
Sample records for amylase

  1. Amylase Test (United States)

    ... be limited. Home Visit Global Sites Search Help? Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  2. Amylase - blood (United States)

    ... amylase levels may occur due to: Acute pancreatitis Cancer of the pancreas , ovaries, or lungs Cholecystitis Gallbladder attack caused by ... open) Decreased amylase levels may occur due to: Cancer of the pancreas Damage to the pancreas Kidney disease Toxemia of ...

  3. Amylase, isoamylase and macroamylase. (United States)

    Goldberg, D M; Spooner, R J


    Hyperamylasaemia has long been regarded as pathognomonic of acute pancreatitis. However, recent work has revealed a number of conditions where a gross elevation may be an incidental finding, notably diabetic ketoacidosis. The recent discovery of 'macroamylase', a high molecular weight amylase-protein complex capable of producing hyperamylasaemia with low urine amylase, has further complicated diagnosis and has led to the introduction of the ratio of amylase clearance to creatinine clearance as a diagnostic aid. Serum amylase may be resolved, by most electrophoretic media, into bands which correspond to those obtained when pancreatic homogenates or saliva are electrophoresed. The initial promise of this technique has not been realised at the routine diagnostic level. Duodenal juice amylase has been the classical enzyme used in assessing exocrine pancreatic function and although it is still of value it is being amplified by other enzyme tests.

  4. Amylase activity in human bile. (United States)

    Donaldson, L A; Joffe, S N; McIntosh, W; Brodie, M J


    The mean amylase level in 42 human bile samples was 154 IU/l and there was no significant difference in the amylase activity of 32 paired serum and bile samples. Estimation of the amylase thermolability of bile showed it to be similar to that of serum. This suggests that the amylase activity in bile may have filtered through the liver from the hepatic circulation rather than refluxed from the pancreatic duct. The presence of amylase in human bile provides further evidence that the liver might have a role in the regulation of serum amylase.

  5. A normal paediatric amylase range.


    Aggett, P J; Taylor, F.(Department of Physics, Massachusetts Institute of Technology, Cambridge, MA, United States of America)


    A normal paediatric range of plasma alpha-amylase activity was determined using the Phadebas blue starch method. The range for children over one year was 98--405 IU/l. Plasma amylase activity increased throughout infancy. Mature levels of activity were observed in some children by age 2 months and in most of them by 9 months.

  6. Concerted evolution of human amylase genes.


    Gumucio, D L; Wiebauer, K; Caldwell, R M; Samuelson, L C; Meisler, M H


    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, we have identified two pancreatic amylase genes and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, du...

  7. Amylase: sensitive tumor marker for amylase-producing lung adenocarcinoma


    Jie ZHANG; Zhang, Lixia; Pan, Shiyang; Gu, Bing; Zhen, Yuping; Yan, Jiabin; Zhou, Yiqin


    Hyperamylasemia in patients with lung cancer is rarely, comprising 1% to 3% of all lung cancers. This report describes two cases of lung adenocarcinoma coexisting with hyperamylasemia in two women aged 77 and 57, respectively. In these two cases, CT revealed a normal pancreas. We monitored the serum and urine amylase levels during therapy and found it paralleled tumor response to chemotherapy and metastasis. We suggest that the amylase levels are related to the tumor size and might be a valua...

  8. Exercise upregulates salivary amylase in humans (Review)


    KOIBUCHI, ERI; Suzuki, Yoshio


    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively ...

  9. Concerted evolution of human amylase genes

    Energy Technology Data Exchange (ETDEWEB)

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.


    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  10. Amylase creatinine clearance ratio after biliary surgery. (United States)

    Donaldson, L A; McIntosh, W; Joffe, S N


    The amylase creatinine clearance ratio (ACCR) is considered to be a more sensitive index of acute pancreatitis than the serum amylase level. Serial ACCR estimations were undertaken in 25 patients undergoing an elective cholecystectomy. Using accepted criteria, 28% of these patients developed, in the postoperative period, biochemical evidence of pancreatic gland damage, although the serum amylase level remained normal. This raised ACCR was particularly noted in patients who had undergone an exploration of the common bile duct. The ACCR would appear to be a more sensitive index of pancreatic gland disruption secondary to biliary surgery than the serum amylase level.

  11. Amylase creatinine clearance ratio after biliary surgery. (United States)

    Donaldson, L A; McIntosh, W; Joffe, S N


    The amylase creatinine clearance ratio (ACCR) is considered to be a more sensitive index of acute pancreatitis than the serum amylase level. Serial ACCR estimations were undertaken in 25 patients undergoing an elective cholecystectomy. Using accepted criteria, 28% of these patients developed, in the postoperative period, biochemical evidence of pancreatic gland damage, although the serum amylase level remained normal. This raised ACCR was particularly noted in patients who had undergone an exploration of the common bile duct. The ACCR would appear to be a more sensitive index of pancreatic gland disruption secondary to biliary surgery than the serum amylase level. PMID:402305

  12. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide;


    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  13. Exercise upregulates salivary amylase in humans (Review). (United States)

    Koibuchi, Eri; Suzuki, Yoshio


    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  14. Amylase and lipase values in normal subjects

    NARCIS (Netherlands)

    Riet, H.G. van


    In 146 hospitalized individuals (71 men and 75 women), the simultaneous fasting serum amylase and lipase concentrations and the urinary amylase excretion per 24 h were determined. Patients with pancreatic abnormalities or other diseases which might produce abnormal enzyme values were ruled out from

  15. Production of alpha-amylase by yeast

    Energy Technology Data Exchange (ETDEWEB)

    Thomse, K.K.


    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  16. Intracellular α-Amylase of Streptococcus mutans


    Simpson, Christine L.; Russell, Roy R. B.


    Sequencing upstream of the Streptococcus mutans gene for a CcpA gene homolog, regM, revealed an open reading frame, named amy, with homology to genes encoding α-amylases. The deduced amino acid sequence showed a strong similarity (60% amino acid identity) to the intracellular α-amylase of Streptococcus bovis and, in common with this enzyme, lacked a signal sequence. Amylase activity was found only in S. mutans cell extracts, with no activity detected in culture supernatants. Inactivation of a...

  17. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii


    Nikitkova, A.E.; Haase, E.M.; Scannapieco, F A


    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amyla...

  18. Production of amylases by Aspergillus tamarii

    Directory of Open Access Journals (Sweden)

    Moreira Fabiana Guillen


    Full Text Available A strain of Aspergillus tamarii, a filamentous fungus isolated from soil, was able to produce both a-amylase and glucoamylase activities in mineral media supplemented with 1% (w/v starch or maltose as the carbon source. Static cultivation led to significantly higher yields than those obtained using shaking culture. The production of amylases was tolerant to a wide range of initial culture pH values (from 4 to 10 and temperature (from 25 to 42oC. Two amylases, one a-amylase and one glucoamylase, were separated by ion exchange chromatography. Both partially purified enzymes had optimal activities at pH values between 4.5 and 6.0 and were stable under acid conditions (pH 4.0-7.0. The enzymes exhibited optimal activities at temperatures between 50o and 60o C and were stable for more than ten hours at 55oC.

  19. Performance evaluation of salivary amylase activity monitor. (United States)

    Yamaguchi, Masaki; Kanemori, Takahiro; Kanemaru, Masashi; Takai, Noriyasu; Mizuno, Yasufumi; Yoshida, Hiroshi


    In order to quantify psychological stress and to distinguish eustress and distress, we have been investigating the establishment of a method that can quantify salivary amylase activity (SMA). Salivary glands not only act as amplifiers of a low level of norepinephrine, but also respond more quickly and sensitively to psychological stress than cortisol levels. Moreover, the time-course changes of the salivary amylase activity have a possibility to distinguish eustress and distress. Thus, salivary amylase activity can be utilized as an excellent index for psychological stress. However, in dry chemistry system, a method for quantification of the enzymatic activity still needs to be established that can provide with sufficient substrate in a testing tape as well as can control enzymatic reaction time. Moreover, it is necessary to develop a method that has the advantages of using saliva, such as ease of collection, rapidity of response, and able to use at any time. In order to establish an easy method to monitor the salivary amylase activity, a salivary transcription device was fabricated to control the enzymatic reaction time. A fabricated salivary amylase activity monitor consisted of three devices, the salivary transcription device, a testing-strip and an optical analyzer. By adding maltose as a competitive inhibitor to a substrate Ga1-G2-CNP, a broad-range activity testing-strip was fabricated that could measure the salivary amylase activity with a range of 0-200 kU/l within 150 s. The calibration curve of the monitor for the salivary amylase activity showed R2=0.941, indicating that it was possible to use this monitor for the analysis of the salivary amylase activity without the need to determine the salivary volume quantitatively. In order to evaluate the assay variability of the monitor, salivary amylase activity was measured using Kraepelin psychodiagnostic test as a psychological stressor. A significant difference of salivary amylase activity was recognized

  20. Measuring human salivary amylase copy number variation


    Dhar, Sugandha


    Copy number variations represent large scale genomic alterations varying from 1kb to 3Mb and are proposed as a driving force for genome evolution and variation. One such locus exhibiting copy number variation and genome evolution is salivary amylase, which is responsible for the digestion of starch in the human parotid glands. It was reported that since human salivary amylase gene (AMY1) copy numbers are correlated positively with protein levels, and also due to the correlation of high gene c...

  1. Effect of changes in circulating amylase levels on amylase output in bile. (United States)

    Grendell, J H; Rothman, S S


    The relation between plasma and biliary amylase activity and their relationship to the functional state of the pancreas were studied in anesthetized rabbits. Repetitive intravenous injections of cholecystokinin resulted in a 25-fold rise in the secretion of amylase via the pancreatic duct, followed at first by a 50% increase in plasma amylase concentration and later by a 270% increase in biliary amylase concentration. There was then a gradual, roughly synchronous decline in both plasma and biliary values toward basal level despite a continued highly augmented rate of pancreatic ductal secretion. "Near-total" pancreatectomy completely abolished the effect. These observations are consistent with a cholecystokinin-induced basolateral secretion of amylase from pancreas into blood and its subsequent movement from blood into bile down a concentration gradient. The output of amylase in bile, however, was quite small and does not suggest that biliary transport of amylase has an important function either as a means of secreting and recycling digestive enzyme into the gut or as a major excretory pathway for circulating amylase in the rabbit.

  2. Expression of alpha-amylase in Bacillus licheniformis.


    Rothstein, D. M.; Devlin, P E; Cate, R. L.


    In Bacillus licheniformis, alpha-amylase production varied more than 100-fold depending on the presence or absence of a catabolite-repressing carbon source in the growth medium. alpha-Amylase was produced during the growth phase and not at the onset of the stationary phase. Induction of alpha-amylase correlated with synthesis of mRNA initiating at the promoter of the alpha-amylase gene.

  3. Two Distinct Pancreatic Amylase Genes Are Active in Ybr Mice


    Strahler, John R.; Meisler, Miriam,


    The genetic determinants of pancreatic amylase expression in YBR mice differ in two respects from those of other inbred strains. First, there are two nonallelic amylase isozymes present in YBR pancreas, while most mouse strains express a single pancreatic amylase protein. In addition, the in vivo rate of total pancreatic amylase synthesis is 50% of that in other strains. Both these traits are determined by genetic sites in the region of the Amy-2 locus on mouse chromosome 3. To determine the ...

  4. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase. (United States)

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua


    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation. PMID:26117761

  5. Radioimmunoassay for human pancreatic amylase: comparison of human serum amylase by measurement of enzymatic activity and by radioimmunoassay

    International Nuclear Information System (INIS)

    A radioimmunoassay (RIA) for human pancreatic amylase has been developed for the determination of human serum amylase content. The assay was shown to be sensitive (7 ng/mI), reproducible and specific, but human pancreatic amylase and salivary amylase could not be distinguished by the antiserum used. In normal subjects, the mean concentration of amylase determined by the RIA was found to be 122.1 ng/ml (range: 55-250 ng/ml). A good correlation was observed between the concentration of amylase and its enzymatic activity in normal subjects. In some instances with high amylase activity, however, the rise in enzymatic activity was not accompanied by increasing amount of amylase content. (Auth.)

  6. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase. (United States)

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua


    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation.

  7. Immobilization of -Amylase onto Luffa operculata Fibers

    Directory of Open Access Journals (Sweden)

    Ricardo R. Morais


    Full Text Available A commercial amylase (amy was immobilized by adsorption onto Luffa operculata fibers (LOFs. The derivative LOF-amy presented capacity to hydrolyze starch continuously and repeatedly for over three weeks, preserving more than 80% of the initial activity. This system hydrolyzed more than 97% of starch during 5 min, at room temperature. LOF-amy was capable to hydrolyze starch from different sources, such as maize (93.96%, wheat (85.24%, and cassava (79.03%. A semi-industrial scale reactor containing LOF-amy was prepared and showed the same yield of the laboratory-scale system. After five cycles of reuse, the LOF-amy reactor preserved over 80% of the initial amylase activity. Additionally, the LOF-amy was capable to operate as a kitchen grease trap component in a real situation during 30 days, preserving 30% of their initial amylase activity.

  8. Kidney ageing and renal excretion of amylase. (United States)

    Brohée, D; Rondelez, L; Bain, H; de Maertelaer, V


    In a cross-sectional study, the amylase to creatinine clearance ratio (ACCR) was determined in 180 patients, age range 18-93 years. An inverse correlation was found between ACCR and creatinine clearance (r = -0.40, p less than 0.001) in keeping with the known inverse relationship between the sieving fraction of macromolecules and the glomerular filtration rate. The fractional clearance of amylase was not significantly affected by amylasemia nor by age when the creatinine clearance was also considered in a multiple regression analysis. No increase in ACCR was observed in patients with low molecular weight proteinuria or with induced urine dilution. The authors assume that the tubular reabsorption of amylase is minimal and that the enhancement of ACCR in the elderly mainly reflects modifications in the glomerular filtration dynamics.

  9. Kidney ageing and renal excretion of amylase. (United States)

    Brohée, D; Rondelez, L; Bain, H; de Maertelaer, V


    In a cross-sectional study, the amylase to creatinine clearance ratio (ACCR) was determined in 180 patients, age range 18-93 years. An inverse correlation was found between ACCR and creatinine clearance (r = -0.40, p less than 0.001) in keeping with the known inverse relationship between the sieving fraction of macromolecules and the glomerular filtration rate. The fractional clearance of amylase was not significantly affected by amylasemia nor by age when the creatinine clearance was also considered in a multiple regression analysis. No increase in ACCR was observed in patients with low molecular weight proteinuria or with induced urine dilution. The authors assume that the tubular reabsorption of amylase is minimal and that the enhancement of ACCR in the elderly mainly reflects modifications in the glomerular filtration dynamics. PMID:6186575

  10. Possible mechanisms of normal amylase activity in hyperlipemic pancreatitis. (United States)

    Mishkin, S.; Bates, J.; O'Hashi, J.; Schneider, P.; Sniderman, A. D.; Wolf, R. O.


    Lipemic serum from three patients with acute pancreatitis and type IV hyperlipemia was fractionated into very-low-density lipoproteins and clear serum. Amylase activity (determined by the Phadebas method) in the component fractions did not exceed that in the original lipemic serum. Addition of these fractions or VLDL and chylomicrons from asymptomatic patients with hyperlipemia to nonlipemic serum from patients with "routine acute pancreatitis" did not inhibit amylase activity or alter the electrophoretic mobility of amylase isoenzymes. Therefore the normal amylase activity often observed in hyperlipemic pancreatitis does not result from an inhibition of amylase activity by serum lipoproteins. Images FIG. 4 FIG. 5 PMID:206333

  11. Influence of amylase assay technique on renal clearance of amylase-creatinine ratio. (United States)

    Levitt, M D; Johnson, S G; Ellis, C J; Engel, R R


    The influence of amylase assay technique on the renal amylase/creatinine clearance measurement was determined by analysis of serum and urine specimens obtained from 10 normal subjects. CAm/CCr averaged 2.19 +/- 0.18% with a saccharogenic technique, 1.52 +/- 0.2% with an iodometric technique, and 0.80 +/- 0.08% with a chromogenic technique. Each of these values differed significantly (P less than 0.05) from the other two. Recovery studies were carried out by adding partially purified human salivary or pancreatic amylase to human newborn serum or urine (which contain minimal endogenous amylase). Equal amylase activity was recovered from serum and urine by the saccharogenic technique whereas recovery from urine was less than 50% of that from serum using the iodometric and chromogenic techniques. The accuracy of the chromogenic technique is markedly improved by the addition of albumin to the urine assay system. Although it appears that only the saccharogenic method provides an accurate estimate of CAm/CCr, each assay technique distinguished the elevated CAm/CCr of patients with pancreatitis from the normal range established for that technique. Accurate clinical interpretation of CAm/CCr measurment requires knowledge of the amylase assay technique used.

  12. Clinical evaluation of amylase-creatinine clearance ratio and amylase isoenzyme clearance in chronic renal failure. (United States)

    Maeda, M; Otsuki, M; Okano, K; Yamasaki, T; Baba, S


    Amylase-creatinine clearance ratio (ACCR) and amylase isoenzyme clearance were determined simultaneously in patients with chronic renal failure. ACCR in patients with compensated renal failure (3.5 +/- 0.4%) was not significantly different from normals (2.6 +/- 0.2%), while that in patients with non-compensated renal failure (6.7 +/- 0.4%) was significantly higher than that in normals. Clearance ratio of pancreatic isoamylase (Amylase-1) relative to creatinine clearance (CAmy . 1/Ccr) in patients with both compensated (5.9 +/- 1.0%) and non-compensated (6.8 +/- 0.4%) renal failure was as high as that in patients with acute pancreatitis (6.6 +/- 0.5%). On the other hand, clearance ratio of salivary isoamylase (Amylase-3) relative to creatinine clearance (CAmy . 3/CCr) in patients with compensated renal failure (1.5 +/- 0.3%) was almost the same as that in normals (2.1 +/- 0.1%), while that in patients with non-compensated renal failure was 5.9 +/- 0.7%, which was significantly higher than that in normals. The present study revealed that elevated ACCR in patients with severely impaired renal function was due to the increase of the clearance ratio for both pancreatic and salivary amylase. These facts suggested that glomerular permeability and tubular reabsorption for pancreatic and salivary amylase might play an important role on ACCR in patients with severely impaired renal function.

  13. Clinical evaluation of amylase-creatinine clearance ratio and amylase isoenzyme clearance in chronic renal failure. (United States)

    Maeda, M; Otsuki, M; Okano, K; Yamasaki, T; Baba, S


    Amylase-creatinine clearance ratio (ACCR) and amylase isoenzyme clearance were determined simultaneously in patients with chronic renal failure. ACCR in patients with compensated renal failure (3.5 +/- 0.4%) was not significantly different from normals (2.6 +/- 0.2%), while that in patients with non-compensated renal failure (6.7 +/- 0.4%) was significantly higher than that in normals. Clearance ratio of pancreatic isoamylase (Amylase-1) relative to creatinine clearance (CAmy . 1/Ccr) in patients with both compensated (5.9 +/- 1.0%) and non-compensated (6.8 +/- 0.4%) renal failure was as high as that in patients with acute pancreatitis (6.6 +/- 0.5%). On the other hand, clearance ratio of salivary isoamylase (Amylase-3) relative to creatinine clearance (CAmy . 3/CCr) in patients with compensated renal failure (1.5 +/- 0.3%) was almost the same as that in normals (2.1 +/- 0.1%), while that in patients with non-compensated renal failure was 5.9 +/- 0.7%, which was significantly higher than that in normals. The present study revealed that elevated ACCR in patients with severely impaired renal function was due to the increase of the clearance ratio for both pancreatic and salivary amylase. These facts suggested that glomerular permeability and tubular reabsorption for pancreatic and salivary amylase might play an important role on ACCR in patients with severely impaired renal function. PMID:6167484

  14. Amylase release from rat parotid glands. II

    International Nuclear Information System (INIS)

    The kinetics of 45Ca2+ uptake, efflux, and calcium potentiation of amylase release by slices of rat parotid glands were examined. Pretreatment of the tissue with 11.25 mM 45Ca2+ medium increased the total tissue 45calcium content. Lanthanum (1 mM) decreased tissue uptake, blocked the slow components of exchange and appeared to inhibit transcellular calcium movement. Neither dibutyryl cyclic AMP nor caffeine caused consistently significant effects on 45Ca2+ kinetics, or total 45calcium content. Carbamylcholine increased the initial rate of 45Ca2+ uptake, but had no effect on total uptake. Elevation of the extracellular Ca2+ concentration of 11.25 mM during stimulation of amylase release resulted in an initial decrease in the rate of amylase release followed by a potentiation of release which developed slowly, requiring 40-50 min to reach the maximal response. The inability to detect release-related changes in either calcium influx or mobilization, and the lengthy times and high Ca2+ concentrations required to achieve calcium potentiation suggests that calcium does not couple amylase release. (Auth.)

  15. Occupational asthma due to porcine pancreatic amylase



    A case of occupational asthma in a 41 year old histopathology laboratory technician attributable to a powder preparation of the porcine pancreatic enzyme amylase is reported. The diagnosis was confirmed by a double blind, placebo controlled, inhalation challenge study which showed immediate and late asthmatic reactions associated with a significant increase in airway responsiveness to methacholine.

  16. Blood amylase - a biochemical radiation indicator?

    International Nuclear Information System (INIS)

    This study describes the suitability of the biological radiation indicator 'amylase in human blood serum' to identify, if previous irradiation has occurred. After 'in vivo' exposure, of the human body with organ doses > 0,5 Gy, high activities of the enzyme are found in serum. The important results of examinations from different work groups and from own experiments were summarized in tabular form and evaluated from the statistic point of view. The results show that in more than 90% of all cases, the amylase system is suitable to identify exposure beyond 0,5 to 1 Gy, approximately. However, this is only possible if the salivary glands were also exposed and blood samples are taken about 18 hours after exposure. For the differentiation between induced increase of amylase from disease and radiation induced increase, it is recommended to carry out the isoamylase test, which makes it possible to distinguish between the individual enzymes. The assessment of the total amylase is appropriate to detect, with a range of significance of P = 0,05 that radiation exposure has occurred. The increase of activity is dose dependent when the salivary glands lie in the radiation field, however, the variations of activity are very high. Therefore the radiation dose cannot be considered. Only in cases where a very high radiation induced increase of activity is observed, a rough estimation of dose at the parotid glands can be made. (orig./MG)

  17. Enhanced amylase production by fusarium solani in solid state fermentation

    International Nuclear Information System (INIS)

    The present study illustrates the investigation carried out on the production of amylase by Fusarium species under solid state fermentation. All the tested Fusarium species were capable of producing amylase. A selected F. solani isolate SY7, showed the highest amylase production in solid state fermentation. Different substrates were screened for enzyme production. Among the several agronomic wastes, wheat bran supported the highest yield of amylase (141.18 U/g of dry substrate) after 3 days of incubation. Optimisation of the physical parameters revealed the optimum pH, temperature and moisture level for amylase production by the isolate as 8.0, 25 C and 70%, respectively. The above results indicate that the production of amylase by F. solani isolate SY7 could be improved by a further optimisation of the medium and culture conditions. (author)

  18. Clinical use of amylase clearance and isoamylase measurements. (United States)

    Levitt, M D


    Isoamylase determinations and measurements of the ratio of the renal clearance of amylase relative to creatinine (CAm/CCr) were employed in an attempt to improve the diagnostic accuracy of the standard amylase measurement. An elevated CAm/CCr reflects defective proximal tubular reabsorption of amylase which occurs in virtually all patients with clear-cut acute pancreatitis. However, other conditions that apparently are associated with acute defective tubular function, such as burns and diabetic acidosis, may cause an elevated ratio. Thus, elevations of CAm/CCr cannot be considered to be specific for acute pancreatitis. Pancreatic isoamylase represents, on the average, about 33% of the normal serum amylase activity, whereas about 66% is salivary-type isoamylase. Isoamylase measurements are useful in determining whether an elevated value for serum amylase activity is of pancreatic origin. However, this measurement is not useful for determining whether patients with normal serum amylase activity have pancreatitis.

