashi; Ochi, Kozo

    2011-01-01

    We investigated the effects of rare earth elements on enzyme production and secondary metabolism in Bacillus subtilis. Addition of scandium to the growth medium stimulated the production of both amylase and bacilysin at the transcriptional level, thus showing scandium to have a remarkable impact in B. subtilis.

  2. A calorimetric study of solute effects on the kinetic stability of alpha-amylase

    DEFF Research Database (Denmark)

    Olsen, Søren Nymand; Andersen, Kim Bruno; Øgendal, Lars Holm;

    2009-01-01

    In this study we evaluated the applications of isothermal titration calorimetry (ITC) to Study solute effects on the kinetics of irreversible protein denaturation. More specifically, denaturation of Bacillus Halmapalus alpha-amylase (BHA) was initiated by addition of EDTA to the calorimetric cell...

  3. Comparative study on production of α-Amylase from Bacillus licheniformis strains

    Directory of Open Access Journals (Sweden)

    Dibu Divakaran

    2011-12-01

    Full Text Available Alpha amylase (α-1, 4-glucan-glucanhydrolase, EC 3.2.1.1, an extracellular enzyme, degrades α, 1-4 glucosidic linkages of starch and related substrates in an endo-fashion producing oligosaccharides including maltose, glucose and alpha limit dextrin (7. The present study deals with the production and comparative study of production of α-amylase from two strains of Bacillus licheniformis, MTCC 2617 and 2618, by using four different substrates, starch, rice, wheat and ragi powder as carbon source by submerged fermentation. The effect of varying pH and incubation temperature, activator, inhibitor, and substrate concentration was investigated on the activity of α-amylase produced by MTCC strain 2618. The results shows that the production of the α-amylase by the B.licheniformis strain MTCC 2618, using four different substrates were found to be maximum (Starch 3.64 IU/ml/minutes, Rice powder 2.93 IU/ml/minutes, Wheat powder 2.67 IU/ml/minutes, Ragi powder 2.36 IU/ml/minutes on comparing the enzyme production of two strains. It was also observed that the maximum production was found on the 3rd day (i.e. 72 hr and characterization of crude enzyme revealed that optimum activity was at pH 7 and 37ºC.

  4. Partial characterization of cold active amylases and proteases of Streptomyces sp. from Antarctica

    Directory of Open Access Journals (Sweden)

    Mihaela Cotârleţ

    2011-09-01

    Full Text Available The aim of this study was to isolate novel enzyme-producing bacteria from vegetation samples from East Antarctica and also to characterize them genetically and biochemically in order to establish their phylogeny. The ability to grow at low temperature and to produce amylases and proteases cold-active was also tested. The results of the 16S rRNA gene sequence analysis showed that the 4 Alga rRNA was 100% identical to the sequences of Streptomyces sp. rRNA from Norway and from the Solomon Islands. The Streptomyces grew well in submerged system at 20ºC, cells multiplication up to stationary phase being drastically increased after 120 h of submerged cultivation. The beta-amylase production reached a maximum peak after seven days, while alpha-amylase and proteases were performing biosynthesis after nine days of submerged cultivation at 20ºC. Newly Streptomyces were able to produce amylase and proteases in a cold environment. The ability to adapt to low temperature of these enzymes could make them valuable ingredients for detergents, the food industry and bioremediation processes which require low temperatures.

  5. Halotolerant Ability and α-Amylase Activity of Some Saltwater Fungal Isolates

    Science.gov (United States)

    Niknejad, Farhad; Moshfegh, Mahsa; Najafzadeh, Mohammad Javad; Houbraken, Jos; Rezaei, Shahla; Zarrini, Gholamreza; Faramarzi, Mohammad Ali; Nafissi-Varcheh, Nastaran

    2013-01-01

    Four halotolerant fungal isolates originating from the saltwater Lake Urmia in Iran were selected during a screening program for salt resistance and α-amylase activity. The isolates were identified based on sequencing the ITS region and a part of the β-tubulin gene, as Penicillium chrysogenum (isolate U1; CBS 132820), Fusarium incarnatum (isolate U2; CBS 132821), and Penicillium polonicum (isolate U3; CBS 132822, and isolate U4; CBS 132823). The growth of these isolates was determined by measuring the colony diameter and mycelia dry weight in Sabouraud dextrose agar and yeast nitrogen base medium supplemented with NaCl, KCl, and LiCl. Isolate U4 showed a growth up in 15% NaCl and U1 was the only isolate that could grow in 20% KCl. None of the strains grew in a media containing LiCl. The salt supplemented medium did not increase the size of colony diameter in all isolates (p > 0.05). The ability of the selected isolates for amylase production was quantitatively tested and showed that P. polonicum isolate U4 was the most potent producer of amylase with a yield of 260.9 U/L after 60 h, whereas P. polonicum isolate U3 was the lowest one with a production level of 97.9 U/L after 48 h. P. polonicum isolate U4 could be a suitable candidate for production of amylase on an industrial scale after optimization. PMID:24250679

  6. Halotolerant ability and α-amylase activity of some saltwater fungal isolates

    NARCIS (Netherlands)

    Niknejad, F.; Moshfegh, M.; Najafzadeh, M.J.; Houbraken, J.; Rezaei, S.; Zarrini, G.; Faramarzi, M.A.; Nafissi-Varcheh, N.

    2013-01-01

    Four halotolerant fungal isolates originating from the saltwater Lake Urmia in Iran were selected during a screening program for salt resistance and α-amylase activity. The isolates were identified based on sequencing the ITS region and a part of the β-tubulin gene, as Penicillium chrysogenum (iso

  7. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase

    Science.gov (United States)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  8. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.

    Science.gov (United States)

    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana

    2016-06-01

    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing. PMID:27085017

  9. Extraction and purification of beta-amylase from stems of Abrus precatorius by three phase partitioning.

    Science.gov (United States)

    Sagu, Sorel Tchewonpi; Nso, Emmanuel Jong; Homann, Thomas; Kapseu, César; Rawel, Harshadrai M

    2015-09-15

    The stems of Abrus precatorius were used to extract a beta-amylase enriched fraction. A three phase partitioning method and a Doehlert design with 3 variables (ratio of crude extract/t-butanol, the ammonium sulphate saturation and pH) were used. The data was fitted in a second-order polynomial model and the parameters were optimized to enrich beta-amylase. Experimental responses for the modulation were recovery of activity and the purification factor. The optimal conditions were: a ratio of crude extract/t-butanol of 0.87 (v/v), saturation in ammonium sulphate of 49.46% (w/v) and a pH of 5.2. An activity recovery of 156.2% and a purification factor of 10.17 were found. The enriched enzyme was identified as a beta-amylase and its molecular weight was 60.1kDa. Km and Vmax values were 79.37mg/ml and 5.13U/ml, respectively and the highest activity was registered at a temperature of 70°C and a pH between 6 and 6.5. A significant stabilization of the beta-amylase was observed up to 65°C. PMID:25863622

  10. Amy63, a novel type of marine bacterial multifunctional enzyme possessing amylase, agarase and carrageenase activities