  19. Effect of tetracycline administration on serum amylase activity in calves


    Zendehbad, Bamdad; Alipour, Adeleh; Zendehbad, Hussein


    Tetracycline and related compounds are used extensively as broad spectrum antibiotics in the treatment of bacterial infections in ruminants. Tetracycline may cause acute pancreatitis which may result in increased serum amylase activity. However, it has been shown that administration of oxytetracycline in human results in decrease serum amylase activity. In this study changes in serum amylase activity were measured in 20 clinically healthy calves following intravenous injection of oxytetracycl...

  20. Immunohistochemical analysis of amylase isoenzymes in thyroid cancer.


    Higashiyama, M; Doi, S; Tomita, N; Monden, T.; Murotani, M.; Kawasaki, Y.; Kobayashi, T.; Shimano, T; Ogawa, M; Takai, S


    The expression of amylase in various histological types of thyroid cancer was studied by an immunohistochemical technique, using a polyclonal antiamylase antiserum and two monoclonal antibodies specific for salivary and pancreatic-type amylases, respectively. Amylase was expressed in 21 of 24 (88%) thyroid cancers by polyclonal antiserum analysis. Analysis by monoclonal antibodies, however, showed that only 13 (54%) cases and three (13%) cases contained salivary-type and pancreatic-type amyla...

  1. Value of repeating amylase levels in abdominal pain


    Rajaraman Durai; Alexandras Uzkalnis


    Rajaraman Durai1, Alexandras Uzkalnis21Specialist registrar, 2Consultant surgeon, Department of Surgery, University Hospital Lewisham, London, SE13 6LH, UKSerum amylase and lipase are commonly used tests for diagnosing pancreatitis. Serum amylase level is usually high in the early days of pancreatitis which subsequently decreases. Serum lipase is not routinely available in every hospital. We report an unusual case of pancreatitis where amylase was normal initially then it began to rise.

  2. Relative effectiveness of mutagens on amylase production in Aspergillus wentii

    International Nuclear Information System (INIS)

    Three physical mutagens (UV light and γ- and X-rays) and 3 chemical mutagens (N-methyl-N-nitro-N-nitrosoguanidine, hydroxylamine and nitrous acid) were tested for their ability to produce mutants of A. wentii Wehmer (IMI 17295) having altered amylase activity. There was marked variation in amylase activity among the mutants, increase, decrease or complete absence of such activity was noticed. Nitrous acid was most effective in inducing high yielding amylase producing mutants. (author)

  3. Serum amylase determinations and amylase to creatinine clearance ratios in patients with chronic renal insufficiency. (United States)

    Tedesco, F J; Harter, H R; Alpers, D H


    Patients with severe chronic renal failure may have significant hyperamylasemia in the absence of clinical symptoms or signs of acute pancreatitis. Amylase to creatinine clearance (CA/CC) ratios were usually elevated in patients with chronic renal failure and were not helpful in evaluating the possibility of acute pancreatitis. The mean amylase to creatinine clearance ratio for the controls with normal renal function was 1.24 +/- 0.13. In patients with chronic renal failure, it was 3.17 +/- 0.42 (P less than 0.001). Serum amylase isoenzyme patterns revealed no difference in salivary to pancreatic isoenzyme ratios between normals (1.04 +/- 0.12) and patients with severe renal insufficiency without evidence of pancreatic disease (1.07 +/- 0.13). The isoenzymes were helpful in excluding the diagnosis of pancreatic in 1 renal failure patient whose hyperamylasemia was primarily salivary in origin and in confirming the diagnosis in another who had only a pancreatic band.

  4. Amylase-creatinine clearance ratios and serum amylase isoenzymes in moderate renal insufficiency. (United States)

    Banks, P A; Sidi, S; Gelman, M L; Lee, K H; Warshaw, A L


    Both the amylase-creatinine clearance ratio (normal 1.55%) and proportion of pancreatic isoamylase in serum (normal 41.0%) increase in acute pancreatitis, and are therefore useful measurements to support that diagnosis. Whether renal insufficiency interferes with the accuracy and specificity of these tests has been debated. Our study indicates that even moderate renal insufficiency (creatinine clearance 30.5 ml/minute) raises the amylase-creatinine clearance ratio (3.23%) close enough to values characteristic of acute pancreatitis (4.41%) to cause potential diagnostic confusion. The fraction of pancreatic isoamylase in serum is also increased (69.9%), but not to the levels of acute pancreatitis (91.0%). We therefore caution against the use of the amylase-creatinine clearance ratio for the diagnosis of acute pancreatitis in patients with moderate renal insufficiency.


    Directory of Open Access Journals (Sweden)

    K S Chandrashekharaiah


    Full Text Available Amylase s are hydrolytic enzymes which are widely distributed in nature, animals, plants and microorganisms. Amylases are of great significance in present - day biotechnology. In present study, amylases are isolated from the soaked seeds of Mucuna pruriens under extreme acidic conditions. Conventional protein purification techniques such as salt fractionation, ion exchange chromatography on CM - cellulose and sephadex G - 75 was employed for the purification of amylase from the seeds of Mucuna pruriens . The amy lase activity was eluted in one peak. The specific activity and yield of the purified amylase was 6.25 and 29.99, respectively. Native PAGE, SDS - PAGE and gel electrofocussing were employed to establish homogeneity of the purified amylase. SDS - PAGE and gel - filtration chromatography on sephadex G - 75 was used to determine the molecular weight of the purified amylase. The purified amylase was nearly homogenous and its molecular weight was found to be 78.4 kDa. The optimum pH and temperature of th e purified amyl ase were 7.0 and 50 o C, respectively. The isolectric pH of the purified amylase was 7.2 and the activity was linear up to 60 minutes

  6. Cloning and characterization of the beta-amylase gene from Bacillus polymyxa.


    Friedberg, F; Rhodes, C.


    The gene for beta-amylase was isolated from Bacillus polymyxa by molecular cloning in B. subtilis. B. subtilis cells containing this gene express and secrete an amylase which resembles the B. polymyxa beta-amylase and barley beta-amylase in terms of the products it generates during carbohydrate hydrolysis. Starch hydrolysis with this beta-amylase produces maltose, not glucose, whereas maltotriose and cycloheptaose are resistant to the action of this beta-amylase. The enzyme has a molecular we...

  7. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii. (United States)

    Nikitkova, A E; Haase, E M; Scannapieco, F A


    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii. PMID:22759313

  8. Functional significance of amylase polymorphism in Drosophila melanogaster. III. Ontogeny of amylase and some alpha-glucosidases. (United States)

    Hoorn, A J; Scharloo, W


    Changes in amylase (E.C., maltase (E.C., sucrase, and PNPGase activities in relation to changes in wet weight and protein content were studied during the development of larvae and adult flies from two strains of Drosophila melanogaster, homozygous for different amylase alleles. All alpha-glucosidase activities increase exponentially during a large part of larval development, parallel to the increase in weight, and drop at the end of the third instar. Amylase activity of the Amy1 strain follows the same pattern. In contrast, amylase activity of the Amy4,6 strain continues its exponential increase longer. In the third larval instar amylase activity in the Amy4,6 strain becomes much higher than in the Amy1 strain. During the first hours of adult life amylase activity of the two strains does not differ. Then Amy4,6 activity starts to rise and becomes much higher (4-5 times) than Amy1 amylase activity, which remains approximately constant. All adult enzyme activities are much higher than in larvae. Comparison of enzyme activity of amylase and alpha-glucosidases in larvae and adults confirms that differences in amylase activities can become important only when starch is a limiting factor in the food.

  9. a-Amylase activity during pullulan production and a-Amylase gene analyses of Aureobasidium pullulans (United States)

    The fungus Aureobasidium pullulans is the source of commercially produced pullulan, a high molecular weight polysaccharide that is used in the manufacture of edible films. It has been proposed that alpha-amylase negatively affects the molecular weight of pullulan in late cultures. Based on a recen...

  10. Distribution of alpha-amylase activity in selected broiler tissues. (United States)

    Rodeheaver, D P; Wyatt, R D


    In an examination of broiler alpha-amylase, significant variation in the serum enzyme activity level was noted, adult levels were lower than those of young chicks. Analysis of alpha-amylase activity in various body fluids and tissues of 11-day and 7-week-old broilers indicated that the liver cannot be considered a source of alpha-amylase, although there was activity in both liver tissue and bile of 10 units/g wet weight and 35 units/100 ml, respectively. Fluid from the oral cavity had low levels of alpha-amylase activity, less than 100 units/100 ml, which decreased with age, indicating that the salivary glands may synthesize some alpha-amylase but are not a primary source. Sonication of the pancreatic homogenates was found to significantly increase the apparent activity of alpha-amylase 35-fold over unsonicated homogenates. The pancreas was the major source of alpha-amylase with activities ranging from 89 X 10(2) to 445 X 10(2) units/g wet weight. The level of activity increased with age of the bird. The electrophoretic zymograms of serum, liver, and pancreatic homogenates indicate a similar pancreatic origin for the alpha-amylase found in each tissue or fluid.

  11. Method for using a yeast alpha-amylase promoter

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway (Richland, WA); Skeen, Rodney S. (Pendleton, OR); Hooker, Brian S. (Kennewick, WA); Anderson, Daniel B. (Pasco, WA)


    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  12. Application of microbial α-amylase in industry - A review

    Directory of Open Access Journals (Sweden)

    Paula Monteiro de Souza


    Full Text Available Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  13. Thermostable, Raw-Starch-Digesting Amylase from Bacillus stearothermophilus


    Kim, Jaeyoung; Nanmori, Takashi; Shinke, Ryu


    An endospore-forming thermophilic bacterium, which produced amylase and was identified as Bacillus stearothermophilus, was isolated from soil. The amylase had an optimum temperature of 70°C and strongly degraded wheat starch granules (93%) and potato starch granules (80%) at 60°C.

  14. The Amylase Project: Creating a Classroom of Biotechnologists. (United States)

    Sweeney, Diane


    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  15. Adsorption of amylase enzyme on ultrafiltration membranes

    DEFF Research Database (Denmark)

    Beier, Søren; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios;


    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of an amylase-F has been measured on two different ultrafiltration membranes, both with a cut-off value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-mo...... is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects can not be neglected. Therefore stagnant film theory and the osmotic pressure model can describe the dependency between flux and bulk concentration....

  16. The activity of granulocyte alpha-amylase in acute appendicitis. (United States)

    Zakrzewska, I; Gajda, R


    The activity of alpha-amylase was measured in isolated granulocytes, serum and urine of 35 patients with acute appendicitis. The measurements were performed before operation and on the 7th day after operation. Slightly increased activity of alpha-amylase was found in the serum and urine of 15 patients. On the 7th day after operation the activity of this enzyme reached normal value. The activity of granulocyte alpha-amylase was elevated in 22 patients. In 2 of them the increased activity still maintained on the 7th day after operation. Positive correlation between the serum and granulocyte alpha-amylase activities was found. These observations allow to conclude that granulocytes are the source of increased alpha-amylase activity in the serum of patients with acute appendicitis.

  17. The activity of granulocyte alpha-amylase in acute appendicitis. (United States)

    Zakrzewska, I; Gajda, R


    The activity of alpha-amylase was measured in isolated granulocytes, serum and urine of 35 patients with acute appendicitis. The measurements were performed before operation and on the 7th day after operation. Slightly increased activity of alpha-amylase was found in the serum and urine of 15 patients. On the 7th day after operation the activity of this enzyme reached normal value. The activity of granulocyte alpha-amylase was elevated in 22 patients. In 2 of them the increased activity still maintained on the 7th day after operation. Positive correlation between the serum and granulocyte alpha-amylase activities was found. These observations allow to conclude that granulocytes are the source of increased alpha-amylase activity in the serum of patients with acute appendicitis. PMID:7497089

  18. Albumin activation of urinary amylase as determined with the Du Pont aca. (United States)

    Garber, C C; Carey, R N


    Protein activation of urinary alpha-amylase (EC activity was observed during an evaluation of the Du Pont aca procedure for the determination of urinary alpha-amylase. This activation effect became constant for urinary albumin concentrations exceeding 1.50 g/liter. It is recommended that urinary alpha-amylase be analyzed with sufficient albumin added to maximize this effect. The aca alpha-amylase procedure is compared to an amyloclastic method for both serum and urine analysis. Expected ranges are presented for the aca method for serum and urinary amylase, amylase clearance, and the amylase clearance/creatinine clearance ratio.

  19. The influence of hydrochlorothiazide and tripamide on serum and urinary amylase. (United States)

    Conrad, K A; Fagan, T C; Simons, J A


    Pancreatitis and asymptomatic elevations of serum amylase have been reported after therapy with thiazide diuretics. In the current study, the effects of hydrochlorothiazide and tripamide treatment on serum and urinary amylase excretion were investigated in 12 hypertensive volunteers. Two patients developed modest elevations of the serum amylase above the normal range after 12 weeks of treatment with hydrochlorothiazide 50 mg daily, but the mean serum amylase did not change. Hydrochlorothiazide did not produce a statistically significant increase in urinary amylase excretion but did reduce the ratio of salivary amylase/creatinine clearance in a two-hour urine collection. Tripamide 10 mg daily had no effect on serum or urinary amylase.

  20. Sensitivity of the amylase-creatinine clearance ratio in acute pancreatitis. (United States)

    Farrar, W H; Calkins, G


    An elevated amylase-creatinine clearance ratio has been established as being highly specific for the diagnosis of acute pancreatitis. In the present study, the sensitivity of this test was compared to that of the serum amylase and the one-hour urinary amylase test in 29 patients with acute pancreatitis. Abnormal elevations of the amylase-creatinine clearance ratio were found less frequently than abnormal elevations of the serum and one-hour urinary amylases. Moreover, abnormal elevations of the amylase-creatinine clearance ratio showed less deviation from normal and values returned to normal sooner than those of the serum and one-hour urinary amylases. When compared to the serum amylase and the one-hour urinary amylase tests, the amylase-creatinine clearance ratio is a relatively insensitive test in patients with acute pancreatitis.

  1. Estimation of restraint stress in rats using salivary amylase activity. (United States)

    Matsuura, Tetsuya; Takimura, Ryo; Yamaguchi, Masaki; Ichinose, Mitsuyuki


    The rat is an ideal model animal for studying physical and psychological stresses. Recent human studies have shown that salivary amylase activity is a useful biomarker of stress in our social life. To estimate the usefulness of amylase activity as a biomarker of stress in rats, we analyzed changes in physiological parameters including amylase activity and anatomical variables, which were induced by a mild restraint of paws (10 min, 3 times/week, 9 weeks). The quantities of food and water intake and excretion amount of the stress rats were smaller than those of the control rats during the experimental period (5-13 weeks). The body weight of the stress rats decreased compared with that of the control rats. Moreover, the enlargement of the adrenal gland was confirmed in the stress rats, indicating that the mild restraint caused a chronic stress response. The amylase activities of the stress rats were significantly greater than those of the control rats at 5 weeks of age. However, the amylase activity of the stress rats decreased compared with that of the control rats after 6 weeks of age. These results indicate that amylase activity is increased by acute stress and reduced by chronic stress, which is caused by repeated restraint stress. In conclusion, amylase activity is a useful biomarker of acute and chronic stresses in rats. PMID:22753135

  2. Mass Spectrometric Analysis of Whole Secretome and Amylase-precipitated Secretome Proteins from Streptococcus gordonii


    Maddi, A; Haase, EM; Scannapieco, FA


    Oral biofilm (dental plaque) is formed by the initial adhesion of “pioneer species” to salivary proteins that form the dental pellicle on the tooth surface. One such pioneer species, Streptococcus gordonii, is known to bind salivary amylase through specific amylase-binding proteins such as amylase-binding protein A (AbpA). Recent studies have demonstrated that once bound, salivary amylase appears to modulate gene expression in S. gordonii. However, it is not known if this amylase-induced gene...

  3. Amylase inhibits Neisseria gonorrhoeae by degrading starch in the growth medium.


    Gregory, M R; Gregory, W W; Bruns, D.E.; Zakowski, J J


    Highly purified salivary alpha-amylase inhibited the growth of fresh isolates of Neisseria gonorrhoeae on GC agar base medium supplemented with 2% IsoVitaleX (BBL Microbiology Systems). Hydrolysis of starch in the medium by amylase resulted in a negative starch-iodine test. However, purified amylase did not inhibit gonococcal growth on agar plates that contained hemoglobin (chocolate agar). This effect was not caused by inhibition of amylase, since amylase activity was the same in the presenc...

  4. Alpha-amylase gene transcription in tissues of normal dog.


    Mocharla, H; Mocharla, R; Hodes, M E


    We studied the distribution of alpha-amylase mRNA in normal dog tissues by northern blotting (NB) and reverse transcription-polymerase chain reaction (RT-PCR) with human pancreatic (AMY2) and salivary (AMY1) alpha-amylase cDNA-specific primers. Analysis of poly(A+) RNA from various normal tissues by NB indicated the presence of detectable levels of alpha-amylase mRNA transcripts only in pancreas. Dot-blot analysis of DNA amplified with primers common to both (human) isoamylase mRNAs showed pr...

  5. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.;


    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...

  6. Extracellular amylase(s) production by fungi Botryodiplodia theobromae and Rhizopus oryzae grown on cassava starch residue. (United States)

    Ray, R C


    The fungi Botryodiplodia theobromae and Rhizopus oryzae produce extracellular amylase when grown on a liquid medium containing 2% (WN) soluble starch or cassava starch residue(CSR) (as starch equivalent), a waste generated after extraction of starch from cassava, as the sole carbon source. Using CSR as the sole carbon source, the highest amylase activity of 3.25 and 3.8 units (mg, glucose released x ml(-1) x h(-1)) were obtained in shake flask cultures during the late stationary phase of growth of B. theobromae and R. oryzae, respectively. These values were slightly lower than the values obtained using soluble starch as the carbon source. Maximum enzyme synthesis in CSR incorporated medium occurred at the growth temperature of 30 degrees C and pH 6.0. Presence of inorganic NH4+ salts like ammonium acetate and ammonium nitrate in culture medium yielded more amylase than the other nitrogen sources. Amylase(s) production in the controlled environment of a Table-Top glass Jar Fermenter (2-L capacity) was 4.8 and 5.1 units for B. theobromae and R. oryzae, respectively using CSR as the carbon substrate. It is concluded that CSR, a cheap agricultural waste obtained after starch extraction from cassava could replace soluble starch as carbon substrate for commercial production of fungal amylase(s).

  7. Nanoactivator mediated modifications in thermostable amylase from Bacillus licheniformis. (United States)

    Khairnar, Rajendra S; Mahabole, Megha P; Pathak, Anupama P


    Gram-positive rod-shaped thermophilic bacteria were isolated using samples collected from terrestrial natural thermal spring located at Unkeshwar (Longitude 78.22 degree East to 78.34 degree East, Latitude 19 degree 34' North to 19 degree 40' North), District Nanded, Maharashtra State, India. The isolates were then cultivated using selective media and identified using culture-dependent techniques. One prominent isolate (UN1) exhibited high temperature stability and remarkable amylase production and was identified as Bacillus licheniformis. Amylase production was carried out in starch media and the enzyme was partially purified and characterized for optimization of pH and temperature. Amylolytic activity of the enzyme was determined. Nanoactivator-mediated modifications were carried out to enhance amylolytic activity of the partially purified amylase. Three-fold increase in catalytic efficiency of amylase was obtained after modification. PMID:23350283

  8. Coordination of murine parotid secretory protein and salivary amylase expression.


    Poulsen, K; Jakobsen, B K; Mikkelsen, B M; Harmark, K; Nielsen, J T; Hjorth, J P


    PSP, parotid secretory protein, and salivary amylase are the major secretory proteins of mouse parotid gland where they appear in a constant ratio. Here we describe the isolation of the PSP gene and show through expression analysis on this and the salivary amylase gene that the two genes are transcribed in a coordinate fashion in adult animals, whereas the activation profiles are different during postnatal development. An explanation is put forward that involves activation of the genes at dif...

  9. Anaerobic Threshold and Salivary α-amylase during Incremental Exercise


    Akizuki, Kazunori; Yazaki, Syouichirou; Echizenya, Yuki; Ohashi, Yukari


    [Purpose] The purpose of this study was to clarify the validity of salivary α-amylase as a method of quickly estimating anaerobic threshold and to establish the relationship between salivary α-amylase and double-product breakpoint in order to create a way to adjust exercise intensity to a safe and effective range. [Subjects and Methods] Eleven healthy young adults performed an incremental exercise test using a cycle ergometer. During the incremental exercise test, oxygen consumption, carbon d...

  10. Screening of marine actinobacteria for amylase enzymes inhibitors


    Raja, S.; Ganesan, S.; Sivakumar, K.; Thangaradjou, T.


    Amylase inhibitor producing actinobacteria were isolated and characterized from terrestrial environment and there is no much report found from marine environment, hence in the present study, 17 strains isolated from the rhizosphere sediments of mangroves were tested for their amylase inhibition ability. Seawater requirement test for the growth of actinobacteria found that the strains SSR-3, SSR-12 and SSR-16 requires at least 50% and SSR-6 requires at least 25% seawater for their growth. The ...