    Science.gov (United States)

    Liu, Ge; Wu, Shimei; Jin, Weihua; Sun, Chaomin

    2016-01-01

    A multifunctional enzyme is one that performs multiple physiological functions, thus benefiting the organism. Characterization of multifunctional enzymes is important for researchers to understand how organisms adapt to different environmental challenges. In the present study, we report the discovery of a novel multifunctional enzyme Amy63 produced by marine bacterium Vibrio alginolyticus 63. Remarkably, Amy63 possesses amylase, agarase and carrageenase activities. Amy63 is a substrate promiscuous α-amylase, with the substrate priority order of starch, carrageenan and agar. Amy63 maintains considerable amylase, carrageenase and agarase activities and stabilities at wide temperature and pH ranges, and optimum activities are detected at temperature of 60 °C and pH of 6.0, respectively. Moreover, the heteroexpression of Amy63 dramatically enhances the ability of E. coli to degrade starch, carrageenan and agar. Motif searching shows three continuous glycosyl hydrolase 70 (GH70) family homologs existed in Amy63 encoding sequence. Combining serial deletions and phylogenetic analysis of Amy63, the GH70 homologs are proposed as the determinants of enzyme promiscuity. Notably, such enzymes exist in all kingdoms of life, thus providing an expanded perspective on studies of multifunctional enzymes. To our knowledge, this is the first report of an amylase having additional agarase and carrageenase activities. PMID:26725302

  11. Proteinase, amylase, and proteinase-inhibitor activities in the gut of six cockroach species

    Czech Academy of Sciences Publication Activity Database

    Vinokurov, Konstantin; Taranushenko, Yuliya; Krishnan, Natraj; Sehnal, František

    2007-01-01

    Roč. 53, - (2007), s. 794-802. ISSN 0022-1910 R&D Projects: GA ČR(CZ) GA522/06/1591; GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50070508 Keywords : amylases * Blattodea * gut pH Subject RIV: CE - Biochemistry Impact factor: 2.294, year: 2007

  12. In silico approach for alpha-amylase inhibitory activity of diosmetin and galangin

    Directory of Open Access Journals (Sweden)

    Arumugam Madeswaran

    2014-10-01

    Full Text Available Objective: The objective of the current study is to evaluate the α-amylase inhibitory activity of diosmetin and galangin using in silico docking studies.Methods: In this perspective, diosmetin and galangin were prepared for the docking evaluation. Acarbose, a known α-amylase inhibitor was used as the standard. In silico docking studies were carried out using recent version of AutoDock 4.2, which has the basic principle of Lamarckian genetic algorithm.Results: The results showed that the selected flavonoids showed binding energy ranging between -6.84 kcal/mol to  -5.96 kcal/mol when compared with that of the standard (-1.97 kcal/mol. Inhibition constant (9.73 µM to 42.76 µM and intermolecular energy (-8.33 kcal/mol to -7.15 kcal/mol of the ligands also coincide with the binding energy.Conclusion: Diosmetin and galangin contributed excellent α-amylase inhibitory activity than the standard because of its structural parameters. These molecular docking analyses of the selected compounds could lead to the further development to find the potent α-amylase inhibitors for the treatment of diabetes.  

  13. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    Directory of Open Access Journals (Sweden)

    Gaurav Sapra

    2013-01-01

    Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations.

  14. Purification and characterization of the extracellular alpha-amylase from Streptococcus bovis JB1.

    Science.gov (United States)

    Freer, S N

    1993-05-01

    The extracellular alpha-amylase (1,4-alpha-D-glucanglucanohydrolase; EC 3.2.1.1) from maltose-grown Streptococcus bovis JB1 was purified to apparent homogeneity by ion-exchange chromatography (Mono Q). The enzyme had an isoelectric point of 4.50 and an apparent molecular mass of 77,000 Da, as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme was rich in acidic and hydrophobic amino acids. The 15-amino-acid NH2-terminal sequence was 40% homologous with the Bacillus subtilis saccharifying alpha-amylase and 27% homologous with the Clostridium acetobutylicum alpha-amylase. alpha-Amylase activity on soluble starch was optimal at pH 5.0 to 6.0. The enzyme was relatively stable between pH 5.5 and 8.5 and at temperatures below 50 degrees C. When soluble potato starch was used as the substrate, the enzyme had a Km of 0.88 mg.ml-1 and a kcat of 2,510 mumol of reducing sugar.min-1.mg of protein-1. The enzyme exhibited neither pullulanase nor dextranase activity and was 40 to 70% as active on amylopectin as on amylose. The major end products of amylose hydrolysis were maltose, maltotriose, and maltotetraose. PMID:8517735

  15. Characterization of a Digestive α-Amylase in the Midgut of Pieris brassicae L. (Lepidoptera: Pieridae).

    Science.gov (United States)

    Sharifloo, Ali; Zibaee, Arash; Sendi, Jalal J; Jahroumi, Khalil Talebi

    2016-01-01

    The current study deals with a digestive α-amylase in the larvae of Pieris brassicae L. through purification, enzymatic characterization, gene expression, and in vivo effect of a specific inhibitor, Acarbose. Although α-amylase activity was the highest in the whole gut homogenate of larvae but compartmentalization of amylolytic activity showed an equal activity in posterior midgut (PM) and anterior midgut (AM). A three step purification using ammonium sulfate, Sepharyl G-100 and DEAE-Cellulose Fast flow revealed an enzyme with a specific activity of 5.18 U/mg, recovery of 13.20, purification fold of 19.25 and molecular weight of 88 kDa. The purified α-amylase had the highest activity at optimal pH and temperature of 8 and 35°C. Also, the enzyme had V max values of 4.64 and 3.02 U/mg protein and K m values of 1.37 and 1.74% using starch and glycogen as substrates, respectively. Different concentrations of acarbose, ethylenediamine tetraacetic acid, and ethylene glycol-bis (β-aminoethylether) N, N, N', N'-tetraacetic acid significantly decreased activity of the purified α-amylase. The 4th instar larvae of P. brassicae were fed on the treated leaves of Raphanus sativus L. with 0.22 mM of Acarbose to find in vivo effects on nutritional indices, α-amylase activity, and gene expression. The significant differences were only found in conversion efficiency of digested food, relative growth rate, and metabolic cost of control and fed larvae on Acarbose. Also, amylolytic activity significantly decreased in the treated larvae by both biochemical and native-PAGE experiments. Results of RT-PCR revealed a gene with 621 bp length responsible for α-amylase expression that had 75% identity with Papilio xuthus and P. polytes. Finally, qRT-PCR revealed higher expression of α-amylase in control larvae compared to acarbose-fed ones. PMID:27014094

  16. Characterization of a Digestive α-Amylase in the Midgut of Pieris brassicae L. (Lepidoptera: Pieridae)

    Science.gov (United States)