  11. The structure of two distinct pancreatic amylase genes in mouse strain YBR

    DEFF Research Database (Denmark)

    Mikkelsen, BM; Clark, ME; Christiansen, Gunna;


    The amylase complex on mouse chromosome 3 encodes both salivary and pancreatic amylase. It appears that one active gene is present for salivary amylase, whereas pancreatic amylase in some strains is coded by at least 4, and perhaps by more than 10, genes. Strain YBR is different from other strains...... in that it produces twice as much salivary amylase. Pancreatic amylase in YBR is present as two different protein forms, A beta and B beta, the sum of which amounts to only one-third of that in, for instance, strain A/J. YBR chromosomal DNA was cloned in phage gamma, followed by restriction and heteroduplex analysis...... of recombinant phages carrying amylase genes. Among 32 phage isolates, 5 carried parts of the salivary amylase sequence. The remaining phage isolates contained pancreatic amylase-like sequences and represented three nonoverlapping genomic regions, i.e., one of 34 kb containing a complete gene, PAN-II beta...

  12. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    Energy Technology Data Exchange (ETDEWEB)

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. (State Univ. of New York, Buffalo (USA))


    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  13. Some studies of alpha-amylase production using Aspergillus oryzae. (United States)

    Esfahanibolandbalaie, Z; Rostami, K; Mirdamadi, S S


    The extracellular alpha-amylase production by Aspergillus oryzae was studied in submerged fermentation using an Adlof-Kuhner orbital shaker. The effect of initial pH values in the range of 4 to 7.5 on enzyme production was investigated and initial pH medium of 6.2 +/- 0.1 resulted in enhanced alpha-amylase production. The effect of carbon and nitrogen source and composition was examined and it has been observed that corn starch concentration of 15 g L(-1) has sound effect on enzyme production. The medium containing corn starch, sodium nitrate resulted in considerable higher enzyme production. Further, the yeast extract of 2.5 g L(-1) in the medium produced higher enzyme in view to other organic nitrogen sources. The effect of temperature on alpha-amylase production from 20 to 40 degrees C has been studied and at 35 +/- 1 degrees C higher alpha-amylase has been obtained. The effect of shaker's speed on alpha-amylase production from 50 to 200 rpm was investigated. And at about 180 rpm higher enzyme production has been observed. In the present study, it has been found that glucose has repressing effect on a-amylase production using A. oryzae PTCC5164. PMID:19260332

  14. Production of Alpha Amylase by Bacillus cereus in Submerged Fermentation

    Directory of Open Access Journals (Sweden)

    Helen H. Raplong


    Full Text Available Microorganisms have the ability to secrete enzymes when they are grown in the presence of certain substrates. Amylases are among the most important industrial enzymes and are of great significance in biotechnological studies. Bacteria belonging to the genus Bacillus were isolated using mannitol egg yolk polymyxin B (MYP agar a highly selective media for Bacillus cereus isolation. The isolates were tested for α-amylase production on nutrient agar supplemented with starch and in submerged fermentation. The bacteria isolated and identified (using the Microgen Bacillus identification kit were all Bacillus cereus and SB2 had the largest zone of hydrolysis of 12mm on nutrient agar supplemented with starch as well as the highest enzyme activity of 1.62U/ml. Amylase activity of 2.56U/ml was obtained after 24 hours incubation in submerged fermentation. When amylase enzyme production parameters where optimized, maximum amylase activity was obtained at a pH of 6.5, temperature of 350C, incubation time of 24 hours and 4% inoculums concentration. Bacillus cereus SB2 is a potential isolate for alpha-amylase production with soluble starch as the sole carbon source in submerged fermentation.

  15. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    International Nuclear Information System (INIS)

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with 125I-labeled HSMSL or 125I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of [125I]alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch

  16. Study of Serum Amylase and Serum Cholinesterase in Organophosphorus Poisoning

    Directory of Open Access Journals (Sweden)

    Sharan Badiger


    Full Text Available Background: Poisoning due to organophosphorus compounds is most commonly seen. Earlier plasma cholinesterase level was used to assess the severity of poisoning. Presently serum amylase is being recommended as a better indicator of severity. Aims and Objectives: To study plasma cholinesterase and serum amylase levels in acute organophosphorus and to correlate serum amylase levels with clinical severity and outcome. Material and Methods: A total of 80 patients in the study admitted to a tertiary care centre within 24 hours with a history of organophosphorus poisoning were included in study. Estimation of plasma cholinesterase and serum rd amylase was done at the time of admission, and on 3 th day and on 5 day. Results: Occurrence of organophosphorus poisoning was more common among age group 21-30 years and among males (57.5%. They were 25 (31.2% farmers, 23 (28.8% st u d e n ts, a n d 2 2 ( 2 7 . 5% h o u s ewi v e s. Monocrotophos (45.0% was commonly used compound. Mean value of plasma cholinesterase and serum amylase at admission are 3693 U/L, and 185.4 U/L. There was significant inhibition of plasma cholinesterase and elevation of serum amylase at th admission with return to normal values on 5 day. Conclusion: Plasma cholinesterase inhibition 200 U/L has been associated with poor prognosis and proneness to respiratory failure.

  17. Expression of the human amylase genes: recent origin of a salivary amylase promoter from an actin pseudogene.


    Samuelson, L C; Wiebauer, K; Gumucio, D L; Meisler, M H


    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. We have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at ...

  18. Study of total serum amylase, its salivary and pancreatic fraction and the pancreatic to salivary amylase ratio in testicular tumours.


    Khanolkar M; Sirsat A; Deshmane V; Kamat M


    Serum levels of total amylase, its pancreatic fraction (P), salivary fraction (S), and the ratio of pancreatic to salivary fraction (P/S) were determined in 52 cases of histologically proved testicular germ cell tumours and 33 healthy controls. Total serum amylase remained unchanged, but the salivary fraction had a lower mean value. P/S ratio and the pancreatic fraction were significantly elevated in both seminomatous and non- seminomatous tumours. The ratio was more frequently raised in non-...

  19. Elevated amylase creatinine clearance ratio and normal serum amylase levels in chronic relapsing pancreatitis after partial pancreatectomy. (United States)

    Cattau, E L; Garcia-Torres, F


    A 29-year-old woman admitted for alcohol detoxification five years after a 90% distal pancreatectomy for chronic pancreatitis had abdominal pain similar to that associated with preoperative pancreatitis. Although her clinical course was consistent with recurrent pancreatitis, the serum amylase level remained normal, but the amylase creatinine clearance ratio became elevated and then returned to normal, paralleling her clinical course. The ACCR may be a useful laboratory method in diagnosing chronic recurrent pancreatitis in patients with decreased functional pancreatic tissue.

  20. Changes of serum amylase, its isozyme fractions and amylase-creatinine clearance ratio in dogs with experimentally induced acute pancreatitis. (United States)

    Akuzawa, M; Morizono, M; Nagata, K; Hayano, S; Sakamoto, H; Yasuda, N; Okamoto, K; Kawasaki, Y; Deguchi, E


    To investigate the diagnostic application of amylase to canine pancreatic diseases, serum amylase activities, its isozyme fractions and amylase-creatinine clearance ratio (ACCR) were analyzed in normal intact dogs and dogs experimentally induced acute pancreatitis. There was no statistic difference between normal male and female dogs. Amylase specific activities in pancreatic tissue extracts were more than 2,300 times higher than that in serum, and were also higher than those in other tissues; parotid and mandibular salivary glands, lung, heart, liver, spleen, duodenum, jejunum, ileum and kidney. Following the chloroform injection into the pancreatic tissue, WBC increased from 6 to 240 hr and serum glucose significantly increased at 72 and 96 hr, and no urine glucose was detected. BUN as well as serum and urine creatinine showed normal levels. ACCR increased until 96 hr without statistic significance. Serum amylase activities increased significantly after 3 hr and its isozyme was separated into 4 fractions (Amy1-Amy4) in contrast to 3 fractions (Amy2-Amy4) in intact dogs. Since this extra Amy1 seen from 1 hr increasing after 6 hr similarly to other 3 fractions, the evaluation of serum amylase and its isozyme fractions was indicated to be useful for the diagnosis of acute pancreatitis in dogs.

  1. Changes of serum amylase, its isozyme fractions and amylase-creatinine clearance ratio in dogs with experimentally induced acute pancreatitis. (United States)

    Akuzawa, M; Morizono, M; Nagata, K; Hayano, S; Sakamoto, H; Yasuda, N; Okamoto, K; Kawasaki, Y; Deguchi, E


    To investigate the diagnostic application of amylase to canine pancreatic diseases, serum amylase activities, its isozyme fractions and amylase-creatinine clearance ratio (ACCR) were analyzed in normal intact dogs and dogs experimentally induced acute pancreatitis. There was no statistic difference between normal male and female dogs. Amylase specific activities in pancreatic tissue extracts were more than 2,300 times higher than that in serum, and were also higher than those in other tissues; parotid and mandibular salivary glands, lung, heart, liver, spleen, duodenum, jejunum, ileum and kidney. Following the chloroform injection into the pancreatic tissue, WBC increased from 6 to 240 hr and serum glucose significantly increased at 72 and 96 hr, and no urine glucose was detected. BUN as well as serum and urine creatinine showed normal levels. ACCR increased until 96 hr without statistic significance. Serum amylase activities increased significantly after 3 hr and its isozyme was separated into 4 fractions (Amy1-Amy4) in contrast to 3 fractions (Amy2-Amy4) in intact dogs. Since this extra Amy1 seen from 1 hr increasing after 6 hr similarly to other 3 fractions, the evaluation of serum amylase and its isozyme fractions was indicated to be useful for the diagnosis of acute pancreatitis in dogs. PMID:7521216

  2. Interstrain Variation in Amylase Gene Copy Number and mRNA Abundance in Three Mouse Tissues


    Meisler, Miriam H.; Antonucci, Tammy K.; Treisman, Laurelee O.; Gumucio, Deborah L.; Samuelson, Linda C.


    Amylase expression in strain YBR differs in several respects from the standard mouse phenotype. The synthesis of salivary amylase is elevated twofold in YBR mice and the synthesis of pancreatic amylase is reduced to one-half the normal rate. We have compared the concentrations of amylase mRNA in the parotid, liver and pancreas of YBR mice with those in strains A/J and C3H. We observed differences in amylase mRNA abundance which can account for the levels of amylase protein synthesis in the pa...

  3. [Alpha-amylase determination in acute pancreatitis: selection of a reference standard]. (United States)

    Bachmann, C; Colombo, J P; Lorenz, E


    It has been investigated which of the amylase determinations agrees most closely with the clinical diagnosis in a group of patients with acute pancreatitis and in a group with other diseases producing amylase elevation. By measuring the amylase in a urine specimen related to its creatinine concentration fewer values within the range of reference in patients with pancreatitis and also fewer falsely elevated values in the second group were observed when compared to amylase in plasma, urinary amylase activity per volume or the amylase/creatinine clearance ratio.

  4. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment


    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng


    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using...


    Directory of Open Access Journals (Sweden)



    Full Text Available : INTRODUCTION: Hypertension is one of the risk factors for cardiovascular disease and causes progressive damage to kidney in a long term process. Hypertension impairs glomerular function and also leads to subclinical atherogenesis, there is a excretion of low molecular weight compounds like albumin and amylase in urine. This study was conducted to analyze the changes in amylase levels in hypertension. MATERIAL AND METHODS: This is a hospital based study. The patients attending the medicine department were selected for the study. 60 subjects were selected based on history and clinical examination consisting of 30 hypertensive patients and 30 normotensive subjects in the age group 35-60 years. Blood samples collected in vacutainers were analyzed in the clinical biochemistry laboratory. Serum samples were analyzed for total protein, albumin and amylase. RESULT: The study showed a statistically significant change in the levels of serum albumin and amylase. The level of serum albumin was 3.71 ± 0.22 g/dl in cases while it was 4.14 ± 0.20 g/dl in controls. The serum amylase levels were 99.79 ±13.63 U/L in cases while it was 137.76 ± 16.86 U/L in the control. The p-value was 0.0001 which was statistically significant. CONCLUSION: The initial damage to glomerulus can be detected by the alteration in serum amylase values in hypertension. Thus serum amylase can be considered as an early marker for detecting the renal damage in hypertension

  6. [Are amylases in bakery products and flour potential food allergens?]. (United States)

    Baur, X; Sander, I; Jansen, A; Czuppon, A B


    The enzyme alpha-amylase from the mould Aspergillus oryzae (Asp o II) routinely used for the production of bread, cakes and pastries has in recent years been identified as an inhalative allergen for occupational diseases (bakers' asthma). It is doubtful whether this amylase in the final product, i.e. after the baking procedure, can still be regarded as an allergen. To clarify this question, detailed case histories on 138 subjects were recorded (98 allergics, 20 patients suffering form chronic intestinal diseases, 20 healthy controls). The clinical examinations included prick skin test and IgE antibody determination using one of the customary enzyme preparations. EAST showed a few of these 138 bread consumers to be weakly sensitized to the enzyme. One of the subjects displayed a significant reaction to alpha-amylase heated to 200 degrees C. As expected, eleven bakers sensitized to alpha-amylase by inhaling it in the workplace (positive prick test, positive case history) predominantly exhibited specific IgE antibodies to the native enzyme. Apart from one weakly positive finding, heated alpha-amylase yielded negative results in this collective. Baking conditions vary widely, especially with regard to single components, temperature and duration. Thus, further investigations as to residual allergenicity or the feasible occurrence of new antigenic determinants during the production of bread, cake and pastries are required. 27% of bakers examined and 9% of atopics showed antibodies to a flour inherent enzyme, a beta-amylase. On the whole, the selected conditions hinted at a weakly sensitizing potential inherent in baking flour and in added amylase. PMID:8209207

  7. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes. (United States)

    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L


    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result. PMID:27327179

  8. The mechanism of increased renal clearance of amylase in acute pancreatitis. (United States)

    Warshaw, A L; Lee, K H


    Amylase isoenzymes, separated by polyacrylamide gel electrophoresis, were measures in 25 normal persons (mean amylase to creatinine clearance ratio 3.0%), 15 patients with acute pancreatitis (mean clearance ratio 9.5%, P less than 0.0001), and 6 patients with hyperamylasemia due to common duct stones (mean clearance ratio 4.1%). Two isoamylases (P1, P2) resembling pancreatic isoenzymes and three isoamylases (S1, S2, S3) resembling salivary isoenzymes appeared regularly in normal serum and urine. Salivary amylases predominated in serum, but pancreatic amylases predominated in urine. This finding is consistent with renal clearance of pancreatic amylases exceeding that of salivary amylases under normal conditions. In patients with pancreatitis or common duct stones, essentially all of the increased amylase activity in serum and urine was due to pancreatic isoamylases (P1 and P2) in their normal proportions. No new or altered amylase isoenzymes were detected. The fraction of pancreatic amylases in the serum or urine was identical for the two diseases. Whereas the difference in amylase to creatinine clearance ratios observed between the two groups of patients is not a function of different amylase isoenzymes presented to the kidney, we conclude that the increased amylase clearance in acute pancreatitis is caused by an alteration of renal transfer of amylase, either at the glomerulus or tubule.

  9. Amylase:creatinine clearance ratios, serum amylase, and lipase after operations with cardiopulmonary bypass. (United States)

    Smith, C R; Schwartz, S I


    Forty-two adults who underwent cardiac operations were studied prospectively for evidence of clinical or subclinical pancreatitis. Clinically detectable pancreatitis was not seen. Serum amylase and lipase levels did not change significantly following operation. The amylase:creatinine clearance ratio (ACCR) immediately following operation was abnormally elevated in 31% of the samples obtained, and the mean ACCR increased from 2.08 +/- 1.85% before operation to 6.2% +/- 6.77% (P less than 0.05). An abnormally elevated ACCR was most often associated with a low urine creatinine concentration. The mean urine creatinine level decreased significantly from 78 +/- 53 mg/dl before operation to 38 +/- 49 mg/dl immediately following operation (P less than 0.02), and 73% of the samples obtained at that time had an abnormally low urine creatinine level (P less than 0.01). The abnormalities observed in ACCR and urine creatinine could not be related to any of several variables presumed to reflect the degree of perioperative physiologic stress, nor could they be related to postoperative hemodynamic performance. It was concluded that ACCR rises following cardiac operation because of perioperative changes in renal function, and not as a reflection of subclinical pancreatic injury.

  10. Amylase:creatinine clearance ratios, serum amylase, and lipase after operations with cardiopulmonary bypass. (United States)

    Smith, C R; Schwartz, S I


    Forty-two adults who underwent cardiac operations were studied prospectively for evidence of clinical or subclinical pancreatitis. Clinically detectable pancreatitis was not seen. Serum amylase and lipase levels did not change significantly following operation. The amylase:creatinine clearance ratio (ACCR) immediately following operation was abnormally elevated in 31% of the samples obtained, and the mean ACCR increased from 2.08 +/- 1.85% before operation to 6.2% +/- 6.77% (P less than 0.05). An abnormally elevated ACCR was most often associated with a low urine creatinine concentration. The mean urine creatinine level decreased significantly from 78 +/- 53 mg/dl before operation to 38 +/- 49 mg/dl immediately following operation (P less than 0.02), and 73% of the samples obtained at that time had an abnormally low urine creatinine level (P less than 0.01). The abnormalities observed in ACCR and urine creatinine could not be related to any of several variables presumed to reflect the degree of perioperative physiologic stress, nor could they be related to postoperative hemodynamic performance. It was concluded that ACCR rises following cardiac operation because of perioperative changes in renal function, and not as a reflection of subclinical pancreatic injury. PMID:6193594

  11. Effect of chemicals on fungal alpha-amylase activity. (United States)

    Ali, F S; Abdel-Moneim, A A


    The effect of 8 growth regulators at concentrations of 1,000, 5,000 and 10,000 ppm on the activity of fungal (Aspergillus flavus var. columnaris) alpha-amylase was studied. Indol acetic acid (IAA) and naphthalene acetic acid (NAA) inhibited alpha-amylase activity by 2% and 7% at 1,000 ppm. The other 6 growth regulators, indol butyric acid (IBA), gibberellic acid, cumarin, cycocel (CCC), atonik-G and kylar, did not inhibit but stimulated alpha-amylase activity (0 to 9%) at 1,000 ppm. All growth regulators studied inhibited alpha-amylase activity at 5,000 and 10,000 ppm concentration except kylar. The effect of organic acids and formaldehyde at 0.01, 0.005, and 0.001 M was studied. Acetic acid stimulated alpha-amylase at all concentrations, but formic acid, oxalic acid, lactic acid and citric acid inhibited alpha-amylase activity by 91, 100, 100 and 79%, respectively, at a concentration of 0.01 M, while by 31, 100, 15 and 20%, respectively, at 0.005 M. Formaldehyde induced 7, 3 and 2% inhibition at 0.01, 0.005 and 0.001 M, respectively. At 0.01 M either sorbitol or fructose inhibited alpha-amylase by 8%, Maltose 7%, sucrose 6%, phenol, glucose and galactose each by 5%, ethanol, glycerol, arabinose and sodium benzoate each by 4%, isopropanol and mannitol 1%, but methanol and ammonium citrate dibasic did not inhibit alpha-amylase. The results indicate that CuCl2, SnCl2, AgNO3 and Fe2(SO4)3 were the strongest inhibitors, followed by Cd(C2H3O2), HgCl2, Na2-EDTA, Na2HPO4, and CaCl2 in decreasing order. NaCl, NaBr and Mn SO4 did not inhibit alpha-amylase at concentrations from 10 mM to 0.01 mM. PMID:2515680

  12. Topographies of Organized Monolayer of α-Amylase Observed by Atomic Force Microscopy

    Institute of Scientific and Technical Information of China (English)


    In this paper, a-amylase organized monolayer was assembled on the surface of the PET-CO2- substrate in different conditions. The different topography of the a-amylase/PET monolayer was obtained by AFM in tapping mode.

  13. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens (United States)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.


    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  14. Zinc oxide nanoparticles as novel alpha-amylase inhibitors (United States)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.


    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  15. Thermo Stability Study of Crude Amylase from Bacillus Isolate

    Directory of Open Access Journals (Sweden)

    Moti Lal


    Full Text Available An amylolytic strain was collected from rotten potato and its activity evaluated. The isolated strain was cultivated for amylase production in shake flasks at 35±2oC and the fermentation pattern was studied. Optimum temperature for maximum enzyme synthesis was observed at 35°C, when initial pH of fermentation medium was adjusted to 5.5. Maximum extracellular amylase activity of 7.9 U/mL and the maximum intracellular activity of 320 U/mL was recorded. Although maximum biomass was present at 12.6 g/L but highest growth rate was observed between 08 to 40h with maximum at 36h. The extracellular amylase present in the broth was partially purified with an overall yield of 44% through purification procedure of ammonium sulphate precipitation. After completed extraction and partial purification and stabilization, the stability of enzyme was observed in a range of temperature and pH between 60°C-90°C and 2-8 pH respectively. Maximum enzyme activity was demonstrated at 90°C, and pH of 5.5 and 6.5. The thermo stability of the amylases of this Bacillus species was comparable to that of amylases from other microbial sources.

  16. The amylase creatinine clearance ratio in acute pancreatitis. (United States)

    Murray, W R; Mackay, C


    One hundred and twenty-two patients have been studied in order to evaluate the usefulness of the amylase creatinine clearance ratio (ACCR) as a simple diagnostic test for acute pancreatitis. Sixteen out of 17 patients with acute pancreatitis had significant elevations in ACCR; in only 10 of these 17 cases was the serum amylase greater than 1200iu/l. The mean ACCR was within the normal range in control patients, in patients with chronic gastro-intestinal disease and in patients with acute abdominal conditions excluding pancreatitis; however, the mean serum amylase was significantly greater in patients with acute abdominal conditions than in the control group (P less than 0-05). The ACCR remained significantly elevated in patients with acute pancreatitis for longer than either serum or urine amylase values. The findings of the study suggest that the amylase creatinine clearance ratio is a simple yet reliable diagnostic test which could be used when screening patients suspected of having acute pancreatitis.