    Sharifloo, Ali; Zibaee, Arash; Sendi, Jalal J.; Jahroumi, Khalil Talebi

    2016-01-01

    The current study deals with a digestive α-amylase in the larvae of Pieris brassicae L. through purification, enzymatic characterization, gene expression, and in vivo effect of a specific inhibitor, Acarbose. Although α-amylase activity was the highest in the whole gut homogenate of larvae but compartmentalization of amylolytic activity showed an equal activity in posterior midgut (PM) and anterior midgut (AM). A three step purification using ammonium sulfate, Sepharyl G-100 and DEAE-Cellulose Fast flow revealed an enzyme with a specific activity of 5.18 U/mg, recovery of 13.20, purification fold of 19.25 and molecular weight of 88 kDa. The purified α-amylase had the highest activity at optimal pH and temperature of 8 and 35°C. Also, the enzyme had Vmax values of 4.64 and 3.02 U/mg protein and Km values of 1.37 and 1.74% using starch and glycogen as substrates, respectively. Different concentrations of acarbose, ethylenediamine tetraacetic acid, and ethylene glycol-bis (β-aminoethylether) N, N, N′, N′-tetraacetic acid significantly decreased activity of the purified α-amylase. The 4th instar larvae of P. brassicae were fed on the treated leaves of Raphanus sativus L. with 0.22 mM of Acarbose to find in vivo effects on nutritional indices, α-amylase activity, and gene expression. The significant differences were only found in conversion efficiency of digested food, relative growth rate, and metabolic cost of control and fed larvae on Acarbose. Also, amylolytic activity significantly decreased in the treated larvae by both biochemical and native-PAGE experiments. Results of RT-PCR revealed a gene with 621 bp length responsible for α-amylase expression that had 75% identity with Papilio xuthus and P. polytes. Finally, qRT-PCR revealed higher expression of α-amylase in control larvae compared to acarbose-fed ones. PMID:27014094

  17. A simple one pot purification of bacterial amylase from fermented broth based on affinity toward starch-functionalized magnetic nanoparticle.

    Science.gov (United States)

    Paul, Tanima; Chatterjee, Saptarshi; Bandyopadhyay, Arghya; Chattopadhyay, Dwiptirtha; Basu, Semanti; Sarkar, Keka

    2015-08-18

    Surface-functionalized adsorbant particles in combination with magnetic separation techniques have received considerable attention in recent years. Selective manipulation on such magnetic nanoparticles permits separation with high affinity in the presence of other suspended solids. Amylase is used extensively in food and allied industries. Purification of amylase from bacterial sources is a matter of concern because most of the industrial need for amylase is met by microbial sources. Here we report a simple, cost-effective, one-pot purification technique for bacterial amylase directly from fermented broth of Bacillus megaterium utilizing starch-coated superparamagnetic iron oxide nanoparticles (SPION). SPION was prepared by co-precipitation method and then functionalized by starch coating. The synthesized nanoparticles were characterized by transmission electron microscopy (TEM), a superconducting quantum interference device (SQUID, zeta potential, and ultraviolet-visible (UV-vis) and Fourier-transform infrared (FTIR) spectroscopy. The starch-coated nanoparticles efficiently purified amylase from bacterial fermented broth with 93.22% recovery and 12.57-fold purification. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) revealed that the molecular mass of the purified amylase was 67 kD, and native gel showed the retention of amylase activity even after purification. Optimum pH and temperature of the purified amylase were 7 and 50°C, respectively, and it was stable over a range of 20°C to 50°C. Hence, an improved one-pot bacterial amylase purification method was developed using starch-coated SPION. PMID:24840788

  18. Production and immobilization of alpha amylase using biotechnology techniques for use in biological and medical applications

    International Nuclear Information System (INIS)

    The immobilized enzymes on polymeric supports are prepared for purpose of repeated use and the possibilities of continuous reaction system. One of the most important properties is the stability of proteins when they are used in some medical and industrial applications. The immobilization of the enzymes improves this property as well as many other properties.In this study, alpha amylase was purified and immobilized onto two different polymers. α- amylase was used in this study for its biological and industrial applications. It is used in paper textile, pharmaceutical applications, food, and detergent industries. α- amylase was found in plants, animals, and microorganisms. Purification of α-amylase from microorganisms is the main source of α-amylase because it was excreted from many bacteria and fungi. In this study, α-amylase was purified from Aspergillus niger. Fractional precipitation of the α- amylase produced by A. niger with 80% ammonium sulphate saturation. The crude enzyme was applied on column chromatography packed with Sephadex G 100 for purification. The active eluents containing partially purified enzyme were collected for further investigation. The specific activity of α-amylase was (34.9 U/mg) which was corresponding to 2.09 fold purification for the tested organism. The purified α-amylase was immobilized by entrapment method into two types of polymers. One of them was natural consist of chitosan and alginate. The other polymer was synthetic consist of N- isopropyl acrylamide and alginate. The temperature optimum and thermal inactivation showed a severe loss in the activity of the free enzymes, while the temperature profile of the immobilized enzymes was much broader at higher temperatures demonstrating the effectiveness of the polymer protecting the enzymes. Also, the immobilized enzymes (natural polymer and synthetic polymer) showed higher thermal stability. Optimum ph and stability showed that immobilization of enzymes resulted in more

  19. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    OpenAIRE

    Uozumi, N; Sakurai, K.(Theoretical Particle Physics and Cosmology Group, Department of Physics, King’s College London, WC2R 2LS, London, UK); Sasaki, T.; Takekawa, S.; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...

  20. NMR-based metabolomics for identification of α-amylase inhibitors in rowan berries (Sorbus spp.)

    DEFF Research Database (Denmark)

    Broholm, Sofie L.; Gramsbergen, Simone; Nyberg, Nils;

    Type 2 diabetes is a metabolic disorder estimated to affect millions of people all over the world.1 One way of reducing diabetes-related complications is to control postprandial glucose.2 Inhibition of the carbohydrate digestive enzyme α-amylase is a therapeutic target for maintaining low blood...... glucose levels. A study from 2011 shows that berries from Sorbus spp (rowan berries) effectively inhibit α-amylase activity and suggests that the active compounds are proanthocyanidins.3 The aim of this project is to identify the rowan berry species with highest α-amylase inhibitory activity - and to find...

  1. Mutational analysis of target enzyme recognition of the beta-trefoil fold barley alpha-amylase/subtilisin inhibitor

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine; Nielsen, Per K.; Abou Hachem, Maher;

    2005-01-01

    The barley alpha-amylase/subtilisin inhibitor ( BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics of...

  2. Purification and Characterization of a Maltotetraose-Forming Alkaline (alpha)-Amylase from an Alkalophilic Bacillus Strain, GM8901

    OpenAIRE

    Kim, T U; Gu, B. G.; Jeong, J Y; Byun, S. M.; Shin, Y. C.

    1995-01-01

    An alkalophilic bacterium, Bacillus sp. strain GM8901, grown at pH 10.5 and 50(deg)C, produced five alkaline amylases in culture broth. At an early stage of the bacterial growth, amylase I (Amyl I) was produced initially and then, as cultivation progressed, four alkaline amylases, Amyl II, Amyl III, Amyl IV, and Amyl V, were produced from proteolytic degradation of Amyl I. A serine protease present in the culture medium was believed to be involved in Amyl I degradation. We purified Amyl I fro...