  17. The amylase creatinine clearance ratio in acute pancreatitis. (United States)

    Murray, W R; Mackay, C


    One hundred and twenty-two patients have been studied in order to evaluate the usefulness of the amylase creatinine clearance ratio (ACCR) as a simple diagnostic test for acute pancreatitis. Sixteen out of 17 patients with acute pancreatitis had significant elevations in ACCR; in only 10 of these 17 cases was the serum amylase greater than 1200iu/l. The mean ACCR was within the normal range in control patients, in patients with chronic gastro-intestinal disease and in patients with acute abdominal conditions excluding pancreatitis; however, the mean serum amylase was significantly greater in patients with acute abdominal conditions than in the control group (P less than 0-05). The ACCR remained significantly elevated in patients with acute pancreatitis for longer than either serum or urine amylase values. The findings of the study suggest that the amylase creatinine clearance ratio is a simple yet reliable diagnostic test which could be used when screening patients suspected of having acute pancreatitis. PMID:890263

  18. Acquired amylase production induced by radiotherapy in a myeloma patient

    International Nuclear Information System (INIS)

    A 55-year-old patient with multiple myeloma (IgG-λ) diagnosed in November 1988 was admitted because of bone pain throughout the body. After plasmapheresis and several courses of chemotherapy, a massive tumor of the left thoracic wall involving the rib appeared. Radiotherapy was performed to ameliorate the severe chest pain, after which myelomatous pleural effusion appeared on the left side. The serum, urine and pleural effusion revealed increased activity of amylase of the salivary type. Amylase activity was also detected in the supernatant of myeloma cells cultured from pleural effusion. We reviewed 12 cases of ectopic amylase-producing multiple myeloma. All the cases except one have been reported from Japan, and hyperamylasemia in these cases was detected at diagnosis or during course of the illness. Moreover, cytogenetic analysis of myeloma cells of previous reports revealed structural abnormalities including chromosome 1, near the amylase gene locus. This case also showed t (1; 10) (q21?; q26) by examination of 8 metaphase derived from bone marrow. These observations suggested that ectopic amylase production was induced by irradiation to the plasmacytoma of thoracic wall. (author)

  19. [Sensitivity and specificity of blood amylase, amylase and creatinine clearance ratio and urinary amylase/urinary creatinine ratio in the diagnosis of acute pancreatitis]. (United States)

    Ligny, G; Meunier, J C; Hayard, P; Ligny, C; Van Cauter, J


    The sensitivity and specificity of amylasemia, the ratios of amylase/creatinine clearance and amylasuria/creatininuria were determined in four groups of patients: a control group (n = 43), patients with acute pancreatitis detected on computed tomography (n = 30, 25 cases of alcoholic pancreatitis), patients with an acute surgical abdomen without pancreatitis (n = 25), and patients with renal failure (n = 20). Sensitivity was defined for the acute pancreatitis group and specificity for the other groups. When amylasemia was greater than 20 UI/dl and the amylasuria/creatininuria ratio greater than 100, sensitivity was 98 per cent. The specificity of these two results in patients with an acute surgical abdomen was 98 per cent. When the ratio amylase/creatinine clearance ratio was greater than 4 sensitivity was 73 per cent and specificity in patients with acute surgical abdomen was 75 per cent. These two values were lower than those of the two preceding tests (p less than 0.01). Sensitivity of the association of an amylasemia greater than 13 UI/dl (m + 2SD) with a clearance ratio greater than 4 was 73 per cent. The amylase/creatinine clearance ratio did not seem to be reliable since its change was delayed with respect to the increase of amylasemia and amylasuria. This ratio has a poor specificity as it increased when the clearance of creatinine decreased in the group with an acute surgical abdomen associated with functional or organic renal failure. In these two groups, the correlation between the amylase/creatinine clearance ratio and creatininemia was significant. This suggested that the clearance of creatinine fell more rapidly than the clearance of amylase as renal failure increased.

  20. Identification and characterization of amylase binding protein C (AbpC) from Streptococcus mitis NS51


    Vorrasi, John; Chaudhuri, Biswendu; Haase, Elaine M.; Scannapieco, Frank A.


    A substantial proportion of the streptococcal species found in dental plaque biofilms are able to interact with the abundant salivary enzyme α-amylase. These streptococci produce proteins that specifically bind amylase. An important plaque species, Streptococcus mitis, secretes a 36-kDa amylase binding protein into the extracellular milieu. Proteins precipitated from S. mitis NS51 cell culture supernatant by the addition of purified salivary amylase were separated by SDS-PAGE, transferred to ...

  1. Impact of calcium on salivary α-amylase activity, starch paste apparent viscosity and thickness perception


    Morris, Cecile


    Thickness perception of starch-thickened products during eating has been linked to starch viscosity and salivary amylase activity. Calcium is an essential cofactor for α-amylase and there is anecdotal evidence that adding extra calcium affects amylase activity in processes like mashing of beer. The aims of this paper were to (1) investigate the role of salivary calcium on α-amylase activity and (2) to measure the effect of calcium concentration on apparent viscosity and thic...

  2. Studies on the production of alkaline α-amylase from Bacillus subtilis CB-18


    Ogbonnaya Nwokoro; Odiase Anthonia


    Background. Amylases are among the main enzymes used in food and other industries. They hydrolyse starch molecules into polymers composing glucose units. Amylases have potential applications in a number of industrial processes including foods and pharmaceutical industries. Alkaline α-amylase has the potential of hydrolysing starch under alkaline pH and is useful in the starch and textile industries and as an ingredient of detergents. Amylases are produced from plants, however, microbial...

  3. Application of microbial α-amylase in industry – A review


    Paula Monteiro de Souza; Pérola de Oliveira e Magalhães


    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential f...

  4. The use of the Rapignost strip for estimating urinary amylase levels.


    Touquet, V. L.; Wilcox, A H


    The Rapignost-Amylase urinary test strip (Behringwerke Laboratories) provides an estimation of urine amylase which takes a few minutes and is easy to perform. During a period of 9 months, 84 patients had their urine tested with this strip by casualty officers in the Accident and Emergency Department of St George's Hospital, London. In addition, urine amylase, and plasma amylase and creatinine were measured in the chemical pathology laboratory. In all but one instance, the result of the strip ...

  5. Exposure-response relations of alpha-amylase sensitisation in British bakeries and flour mills


    Nieuwenhuijsen, M.J.; Heederik, D.J.J.; Doekes, G; Venables, K M; Newman Taylor, A. J.


    OBJECTIVES: To describe the levels of exposure to fungal alpha-amylase in British bakeries and flour mills, and to describe the relation between exposure to alpha-amylase and sensitisation to fungal alpha- amylase. METHODS: 495 personal flour dust samples were taken in seven British bakeries and flour mills and analysed for alpha-amylase with an immunoassay. Workers at the sites were asked to fill out questionnaires on work related symptoms, smoking history, and work history, and they w...

  6. General Biochemical Characterization of Thermostable Extracellular β-Amylase from Clostridium thermosulfurogenes


    Hyun, H H; Zeikus, J G


    Clostridium thermosulfurogenes, an anaerobic bacterium which ferments starch into ethanol at 62°C, produced an active extracellular amylase and contained intracellular glucoamylase but not pullulanase activity. The extracellular amylase was purified 2.4-fold, and its general physicochemical and catalytic properties were examined. The extracellular amylase was characterized as a β-amylase (1,4-α-d-glucan maltohydrolase) based on demonstration of exocleavage activity and the production of malto...

  7. Regulation and genetic enhancement of beta-amylase production in Clostridium thermosulfurogenes.


    Hyun, H H; Zeikus, J G


    We studied the general mechanism for regulation of beta-amylase synthesis in Clostridium thermosulfurogenes. beta-Amylase was expressed at high levels only when the organism was grown on maltose or other carbohydrates containing maltose units. Three kinds of mutants altered in beta-amylase production were isolated by using nitrosoguanidine treatment, enrichment on 2-deoxyglucose, and selection of colonies with large clear zones on iodine-stained starch-glucose agar plates. beta-Amylase was pr...

  8. Influence of addition of amylase preparation to dough on fermentative activity of baker's yeast


    Dodić Jelena M.; Pejin Dušanka J.; Popov Stevan D.; Dodić Siniša N.; Mastilović Jasna S.; Popov-Raljić Jovanka V.


    Dough samples with different content of amylases were investigated immediately after mixing and after 7, 14 and 30 days of frozen storage. The obtained results show that the fermentation time is shorter, both in fresh and frozen samples, when amylase sample 1 was added, compared to dough without enzymes. The addition of amylase 2 to dough resulted in minimal decrease of "rising" time, both is frozen and fresh dough samples. The rising time of fresh samples was shorter when amylase 3 was added...

  9. Culture medium for amylase production by toxigenic fungi

    Directory of Open Access Journals (Sweden)

    Figueira Edson Luiz Zangrando


    Full Text Available Mycelial growth and amylase production by a mycotoxigenic strain of Fusarium moniliforme and Aspergillus flavus were evaluated in a culture medium containing starch, glycerol, wheat bran or corn. With emphasis on corn, different fractions composed by germ, degermed seed, starch, milky stage corn and the respective starch or supernatant fraction were analyzed for F. moniliforme growth . The medium composed of milky stage corn supernatant promoted the best mycelial growth (p<0.05, and it was used to prepare amylase production medium in the next step. The medium composed with 2% ground corn in milky stage corn supernatant (350g of milky stage corn blended with 250mL water and centrifuged promoted the highest amylase production, which was at the 10th day of fermentation, both for F. moniliforme (42.32U/mL and A. flavus (4,745.54U/mL.

  10. Enhancement of the amylase-creatinine clearance ratio in pregnancy. (United States)

    Naeije, R; Neuray, F; Van Melsen, A; Delcourt, A


    The renal clearance of amylase, expressed as a proportion of simultaneous creatinine clearance (Cam/-Ccr), was determined in 131 women in various stages of pregnancy. No abnormal serum levels of amylase were found. A moderate but significant increase in Cam/Ccr occurred during the last 15 weeks of pregnancy. Possible causes for this change were investigated in smaller groups of subjects. No increase in rapidly cleared isoamylase could be detected. No modification in renal tubular handling of protein could be evidenced, as assessed by measurements of the renal clearance of beta 2 microglobulin, expressed as a proportion of simultaneous creatinine clearance. An incrased glomerular permeability to amylase probably accounts for elevated Cam/Ccr in pregnancy.

  11. Kinetics of alpha-amylase secretion in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Henriksen, Anne Laurence Santerre; Carlsen, Morten; Bang de, H.;


    Pulse and pulse-chase experiments have been performed to study L-[S-35] methionine incorporation and protein secretion kinetics in Aspergillus oryzae. Pulse experiments confirmed the mechanism of methionine uptake reported previously for Penicillium chrysogenum (Benko et al., 1967). Pulse......-chase experiments were carried out to investigate the alpha-amylase secretion kinetics in A. oryzae. No unglycosylated alpha-amylase was detected neither intracellularly nor extracellularly demonstrating that glycosylation was not the rate controlling step in the secretory pathway. The pulse chase experiments...... indicated that there are two pools of intracellular alpha-amylase: a fast secreted and a slow secreted. The secretion of those two pools were described with a kinetic model, which was fitted to the pulse chase experiments. (C) 1999 John Wiley & Sons, Inc. Biotechnol Bioeng 65: 76-82, 1999....


    Directory of Open Access Journals (Sweden)

    Gabriela Vasile


    amylase in two Asian cyprinids namely, bighead carp (Aristichthys nobilis and silver carp (Hypophthalmichthys molitrix. The activity of -amylase has been determined by the Métais-Bieth method, the results obtained being expressed as mg starch / ml x 30 min. Our experimental data evidence some differences between the activity of -amylase from the digestive tube, in the two species under study.

  13. Spatio-temporal profiling and degradation of α-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, S.; Østergaard, O.;


    and near the C-terminus. Only two shorter fragments were identified of the other alpha-amylase 2 (gi|166985). The 2D gels of dissected tissues showed alpha-amylase degradation to be confined to endosperm. In contrast, the aleurone layer contained essentially only full-length alpha-amylase forms. While only...

  14. The role of α-amylase in the perception of oral texture and flavour in custards

    NARCIS (Netherlands)

    Wijk,; Prinz, J.F.; Engelen, L.; Weenen, H.


    The role of salivary α-amylase in odour, flavour, and oral texture sensations was investigated in two studies in which the activity of salivary amylase present in the mouth of human subjects was either increased by presenting custards with added α-amylase or decreased by presenting custards with add

  15. Characterization of a new Bacillus stearothermophilus isolate : a highly thermostable α-amylase-producing strain

    NARCIS (Netherlands)

    Wind, R.D.; Buitelaar, R.M.; Eggink, G.; Huizing, H.J.; Dijkhuizen, L.


    A novel strain of Bacillus stearothermophilus was isolated from samples of a potato-processing industry. Compared to known α-amylases from other B. stearothermophilus strains, the isolate was found to produce a highly thermostable α-amylase. The half-time of inactivation of this α-amylase was 5.1 h

  16. The role of alpha-amylase in the perception of oral texture and flavour in custards

    NARCIS (Netherlands)

    Wijk, de R.A.; Prinz, J.F.; Engelen, L.; Weenen, H.


    The role of salivary a-amylase in odour, flavour, and oral texture sensations was investigated in two studies in which the activity of salivary amylase present in the mouth of human subjects was either increased by presenting custards with added alpha-amylase or decreased by presenting custards with

  17. Elevated amylase creatinine clearance ratio and normal serum amylase levels in chronic relapsing pancreatitis after partial pancreatectomy. (United States)

    Cattau, E L; Garcia-Torres, F


    A 29-year-old woman admitted for alcohol detoxification five years after a 90% distal pancreatectomy for chronic pancreatitis had abdominal pain similar to that associated with preoperative pancreatitis. Although her clinical course was consistent with recurrent pancreatitis, the serum amylase level remained normal, but the amylase creatinine clearance ratio became elevated and then returned to normal, paralleling her clinical course. The ACCR may be a useful laboratory method in diagnosing chronic recurrent pancreatitis in patients with decreased functional pancreatic tissue. PMID:6160621

  18. Immobilization of Trichoderma harzianum α-Amylase on Treated Wool: Optimization and Characterization


    Saleh A. Mohamed; Khan, Jalaluddin A; Omar A.M. Al-Bar; El-Shishtawy, Reda M.


    α-Amylase from Trichoderma harzianum was covalently immobilized on activated wool by cyanuric chloride. Immobilized α-amylase exhibited 75% of its initial activity after 10 runs. The soluble and immobilized α-amylases exhibited maximum activity at pH values 6.0 and 6.5, respectively. The immobilized enzyme was more thermally stable than the soluble one. Various substrates were hydrolyzed by immobilized α-amylase with high efficiencies compared to those of soluble α-amylase. The inhibition of ...

  19. Effect of therapeutic irradiation on serum amylase levels of cancer patients

    International Nuclear Information System (INIS)

    Serum amylase levels were estimated in forty cancer patients treated by radiotherapy. Amylase levels of normal controls and cancer patients did not reveal any significant differences. Amylase levels in cases with oral cancer were in the lower range as compared to the levels in cancer cases of other sites. Significant rise of levels in oral cancer cases after first sitting of 200 rads was attributed to hyperamylasia, produced in salivary glands by irradiation. Other amylase contributing organs showed the changes in the levels by irradiation but to a lesser extent. Pre- and post-radiotherapy amylase levels in most of the cancer cases were not significantly different. (author). 3 tables, 5 refs

  20. Extraction, Purification and Characterization of Thermostable, Alkaline Tolerant α-Amylase from Bacillus cereus


    Annamalai, N.; Thavasi, R.; Vijayalakshmi, S.; Balasubramanian, T.


    Thermostable alkaline α-amylase producing bacterium Bacilluscereus strain isolated from Cuddalore harbour waters grew maximally in both shake flask and fermentor, and produced α-amylase at 35°C, pH 7.5 and 1.0% of substrate concentrations. α-Amylase activity was maximum at 65°C, pH 8.0, 89% of its activity was sustained even at pH 11.0. Added with MnCl2, α-amylase activity showed 4% increase but it was inhibited by EDTA. The molecular weight of the purified α-amylase is 42 kDa.

  1. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji;


    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors....

  2. Characterization of a new cell-bound alpha-amylase in Bacillus subtilis 168 Marburg that is only immunologically related to the exocellular alpha-amylase.


    Haddaoui, E; Petit-Glatron, M F; Chambert, R


    Immunoblot analysis of Bacillus subtilis cell extracts with polyclonal antibodies, raised against purified exocellular alpha-amylase, revealed one protein species of 82,000 Da. This protein was found even in cells in which the amyE gene, encoding exocellular alpha-amylase, was disrupted. Isolated from the membrane fraction, the 82,000-M(r) protein displayed an alpha-amylase activity in vitro.

  3. Interaction of Salivary alpha-Amylase and Amylase-Binding-Protein A (AbpA) of Streptococcus gordonii with Glucosyltransferase of S. gordonii and Streptococcus mutans


    Tanzer Jason M; Vickerman M; Rojek Jennifer; Chaudhuri Biswendu; Scannapieco Frank A


    Abstract Background Glucosyltransferases (Gtfs), enzymes that produce extracellular glucans from dietary sucrose, contribute to dental plaque formation by Streptococcus gordonii and Streptococcus mutans. The alpha-amylase-binding protein A (AbpA) of S. gordonii, an early colonizing bacterium in dental plaque, interacts with salivary amylase and may influence dental plaque formation by this organism. We examined the interaction of amylase and recombinant AbpA (rAbpA), together with Gtfs of S. ...

  4. The influence of nitrogen sources on the alpha-amylase productivity of Aspergillus oryzae in continuous cultures

    DEFF Research Database (Denmark)

    Pedersen, Henrik; Nielsen, Jens


    The influence of the nitrogen source on the cc-amylase productivity of Aspergillus oryzae was quantified in continuous cultivations. Both inorganic and complex nitrogen sources were investigated and glucose was used as the carbon and energy sources. For production of alpha-amylase, nitrate...... in the cc-amylase productivity. The higher alpha-amylase productivity during growth on casein hydrolysate was not caused by increased transcription of the alpha-amylase genes but was caused by a faster secretion of alpha-amylase or by a lower binding of alpha-amylase to the biomass....

  5. Effect of pancreatic stimulation on serum and urine amylase isoenzymes in man. (United States)

    Derugin, N; MacGregor, I L


    Alpha amylase of pancreatic origin is cleared by the kidney more rapidly than the salivary isoamylase. To determine whether alterations in the ratio of pancreatic to salivary amylase in sera caused alterations in over all renal clearance, the clearance of amylase was measured before and after the exocrine pancreas was stimulated with a prolonged intravenous infusion of secretin plus cholecystokinin. Serum and urine samples collected prior to and following stimulation were analyzed for amylase activity and creatinine concentration. Amylase isoenzymes were separated using isoelectric focusing. Over all renal clearance of amylase and of the separated amylase isoenzymes were calculated as a percentage of the clearance of creatinine. The hormone infusion was associated with an increase in serum and urine amylase activities, this increase being mainly accounted for by pancreatic amylase. The renal clearance of the salivary and pancreatic isoamylases was not altered by the hormone infusion but the over all amylase clearance by the kidney rose from 2.31 +/- 0.74 to 3.42 +/- 1.46% of creatinine clearance. In some cases the renal clearance of amylase following stimulation entered the range considered diagnostic for acute pancreatitis.

  6. Macroamylasemia with a markedly increased amylase clearance ratio in a patient with renal cell carcinoma. (United States)

    Kazmierczak, S C; Van Lente, F; McHugh, A M; Katzin, W E


    We report hyperamylasemia, macroamylasemia, and a markedly increased amylase clearance/creatinine clearance ratio in a patient with renal cell carcinoma. Serum amylase activity was characterized as macroamylase by gel exclusion chromatography. Electrophoretic separation revealed an atypical band of amylase, migrating anodal to the S2 control fraction. Electrophoresis of urine revealed the presence of both S1 and S2 fractions, but not the atypical band found in serum. Quantification of the salivary- and pancreatic-type amylase fractions showed amylase in urine to be 100% salivary. Immunofixation disclosed the macroamylase to consist of an immune complex between amylase and IgA-lambda antibody. Binding-capacity studies showed that the serum immunoglobulin was present in excess and could bind 46% and 49% additional S-type amylase activity derived from saliva and the patient's urine, respectively. The amylase clearance/creatinine clearance ratio was markedly supranormal (0.134), unexpected in a patient with macroamylasemia. A biopsy specimen of the renal cell tumor was found to contain significant salivary-type amylase activity. These results suggest production of amylase by tumor tissue in the renal carcinoma and secretion of S-type amylase into the patient's urine. Evidently, macroamylase should be confirmed by gel exclusion chromatography.

  7. Production and properties of alpha-amylase from Citrobacter species

    Directory of Open Access Journals (Sweden)

    Ebuta N. Etim-Osowo


    Full Text Available Amylase production by Citrobacter sp. isolated from potato was optimized in batch culture studies under shake flask conditions. Effects and interactions of best sources and levels of carbon and nitrogen estimated by 4 x 5 and 4 x 4 factorial experimental arrangements were significant (P < 0.01 on amylase production. Optimal alpha-amylase yield was obtained in a medium containing sorghum flour (2.0 % w/v and a mixture of (NH42SO4 + soybean meal (1.5% w/v with an initial medium pH of 8.0. Under optimum conditions, amylase yield was maximal (0.499 U/ml after 60h incubation at room temperature (28oC ± 2oC. Characterization studies showed that the enzyme had maximum activity at 60oC, retained 100% of its original activities at 60oC for 2h, was maximally active at pH 7.0 and retained 100% of original activities at pH 9.0 for 2h. Enzyme activity was stimulated by urea, Mg2+, Ca2+ and Zn2+ but inhibited by Hg2+.

  8. 21 CFR 862.1070 - Amylase test system. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  9. Amylase catalyzed synthesis of glycosyl acrylates and their polymerization

    NARCIS (Netherlands)

    Kloosterman, Wouter M.J.; Jovanovic, Danijela; Brouwer, Sander; Loos, Katja


    The enzymatic synthesis of novel (di)saccharide acrylates from starch and 2-hydroxyethyl acrylate, 2-hydroxyethyl methacrylate and 4-hydroxybutyl acrylate (2-HEA, 2-HEMA and 4-HBA) catalyzed by various commercially available amylase preparations is demonstrated. Both liquefaction and saccharificatio

  10. Factors affecting the solubility of Bacillus halmapalus alpha-amylase

    DEFF Research Database (Denmark)

    Faber, Cornelius; Hobley, Timothy John; Mollerup, Jørgen;


    A detailed study of the solubility of recombinant Bacillus halmapalus alpha-amylase has been conducted. A semi-purified preparation from a bulk crystallisation was chos en that contained six isoforms with pI-values of between 5.5 and 6.1. The solubility was strongly affected by pH and could...

  11. A comparative immunohistochemical study on amylase localization in the rat and human exocrine pancreas

    International Nuclear Information System (INIS)

    Objective was to localize amylase enzyme immunohistochemically in the pancreatic acinar cells of rats and humans using polyclonal sheep anti-human amylase antibody, and to compare between the intensities of their amylase-immunostaining. Indirect immunofluorescence method was applied on formaldehyde-fixed, and paraffin-embedded pancreatic sections obtained from adult male Wistar rats and autopsied human samples. Primary incubation was performed using sheep anti-amylase antibody followed by secondary incubation with fluorescein isothiocyanate-labeled rabbit anti-sheep IgG serum. Control tests of amylase immunospecificity were also undertaken either by incubation with primary antibodies previously pre-adsorbed with an excess of human pancreatic amylase, or only with secondary antibodies. The amylase immunofluorescence was positively and homogenously detected in all acinar cells of both rat and human pancreatic stained sections. The immunostaining was clearly demonstrated in the cell apices and peri-nuclear areas, but it was consistently brighter and more intense in the human acinar cells compared with that of the rat pancreas. Control tests of amylase immunofluorescence revealed the specificity of the antibodies applied for amylase localization in rat and human pancreas. Although many previous immunohisto- and cytochemical reports have successfully localized amylase in the pancreas of different mammalian species, but all of them have used locally prepared anti-amylase antibodies. The present report successfully illustrates immuno-localization of amylase in the pancreatic acinar cells of rats and humans using commercial polyclonal sheep anti-human pancreatic amylase antibodies, and also suggests their useful application in the immunochemical studies on various mammalian species. Additionally, the results indicate a structural similarity between the human and rat pancreatic amylases, a concept required further exploration. (author)

  12. A 78-kilobase region of mouse chromosome 3 contains salivary and pancreatic amylase genes and a pseudogene.


    Wiebauer, K; Gumucio, D L; Jones, J M; Caldwell, R M; Hartle, H T; Meisler, M H


    Genetic studies have demonstrated that salivary and pancreatic amylase genes are closely linked in human and mouse. To analyze the arrangement of genes within the amylase cluster, a library of YBR mouse genomic DNA was cloned in the cosmid vector pJB8. Clones containing amylase genes were identified by hybridization with amylase cDNA probes. Salivary and pancreatic amylase genes were isolated on separate cosmid clones, but no overlapping clones were evident from the initial screening. A strat...