  3. Engineering α-amylase levels in wheat grain suggests a highly sophisticated level of carbohydrate regulation during development

    OpenAIRE

    Whan, Alex; Dielen, Anne-Sophie; Mieog, Jos; Bowerman, Andrew F.; Robinson, Hannah M.; Byrne, Keren; Colgrave, Michelle; Larkin, Philip J.; Howitt, Crispin A; Morell, Matthew K.; Ral, Jean-Philippe

    2014-01-01

    Wheat starch degradation requires the synergistic action of different amylolytic enzymes. Our spatio-temporal study of wheat α-amylases throughout grain development shows that AMY3 is the most abundant isoform compared with the other known α-amylases. Endosperm-specific over-expression of AMY3 resulted in an increase of total α-amylase activity in harvested grains. Unexpectedly, increased activity did not have a significant impact on starch content or composition but led to an increase of sol...

  4. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.

    OpenAIRE

    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T.; Yamagata, H.; Tsukagoshi, N; Udaka, S

    1987-01-01

    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtili...

  5. Molecular cloning and expression of two alpha-amylase genes from Streptococcus bovis 148 in Escherichia coli.

    OpenAIRE

    Satoh, E; Niimura, Y; UCHIMURA,T; Kozaki, M; Komagata, K

    1993-01-01

    The alpha-amylase genes of Streptococcus bovis 148 were cloned in Escherichia coli MC1061, using pBR322. The recombinant plasmids were classified into two groups on the basis of their restriction maps. Southern blot analysis did not show homology between the two types of alpha-amylase genes, and the two alpha-amylase genes existed on the chromosomal DNA of S. bovis 148. The enzymatic properties and N-terminal amino acid sequences of the two purified enzymes produced by the cloned E. coli stra...

  6. Engineering high α-amylase levels in wheat grain lowers Falling Number but improves baking properties.

    Science.gov (United States)

    Ral, Jean-Philippe; Whan, Alex; Larroque, Oscar; Leyne, Emmett; Pritchard, Jeni; Dielen, Anne-Sophie; Howitt, Crispin A; Morell, Matthew K; Newberry, Marcus

    2016-01-01

    Late maturity α-amylase (LMA) and preharvest sprouting (PHS) are genetic defects in wheat. They are both characterized by the expression of specific isoforms of α-amylase in particular genotypes in the grain prior to harvest. The enhanced expression of α-amylase in both LMA and PHS results in a reduction in Falling Number (FN), a test of gel viscosity, and subsequent downgrading of the grain, along with a reduced price for growers. The FN test is unable to distinguish between LMA and PHS; thus, both defects are treated similarly when grain is traded. However, in PHS-affected grains, proteases and other degradative process are activated, and this has been shown to have a negative impact on end product quality. No studies have been conducted to determine whether LMA is detrimental to end product quality. This work demonstrated that wheat in which an isoform α-amylase (TaAmy3) was overexpressed in the endosperm of developing grain to levels of up to 100-fold higher than the wild-type resulted in low FN similar to those seen in LMA- or PHS-affected grains. This increase had no detrimental effect on starch structure, flour composition and enhanced baking quality, in small-scale 10-g baking tests. In these small-scale tests, overexpression of TaAmy3 led to increased loaf volume and Maillard-related browning to levels higher than those in control flours when baking improver was added. These findings raise questions as to the validity of the assumption that (i) LMA is detrimental to end product quality and (ii) a low FN is always indicative of a reduction in quality. This work suggests the need for a better understanding of the impact of elevated expression of specific α-amylase on end product quality. PMID:26010869

  7. Remarkable evolutionary relatedness among the enzymes and proteins from the α-amylase family.

    Science.gov (United States)

    Janeček, Štefan; Gabriško, Marek

    2016-07-01

    The α-amylase is a ubiquitous starch hydrolase catalyzing the cleavage of the α-1,4-glucosidic bonds in an endo-fashion. Various α-amylases originating from different taxonomic sources may differ from each other significantly in their exact substrate preference and product profile. Moreover, it also seems to be clear that at least two different amino acid sequences utilizing two different catalytic machineries have evolved to execute the same α-amylolytic specificity. The two have been classified in the Cabohydrate-Active enZyme database, the CAZy, in the glycoside hydrolase (GH) families GH13 and GH57. While the former and the larger α-amylase family GH13 evidently forms the clan GH-H with the families GH70 and GH77, the latter and the smaller α-amylase family GH57 has only been predicted to maybe define a future clan with the family GH119. Sequences and several tens of enzyme specificities found throughout all three kingdoms in many taxa provide an interesting material for evolutionarily oriented studies that have demonstrated remarkable observations. This review emphasizes just the three of them: (1) a close relatedness between the plant and archaeal α-amylases from the family GH13; (2) a common ancestry in the family GH13 of animal heavy chains of heteromeric amino acid transporter rBAT and 4F2 with the microbial α-glucosidases; and (3) the unique sequence features in the primary structures of amylomaltases from the genus Borrelia from the family GH77. Although the three examples cannot represent an exhaustive list of exceptional topics worth to be interested in, they may demonstrate the importance these enzymes possess in the overall scientific context. PMID:27154042

  8. Are salivary amylase and pH – Prognostic indicators of cancers?

    Science.gov (United States)

    Ramya, Atmakuri Shanmukha; Uppala, Divya; Majumdar, Sumit; Surekha, Ch.; Deepak, K.G.K.

    2015-01-01

    Background Saliva, “Mirror of body's health” has long been of particular interest as a substitute for blood for disease diagnosis and monitoring. The radiation effects on salivary glands are of particular interest in which salivary amylase is a good indicator of salivary glands function. Thus, estimation of these parameters represents a reasonable approach in evaluation of patient's risk for disease occurrence, intensity and prognosis. Aim of study To evaluate and compare the pH and amylase levels in saliva of cancer patients prior to treatment, patients during treatment. Materials and methods Saliva samples of 90 individuals were taken which were divided into 3 groups - 30 individuals without cancer, 30 cancer patients prior treatment and 30 cancer patients during treatment. Materials used were pH strips and pH meter, Salivary Amylase assay. Results Statistical analysis – ANOVA with post-hoc Tukey's test. 1) Significant decrease in salivary amylase levels – in cancer patients, during treatment when compared to others. 2) Significant decrease in salivary pH levels in newly diagnosed cancer patients prior to treatment. Conclusion To conclude, pH strips and pH meter showed to be a useful tool in the measurement of pH of saliva in individuals with and without cancer. This study showed that cancer patients without treatment have a lower pH of saliva. Treatment increased the pH of the saliva to a more alkaline level whereas amylase levels decreased in those subjects. Therefore those parameters can be an area of further research with an increased sample size, which in-turn may help in opening the doors for new dimension in non invasive prognostic markers. PMID:26258019

  9. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    Science.gov (United States)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  10. Disruption of amylase genes by RNA interference affects reproduction in the Pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Huvet, Arnaud; Béguel, Jean-Philippe; Cavaleiro, Nathalia Pereira; Thomas, Yoann; Quillien, Virgile; Boudry, Pierre; Alunno-Bruscia, Marianne; Fabioux, Caroline

    2015-06-01

    Feeding strategies and digestive capacities can have important implications for variation in energetic pathways associated with ecological and economically important traits, such as growth or reproduction in bivalve species. Here, we investigated the role of amylase in the digestive processes of Crassostrea gigas, using in vivo RNA interference. This approach also allowed us to investigate the relationship between energy intake by feeding and gametogenesis in oysters. Double-stranded (ds)RNA designed to target the two α-amylase genes A and B was injected in vivo into the visceral mass of oysters at two doses. These treatments caused significant reductions in mean mRNA levels of the amylase genes: -50.7% and -59% mRNA A, and -71.9% and -70.6% mRNA B in 15 and 75 µg dsRNA-injected oysters, respectively, relative to controls. Interestingly, reproductive knock-down phenotypes were observed for both sexes at 48 days post-injection, with a significant reduction of the gonad area (-22.5% relative to controls) and germ cell under-proliferation revealed by histology. In response to the higher dose of dsRNA, we also observed reductions in amylase activity (-53%) and absorption efficiency (-5%). Based on these data, dynamic energy budget modeling showed that the limitation of energy intake by feeding that was induced by injection of amylase dsRNA was insufficient to affect gonadic development at the level observed in the present study. This finding suggests that other driving mechanisms, such as endogenous hormonal modulation, might significantly change energy allocation to reproduction, and increase the maintenance rate in oysters in response to dsRNA injection. PMID:25883379

  11. β-amylase 1 (BAM1) degrades transitory starch to sustain proline biosynthesis during drought stress.

    Science.gov (United States)

    Zanella, Martina; Borghi, Gian Luca; Pirone, Claudia; Thalmann, Matthias; Pazmino, Diana; Costa, Alex; Santelia, Diana; Trost, Paolo; Sparla, Francesca

    2016-04-01

    During photosynthesis of higher plants, absorbed light energy is converted into chemical energy that, in part, is accumulated in the form of transitory starch within chloroplasts. In the following night, transitory starch is mobilized to sustain the heterotrophic metabolism of the plant. β-amylases are glucan hydrolases that cleave α-1,4-glycosidic bonds of starch and release maltose units from the non-reducing end of the polysaccharide chain. In Arabidopsis, nocturnal degradation of transitory starch involves mainly β-amylase-3 (BAM3). A second β-amylase isoform, β-amylase-1 (BAM1), is involved in diurnal starch degradation in guard cells, a process that sustains stomata opening. However, BAM1 also contributes to diurnal starch turnover in mesophyll cells under osmotic stress. With the aim of dissecting the role of β-amylases in osmotic stress responses in Arabidopsis, mutant plants lacking either BAM1 or BAM3 were subject to a mild (150mM mannitol) and prolonged (up to one week) osmotic stress. We show here that leaves of osmotically-stressed bam1 plants accumulated more starch and fewer soluble sugars than both wild-type and bam3 plants during the day. Moreover, bam1 mutants were impaired in proline accumulation and suffered from stronger lipid peroxidation, compared with both wild-type and bam3 plants. Taken together, these data strongly suggest that carbon skeletons deriving from BAM1 diurnal degradation of transitory starch support the biosynthesis of proline required to face the osmotic stress. We propose the transitory-starch/proline interplay as an interesting trait to be tackled by breeding technologies aimingto improve drought tolerance in relevant crops. PMID:26792489

  12. A rapid response of beta-amylase to nitric oxide but not gibberellin in wheat seeds during the early stage of germination.

    Science.gov (United States)

    Zhang, Hua; Shen, Wen-Biao; Zhang, Wei; Xu, Lang-Lai

    2005-03-01

    The effects of nitric oxide (NO) and gibberellic acid (GA(3)) on the responses of amylases in wheat (Triticum aestivum L.) seeds (caryopses) were investigated during the first 12 h of germination. GA(3) had no effects on the activities of alpha-amylase (EC 3.2.1.1) or beta-amylase (EC 3.2.1.2), either in intact seeds or embryoless halves within 12 h. In contrast, addition of sodium nitroprusside (SNP), an NO donor, was able to induce a rapid increase in beta-amylase activity without affecting alpha-amylase. Furthermore, the rapid response of beta-amylase to SNP in wheat seeds could be attributed to NO and was approximately dose-dependent. Some other aspects of SNP induction of amylase isozymes were also characterized. Further investigations showed that SNP might play an interesting role in the dissociation of free beta-amylase from small homopolymers or heteropolymers. Furthermore, SNP also directly induced the release of bound beta-amylase from glutenin and its crude enzyme preparation. However, the slight increase in protease also induced by SNP might not be responsible for this action. Interestingly, based on the fact that the rapid response of beta-amylase to NO also existed in seeds of other species, such as barley, soybean, rice and watermelon, it might be a universal event in early seed germination. PMID:15517355

  13. Physiological characterisation of recombinant Aspergillus nidulans strains with different creA genotypes expressing A-oryzae alpha-amylase

    DEFF Research Database (Denmark)

    Agger, Teit; Petersen, J.B.; O'Connor, S.M.; Murphy, R.L.; Kelly, J.M.; Nielsen, Jette

    2002-01-01

    The physiology of three strains of Aspergillus nidulans was examined-a creA deletion strain, a wild type creA genotype and a strain containing extra copies of the creA gene, all producing Aspergillus oryzae alpha-amylase. The strains were cultured in batch and continuous cultivations and the...... biomass formation and alpha-amylase production was characterised. Overexpression of the creA gene resulted in a lower maximum specific growth rate and a slightly higher repression of the alpha-amylase production during conditions with high glucose concentration. No expression of creA also resulted in a...... sources on the alpha-amylase production in the creA deletion strain was investigated and it was found that starch was the best inducer. The degree of induction by starch increased almost linearly with the concentration of starch in starch/glucose mixtures. High-density batch cultivation was performed with...

  14. EFFECT OF GAMMA IRRADIATION AND ENVIRONMENTAL FACTORS ON -AMYLASE PRODUCTION BY ASPERGILLUS NIGER AND ASPERGILLUS ORYZAE FROM SOME AGRICULTURAL WASTES

    International Nuclear Information System (INIS)

    Amylases are one of the most important and oldest industrial enzymes. The optimization of production of α -amylase from Aspergillus niger and Aspergillus oryzae fungi, using different agro-wastes as sole carbon sources, was performed. The highest productivity of α -amylase by the two organisms was recorded at pH 6 and incubation temperature at 300C when the two organisms were grown on potato peels (PPs) and/or wheat straw (Ws) after days of cultivation. Pre-treated PPs and Ws with 20 kGy gave the best enzyme productivity by the two organisms compared with untreated ones. Also, exposing the inoculums of A. niger and A.oryzae to 0.5 and 0.75 kGy, respectively, led to enhancement of α-amylase to 48 and 46 μ/ml, respectively

  15. An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment

    DEFF Research Database (Denmark)

    Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

    2015-01-01

    A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold......-adapted enzymes, as did comparison of the kinetic parameters Km and kcat to a mesophilic α-amylase. AmyI3C6 was shown to be heat-labile. Temperature optimum was at 10-15 °C, and more than 70 % of the relative activity was retained at 1 °C. The pH optimum of AmyI3C6 was at pH 8-9, and the enzyme displayed activity...