  13. A Study on Effect of different culture media on amylase enzyme production by a native strain of Bacillus subtilis


    ziba Akbari; Hashem Nayeri; Keivan Beheshtimaal


    Introduction: Amylases are among the most important enzymes and have great significance in present-day biotechnology. Amylase with commercial applications is mainly derived from the genus Bacillus. The main purpose of this study is identification and isolatation amylase enzyme producer Bacillus, determining the amylase enzyme activity and affecting a number of culture medium on amylase enzyme production. Materials and methods: Soil, water and wastewater samples were collected from agricul...

  14. Expression of the human amylase genes: Recent origin of a salivary amylase promoter from an actin pseudogene

    Energy Technology Data Exchange (ETDEWEB)

    Samuelson, L.C.; Gumucio, D.L.; Meisler, M.H. (Univ. of Michigan, Ann Arbor (USA)); Wiebauer, K. (Friedrich Miescher Institut, Basel (Switzerland))


    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. The authors have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5{prime} regions of the five human amylase genes contain a processed {gamma}-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3{prime} untranslated region of {gamma}-actin. In addition, insertion of an endogenous retrovirus has interrupted the {gamma}-actin pseudogene in four of the five amylase genes.

  15. Characterization of a Hydrophobic Amylase Inhibitor from Corn (Zea mays) Seeds with Activity Against Amylase from Fusarium verticillioides. (United States)

    Figueira, Edson L Z; Hirooka, Elisa Y; Mendiola-Olaya, Elizabeth; Blanco-Labra, Alejandro


    ABSTRACT A hydrophobic 19.7-kDa amylase inhibitor (AI) was purified from corn kernels by 95% ethanol extraction and anionic exchange chromatography. The AI has an isoelectric point of 3.6 and was very stable at different pH values and high temperatures, maintaining 47.6% activity after heating to 94 degrees C for 60 min. Amino acid analysis indicated high valine, leucine, glycine, alanine, and glutamic acid/glutamine content, and especially high valine content (41.2 mol%). This inhibitor is not a glycoprotein. It required 30-min preincubation to maximize complex enzyme-inhibitor formation when the amylase from Fusarium verticillioides was tested. The optimal pH of interaction was 6.5. It showed broad-spectrum activity including the following amylases: human saliva, porcine pancreas, F. verticillioides, as well as those from some insects of agricultural importance (Acanthoscelides obtectus, Zabrotes subfasciatus, Sitophilus zeamais, and Prostephanus truncatus). This novel hydrophobic protein not only inhibited the amylase from F. verticillioides but also decreased the conidia germination. Thus, this protein represents an approach to decrease the production of fumonisin in corn, either by using it as a molecular marker to detect fungal resistance or through genetic engineering. PMID:18943857

  16. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner. (United States)

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi


    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats. PMID:24319124

  17. Amylase-producing lung cancer: case report and review of the literature. (United States)

    Katayama, S; Ikeuchi, M; Kanazawa, Y; Akanuma, Y; Kosaka, K; Takeuchi, T; Nakayama, T


    A case of hyperamylasemia with lung cancer is described. Macroamylasemia was excluded by a normal amylase/creatinine clearance ratio and by a sedimentation constant obtained by sucrose density gradient centrifugation. Positive immunofluorescent staining of tumor cells with a specific antibody against human salivary amylase and significant amylase activity in the primary tumor and metastases support the hypothesis of independent production of amylase by the lung tumor. Cellulose--acetate membrane electrophoresis demonstrated three bands of amylase activity. The major component corresponded to normal salivary amylase in electrophoretic mobility, isoelectric point and molecular size. The minor bands, one of which occupied about 10% of the total amylase activity in serum, urine and tissue homogenates, demonstrated a lower electrophoretic mobility and a more acidic isoelectric point. Gel filtration and electrophoresis disclosed that these minor bands were derived from an amylase isozyme with a larger molecular size than that of normal salivary amylase. The results suggest ectopic tumor production of heterogenous amylase isozymes, with the larger form being secreted into the circulation.

  18. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera) (United States)

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  19. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents (United States)

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel


    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  20. Is There Consistency between the Binding Affinity and Inhibitory Potential of Natural Polyphenols as α-amylase Inhibitors? (United States)

    Xu, Wei; Shao, Rong; Xiao, Jianbo


    The inhibitory potential of natural polyphenols for α-amylases has attracted great interests among researchers. The structure-affinity properties of natural polyphenols binding to α-amylase and the structure-activity relationship of dietary polyphenols inhibiting α-amylase were deeply investigated. There is a lack of consistency between the structure-affinity relationship and the structure-activity relationship of natural polyphenols as α-amylase inhibitors. Is it consistent between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors? It was found that the consistency between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors is not equivocal. For example, there is no consistency between the binding affinity and the inhibitory potential of quercetin and its glycosides as α-amylase inhibitors. However, catechins with higher α-amylase inhibitory potential exhibited higher affinity with α-amylase. PMID:25748632

  1. Preparation of a highly purified antibody and a solid-state immunoassay for porcine pancreatic α-amylase

    International Nuclear Information System (INIS)

    Porcine pancreas and parotid cell suspensions provide model systems in which to study the mechanism of induction of a specific protein, α-amylase, by hormones acting via cAMP. A highly purified antibody against porcine pancreatic α-amylase was prepared using affinity chromatography of the total IgG fraction derived from rabbit anti-α-amylase antiserum and was used to develop a radioimmunoassay for α-amylase. The antigen--antibody complex was separated from unbound α-amylase using either glutaraldehyde gelled α-amylase or a second antibody technique; a linear standard curve was achieved over a 100- to 1000-fold range of α-amylase concentration. Tissue homogenates did not interfere with this assay, and assayed levels of α-amylase in porcine pancreas were linear using 10 to 200 μg of homogenate. No levels or very low levels of α-amylase were detected in control tissues. (U.S.)

  2. Interaction of Salivary alpha-Amylase and Amylase-Binding-Protein A (AbpA of Streptococcus gordonii with Glucosyltransferase of S. gordonii and Streptococcus mutans

    Directory of Open Access Journals (Sweden)

    Tanzer Jason M


    Full Text Available Abstract Background Glucosyltransferases (Gtfs, enzymes that produce extracellular glucans from dietary sucrose, contribute to dental plaque formation by Streptococcus gordonii and Streptococcus mutans. The alpha-amylase-binding protein A (AbpA of S. gordonii, an early colonizing bacterium in dental plaque, interacts with salivary amylase and may influence dental plaque formation by this organism. We examined the interaction of amylase and recombinant AbpA (rAbpA, together with Gtfs of S. gordonii and S. mutans. Results The addition of salivary alpha-amylase to culture supernatants of S. gordonii precipitated a protein complex containing amylase, AbpA, amylase-binding protein B (AbpB, and the glucosyltransferase produced by S. gordonii (Gtf-G. rAbpA was expressed from an inducible plasmid, purified from Escherichia coli and characterized. Purified rAbpA, along with purified amylase, interacted with and precipitated Gtfs from culture supernatants of both S. gordonii and S. mutans. The presence of amylase and/or rAbpA increased both the sucrase and transferase component activities of S. mutans Gtf-B. Enzyme-linked immunosorbent assay (ELISA using anti-Gtf-B antibody verified the interaction of rAbpA and amylase with Gtf-B. A S. gordonii abpA-deficient mutant showed greater biofilm growth under static conditions than wild-type in the presence of sucrose. Interestingly, biofilm formation by every strain was inhibited in the presence of saliva. Conclusion The results suggest that an extracellular protein network of AbpA-amylase-Gtf may influence the ecology of oral biofilms, likely during initial phases of colonization.

  3. Identification of alpha amylase inhibitors from Syzygium cumini Linn seeds. (United States)

    Karthic, K; Kirthiram, K S; Sadasivam, S; Thayumanavan, B


    The aqueous extract of S. cumini or Eugenia jambolana seeds and Psidium guajava leaves showed higher inhibition against the porcine pancreatic alpha-amylase among the medicinal plants studied. The alpha-amylase inhibitors from S. cumini seeds were separated from the extract by preparative thin layer chromatography into fractions with different Rf values. The fraction with Rf value between 0.285 and 0.43, which showed maximum inhibitory activity, was eluted and analyzed through LC-MS. The compounds identified from the seed extract ofS. cumini were betulinic acid and 3,5,7,4'-tetrahydroxy flavanone, which were reported earlier from S. formosanum and other plants. Dixon plot showed that the inhibition was noncompetitive in nature. PMID:18949899

  4. Study of fluorescence quenching of Barley α-amylase (United States)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.


    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  5. [Amylase-creatinine clearance ratios in burned patients (author's transl)]. (United States)

    Minaire, Y; Marichy, J; Forichon, J; Motin, J


    The amylase/creatinine clearance ratio (ACCR) has been examined every 3 days, in 34 burned patients during the 20 days following the accident. This ratio was often abnormal since it was found increased at least on one occasion, in 75% of these patients, to be compared with 23 and 13% for amylase in serum and urine respectively. In another group of 9 burned patients, the ACCR was monitored for time-period between 10 to 52 days. It was observed that a high frequency in increased ACCR was associated with a fatal outcome. Finally simultaneous measurements of ACCR and of the beta2 microglobulin/creatinine clearance ratio (MCCR) showed that increased ACCR were statistically associated with increased MCCR suggesting a decreased renal tubular reabsorption of low molecular weight proteins in these burned patients.

  6. [Amylase-creatinine clearance ratios in burned patients (author's transl)]. (United States)

    Minaire, Y; Marichy, J; Forichon, J; Motin, J


    The amylase/creatinine clearance ratio (ACCR) has been examined every 3 days, in 34 burned patients during the 20 days following the accident. This ratio was often abnormal since it was found increased at least on one occasion, in 75% of these patients, to be compared with 23 and 13% for amylase in serum and urine respectively. In another group of 9 burned patients, the ACCR was monitored for time-period between 10 to 52 days. It was observed that a high frequency in increased ACCR was associated with a fatal outcome. Finally simultaneous measurements of ACCR and of the beta2 microglobulin/creatinine clearance ratio (MCCR) showed that increased ACCR were statistically associated with increased MCCR suggesting a decreased renal tubular reabsorption of low molecular weight proteins in these burned patients. PMID:360162

  7. Stabilization of α-amylase by using anionic surfactant during the immobilization process (United States)

    El-Batal, A. I.; Atia, K. S.; Eid, M.


    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10 mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher k/K and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

  8. Complete starch hydrolysis by the synergistic action of amylase and glucoamylase: impact of calcium ions. (United States)

    Presečki, Ana Vrsalović; Blažević, Zvjezdana Findrik; Vasić-Rački, Durđa


    Starch hydrolysis was performed by the synergistic action of amylase and glucoamylase. For that purpose glucoamylase (Dextrozyme) and two amylases (Liquozyme and Termamyl) in different combinations were investigated. Experiments were carried out in the repetitive- and fed-batch modes at 65 °C and pH 5.5 with and without the addition of Ca(2+) ions. 100 % conversion of starch to glucose was achieved in batch experiments. Calcium ions significantly enhanced stability of the amylase Termamyl. The intensity of synergism between amylase Termamyl and glucoamylase Dextrozyme was higher than in the experiments carried out with amylase Liquozyme and Dextrozyme. Mathematical model of the complete reaction system was developed. Using the model, a possible explanation of the synergism between the amylase and glucoamylase was provided.

  9. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds. (United States)

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D


    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed. PMID:23320956

  10. Imunohistochemical Localization of alpha-Amylase in Cotyledons of Vigna mungo Seedlings. (United States)

    Tomura, H; Koshiba, T; Minamikawa, T


    We studied the localization of alpha-amylase with indirect fluorescence microscopy in transversely sectioned cotyledons of Vigna mungo seedlings. Tissue sections were fixed in periodate-lysine-paraformaldehyde and treated with anti-alpha-amylase immunoglobulin G followed by fluorescein isothiocyanate labeled goat anti-rabbit immunoglobulin G. alpha-Amylase appeared in the cells farthest from vascular bundles on the second day of growth and appeared gradually closer to the vascular bundles as growth progressed. The pattern of alpha-amylase appearance was similar in detached cotyledons, indicating that attachment of the embryonic axis has no effect on this pattern. However, in attached cotyledons, alpha-amylase disappeared from the regions where starch grains had been digested, but in detached cotyledons there was no disappearance of alpha-amylase, and digestion was slower than in intact cotyledons.

  11. Imunohistochemical Localization of α-Amylase in Cotyledons of Vigna mungo Seedlings 1 (United States)

    Tomura, Hideaki; Koshiba, Tomokazu; Minamikawa, Takao


    We studied the localization of α-amylase with indirect fluorescence microscopy in transversely sectioned cotyledons of Vigna mungo seedlings. Tissue sections were fixed in periodate-lysine-paraformaldehyde and treated with anti-α-amylase immunoglobulin G followed by fluorescein isothiocyanate labeled goat anti-rabbit immunoglobulin G. α-Amylase appeared in the cells farthest from vascular bundles on the second day of growth and appeared gradually closer to the vascular bundles as growth progressed. The pattern of α-amylase appearance was similar in detached cotyledons, indicating that attachment of the embryonic axis has no effect on this pattern. However, in attached cotyledons, α-amylase disappeared from the regions where starch grains had been digested, but in detached cotyledons there was no disappearance of α-amylase, and digestion was slower than in intact cotyledons. Images Fig. 1 Fig. 2 Fig. 3 PMID:16664548

  12. Stabilization of α-amylase by using anionic surfactant during the immobilization process

    International Nuclear Information System (INIS)

    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher kcat/Km and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems

  13. Adrenergic effects on secretion of amylase from the rat salivary glands

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba


    The present study was undertaken to investigate the effect of adrenergic agents on secretion of amylase from the salivary glands in vivo. Saliva was collected from the distal oesophagus in conscious rats. Adrenaline increased the concentration of amylase in saliva and serum significantly....... The result of infusion of alpha- and beta-adrenergic antagonists as well as noradrenaline and isoproterenol showed that secretion of salivary amylase is predominantly mediated by stimulation of beta-adrenergic receptors, especially of the beta 1-subtype. Investigation of the isoenzyme pattern in saliva......, pancreatic juice and serum demonstrated that the major component in serum is salivary amylase. This study has shown that beta-adrenergic agents stimulate secretion of amylase from the salivary glands in rats. Though the secretion is mainly exocrine small amounts of amylase is found in serum, which seems...

  14. Spatio-temporal profiling and degradation of alpha-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, Sabrina; Østergaard, Ole;


    Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... spectrometry. Mass spectrometric analysis confirmed that the 29 alpha-amylase positive 2D gel spots contained products of one ( GenBank accession gi| 113765) and two ( gi vertical bar 4699831 and gi vertical bar 166985) genes encoding alpha-amylase 1 and 2, respectively, but lacked products from seven other...... genes. Eleven spots were identified only by immunostaining. Mass spectrometry identified 12 full-length forms and 12 fragments from the cultivar Barke. Products of both alpha-amylase 2 entries co-migrated in five full-length and one fragment spot. The alpha-amylase abundance and the number of fragments...

  15. Raw starch conversion by Saccharomyces cerevisiae expressing Aspergillus tubingensis amylases


    Viktor, Marko J; Rose, Shaunita H.; van Zyl, Willem H; Viljoen-Bloom, Marinda


    Background Starch is one of the most abundant organic polysaccharides available for the production of bio-ethanol as an alternative transport fuel. Cost-effective utilisation of starch requires consolidated bioprocessing (CBP) where a single microorganism can produce the enzymes required for hydrolysis of starch, and also convert the glucose monomers to ethanol. Results The Aspergillus tubingensis T8.4 α-amylase (amyA) and glucoamylase (glaA) genes were cloned and expressed in the laboratory ...

  16. Amylase polymorphism affects growth in the cupped oyster Crassostrea gigas


    Huvet, Arnaud; Samain, Jean-francois; Boudry, Pierre; Bedier, Edouard; Ropert, Michel; Van Wormhoudt, A


    The better understanding of physiological and environmental factors that determine optimal food conversion efficiencies is of major interest for the cupped oyster Crassostrea gigas for which the strong increase of aquaculture has been correlated in France with a decrease in productivity due to competition between aquatic species for limited food supplies at grow-out sites. To investigate the non-neutrality of the polymorphism of amylase, a key enzyme for carbohydrate assimilation, in oyster p...

  17. Early changes of urinary amylase isoenzymes in diabetes mellitus. (United States)

    Recio, F; Villamil, F; Recio, C; Ferrer, C


    The altered excretion of isoenzymes of amylase in urine was used as an early indicator of the loss of electric charges in the glomerular basement membrane, in 202 juvenile-onset insulin-dependent diabetic patients, compared with the pattern of excretion in 51 normal subjects matched for age and sex. Diabetics showed an increased excretion of salivary amylase. The salivary to pancreatic amylase ratio in urine (S/P ratio) was always below 1 in control subjects, but was elevated in 33.2% of diabetics, although microalbuminuria was present in only 26.2% of diabetic patients. The concentrations of other proteins in urine were within the reference ranges in nearly all patients, indicating that the kidney was not seriously affected. The increased salivary amylase excretion was not due to changes in the plasma concentration of any of the isoamylases, but to a real increase in excretion, as its fractional excretion in relation to creatinine clearance was clearly increased (1.0 +/- 0.7 vs. 1.52 +/- 1.99, p ratio of their clearances was also increased (0.35 +/- 0.18 vs. 0.49 +/- 0.61, p > 0.05). Moreover, the prevalence of altered S/P ratios was higher than the prevalence of microalbuminuria (36.6% vs. 18.8% of patients in the first decade of evolution of insulin-dependent diabetes mellitus). Altered S/P ratios were most prevalent in the first decade, whereas microalbuminuria was most prevalent in the second decade of the disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Thermal stability of -amylase in aqueous cosolvent systems

    Indian Academy of Sciences (India)

    Jay Kant Yadav; V Prakash


    The activity and thermal stability of -amylase were studied in the presence of different concentrations of trehalose, sorbitol, sucrose and glycerol. The optimum temperature of the enzyme was found to be 50 ± 2°C. Further increase in temperature resulted in irreversible thermal inactivation of the enzyme. In the presence of cosolvents, the rate of thermal inactivation was found to be significantly reduced. The apparent thermal denaturation temperature ()app and activation energy () of -amylase were found to be significantly increased in the presence of cosolvents in a concentration-dependent manner. In the presence of 40% trehalose, sorbitol, sucrose and glycerol, increments in the ()app were 20°C, 14°C, 13°C and 9°C, respectively. The of thermal denaturation of -amylase in the presence of 20% (w/v) trehalose, sorbitol, sucrose and glycerol was found to be 126, 95, 90 and 43 kcal/mol compared with a control value of 40 kcal/mol. Intrinsic and 8-anilinonaphathalene-1-sulphonic acid (ANS) fluorescence studies indicated that thermal denaturation of the enzyme was accompanied by exposure of the hydrophobic cluster on the protein surface. Preferential interaction parameters indicated extensive hydration of the enzyme in the presence of cosolvents.

  19. Biosynthesis of alpha-Amylase in Vigna mungo Cotyledon. (United States)

    Tomura, H; Koshiba, T


    In vitro translation of RNA extracted from Vigna mungo cotyledons showed that alpha-amylase is synthesized as a polypeptide with a molecular mass of 45,000, while cotyledons contain a form of alpha-amylase with a molecular mass of 43,000. To find out whether the 45,000 molecular mass polypeptide is a precursor to the 43,000 found in vivo, the cell free translation systems were supplemented with canine microsomal membrane; when mRNA was translated in the wheat germ system supplemented with canine microsomes, the 45,000 molecular mass form was not processed to a smaller form but the precursor form was partly processed in the membrane-supplemented reticulocyte lysate system. When V. mungo RNA was translated in Xenopus oocyte system, only the smaller form (molecular mass 43,000) was detected. Involvement of contranslational glycosylation in the maturating process of the alpha-amylase was ruled out because there was no effect of tunicamycin, and the polypeptide was resistant to endo-beta-H or endo-beta-D digestion. We interpret these results to mean that the 45,000 molecular mass form is a precursor with a signal peptide or transit sequence, and that the 43,000 molecular mass is the mature form of the protein.

  20. Biosynthesis of α-Amylase in Vigna mungo Cotyledon 1 (United States)

    Tomura, Hideaki; Koshiba, Tomokazu


    In vitro translation of RNA extracted from Vigna mungo cotyledons showed that α-amylase is synthesized as a polypeptide with a molecular mass of 45,000, while cotyledons contain a form of α-amylase with a molecular mass of 43,000. To find out whether the 45,000 molecular mass polypeptide is a precursor to the 43,000 found in vivo, the cell free translation systems were supplemented with canine microsomal membrane; when mRNA was translated in the wheat germ system supplemented with canine microsomes, the 45,000 molecular mass form was not processed to a smaller form but the precursor form was partly processed in the membrane-supplemented reticulocyte lysate system. When V. mungo RNA was translated in Xenopus oocyte system, only the smaller form (molecular mass 43,000) was detected. Involvement of contranslational glycosylation in the maturating process of the α-amylase was ruled out because there was no effect of tunicamycin, and the polypeptide was resistant to endo-β-H or endo-β-D digestion. We interpret these results to mean that the 45,000 molecular mass form is a precursor with a signal peptide or transit sequence, and that the 43,000 molecular mass is the mature form of the protein. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16664549

  1. Production of Fungal Amylases Using Cheap, Readily Available Agriresidues, for Potential Application in Textile Industry

    Directory of Open Access Journals (Sweden)

    Shalini Singh


    Full Text Available The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL and supernatant protein concentration (9.7 mg/mL for incubation period (6 days, temperature (35°C, initial pH (6.0, nutrient salt solution as moistening agent, and beef extract as nitrogen source. Pomegranate peel produced maximum amylase activity, but wheat bran (only slightly lesser amylase activity as compared to that of pomegranate peel was chosen for further studies, keeping in mind the seasonal availability of pomegranate peel. TLC confirmed the amylase produced to be α-type and 60 kDa was the molecular weight of the partially purified amylase. The enzyme showed maximum enzyme activity at pH 6.0, temperature of 55°C, and incubation time of 60 minutes. UV (616.0 U/mL and chemical (814.2 U/mL mutation enhanced amylase activity as compared to wild test strain. The study indicates that Aspergillus fumigatus NTCC1222 can be an important source of amylase and the crude enzyme, hence obtained, can be cost effectively applied in multiple sections of textile wet processing.