  16. Fermentation Kinetics of Media Optimization for the Production of Alpha Amylase by a New Isolate of Aspergillus Oryzae

    Institute of Scientific and Technical Information of China (English)

    Ikram-ul-Haq; Roheena Abdullah; Hamid Mukhtar; Muhammad Nauman Aftab

    2007-01-01

    The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested,Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35. Kinetic analysis revealed that the values of product yield coefficient (Yp/x) and specific product yield coefficient( qp ) were found highly significant (p ≤ 0.05 ) when medium M1 was used for the enzyme production.

  17. [Amylase in the mixed saliva of diabetics and nondiabetics on an empty stomach and during the glucose tolerance test].

    Science.gov (United States)

    Fekete, Z; Gol'denberg, A; Lukach, I; Korets, R; Shval'b, O; Platilova, G; Bandura, A

    1989-01-01

    The catalytic activity of alpha-amylase is significantly elevated in salivary pool from 146 diabetics (2176 +/- 149.3 mu catal.l-1) vs. the salivary pool from 78 nondiabetics (1159 +/- 97.3 mu catal X l-1), the difference in the concentrations of the saliva condensation index (the chloride concentration) in the diabetics and nondiabetics being negligible. Glucose tolerance test has been carried out in 54 subjects. Glucose intake has increased the alpha-amylase catalytic activity and augmented glycosialia in 14 diabetics, in 13 subjects with abnormal glucose tolerance, and in 16 nondiabetics; a negligible rise of glycosialia and a reduction of alpha-amylase catalytic activity have been observed in 11 subjects with a flat glycemia curve. Basing on these data, the authors claim that oral glucose activates amylase and glucose secretion by the salivary glands. PMID:2481117

  18. Mixed-mode resins: taking shortcut in downstream processing of raw-starch digesting α-amylases.

    Science.gov (United States)

    Lončar, Nikola; Šokarda Slavić, Marinela; Vujčić, Zoran; Božić, Nataša

    2015-01-01

    Bacillus licheniformis 9945a α-amylase is known as a potent enzyme for raw starch hydrolysis. In this paper, a mixed mode Nuvia cPrime™ resin is examined with the aim to improve the downstream processing of raw starch digesting amylases and exploit the hydrophobic patches on their surface. This resin combines hydrophobic interactions with cation exchange groups and as such the presence of salt facilitates hydrophobic interactions while the ion-exchange groups enable proper selectivity. α-Amylase was produced using an optimized fed-batch approach in a defined media and significant overexpression of 1.2 g L(-1) was achieved. This single step procedure enables simultaneous concentration, pigment removal as well as purification of amylase with yields of 96% directly from the fermentation broth. PMID:26492875

  19. Pancreatic amylase is an environmental signal for regulation of biofilm formation and host interaction in Campylobacter jejuni.

    Science.gov (United States)

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A; Nair, Sean P; Sadiq, Sohaib; Williams, Lisa K; Trantham, Emma K; Stephenson, Holly; Wren, Brendan W; Bajaj-Elliott, Mona; Cogan, Tristan A; Laws, Andrew P; Wade, Jim; Dorrell, Nick; Allan, Elaine

    2015-12-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism. PMID:26438798

  20. 大豆β-淀粉酶和大麦β-淀粉酶糖化特性的比较%Comparison of Enzymatic Properties of the Soybean β-amylase and Barley β-amylase

    Institute of Scientific and Technical Information of China (English)

    周春海

    2011-01-01

    In this paper, the activity of the soybean β-amylase and barley β-amylase were compared under the conditions of the existing saccharification for producing maltose. The impact of low pH and high temperature on the activity of the two enzymes were studied The results showed that 1.2 dosage of soybeanβ-amylase and 1 dosage of the barley β-amylase has the same maltose throughput, and the soybean β-amylase is more suitable for low pH and high temperature condition compared to soybean β-amylase.%本实验参照淀粉糖车间现有糖化工艺条件,对大豆β-淀粉酶和正在使用的大麦β-淀粉酶糖化能力及两种酶的低pH和高温的耐受性进行了对比研究.结果显示大豆β-淀粉酶添加量为大麦淀粉酶的1.2倍时与其有等效的麦芽糖生产能力,且大豆β-淀粉酶比大麦β-淀粉酶对低pH和高温有更好的耐受性.

  1. Phospholipase A2 as a point of care alternative to serum amylase and pancreatic lipase

    Science.gov (United States)

    Liu, Nathan J.; Chapman, Robert; Lin, Yiyang; Bentham, Andrew; Tyreman, Matthew; Philips, Natalie; Khan, Shahid A.; Stevens, Molly M.

    2016-06-01

    Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to serve as high lipase (n = 20), CA19-9 positive (n = 15), and healthy (n = 20) controls. sPLA2-IB concentration correlated well with the serum activity of both amylase and lipase, and performed at least as well as either markers in the differentiation of pancreatitis from controls.Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to

  2. Isolation, purification and characterization of β-amylase from Dioscorea hispida Dennst

    Science.gov (United States)

    Oktiarni, Dwita; Lusiana, Simamora, Febri Yanti; Gaol, Jusni M. Lumban

    2015-09-01

    β-amylase (E.C 3.2.1.2) is an enzyme commonly found in plants and bacteria. The enzyme is an exo-acting carbohydrolase which hydrolyzes α-1.4-glucosidic linkages of starch, removing maltose units from the non-reducing end of the polysaccharide chain, producing β-maltose and β-limit dextrin as the final product. β-amylase is widely distributed in the higher plants such as sweet potato. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-stalling agents in baking. This enzyme was extracted from Dioscorea hispida Dennst in 0.05 M acetate buffer pH 4.8 and followed by ammonium sulfate fractionation at cold temperature (10°C). Ammonium sulfate fractionation was shared into fraction of 0-60%, 60-70%, 70-80% and 80-100%. The fraction containing high of specific activity (determined by Somogyi-Nelson and Lowry methods) was futher purified by dialysis. Fraction with high enzyme activity of β-amylase were fraction 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst were 1.32 and 1.55 mg sugar.mg protein-1.minute-1, whereas specific activity of crude extract enzyme was 0.21 mg sugar.mg protein-1.minute-1. After purified with dialysis, fraction with high enzyme activity of β-amylase were fraction of 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst was 2.72 and 4.24 mg sugar.mg protein-1.minute-1. The purified Dioscorea hispida Dennst β-amylase from dialysis showed increasing in spesific activity the crude enzyme as much as 24 folds. The characterization of enzyme showed that Dioscorea hispida Dennst derived enzyme had optimum pH of 5.5 and temperature of 70°C. The kinetic parameters of purified Dioscorea hispida Dennst β-amylase showed that the KMapp, Vmaxapp value and Hill constant were 0.0211 mg/ml, 9.63 mg sugar.minute-1 and 1.34, respectively.

  3. The Effect of a Brief Salivary α-Amylase Exposure During Chewing on Subsequent in Vitro Starch Digestion Curve Profiles

    OpenAIRE

    Brennan, Charles S.; Woolnough, James W.; Bird, Anthony R.; Monro, John A.

    2010-01-01

    There is inconsistency between current in vitro digestion methods with regard to accommodation of a (salivary) α-amylase exposure during the oral phase. The effect of a salivary α-amylase pre-exposure on subsequent in vitro starch digestion curve profiles for various foods was investigated. Foods were chewed, expectorated and the boluses left to rest for 0–15 min. During pancreatic digestion, aliquots were taken and hydrolysis curves constructed for comparison against those of the same foods ...

  4. Normative references of heart rate variability and salivary alpha-amylase in a healthy young male population

    OpenAIRE

    Kobayashi Hiromitsu; Park Bum-Jin; Miyazaki Yoshifumi

    2012-01-01

    Abstract Background This study aimed to present normative reference values of heart rate variability and salivary alpha-amylase in a healthy young male population with a particular focus on their distribution and reproducibility. Methods The short-term heart rate variability of 417 young healthy Japanese men was studied. Furthermore, salivary alpha-amylase was measured in 430 men. The average age of the subjects were 21.9 years with standard deviation of 1.6 years. Interindividual variations ...

  5. Inheritance of a Parotid Secretory Protein in Mice and Its Use in Determining Salivary Amylase Quantitative Variants

    OpenAIRE

    Owerbach, David; Hjorth, J. Peter

    1980-01-01

    Among inbred strains of mice, a major protein, PSP, produced and secreted by the parotid glands, shows variation in electrophoretic mobility and in the peptides produced by cyanogen bromide treatment. This variation is inherited as a single Mendelian factor with two alleles showing co-dominant expression. In genetic crosses, it segregates independently from the amylase complex and is closely linked to the agouti locus on chromosome 2. The protein ratios between amylase and PSP in saliva, obta...

  6. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222

    OpenAIRE

    Shalini Singh; Sahibjot Kaur Cheema; Bineypreet Kaur,; Navreet Kaur Mann

    2015-01-01

    Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best o...

  7. The Construction of the Probe for Amylase Ⅱ Gene Cloning from Bacillus halodurans Strain 38C1-1

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Thermus sp. IM6501, B. stearothermophilus ET-1, and B. acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.

  8. Comparative study of alpha amylase inhibitory activity of flavonoids of Vitex negundo Linn. and Andrographis paniculata Nees

    OpenAIRE

    Keerti Gautam; Padma Kumar; Chitra Jain

    2013-01-01

    Background: One important therapeutic approach for the treatment of Type 2 Diabetes Mellitus is by decreasing the postprandial increase of glucose. This is possible by inhibiting certain carbohydrate hydrolyzing enzymes like alpha-amylase. Aim: The objective of the present study was to evaluate the alpha amylase inhibitory activity of flavonoids extracts of different parts of Vitex negundo Linn and Andrographis paniculata Nees. Materials and Methods: In the present study, the percentage inhib...

  9. Amylase level in extrahepatic bile duct in adult patients with choledochal cyst plus anomalous pancreatico-biliary ductal union

    Institute of Scientific and Technical Information of China (English)

    In-Ho Jeong; Jin-Hong Kim; Jae-Ho Han; Wook-Hwan Kim; Yong-Sik Jung; Hong Kim; Bong-Wan Kim; Jung-Woon Kim; Jeong Hong; Hee-Jung Wang; Myung-Wook Kim; Byung-Moo Yoo

    2005-01-01

    AIM: To investigate the relationship between pancreatic amylase in bile duct and the clinico-pathological features in adult patients with choledochal cyst and anomalous pancreatico-biliary ductal union (APBDU).METHODS: From 39 patients who underwent surgery for choledochal cyst between March 1995 and March 2003,we selected 15 adult patients who had some symptoms and were radiologically diagnosed as APBDU, and their clinico-pathological features were subsequently evaluated retrospectively. However, we could not obtain biliary amylase in all the patients because of the surgeon's slip.Therefore, we measured the amylase level in gall bladder of 10 patients and in common bile duct of 11 patients.RESULTS: Levels of amylase in common bile duct and gall bladder ranged from 11 500 to 212 000 IU/L, and the younger the patients, the higher the biliary amylase level (r= -0.982, P<0.01). Pathologically, significant correlation was found between the size of choledochal cyst and the grade of inflammation (r= 0.798,P<0.01). And, significant correlation was found between the level of amylase in gall bladder and the grade of hyperplasia. On the other hand, there was no correlation to the age of symptomatic onset or inflammatory grade (r = 0.743, P<0.05). Level of lipase was elevated from 6 000 to 159 000 IU/L in bile duct and from 14 400 to 117 000 IU/L in the gall bladder;however, there was no significant correlation with age or clinico-pathological features.CONCLUSION: The results support the notion that amylase has a particular role in the onset of symptoms, and suggest that a large amount of biliary amylase induces early onset of symptom, thereby making early diagnosis possible.

  10. Influence of α-amylase template concentration on systematic entrapment of highly stable and monodispersed colloidal gold nanoparticles

    OpenAIRE

    A. Nitthin Ananth; A. Nimrodh Ananth; Sujin P. Jose; Umapathy, S.; T. Mathavan

    2016-01-01

    Nano gold / α-amylase colloidal dispersions of profound stability were made using simple procedure with a conventional reducing agent. The surface plasmon resonance of the gold nanocrystals was used to quantify the extent of the dispersion stability and functionalization. It is found that the reduced gold nanoparticles were trapped into the protein network without denaturation the structure of α-amylase protein. This kind of entrapment of particles into the protein network prevents clustering...

  11. Mixed-mode resins: taking shortcut in downstream processing of raw-starch digesting α-amylases

    OpenAIRE

    Nikola Lončar; Marinela Šokarda Slavić; Zoran Vujčić; Nataša Božić

    2015-01-01

    Bacillus licheniformis 9945a α-amylase is known as a potent enzyme for raw starch hydrolysis. In this paper, a mixed mode Nuvia cPrime™ resin is examined with the aim to improve the downstream processing of raw starch digesting amylases and exploit the hydrophobic patches on their surface. This resin combines hydrophobic interactions with cation exchange groups and as such the presence of salt facilitates hydrophobic interactions while the ion-exchange groups enable proper selectivity. α-Amyl...