  2. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation


    Nakajima, Kei


    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may ...

  3. Fluid and amylase secretion by perfused parotid gland: physio-morphological approach.


    Murakami, M.; Yoshimura, K.; H. Sugiya; Segawa, A; Loffredo, F; Testa-Riva, F; Riva, A.


    Whole gland perfusion technique was applied to rat parotid glands to assess whether amylase affects fluid secretion. Control perfusion without any secretagogue evoked no spontaneous secretion. Carbachol (CCh 1 microM) induced both amylase and fluid secretion with distinctive kinetics. Fluid secretion occurred constantly around 60 microL/g-min, whereas amylase secretion exhibited an initial peak, followed by a rapid decrease to reach a plateau. Isoproterenol (Isop 1 microM) alone did not induc...

  4. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts


    Mahsa Rahimzadeh; Samaneh Jahanshahi; Soheila Moein; Mahmood Reza Moein


    Objective(s): One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Materials and Methods: Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhi...

  5. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii


    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M Margaret; Gill, Steven R.; Scannapieco, Frank A.


    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were di...

  6. Drosophila melanogaster larvae control amylase secretion according to the hardness of food


    Sakaguchi, Honami; Suzuki, Masataka G.


    Drosophila melanogaster larvae excrete amylase and perform external digestion of their food. In this study, to investigate whether their external digestion ability varies in response to changes in the external environment, we measured the relative amount of amylase excreted by larvae using a new method: the iodine starch agar method (ISAM). Analysis using this method revealed that the amount of amylase excreted by larvae increased in accordance with the increase in the agar concentration. In ...



    Roopa Murgod; Gladys Soans; Bindu CM


    Acute pancreatitis is most often diagnosed clinically and by blood tests rather than expensive radiological methods. Among the blood tests, amylase and lipase are frequently used to diagnose acute pancreatitis. In this retrospective study, we compare amylase versus lipase in terms of sensitivity and specificity with ROC curve analysis.40 established cases of acute pancreatitis were chosen. Day 1 measurements of serum amylase and lipase were noted. Values ≥3 times the upper limit of normal wer...

  8. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.


    Kitamoto, N; Yamagata, H; Kato, T; Tsukagoshi, N; Udaka, S


    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosu...

  9. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270) Using Solid State Fermentation


    Koel Saha; Sujan Maity; Sudeshna Roy; Koustav Pahan; Rishija Pathak; Susmita Majumdar; Suvroma Gupta


    Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270). In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca+2), Nitrate (NO3 −), and chloride ions (Cl−) as well as in the presen...

  10. Eliminating Amylase Testing from the Evaluation of Pancreatitis in the Emergency Department


    Volz, Kathryn A.; McGillicuddy, Daniel C.; Gary L Horowitz; Wolfe, Richard E.; Joyce, Nina; Sanchez, Leon D.


    Background: Alterations in serum biomarkers have been used to evaluate for pancreatitis in the emergency department (ED). Studies have shown lipase to be as sensitive and more specific than amylase in diagnosing pancreatitis and that amylase plus lipase does not improve accuracy over lipase alone. Objective: To determine effects of interventions to decrease ordering of amylase in the evaluation of pancreatitis. Methods: We conducted a pre- and post-cohort study. The number o...

  11. The screening value of the amylase-creatinine clearance ratio in acute pancreatitis. (United States)

    Van Hee, R; Hubens, A


    The screening value of the amylase creatinine clearance ratio in acute pancreatitis is studied. A series of 28 patients with pancreatic disease is compared with 80 controls and 82 patients with other intra-abdominal disease. The greatest specificity of the amylase creatinine clearance ratio value is reached at the 3.5 level. The amylase creatinine clearance ratio value proves to be of interest, not only in the diagnosis of acute pancreatitis but also in differentiating mild and heavy forms of pancreatitis.

  12. The value of the amylase/creatinine clearance ratio in the diagnosis of acute pancreatitis. (United States)

    Solomon, A R


    Acute pancreatitis usually confronts the clinician with a difficult diagnostic task. For years, the primary laboratory diagnostic tests were the serum and urine amylase and the serum lipase determinations. Recent studies have introduced the concept of the amylase/creatinine clearance ratio as a means of increasing the specificity of the laboratory diagnosis. This paper reviews the laboratory evaluation of acute pancreatitis with emphasis on the rationale, derivation, and specificity of the amylase/creatinine clearance ratio.

  13. Eliminating Amylase Testing from the Evaluation of Pancreatitis in the Emergency Department

    Directory of Open Access Journals (Sweden)

    Volz, Kathryn A


    Full Text Available Background: Alterations in serum biomarkers have been used to evaluate for pancreatitis in the emergency department (ED. Studies have shown lipase to be as sensitive and more specific than amylase in diagnosing pancreatitis and that amylase plus lipase does not improve accuracy over lipase alone.Objective: To determine effects of interventions to decrease ordering of amylase in the evaluation of pancreatitis.Methods: We conducted a pre- and post-cohort study. The number of amylase and lipase tests ordered in the ED was recorded prior to intervention to establish a baseline. We introduced an educational intervention to order lipase without amylase. A second intervention involved removing amylase from bedside order entry forms. We introduced a third intervention that included deleting amylase from trauma order forms, and decoupling amylase and lipase in the computer ordering system. We recorded the number of lipase and amylase tests in weekly aggregates for comparison to the baseline. Data analysis using students t-test, standard deviation and p values are reported.Results: Before interventions 93% of patients had both tests ordered. Educational interventions resulted in a decrease to 91% (p=0.06 of co-ordering. Further interventions decreased the percentage of patients evaluated with both tests to 14.3%. This translates into a decrease in patient charges of approximately $350,000 a year.Conclusion: Using simple structured interventions in the ED can reduce amylase ordering. Educational programming alone was not effective in significantly decreasing amylase ordering; however, education plus system-based interventions decreased amylase ordering. [West J Emerg Med. 2010; 11(4:344-347.

  14. Specificity of serum amylase and amylase creatinine clearance ratio in the diagnosis of acute and chronic pancreatitis. (United States)

    Grosberg, S J; Wapnick, S; Purow, E; Purow, J R


    In 31 patients with pancreatitis, the amylase to creatinine clearance ratio (CACR) was significantly greater than for controls (10.7 +/- 1.7 vs. 2.6 +/- 0.3, P less than .001). Sixteen pancreatitis patients with serum amylase (SAm) within the normal range had a mean CACR significantly greater than that of 19 hospital control patients with normal SAm (9.2 +/- 1.5 vs. 3.0 +/- 0.4, P less than .001). For control patients a highly significant inverse correlation between SAm and CACR was observed. No relationship was detected between these parameters for pancreatitis patients. The results suggest that the CACR may be of aid in establishing the diagnosis of pancreatitis even in patients without hyperamylasemia.

  15. Influence of addition of amylase preparation to dough on fermentative activity of baker's yeast

    Directory of Open Access Journals (Sweden)

    Dodić Jelena M.


    Full Text Available Dough samples with different content of amylases were investigated immediately after mixing and after 7, 14 and 30 days of frozen storage. The obtained results show that the fermentation time is shorter, both in fresh and frozen samples, when amylase sample 1 was added, compared to dough without enzymes. The addition of amylase 2 to dough resulted in minimal decrease of "rising" time, both is frozen and fresh dough samples. The rising time of fresh samples was shorter when amylase 3 was added to dough. The specific fermentative activity of fresh dough samples is increasing by about 10% compared to the control sample, for all amounts of amylase 1 and 2 added to the do- ugh. The fermentative activity of yeast in frozen samples increased by 5-10%, after keeping of dough with the addition of amylase 1 for 14 days. The specific fermentative activity of fresh dough samples increased compared to the control, for all amounts of added amylase 3 to the dough. In frozen dough samples the fermentative activity of yeast decreased by 10% for all added amounts of amylase 3. Baked goods made of fresh and frozen dough, prepared with the addition of amylase 1, are better than the ones made of control dough sample, considering all evaluated parameters.

  16. Expression and Localization of α-amylase in the Submandibular and Sublingual Glands of Mice


    Yamagishi, Ryoko; Wakayama, Tomohiko; Nakata, Hiroki; Adthapanyawanich, Kannika; Kumchantuek, Tewarat; Yamamoto, Miyuki; Iseki, Shoichi


    In the major salivary glands of mice, acinar cells in the parotid gland (PG) are known to be the main site for the production of the digestive enzyme α-amylase, whereas α-amylase production in the submandibular gland (SMG) and sublingual gland (SLG), as well as the cell types responsible for α-amylase production, has been less firmly established. To clarify this issue, we examined the expression and localization of both the mRNA and protein of α-amylase in the major salivary glands of male an...


    Directory of Open Access Journals (Sweden)



    Full Text Available Solid state fermentation holds tremendous potentials for the production of the enzyme amylase by Aspergillus niger. Different solid substrates like rice bran, wheat bran, black gram bran, coconut oil cake, gingely oil cake and groundnut oil cake are rich in starch. These agro industrial residues are cheap raw materials for amylase production. Aspergillus niger BAN3E was identified to be the best producer of amylase. When A. niger BAN3E was incubated for 6 days at 37°C it showed high yield of amylase in groundnut oil cake substratein solid state fermentation. Sucrose and nitrogen improved the yield in the same medium.

  18. Unique features of several microbial α-amylases active on soluble and native starch


    Sarian, Fean Davisunjaya


    Starch is the main energy store of major agricultural crops such as corn, potato, rice and wheat. Various amylase type enzymes are used to convert cooked starch to glucose that goes into bioethanol fermentation. Only a few amylase type enzymes have been described that can act on the starch granule itself. Granular starch has a complex crystalline structure that prevents most amylases to directly act on it. In this PhD thesis the action of several amylases on native granular starch was studied...

  19. [Amylase inhibitors from Streptomyces lucensis VKPM Ac-1743 and Streptomyces violaceus VKPM Ac-1734]. (United States)

    Sharova, N Iu


    Inhibitors synthesized by the Streptomyces lucensis VKPM AS-1743 and Streptomyces violaceus VKPM AS-1734 strains were studied for their influence on amylases of different origin. The effect of the inhibitors was shown to be different on fungal amylase, pancreatic amylase, and amylase from human blood. It has been found that the studied inhibitors are substances of a pseudooligosaccharide nature and exhibit their activity and stability over a wide range of pH and temperature values. The physico-chemical and biochemical properties of isolated inhibitors were compared with those of known microbial inhibitors of α-glucosidases. PMID:25842903

  20. Salivary type alpha-amylase activity in serum and in urine of patients with lung adenocarcinoma

    International Nuclear Information System (INIS)

    Total alpha-amylase activity in sera and urine of 30 patients with lung adenocarcinoma has been tested. The results were compared with control group of 30 healthy voluntaries. The activity of pancreatic type was differentiated from salivary alpha amylase. Salivary type was inhibited selectively by Triticum aestivum. Higher levels of total and salivary type amylase were noted in patients with lung adenocarcinoma in comparison to healthy control. The increase was significant (p<0.005). Correlation was observed between the activity of salivary type amylase and the stage of adenocarcinoma. (author)

  1. Determination of amylase activity in cotyledons of Phaseolus vulgaris L. cv. carioca


    Glaucia Almeida de Morais; Massanori Takaki


    Determination of α- and β-amylase activity in the extracts of cotyledons of Phaseolus vulgaris L. cv. cariocawas done using selective inactivation of α-amylase by lowering the pH of the incubation medium or by the use of EDTA as inhibitor or selective inactivation of β-amylase by the use of HgCl2 or by heating to 70ºC in the presence of CaCl2; and still by using the reagent starch azure for specific determination of α-amylase. Results indicated that the methods used w...

  2. Cloning and Expression of a Schwanniomyces occidentalis α-Amylase Gene in Saccharomyces cerevisiae


    Wang, Tsung Tsan; Lin, Long Liu; Hsu, Wen Hwei


    An α-amylase gene (AMY) was cloned from Schwanniomyces occidentalis CCRC 21164 into Saccharomyces cerevisiae AH22 by inserting Sau3AI-generated DNA fragments into the BamHI site of YEp16. The 5-kilobase insert was shown to direct the synthesis of α-amylase. After subclones containing various lengths of restricted fragments were screened, a 3.4-kilobase fragment of the donor strain DNA was found to be sufficient for α-amylase synthesis. The concentration of α-amylase in culture broth produced ...

  3. Expression and Localization of α-amylase in the Submandibular and Sublingual Glands of Mice

    International Nuclear Information System (INIS)

    In the major salivary glands of mice, acinar cells in the parotid gland (PG) are known to be the main site for the production of the digestive enzyme α-amylase, whereas α-amylase production in the submandibular gland (SMG) and sublingual gland (SLG), as well as the cell types responsible for α-amylase production, has been less firmly established. To clarify this issue, we examined the expression and localization of both the mRNA and protein of α-amylase in the major salivary glands of male and female mice by quantitative and histochemical methods. α-amylase mRNA levels were higher in the order of PG, SMG, and SLG. No sexual difference was observed in α-amylase mRNA levels in the PG and SLG, whereas α-amylase mRNA levels in the female SMG were approximately 30% those in the male SMG. Using in situ hybridization and immunohistochemistry, signals for α-amylase mRNA and protein were found to be strongly positive in acinar cells of the PG, serous demilune cells of the SLG, and granular convoluted tubule (GCT) cells of the male SMG, weakly positive in seromucous acinar cells of the male and female SMG, and negative in mucous acinar cells of the SLG. These results clarified that α-amylase is produced mainly by GCT cells and partly by acinar cells in the SMG, whereas it is produced exclusively by serous demilune cells in the SLG of mice

  4. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.


    Brisman, J.; Belin, L


    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase p...

  5. Paper-based α-amylase detector for point-of-care diagnostics. (United States)

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar


    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase.

  6. A very high amylase can be benign in paediatric Crohn's disease. (United States)

    Venkataraman, Devasmitha; Howarth, Lucy; Beattie, Robert Mark; Afzal, Nadeem Ahmad


    A 12.5-year-old boy with Crohn's disease with abdominal pain had a raised amylase of 1835 IU/l with normal lipase levels. Ultrasound showed no evidence of inflammation of pancreas. The amylase to creatinine clearance ratio, was 0.8% (reference interval 2%-5%; >6% consistent with acute pancreatitis; amylase with a corresponding reduced clearance of amylase in his urine, positively supporting the diagnosis of macroamylasemia. Macroamylasemia has no clinical significance other than misdiagnosis as acute pancreatitis. Awareness of this condition is important and a positive diagnosis should always be made to avoid unnecessary changes in treatments.

  7. Determination of renal clearances of amylase/creatinine with chromogenic and enzymatic methods. (United States)

    Hohenwallner, W; Wimmer, E; Sommer, R


    Urinary amylase was estimated by chromogenic (amylochrome Roche) as well as enzymatic methods (SKI and Beckman: substrate starch and substrate maltotetraose respectively). Random and timed urines (24 hour collections) were analysed. Clearances of amylase gave different results dependent upon the amylase-test used and the glomerular filtration rate. Correlation between chromogenic and enzymatic methods (starch as substrate) was poor. The ratio of amylase and creatinine clearance was used to test different methods. Reference values for this ratio for the amylochrome method (N = 106) were 2.85 +/- 0.99% and for the Beckman-DS method (N = 60) 2.82 +/- 0.87%.

  8. Amylase: creatinine clearance ratio and urinary excretion of lysozyme in acute pancreatitis and acute duodenal perforation. (United States)

    Berger, G M; Cowlin, J; Turner, T J


    The amylase:creatinine clearance ratio in patients suffering from acute pancreatitis or acute duodenal perforation was higher than normal in both groups of patients. These findings cast doubt on the value of this parameter as a specific index of acute pancreatitis. The mechanism or mechanisms underlying the increased amylase excretion have not been determined. However, the markedly elevated urinary excretion of lysozyme observed in some patients suggests, by analogy, that diminished tubular reabsorption of amylase may contribute towards the elevated amylase:creatinine ratio.

  9. Renal clearance of pancreatic and salivary amylase relative to creatinine in patients with chronic renal insufficiency. (United States)

    Keogh, J B; McGeeney, K F; Drury, M I; Counihan, T B; O'Donnell, M D


    Pancreatic and salivary amylase/creatinine clearance ratios in patients with various degrees of renal impairment were compared with those obtained for control subjects. In chronic renal insufficiency (mean GFR 30 ml/min +/- 15 SD; n = 13) the clearance ratios for pancreatic (mean 3.5 +/- 1.85 SD) and salivary (mean 2.3 +/- 1.3 SD) amylase were significantly higher (P less than 0.05) than those in controls. Corresponding control values (n = 26) were 2.64 +/- 0.86 (pancreatic) and 1.64 +/- 0.95 (salivary). Three patients showed values above the normal limit. In the diabetic group (mean GFR 41 ml/min +/- 22 SD; n = 10) salivary amylase/creatinine clearance ratios (mean 2.36 +/- 1.55 SD) were significantly higher than in controls (P less than 0.05). Three patients showed raised values. Pancreatic amylase clearance was raised in only one of these patients. Three patients with terminal disease (mean GFR 10 ml/min) showed markedly raised (two- to threefold) clearance ratios for both salivary and pancreatic amylase. Of a total of 26 patients, eight had increased total amylase/creatinine clearance ratios. Pancreatic amylase/creatinine clearance was increased in seven patients, while nine patients showed raised salivary amylase/creatinine ratios. Patients with raised clearance ratios did not have clinical evidence of pancreatitis. We suggest that, in the presence of impaired renal function, a high amylase/creatinine clearance ratio need not be indicative of pancreatic disease.

  10. The Effect of Colloidal Silica Nanoparticles on the Activity of α-Amylase

    Directory of Open Access Journals (Sweden)

    G. R. Behbehani


    Full Text Available The effect of silica nanoparticles on the activity of α-amylase is determinations using isothermal titration calorimetry. It was found that the immobilized enzyme activity increased as evidenced by the stability parameters recovered from the extended solvation theory. The stability indexes of the immobilized α-amylase was less than of the free enzyme, thereby the activity of the enzyme was increased as a result of its interaction with silica nanoparticles. The present report shows that silica nanoparticles are activator of -amylase, as the complexes of silica+ -amylase are less stable than the free enzyme.

  11. Chemical synthesis of a dual branched malto-decaose: A potential substrate for alpha-amylases

    DEFF Research Database (Denmark)

    Damager, Iben; Jensen, Morten; Olsen, Carl Erik;


    . Using this chemically defined branched oligosaccharide as a substrate, the cleavage pattern of seven different alpha-amylases were investigated. alpha-Amylases from human saliva, porcine pancreas, barley alpha-amylose 2 and recombinant barley alpha-amylase 1 all hydrolysed the decasaccharide selectively....... This resulted in a branched hexasaccharide and a branched tetrasoccharide. alpha-Amylases from Asperagillus oryzae, Bacillus licheniformis and Bacillus sp. cleaved the decasoccharide at two distinct sites, either producing two branched pentasoccharides, or a branched hexasoccharide and a branched...

  12. Production and characterization of amylases from Zea mays malt

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus


    Full Text Available In this work the α and β-amylase enzymes were obtained from maize (Zea mays malt and were biochemistry characterized. A germination study to obtain the maize malt with good amylase activity was made. The maize seeds were germinated in laboratory and the enzymatic activity was measured daily. Activity dependence to germination time were fitted to an exponential model (A=A0eµt, which showed that the behaviour of enzymatic activity in the germination process was similar to the growth of the microorganism. Its model could be applied to describe the mechanism of α-amylase production for each maize varieties and others cereals. Maize malt characterization showed that α and β-amylase had optimal pH between 4-6.5, optimal temperature 50 and 90ºC, and molecular weight of 67.4 and 47.5kDa, respectively. This work contributed with the advances in biotechnology generating of conditions for application of a new and of low price amylases source.Neste trabalho as enzimas α e β-amilases foram obtidas de malte de milho e depois foram caracterizadas bioquimicamente. Um estudo da germinação foi feito para obtenção do malte com boa atividade amilásica. A germinação ocorreu em escala laboratorial e a atividade enzimática foi medida diariamente. Um modelo exponencial do tipo A=A0eµt foi ajustado a dependência do tempo de germinação com a atividade, mostrando que o comportamento da atividade enzimática no processo de germinação é semelhante ao crescimento de microorganismos. Este modelo pode ser aplicado para descrever o mecanismo de produção da α-amilase para cada variedade de milho e de outros cereais. A caracterização do malte de milho mostrou que as α e β-amilase têm pH ótimo entre 4,0-6,5, temperatura ótima de 50 e 90ºC, e massa molar de 67,4 e 47,5 kDa, respectivamente. Este trabalho contribuiu com os avanços da biotecnologia gerando condições de emprego de uma nova e barata fonte de amilases.

  13. Starch supplementation modulates amylase enzymatic properties and amylase B mRNA level in the digestive gland of the Pacific oyster Crassostrea gigas. (United States)

    Huvet, A; Jeffroy, F; Daniel, J Y; Quéré, C; Le Souchu, P; Van Wormhoudt, A; Boudry, P; Moal, J; Samain, J F


    In the oyster Crassostrea gigas consumption-related traits, amylase properties and growth were found to be linked through genotypes that differed for polymorphism in the two amylase genes AMYA and AMYB. Modulation of AMYA mRNA level had already been observed in response to food availability, whereas the functional role of AMYB was still unknown. To improve knowledge about the regulation of amylase expression in C. gigas and the respective roles of the two genes, we made an assay of amylase expression at mRNA and enzymatic levels in the digestive gland of oysters that had received dietary supplements of starch. After 18 days, a significant increase of translatable mRNA for AMYB was observed, with a correlated increase in Michaelis-Menten constant Km values and a decrease in total amylase activity. This modulation is the first evidence of observable functioning of AMYB in digestive processes. Amylase B is suggested to display a higher Km than amylase A, offering a means of adapting to high substrate concentrations. The highest starch supplement level (10 mgL(-1)) induced alteration in oyster physiology. The 1 mgL(-1) treatment should be tested as a practical food supplement that could lead to growth benefits for oysters.



    Berhanu Andualem; Amare Gessesse


    ‘Tella’ is local beer which is used in most part of Ethiopia. It is made from cereals, such as barley, wheat, maize and other crops. Rhamnus prinoides is also used to provide a special aroma and flavor as well as antiseptic agent. The objective of this study is to determine the contribution of amylases from tella yeast isolates and compare with the role of amylase from malt. House hold ‘tella’ samples were collected and plated on starch agar and then amylase positive isolates of yeast were id...

  15. Mutational analysis of the β-trefoil fold protein barley α-amylase/subtilisin inhibitor probes hot spots for the interaction with barley α-amylase

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine; Nielsen, P. K.; Abou Hachem, Maher;


    The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics...

  16. GA Enhanced a-Amylase Synthesis in Halved Grains of Barley (Hordeum vulgare): A Simple Laboratory Demonstration (United States)

    Freeland, P. W.


    A laboratory demonstration is suggested for the formation of a-amylase enzyme in halved grains of barley. Data presented in the article provide some information of the pattern of a- and b-amylase activity during germination. (PS)

  17. Individual Differences in AMY1 Gene Copy Number, Salivary α-Amylase Levels, and the Perception of Oral Starch


    Abigail L Mandel; Peyrot des Gachons, Catherine; Plank, Kimberly L.; Alarcon, Suzanne; Breslin, Paul A.S.


    Background The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of star...

  18. Alpha-amylase activity in blood increases after pharmacological, but not psychological, activation of the adrenergic system


    Nater, Urs M.; Roberto La Marca; Katja Erni; Ulrike Ehlert


    BACKGROUND & AIM: Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separat...

  19. Predictive value of serum amylase level in outcome of multiple trauma patients

    Directory of Open Access Journals (Sweden)

    Arezu Nejabatian


    Full Text Available Introduction: The early detection of injury in multiple trauma patients can lead to decreased mortality, length of stay, and improved clinical status of the patient. It is shown that there is a relation between increased level of serum amylase and pancreatic injury in trauma patients. The aim of this study is to evaluate serum amylase level in hospital outcomes of patients with abdominal blunt trauma. Methods: This study was a cross-sectional survey that was conducted at the emergency room of Imam Reza (AS Medical and Educational Center in Tabriz, Iran, during a year (April 2014-April 2015 on 101 patients with blunt abdominal trauma. Serum amylase levels were measured 6 hours after injury. The outcome of patients during hospitalization including the need for laparotomy and mortality were followed. Data were analyzed by SPSS software. P < 0.050 was considered significant. Results: A significant relationship between elevated serum amylase level by laparotomy and mortality was observed (P < 0.001. 15 patients had serum amylase higher than 100 U/L. All patients with abnormal serum amylase died. Conclusion: Determination of serum amylase level can be valuable in the prognosis of patients with blunt abdominal trauma, especially in determining mortality and proceed to laparotomy. However, studies with larger research community are required to investigate the precise role of amylase in the diagnosis and prognosis of patients with blunt abdominal trauma.

  20. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression (United States)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA


    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  1. Physico-chemical studies on amylases from fermented cassava waste water

    International Nuclear Information System (INIS)

    Waste water from cassava mash fermented with pure strain of Saccharomycees cerevisae together with Lactobacillus delbruckii and Lactobacillus coryneformis (3 days) was assayed for amylase activity. The result of the study indicated that the fermentation waste water had amylase activity, the unit activity and the specific activity of the amylase in the waste water was 0.22μmole/min and 0.06μmole/min/mg, respectively. The amylase was partially purified using Gel filtration (Sephadex-G150). The partially purified enzyme was maximally activity at pH 6.0 and 60 deg. C temperature. It had its maximum stability between pH 6-7 for 4hr, and 30 deg. C for 50 mins. NaCl, NH4Cl, FeCl3, KCl, NaNO3 activates the enzyme activity while CUSO4 and HgCl2 inhibit the activity of the amylase. It could be concluded that these amylases from the fermented cassava waste amylase were active at wide temperature and pH ranges, this quality could be explored in the industrial sector (most especially food industry) as a source of industrial amylase that requires a wide range of conditions (temperature and pH). (author)

  2. Binding of carbohydrates and protein inhibitors to the surface of alpha-amylases

    DEFF Research Database (Denmark)

    Bozonnet, Sophie; Bønsager, Birgit Christine; Kramhoft, B.;


    This review on barley alpha-amylases 1 (AMY1) and 2 (AMY2) addresses rational mutations at distal subsites to the catalytic site, polysaccharide hydrolysis, and interactions with proteinaceous inhibitors. Subsite mapping of barley alpha-amylases revealed 6 glycone and 4 aglycone substrate subsite...

  3. Draft genome sequences of 18 oral streptococcus strains that encode amylase-binding proteins. (United States)

    Sabharwal, Amarpreet; Liao, Yu-Chieh; Lin, Hsin-Hung; Haase, Elaine M; Scannapieco, Frank A


    A number of commensal oral streptococcal species produce a heterogeneous group of proteins that mediate binding of salivary α-amylase. This interaction likely influences streptococcal colonization of the oral cavity. Here, we present draft genome sequences of several strains of oral streptococcal species that bind human salivary amylase. PMID:25999552

  4. NMR assignment of the amylase-binding protein A from Streptococcus parasanguinis. (United States)

    Liu, Bing; Zhu, Fan; Wu, Hui; Matthews, Stephen


    Streptococcus parasanguinis is a primary colonizer of tooth surfaces in the oral cavity. Amylase-binding protein A (AbpA) from S. parasanguinis is responsible for the recruitment of salivary amylase to bacterial surface, which plays an important role in the development of oral biofilms. Here, we describe the essentially complete NMR assignments for AbpA. PMID:25016927

  5. Draft Genome Sequences of 18 Oral Streptococcus Strains That Encode Amylase-Binding Proteins


    Sabharwal, Amarpreet; Liao, Yu-Chieh; Lin, Hsin-Hung; Haase, Elaine M.; Scannapieco, Frank A.


    A number of commensal oral streptococcal species produce a heterogeneous group of proteins that mediate binding of salivary α-amylase. This interaction likely influences streptococcal colonization of the oral cavity. Here, we present draft genome sequences of several strains of oral streptococcal species that bind human salivary amylase.

  6. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation. (United States)

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma


    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  7. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121 Using Solid State Fermentation

    Directory of Open Access Journals (Sweden)

    Dibyangana Raul


    Full Text Available Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF for α-amylase production has been used in lieu of submerged fermentation (SmF due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30–70% (NH42SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  8. Structure and expression of alpha-amylase gene from Vigna mungo. (United States)

    Yamauchi, D; Takeuchi, H; Minamikawa, T


    A single copy of the alpha-amylase gene, composed of three introns and four exons, was found in Vigna mungo. Examination of levels of alpha-amylase and its mRNA in detached cotyledons indicated that attachment of the embryonic axis is not required for expression of the gene in cotyledons of germinating seeds.

  9. Use of activated carbons to remove undesirable residual amylase from factory and refinery streams (United States)

    In recent years, there has been increased world-wide concern over residual (carry-over) activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were develope...

  10. Unique features of several microbial α-amylases active on soluble and native starch

    NARCIS (Netherlands)

    Sarian, Fean Davisunjaya


    Starch is the main energy store of major agricultural crops such as corn, potato, rice and wheat. Various amylase type enzymes are used to convert cooked starch to glucose that goes into bioethanol fermentation. Only a few amylase type enzymes have been described that can act on the starch granule i

  11. A simplified method for detecting macroamylasemia by measuring serum amylase activity at different reaction temperatures. (United States)

    Koda, T; Kuratsune, H; Kurahori, T


    Amylase activity in serum and urine, and isoamylase, were measured in 300 patients with abdominal pain to detect cases of macroamylasemia. Of these patients, 9 had hyperamylasemia and 2 were diagnosed as cases of macroamylasemia on the basis of their amylase/creatinine clearance ratio, the gel filtration pattern of their amylase on a dextran column, and results of immunological analysis. Amylase activity in macroamylasemia is reported to show an anomalous response to increase in reaction-temperature. In this report, measurements of the temperature-activity relationships of serum amylase confirmed that the ratio of serum amylase activity at 50 degrees C to that at 25 degrees C (AMY-50 degrees C/AMY-25 degrees C ratio) in patients with macroamylasemia was higher than that in normal subjects or patients with pancreatitis. Moreover, when macromolecular amylase in the sera of patients with macroamylasemia was separated from amylase of normal molecular weight by dextran gel chromatography, it showed a significantly higher AMY-50 degrees C/AMY-25 degrees C ratio than the latter. Measurement of this AMY-50 degrees C/AMY-25 degrees C ratio seems to be a convenient and useful method for differential diagnosis of hyperamylasemia.

  12. Phylogenetic and biochemical characterization of a novel cluster of intracellular fungal α-amylase enzymes

    NARCIS (Netherlands)

    Kaaij, R.M. van der; Janeček, Š.; Maarel, M.J.E.C. van der; Dijkhuizen, L.


    Currently known fungal α-amylases are well-characterized extracellular enzymes that are classified into glycoside hydrolase subfamily GH13_1. This study describes the identification, and phylogenetic and biochemical analysis of novel intracellular fungal α-amylases. The phylogenetic analysis shows t

  13. Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations

    DEFF Research Database (Denmark)

    Spohr, Anders Bendsen; Carlsen, Morten; Nielsen, Jens Bredal;


    Three alpha-amylase producing strains of Aspergillus oryzae used for recombinant protein production have been studied with respect to growth and protein production. By comparing the three strains with respect to morphology and protein production it is shown that a morphological mutant with a more...... dense mycelium is more efficient in producing alpha-amylase....


    NARCIS (Netherlands)



    A novel strain of Bacillus stearothermophilus was isolated from samples of a potato-processing industry. Compared to known alpha-amylases from other B. stearothermophilus strains, the isolate was found to produce a highly thermostable alpha-amylase. The half-time of inactivation of this alpha-amylas

  15. Serum amylase activity and renal amylase activity clearance in patients with severely impaired renal function and in patients treated with renal allotransplantation. (United States)

    Pedersen, E B; Brock, A; Kornerup, H J


    Serum amylase activity was measured in 29 nondialysed patients with severe renal failure, in 24 uraemic patients treated with chronic haemodialysis, and in 29 patients treated with renal allotransplantation. Simultaneous measurement of renal amylase activity clearance (CAm) and creatinine clearance (CCr) was performed in 25 patients with severe renal failure and in 19 transplanted patients. Serum amylase activity was elevated in all three groups. CAm was significantly correlated to CCr both in the group with severe renal failure and in the transplanted group. Unlike in the group of transplanted patients, the ratio CAm/CCr was significantly increased in patients with severe impaired renal function. It is concluded that the elevation of serum amylase activity in patients with impaired renal function is primarily due to decreased glomerular filtration rate. The value of CAm/CCr for diagnosing acute pancreatitis is doubtful in patients with severe renal disease.

  16. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.


    Kuhn, H; Fietzek, P P; Lampen, J. O.


    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  17. Studies on amylase activity of pancreatin obtained from bovine pancreas

    International Nuclear Information System (INIS)

    The main objective of this study was to prepare pancreatin in liquid and powder form and to determine its amylase activity in crude homogenate of animal tissue. Different conditions were optimized for estimation of maximal activity including pH, temperature and substrate concentration. The optimum pH was found to be 6.8. The enzyme was optimally active at 50 degree C. The effect of substrate concentration on enzyme activity was also studied and Km was found to be 0.5%. (author)

  18. Clinical significance of elevated serum and urine amylase levels in patients with appendicitis. (United States)

    Swensson, E E; Maull, K I


    During the 45 month period beginning January 1977, 251 patients with a pathologically confirmed diagnosis of acute appendicitis underwent celiotomy at the Medical College of Virginia Hospital. A preoperative serum or urine amylase determination was recorded in 155 of the patients (62 percent). Of this group, 15 patients (10 percent) had elevation of serum amylase or 2 hour urine amylase. Hyperamylasemia or hyperamylasuria directly led to misdiagnosis or treatment delay in 5 of the 15 patients. Appendiceal rupture occurred in three patients, two of whom had prolonged (greater than 1 month) hospitalizations directly attributable to the misdiagnosis. As a result of this study, we conclude that (1) acute appendicitis and elevated amylase levels may occur concurrently, (2) hyperamylasemia or hyperamylasuria should not dissuade the surgeon from early operation if other clinical features suggest appendicitis, and (3) abdominal pain and elevation of amylase level define significant intraabdominal disease, not specifically pancreatic disease.

  19. [Diagnostic significance of index alpha-amylase/glucose in amniotic fluid in prediction of fetal maturity]. (United States)

    Krasomski, G; Sałacińska, B; Broniarczyk, D; Swiatkowska, E


    An increase in alpha-amylase activity with parallel decrease in glucose concentration in amniotic fluid is observed during pregnancy. This interdependence is a theoretical basis for using an alpha-amylase/glucose index in fetal maturity evaluation. The aim of the study was to investigate usefulness of the alpha-amylase/glucose index in amniotic fluid in prenatal fetal maturity diagnosis. The study was carried out on 180 pregnant women, chosen by random selection, hospitalized in Polish Mother's Health Centre Hospital in the period from 15.06.1994 to 31.12.1995. 223 samples of amniotic fluid were tested for glucose concentration and alpha-amylase activity. It was found that the alpha-amylase/glucose or = 6.0 index has high diagnostic value (95.8%) in prenatal prediction of fetal lung maturity. PMID:11757480

  20. Clinical significance of elevated serum and urine amylase levels in patients with appendicitis. (United States)

    Swensson, E E; Maull, K I


    During the 45 month period beginning January 1977, 251 patients with a pathologically confirmed diagnosis of acute appendicitis underwent celiotomy at the Medical College of Virginia Hospital. A preoperative serum or urine amylase determination was recorded in 155 of the patients (62 percent). Of this group, 15 patients (10 percent) had elevation of serum amylase or 2 hour urine amylase. Hyperamylasemia or hyperamylasuria directly led to misdiagnosis or treatment delay in 5 of the 15 patients. Appendiceal rupture occurred in three patients, two of whom had prolonged (greater than 1 month) hospitalizations directly attributable to the misdiagnosis. As a result of this study, we conclude that (1) acute appendicitis and elevated amylase levels may occur concurrently, (2) hyperamylasemia or hyperamylasuria should not dissuade the surgeon from early operation if other clinical features suggest appendicitis, and (3) abdominal pain and elevation of amylase level define significant intraabdominal disease, not specifically pancreatic disease. PMID:6172043

  1. Amylase production by endophytic fungi Cylindrocephalum sp. isolated from medicinal plant Alpinia calcarata (Haw. Roscoe

    Directory of Open Access Journals (Sweden)

    V. H. Sunitha.


    Full Text Available Amylases are among the most important enzymes used in modern biotechnology particularly in the process involving starch hydrolysis. Fungal amylase has large applications in food and pharmaceutical industries. Considering these facts, endophytic fungi isolated from the plant Alpinia calcarata (Haw. Roscoe were screened for amylolytic activity on glucose yeast extract peptone agar (GYP medium. Among thirty isolates of endophytic fungi, isolate number seven identified as Cylindrocephalum sp. (Ac-7 showed highest amylolytic activity and was taken for further study. Influence of various physical and chemical factors such as pH, temperature, carbon and nitrogen sources on amylase production in liquid media were studied. The maximal amylase production was found to be at 30ºC and at pH 7.0 of the growth medium. Among the various carbon and nitrogen sources tested, maltose at 1.5% and Sodium nitrate at 0.3% respectively gave optimum amylase production.

  2. Amylase/creatinine clearance ratio in diabetic ketoacidosis: a case report. (United States)

    Boybeyi, Ozlem; Ergür, Ayça Törel; Dursun, Zarife Esra; Gülerman, Fulya


    Diabetic ketoacidosis (DKA) accompanies any other intra-abdominal pathology. Serum amylase/lipase levels are commonly used in order to rule out acute pancreatitis in patients having abdominal pain in DKA. A more specific and noninvasive diagnostic tool - amylase/creatinine clearance ratio (ACCR) - can be used to rule out pancreatitis in patients with DKA. A 14-year-old girl was admitted with abdominal pain and nausea. She had been followed up for type 1 diabetes mellitus for the last 5 years. The serum amylase levels were increased up to 687 U/L (normal: 28-120 U/L) on the third day of hospitalization. Simultaneous serum and urinary amylase concentrations were measured, and ACCR was calculated (1.2%). The diagnosis of pancreatitis was ruled out. The serum amylase levels decreased in the following days, and she was discharged. ACCR determination is a simple and specific test to diagnose pancreatitis, especially in patients with DKA.

  3. Amylase/creatinine clearance ratio in diabetic ketoacidosis: a case report. (United States)

    Boybeyi, Ozlem; Ergür, Ayça Törel; Dursun, Zarife Esra; Gülerman, Fulya


    Diabetic ketoacidosis (DKA) accompanies any other intra-abdominal pathology. Serum amylase/lipase levels are commonly used in order to rule out acute pancreatitis in patients having abdominal pain in DKA. A more specific and noninvasive diagnostic tool - amylase/creatinine clearance ratio (ACCR) - can be used to rule out pancreatitis in patients with DKA. A 14-year-old girl was admitted with abdominal pain and nausea. She had been followed up for type 1 diabetes mellitus for the last 5 years. The serum amylase levels were increased up to 687 U/L (normal: 28-120 U/L) on the third day of hospitalization. Simultaneous serum and urinary amylase concentrations were measured, and ACCR was calculated (1.2%). The diagnosis of pancreatitis was ruled out. The serum amylase levels decreased in the following days, and she was discharged. ACCR determination is a simple and specific test to diagnose pancreatitis, especially in patients with DKA. PMID:25153214

  4. Interactions between Barley a-Amylases, Substrates, Inhibitors and Regulatory Proteins

    DEFF Research Database (Denmark)

    Hachem, Maher Abou; Bozonnet, Sophie; Willemoës, Martin;


    Barley a-amylase binds sugars at two sites on the enzyme surface in addition to the active site. Crystallography and site-directed mutagenesis highlight the importance of aromatic residues at these surface sites as demonstrated by Kd values determined for ß-cyclodextrin by surface plasmon resonance...... by mutagenesis, crystallography and microcalorimetry. Further improvement of recombinant AMY2 production allows future direct mutational analysis in this isozyme. Specific proteinaceous inhibitors act on a-amylases of different origin. In the complex of barley a-amylase/subtilisin inhibitor (BASI) with AMY2...... of the disulphide reductase thioredoxin h that attacks a specific disulphide bond in BASI and, remarkably, reduces two different disulphide bonds in the barley monomeric and dimeric amylase inhibitors that both belong to the CM-proteins and inhibit animal a-amylase....

  5. Clinical Performance of a Salivary Amylase Activity Monitor During Hemodialysis Treatment

    Directory of Open Access Journals (Sweden)

    Masaru Shimazaki


    Full Text Available The hemodialysis procedure is thought to be a physical stressor in the majority of hemodialyzed patients. Previous studies suggest that elevated salivary amylase level may correlate with increased plasma norepinephrine level under psychological and physical stress conditions. In this study, we investigated biological stress reactivity during hemodialysis treatment using salivary amylase activity as a biomarker. Seven patients (male/female = 5/2, age:67.7+ /− 5.9 years who had been receiving regular 4 h hemodialysis were recruited. Salivary amylase activity was measured using a portable analyzer every hour during the hemodialysis session. Salivary amylase activity was shown to be relatively stable and constant throughout hemodialysis, whereas there were significant changes in systolic blood pressure and pulse rate associated with blood volume reduction. Our results show that hemodialysis treatment per se dose not affect salivary amylase activity.

  6. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation. (United States)

    Nakajima, Kei


    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations (CNVs) in the salivary amylase gene (AMY1), which range more broadly than the pancreatic amylase gene (AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent (minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance (major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome. PMID:27022442


    Directory of Open Access Journals (Sweden)

    Berhanu Andualem


    Full Text Available ‘Tella’ is local beer which is used in most part of Ethiopia. It is made from cereals, such as barley, wheat, maize and other crops. Rhamnus prinoides is also used to provide a special aroma and flavor as well as antiseptic agent. The objective of this study is to determine the contribution of amylases from tella yeast isolates and compare with the role of amylase from malt. House hold ‘tella’ samples were collected and plated on starch agar and then amylase positive isolates of yeast were identified by folding iodine solution over the starch agar. Amylase assay and activities were investigated by standard methods and compared with amylase from malt. According to this study, the activity of amylases which was extracted from yeast isolates was very low and may have no contribution in the conversion of starch into fermentable sugars. Thus, it is better to avoid such organisms from ‘tella’ fermentation in order to discriminate unwanted bio-products. In conclusion, the substrates and ingredients should be sterilized and introduced into the fermentation system aseptically.

  8. Characterization of two coleopteran α-amylases and molecular insights into their differential inhibition by synthetic α-amylase inhibitor, acarbose. (United States)

    Channale, Sonal M; Bhide, Amey J; Yadav, Yashpal; Kashyap, Garima; Pawar, Pankaj K; Maheshwari, V L; Ramasamy, Sureshkumar; Giri, Ashok P


    Post-harvest insect infestation of stored grains makes them unfit for human consumption and leads to severe economic loss. Here, we report functional and structural characterization of two coleopteran α-amylases viz. Callosobruchus chinensis α-amylase (CcAmy) and Tribolium castaneum α-amylase (TcAmy) along with their interactions with proteinaceous and non-proteinaceous α-amylase inhibitors. Secondary structural alignment of CcAmy and TcAmy with other coleopteran α-amylases revealed conserved motifs, active sites, di-sulfide bonds and two point mutations at spatially conserved substrate or inhibitor-binding sites. Homology modeling and molecular docking showed structural differences between these two enzymes. Both the enzymes had similar optimum pH values but differed in their optimum temperature. Overall, pattern of enzyme stabilities were similar under various temperature and pH conditions. Further, CcAmy and TcAmy differed in their substrate affinity and catalytic efficiency towards starch and amylopectin. HPLC analysis detected common amylolytic products like maltose and malto-triose while glucose and malto-tetrose were unique in CcAmy and TcAmy catalyzed reactions respectively. At very low concentrations, wheat α-amylase inhibitor was found to be superior over the acarbose as far as complete inhibition of amylolytic activities of CcAmy and TcAmy was concerned. Mechanism underlying differential amylolytic reaction inhibition by acarbose was discussed. PMID:27132147

  9. Antidiabetic Indian plants: a good source of potent amylase inhibitors. (United States)

    Bhat, Menakshi; Zinjarde, Smita S; Bhargava, Shobha Y; Kumar, Ameeta Ravi; Joshi, Bimba N


    Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II) is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG). Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L.) Sprengel; Ocimum tenuflorum (L.) (syn: Sanctum); Syzygium cumini (L.) Skeels (syn: Eugenia jambolana); Linum usitatissimum (L.) and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor. PMID:18955350

  10. Antidiabetic Indian Plants: A Good Source of Potent Amylase Inhibitors

    Directory of Open Access Journals (Sweden)

    Menakshi Bhat


    Full Text Available Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG. Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L. Sprengel; Ocimum tenuflorum (L. (syn: Sanctum; Syzygium cumini (L. Skeels (syn: Eugenia jambolana; Linum usitatissimum (L. and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor.