  12. Aspergillus 6V4, a Strain Isolated from Manipueira, Produces High Amylases Levels by Using Wheat Bran as a Substrate

    OpenAIRE

    Jessyca dos Reis Celestino; Ana Caroline Duarte; Cláudia Maria de Melo Silva; Hellen Holanda Sena; Maria do Perpétuo Socorro Borges Carriço Ferreira; Neila Hiraishi Mallmann; Natacha Pinheiro Costa Lima; Chanderlei de Castro Tavares; Rodrigo Otávio Silva de Souza; Érica Simplício Souza; João Vicente Braga Souza

    2014-01-01

    The aim of this study was screening fungi strains, isolated from manipueira (a liquid subproduct obtained from the flour production of Manihot esculenta), for amylases production and investigating production of these enzymes by the strain Aspergillus 6V4. The fungi isolated from manipueira belonged to Ascomycota phylum. The strain Aspergillus 6V4 was the best amylase producer in the screening assay of starch hydrolysis in petri dishes (ASHPD) and in the assay in submerged fermentation (ASbF)....

  13. Structural Stability and Unfolding Properties of Thermostable bacterial alpha-amylases: A Comparative Study on Homologous Enzymes

    OpenAIRE

    Fitter, J.; Haber-Pohlmeier, S.

    2004-01-01

    In a comparative investigation on two thermostable alpha-amylases [Bacillus amyloliquefaciens (BAA), T(m) = 86 degrees C and Bacillus licheniformis (BLA), T(m) = 101 degrees C], we studied thermal and guanidine hydrochloride (GndHCl)-induced unfolding using fluorescence and CD spectroscopy, as well as dynamic light scattering. Depletion of calcium from specific ion-binding sites in the protein structures reduces the melting temperature tremendously for both alpha-amylases. The reduction is ne...

  14. Digestive alpha-amylases of the flour moth Ephestia kuehniella - adaptation to alkaline environment and plant inhibitors

    Czech Academy of Sciences Publication Activity Database

    Pytelková, Jana; Hubert, J.; Lepšík, Martin; Šobotník, Jan; Šindelka, Radek; Křížková, I.; Horn, Martin; Mareš, Michael

    2009-01-01

    Roč. 276, č. 13 (2009), s. 3531-3546. ISSN 1742-464X R&D Projects: GA AV ČR IAA400550617; GA MŠk LC512; GA ČR GA301/09/1752 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : alkaline adaptation * alpha -amylase * alpha-amylase inhibitor * Ephestia kuehniella * plant-insect interaction Subject RIV: CE - Biochemistry Impact factor: 3.042, year: 2009

  15. Dopamine-induced amylase secretion from rat parotid salivary gland in vitro: an effect mediated via noradrenergic and cholinergic nerves.

    OpenAIRE

    Hata, F.; Ishida, H.; Kondo, E.

    1986-01-01

    The effect of dopamine on amylase secretion by rat parotid tissue was examined in vitro. Dopamine induced marked amylase secretion from the tissue in a dose-dependent manner. Its EC50 value was about 4 microM and the maximal response was obtained at a concentration of 100 microM. The dopamine-induced secretion was inhibited by the dopamine-antagonists haloperidol, (+)-butaclamol and spiroperidol. Atropine reduced the dopamine-induced secretion significantly, and physostigmine enhanced the sec...

  16. α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest

    Directory of Open Access Journals (Sweden)

    Oliveira-Neto Osmundo B

    2010-06-01

    Full Text Available Abstract Background Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei, is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an α-amylase inhibitor gene (α-AI1, which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. Results We transformed C. arabica with the α-amylase inhibitor-1 gene (α-AI1 from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L. The presence of the α-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against α-AI1 inhibitor showed a maximum α-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the α-AI1 protein against H. hampei α-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. Conclusions This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee.

  17. Amy1, the alpha-Amylase Gene of Aspergillus flavus: Involvement in Aflatoxin Biosynthesis in Maize Kernels.

    Science.gov (United States)

    Fakhoury, A M; Woloshuk, C P

    1999-10-01

    ABSTRACT Aspergillus flavus is the causal agent of an ear and kernel rot in maize. In this study, we characterized an alpha-amylase-deficient mutant and assessed its ability to infect and produce aflatoxin in wounded maize kernels. The alpha-amylase gene Amy1 was isolated from A. flavus, and its DNA sequence was determined to be nearly identical to Amy3 of A. oryzae. When Amy1 was disrupted in an aflatoxigenic strain of A. flavus, the mutant failed to produce extracellular alpha-amylase and grew 45% the rate of the wild-type strain on starch medium. The mutant produced aflatoxin in medium containing glucose but not in a medium containing starch. The alpha-amylase-deficient mutant produced aflatoxin in maize kernels with wounded embryos and occasionally produced aflatoxin only in embryos of kernels with wounded endosperm. The mutant strain failed to produce aflatoxin when inoculated onto degermed kernels. In contrast, the wild-type strain produced aflatoxin in both the endosperm and embryo. These results suggest that alpha-amylase facilitates aflatoxin production and growth of A. flavus from a wound in the endosperm to the embryo. A 14-kDa trypsin inhibitor associated with resistance to A. flavus and aflatoxin in maize also inhibited the alpha-amylase from A. flavus, indicating that it is a bifunctional inhibitor. The inhibitor may have a role in resistance, limiting the growth of the fungus in the endosperm tissue by inhibiting the degradation of starch. PMID:18944734

  18. Control of α-amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    International Nuclear Information System (INIS)

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA3) with or without 5 millimolar CaCl2 shows that α-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca2+. No difference was observed in α-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA3 with 5 millimolar CaCl2 and layers incubated in GA3 alone. RNA isolated from layers incubated for 12 hours in GA3 with and without CA2+. A cDNA clone for α-amylase was isolated and used to measure α-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca2+ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca2+ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for α-amylase synthesized in Ca2+-deprived aleurone layers was translatable. Ca2+ is required for the synthesis of α-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing

  19. Estimation of salivary amylase and total proteins in leukemia patients and its correlation with clinical feature and radiographic finding

    Directory of Open Access Journals (Sweden)

    Ashok L

    2010-01-01

    Full Text Available Background: Leukemia is a fatal disease. The oral manifestations of the leukemias occur early in the course of the disease and these oral features can at times act as a diagnostic indicator. Saliva has been used as a diagnostic aid in a number of systemic diseases. Materials and Methods: In our study, samples of unstimulated saliva of 30 leukemia patients who were not on chemotherapy were collected and analyzed for salivary amylase and total protein. The oral manifestations and radiographic changes (OPG were recorded. The correlation between the oral manifestations and the salivary components (salivary amylase and total protein was assessed for prognostic significance. Results: In the present study when the mean values of salivary amylase (1280±754 U/ml and total protein (647.2±320.7 mg% were compared with that in control subjects. There was a statistically significant difference for amylase levels (P<.05. On intraoral examination the study subjects showed pallor, gingivitis, gingival enlargement, petechiae, and ecchymosis. On the OPG, the radiographic features included generalized rarefaction of bone (20%, thinning of lamina dura (3.4%, generalized alveolar crest bone resorption (30%, thinning of walls of alveolar crypts (6.7%, besides others, e.g., periapical abscess (10%. Conclusions: The saliva of leukemic patients demonstrated obvious changes in composition. A rise in salivary amylase and total protein levels was evident, with the increase in amylase levels being statistically significant.

  20. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.

    Science.gov (United States)

    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng

    2015-01-01

    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants. PMID:26154585