  11. Amylase in the saliva and in the gastric aspirates of premature infants: its potential role in glucose polymer hydrolysis. (United States)

    Hodge, C; Lebenthal, E; Lee, P C; Topper, W


    Amylase activity was found in saliva from 13 infants, 26-42 wk corrected gestational age. The levels of salivary amylase activity increased with advancing age. In 10 infants, 31-38 wk corrected gestational age (estimated gestational age in wk plus age in wk after birth), gastric aspirates collected before a feeding and sequentially at 30-min intervals after two consecutive feedings were analyzed for amylase activity and pH. Two different postprandial patterns were obtained. For six of the 10 infants, both the pH and amylase activities of their gastric aspirates showed a distinct maxima at about 60 min after a feeding and a minima at 180 min just before the second feeding. In the remaining four infants, the pHs of their gastric aspirates remained relatively high (5.0-6.0) for the entire postprandial period. In these infants, there was a persistently high level of the amylase activity. In all 10 infants, amylase activity was found in their gastric aspirate samples when the pH was above 3.0. Comparison of the amylase in the gastric aspirate with purified pancreatic and salivary amylases by polyacrylamide gel electrophoresis showed that the amylase in the gastric aspirate has an electrophoretic mobility similar to that of salivary amylase, which suggests a salivary origin. This study supports the possibility that salivary amylase could enter the stomach and retain a significant amount of its activity in premature infants. PMID:6197692

  12. An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment

    DEFF Research Database (Denmark)

    Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter


    A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold-ad...... in two commercial detergents tested, suggesting that the AmyI3C6 α-amylase may be useful as a detergent enzyme in environmentally friendly, low-temperature laundry processes. © 2014 Springer-Verlag Berlin Heidelberg.......A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold-adapted...

  13. The Prognostic Value of Drain Amylase on Post-Operative Day One after the Whipple Procedure

    Directory of Open Access Journals (Sweden)

    Kristina Hasselgren


    Full Text Available Introduction For patients with periampullary tumors, the only treatment with curative intention is resection. One potentially serious complication is a postoperative pancreatic fistula. The reported risk factors are a soft pancreas and a small pancreatic duct as well as overweight/ obesity. The aim of this study was to investigate the prognostic value for a postoperative pancreatic fistula of elevated drain amylase (>3 times the upper limit in serum on postoperative day 1. Results In total, 170 patients underwent a pancreaticoduodenectomy at Linköping University Hospital between 2011 and 2014; 27 patients (16% had a postoperative complication ≥ grade 3b, and the postoperative mortality was 3%. The patients with elevated drain amylase on postoperative day one (n=65 had more complications (≥3b than the patients without elevated levels (n=80, although the difference was not significant (p=0.054. Two patients (3% without elevated amylase on postoperative day 1 developed postoperative pancreatic fistula (p<0.001 compared to 29 patients (45% with elevated amylase. Conclusion Normal drain amylase on postoperative day 1 is associated with a lower risk of postoperative complications than is elevated drain amylase. Elevated amylase in the drain fluid on postoperative day 1 is significantly correlated with POPF and is associated with an increased risk of postoperative complications.

  14. β-amylase in developing apple fruits: activities, amounts and subcellular localization

    Institute of Scientific and Technical Information of China (English)

    张大鹏; 王永章


    Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuberous roots, and fleshy fruit development. Based on previously reported in vitro assays, β-amylase is considered one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was shown often extrachloroplastic in living cells. The present experiment showed that β-amylase activity was progressively increasing concomitantly with decreasing starch concentrations during apple (Malus domestica Borkh cv. Starkrimson) fruit development. The apparent amount of β-amylase assessed by Western blotting also increased during the fruit development, which is consistent with the seasonal changes in the enzyme activity. The subcellular-localization studies via immunogold electron-microscopy technique showed that β-amylase visualized by gold particles was predominantly located in plastids especially at periphery of starch granules, but the gold particles were scarcely found in other subcellular compartments. These data proved for the first time that the enzyme is compartmented in its functional sites in plant living cells. The predominantly plastid-distributed pattern of β-amylase in cells was shown unchanged throughout the fruit development. The density of gold particles (β-amylase) in plastids was increasing during the fruit development, which is consistent with the results of Western blotting. So it is considered that β-amylase is involved in starch hydrolysis in plastids of the fruit cells.

  15. Studies on the Thermodenaturation Behavior of Bacillus subtilis α-Amylase on Chromatographic Media

    Institute of Scientific and Technical Information of China (English)


    The thermodenaturation behavior of Bacillus subtilis α-amylase on some chromatographic media was studied by determining their adsorption parameters with frontal analysis. The experimental results show that on a RP-C18 reversed-phase medium, a Chelating Sepharose Fast-Flow chelated by Zn2+ affinity medium and a WCX-1 cation-exchange medium, a stable conformation of a-amylase molecule separately exists below or over 30℃; while on a PEG-400 hydrophobic medium and a modified PEG-400 medium, a stable conformation of α-amylase mole-cule separately exists below 40 and 30℃, and when the experimental temperatures are separately over 40 and 30℃,a drastically conformational change of α-amylase molecules can continuously take place. And by combining the in-trinsic fluorescence emission spectrum and thermal inactivation profile of α-amylase in free solution and on the PEG-400 and modified PEG-400 hydrophobic media, it can be concluded that in liquid chromatographic procedure,chromatographic media can induce the conformational change of a-amylase molecules and promote their ther-modenaturation; and in hydrophobic interaction chromatography, the higher the hydrophobicity of chromatographicmedium, the lower the conformational change temperature of a-amylase molecules on the chromatographic me-dium.

  16. α-Amylase: an enzyme specificity found in various families of glycoside hydrolases

    DEFF Research Database (Denmark)

    Janeček, Štefan; Svensson, Birte; MacGregor, E. Ann


    α-Amylase (EC represents the best known amylolytic enzyme. It catalyzes the hydrolysis of α-1,4-glucosidic bonds in starch and related α-glucans. In general, the α-amylase is an enzyme with a broad substrate preference and product specificity. In the sequence-based classification system...... of all carbohydrate-active enzymes, it is one of the most frequently occurring glycoside hydrolases (GH). α-Amylase is the main representative of family GH13, but it is probably also present in the families GH57 and GH119, and possibly even in GH126. Family GH13, known generally as the main α-amylase...... family, forms clan GH-H together with families GH70 and GH77 that, however, contain no α-amylase. Within the family GH13, the α-amylase specificity is currently present in several subfamilies, such as GH13_1, 5, 6, 7, 15, 24, 27, 28, 36, 37, and, possibly in a few more that are not yet defined. The α-amylases...

  17. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch

    International Nuclear Information System (INIS)

    α-Amylase (EC; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. Km values were 0.26 and 0.87 mM and Vmax values were 0.36 IU mg−1 and 22.32 IU mg−1 for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70–80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. - Highlights: ► Developing to prepare nanoprotein particles carrying α-amylase ► Characterization of nanostructured α-amylase ► Usability of α-amylase nanoparticles in hydrolysis of starch

  18. Spectroscopic study on the interaction of Bacillus subtilis α-amylase with cetyltrimethylammonium bromide

    International Nuclear Information System (INIS)

    The interaction between α-amylase from Bacillus subtilis and cetyltrimethylammonium bromide (CTAB) has been investigated at various temperature conditions using fluorescence and circular dichroism (CD) spectroscopic methods. Fluorescence data revealed that the fluorescence quenching of α-amylase by CTAB is the result of complex formation between CTAB and α-amylase. The thermodynamic analysis on the binding interaction data shows that the interactions are strongly exothermic (ΔHo=-17.92 kJ mol-1) accompanied with increase in entropy (ΔSo between 109 to 135 J mol-1 K-1). Thus the binding of CTAB to α-amylase is both enthalpic and entropic driven, which represent the predominate role of both electrostatic and hydrophobic interactions in complex formation process. The values of 2.17x10-3 M-1 and 1.30 have been obtained from associative binding constant (Ka) and stoichiometry of binding number (n), from analysis of fluorescence data, respectively. Circular dichroism spectra showed the substantial conformational changes in secondary structure of α-amylase due to binding of CTAB, which represents the complete destruction of both secondary and tertiary structure of α-amylase by CTAB. - Research highlights: → The Fluorescence quenching effect of α-amylase by CTAB is a consequence of formation α-amylase-CTAB complex. → The α-helical analyzing from the CD spectra in the various concentration of CTAB shows strongly deformation of α-amylase. → Thermodynamic analysis of quenching verify that the interactions are both enthalpy and entropic driven.

  19. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch

    Energy Technology Data Exchange (ETDEWEB)

    Say, R. [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Şenay, R. Hilal [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Akgöl, Sinan, E-mail: [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Denizli, Adil [Hacettepe University, Faculty of Science, Chemistry Department, 06532 Ankara (Turkey)


    α-Amylase (EC; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. K{sub m} values were 0.26 and 0.87 mM and V{sub max} values were 0.36 IU mg{sup −1} and 22.32 IU mg{sup −1} for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70–80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. - Highlights: ► Developing to prepare nanoprotein particles carrying α-amylase ► Characterization of nanostructured α-amylase ► Usability of α-amylase nanoparticles in hydrolysis of starch.

  20. Spectroscopic study on the interaction of Bacillus subtilis {alpha}-amylase with cetyltrimethylammonium bromide

    Energy Technology Data Exchange (ETDEWEB)

    Omidyan, R., E-mail: [Department of Chemistry, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of); Kazemi, S.H. [Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of); Bordbar, A.K. [Department of Chemistry, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Zaynalpour, S. [Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of)


    The interaction between {alpha}-amylase from Bacillus subtilis and cetyltrimethylammonium bromide (CTAB) has been investigated at various temperature conditions using fluorescence and circular dichroism (CD) spectroscopic methods. Fluorescence data revealed that the fluorescence quenching of {alpha}-amylase by CTAB is the result of complex formation between CTAB and {alpha}-amylase. The thermodynamic analysis on the binding interaction data shows that the interactions are strongly exothermic ({Delta}H{sup o}=-17.92 kJ mol{sup -1}) accompanied with increase in entropy ({Delta}S{sup o} between 109 to 135 J mol{sup -1} K{sup -1}). Thus the binding of CTAB to {alpha}-amylase is both enthalpic and entropic driven, which represent the predominate role of both electrostatic and hydrophobic interactions in complex formation process. The values of 2.17x10{sup -3} M{sup -1} and 1.30 have been obtained from associative binding constant (K{sub a}) and stoichiometry of binding number (n), from analysis of fluorescence data, respectively. Circular dichroism spectra showed the substantial conformational changes in secondary structure of {alpha}-amylase due to binding of CTAB, which represents the complete destruction of both secondary and tertiary structure of {alpha}-amylase by CTAB. - Research highlights: {yields} The Fluorescence quenching effect of {alpha}-amylase by CTAB is a consequence of formation {alpha}-amylase-CTAB complex. {yields} The {alpha}-helical analyzing from the CD spectra in the various concentration of CTAB shows strongly deformation of {alpha}-amylase. {yields} Thermodynamic analysis of quenching verify that the interactions are both enthalpy and entropic driven.

  1. Variations of salivary amylase as a test of internal irradiation in man

    Energy Technology Data Exchange (ETDEWEB)

    Zamfirescu-Gheorghiu, M.; Cheta, N.; Funduc, I.; Ciobanu, F.


    The hypothesis of the parotid gland radiosensitivity has suggested to the authors to follow up the effect of therapeutic internal irradiation on the serum, urine and salivary ..cap alpha..-amylasee activity in man. The assay and visualization of ..cap alpha..-amylase isoenzymes on agar gel zymograms by using the ''Phadebas amylase test'' tablets has demonstrated in some cases increases of salivary ..cap alpha..-amylase activity expressed by the ratio of the optical density after internal irradiation to that before administration of radioisotopes.

  2. Seeking new mutation clues from Bacillus licheniformis amylase by molecular dynamics simulations (United States)

    Lu, Tao


    Amylase is one of the most important industrial enzymes in the world. Researchers have been searching for a highly thermal stable mutant for many years, but most focus on point mutations of one or few nitrogenous bases. According to this molecular dynamic simulation of amylase from Bacillus licheniformis (BLA), the deletion of some nitrogenous bases would be more efficacious than point mutations. The simulation reveals strong fluctuation of the BLA structure at optimum temperature. The fluctuation of the outer domains of BLA is stronger than that of the core domain. Molecular simulation provides a clue to design thermal stable amylases through deletion mutations in the outer domain.

  3. Changes of amylase and trypsin activities in pancreas of rats after γ-irradiation

    International Nuclear Information System (INIS)

    The activities of amylase and trypsin in pancreas of rats decreased significantly after irradiation. The degree of changes in both amylase and trypsin was identical, depending on radiation doses and varying with the weight of pancreas. Within a certain range of doses the weight and enzymic activity of pancreas decreased gradually. The amylase and trypsin activities of pancreas decreased markedly after 6 Gy exposure. These enzymic activities varied with time after exposure and fluctuated around low level for a long time. The recovery of enzymic activity occurred later than that of pancreas weight. These results indicated that the mechanism of decrease and recovery of pancreatic enzyme was complex

  4. Regulation of amylase messenger RNA concentration in rat pancreas by food content.


    Giorgi, D; Bernard, J P; Lapointe, R.; Dagorn, J C


    Regulation of the expression of pancreatic amylase genes was studied by comparing groups of rats fed diets with high (75%), intermediate (20%) and low (11%) carbohydrate content. Animals on the high carbohydrate diet had nine times as much amylase mRNA as those on low carbohydrate diet, and twice as much as the intermediate group, as determined by filter hybridization of equal amounts of total pancreatic RNA to an excess of a cloned rat amylase cDNA probe. Parallel results were obtained when ...

  5. Measurements of amylase isoenzymes in sera and saliva of patients after radiotherapy because of larynx carcinoma

    International Nuclear Information System (INIS)

    Serum and salivary alpha-amylase were measured for controls and patients with laryngeal carcinoma before and after localized irradiation including salivary glands. A significant increase in amylasemia was observed after irradiation. Alpha-amylase activity in saliva was decreased after irradiation but differences were not statistically significant due to the significant decrease of protein in saliva of irradiated group. An increase of salivary isoenzyme S activity was observed while pancreatic isoenzyme activity was not altered. This method allows easy differentiation of hyperamylasemia due to irradiation of parothyroid gland and disorders of the pancreas. Alpha-amylase activity measurements may detect metabolic changes in salivary glands after irradiation. (author)

  6. Effects of irradiation with conventional and multiple daily fractionation on serum amylase activity

    International Nuclear Information System (INIS)

    The behaviour of serum α-amylase activity was determined in patients with head and neck cancer treated by radiation therapy. The levels of serum α-analyse activity during conventional and multiple daily fractionation were compared. Starting from the second day of treatment an increase of serum α-amylase activity was observed. The increase and its duration depended on the total daily dose: after the first day of treatment a linear correlation between serum levels and total daily dose could be observed. The size of the amylase increase correlated to the proportion of salivary gland tissue included in the irradiated volume. (orig.)

  7. Limitation of amylase creatinine clearance ratio as a diagnostic test for postoperative pancreatitis. (United States)

    Wapnick, S; Evans, M I; Hadas, N; Grosberg, S J


    The mean +/- S.E.M. ratio of amylase to creatinine clearance significantly increased at 24 hours after operations on the stomach and gallbladder but not after operations at sites remote from the abdominal cavity. Clinically, the elevated amylase to creatinine clearance ratio was not accompanied by pancreatitis. In dogs, surgical handling of the pancreas alone caused a significant increase in this measurement. The amylase to creatinine clearance ratio is not likely to be helpful in predicting the rare, but serious, postoperative complication of pancreatitis.



    Suganthi; R., Benazir,; J.F., Santhi,; R., Ramesh Kumar,; V., Anjana Hari,; Nitya Meenakshi; Nidhiya; K. A., Kavitha,; G., Lakshmi, R.


    Solid state fermentation holds tremendous potentials for the production of the enzyme amylase by Aspergillus niger. Different solid substrates like rice bran, wheat bran, black gram bran, coconut oil cake, gingely oil cake and groundnut oil cake are rich in starch. These agro industrial residues are cheap raw materials for amylase production. Aspergillus niger BAN3E was identified to be the best producer of amylase. When A. niger BAN3E was incubated for 6 days at 37°C it showed high yield of ...

  9. Effect of Cerium on Activity of α-Amylase from Porcine Pancreas

    Institute of Scientific and Technical Information of China (English)

    王雪峰; 洪法水; 沈颂东; 苏国兴; 潘兴法


    The activity of α-amylase from porcine pancreas was enhanced under the treatment by Ce3+ of low concentration (0.5~10 μmol*L-1), but was inhibited by Ce3+ of high concentration (>10 μmol*L-1). Ce3+ at high concentration displaced Ca2+ from α-amylase competitively. The equilibrium dialysis demonstrates that α-amylase has five Ca2+-binding sites with different affinities. The fluorescence titration shows that Ce3+ can bind to Ca2+-binding sites.

  10. Kinetic studies of acid inactivation of alpha-amylase from Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens Bredal; Villadsen, John


    The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on...... regains part of its activity, and the reactivation process also follows first-order kinetics. The irreversible loss of activity is found not to result from a protease contamination of the protein samples. A proposed model, where irreversibly inactivated a-amylase is formed both directly from the active...

  11. Purification of a novel α-amylase inhibitor from local Himalayan bean (Phaseolus vulgaris) seeds with activity towards bruchid pests and human salivary amylase. (United States)

    Gupta, Mridu; Sharma, Pratima; Nath, Amarjit K


    Six bean (Phaseolus vulgaris L.) cultivars of Himalayan region were analysed for α- amylase inhibitor activity. The α-amylase inhibitor from seeds of screened bean cultivar KR-9, showing maximum inhibitory activity was purified using ammonium sulfate precipitation, gel filtration chromatography (Sephadex G-100) and ion exchange chromatography (DEAE-Sephadex). The inhibitor was purified to homogeneity as judged by native-PAGE with 14.22 fold purification and 71.66% recovery. Purified inhibitor consisted of three subunits of molecular weight 15,488, 18,620 and 26,302 daltons, respectively as determined by SDS-PAGE. It was found to be heat stable up to 30 °C-40 °C and had two pH optima of 5.0 and 6.9. Nature of inhibition was found to be of non-competitive type. The purified inhibitor was found to be effective against α-amylases extracted from larvae of Callosobruchus chinensis, Tribolium castaneum and gut enzyme of Spodoptera littoralis. Larvae of Tribolium castaneum fed on flour mixed with purified inhibitor for 5 days showed 100% larval mortality. Purified α-amylase inhibitor was also found to inhibit human salivary α-amylase, suggesting its potential in prevention and therapy of obesity and use as drug design targets for treatment of diabetes. The gene encoding the inhibitor may be used to develop transgenic plants resistant against insect pests. PMID:24966421

  12. Enhanced starch hydrolysis using α-amylase immobilized on cellulose ultrafiltration affinity membrane. (United States)

    Konovalova, Viktoriia; Guzikevich, Kateryna; Burban, Anatoliy; Kujawski, Wojciech; Jarzynka, Karolina; Kujawa, Joanna


    In order to prepare ultrafiltration membranes possessing biocatalytic properties, α-amylase has been immobilized on cellulose membranes. Enzyme immobilization was based on a covalent bonding between chitosan and a surface of cellulose membrane, followed by an attachment of Cibacron Blue F3G-A dye as affinity ligand. Various factors affecting the immobilization process, such as enzyme concentration, pH of modifying solution, zeta-potential of membrane surface, and stability of immobilized enzyme were studied. The applicability of immobilized α-amylase has been investigated in ultrafiltration processes. The immobilization of α-amylase on membrane surface allows to increase the value of mass transfer coefficient and to decrease the concentration polarization effect during ultrafiltration of starch solutions. The enzyme layer on the membrane surface prevents a rapid increase of starch concentration due to the amylase hydrolysis of starch in the boundary layer. The presented affinity immobilization technique allows also for the regeneration of membranes from inactivated enzyme.

  13. Plasma amylase activity as a biochemical indicator of radiation injury to salivary glands

    Energy Technology Data Exchange (ETDEWEB)

    Becciolini, A.; Giannardi, G.; Cionini, L.; Porciani, S.; Fallai, C.; Pirtoli, L. (Florence Univ. (Italy). Ist. di Radiologia)


    Irradiation of the salivary glands produces a rapid increase of salivary amylase in serum, released by the highly radiation sensitive serous cells of the glands. Serial assays of salivary amylase in serum were performed in patients treated by radiation to the upper neck region. The changes observed were compared with the amount of salivary gland mass irradiated and with the dose fractionation modality used. The irradiated volume included either the entire salivary gland mass or less than 50 per cent of the gland. Two fractionation modalities were used: a conventional fractionation of 2 Gy per day, 5 times a week, or a multiple daily fractionation of 2 Gy, 3 times a day in two series of 4 days with a 4-day interval. Both parameters (salivary gland mass irradiated and fractionation modality used) significantly influenced the shape of the amylase curve in the serum. Serum amylase may therefore be considered a reliable biologic indicator of early injury to the salivary glands.

  14. Isolation of Amylase Producing Bacteria from Solar Salterns of Nellore District, Andhra Pradesh, India

    Directory of Open Access Journals (Sweden)

    Shameer Syed


    Full Text Available α-Amylases are a class of starch degrading enzymes catalyzing the hydrolysis of internal α-1,4-O-glycosidic bonds in polysaccharides. The following investigation were carried out to isolate haloalkaliphilic bacteria, a group of organisms with twin extremities of pH and salinity, capable of producing α-amylases from an artificial solar saltern. A total of 25 discrete colonies were isolated, 21 isolates showed amylase production. Among these 7 isolates produced amylase at extreme conditions such as salt, alkalinity and temperature. The isolates were characterized biochemically and also for other enzymes. From the results it is imperative that these isolates can be further studied to exploit them up to industrial scale.

  15. Characterization of extracellular amylase produced by haloalkalophilic strain Kocuria sp. HJ014. (United States)

    Soto-Padilla, Marisela Y; Gortáres-Moroyoqui, Pablo; Cira-Chávez, Luis A; Levasseur, Anthony; Dendooven, Luc; Estrada-Alvarado, María Isabel


    The haloalkaliphilic bacterium Kocuria sp. (HJ014) has the ability to produce extracellular amylase. The aim of this study was to purify and characterize this protein. The amylase enzyme with a specific activity of 753,502 U/mg was purified 5.7- fold using Sepharose 4B and Sephacryl S-300 gel filtration columns. The molecular weight of the enzyme was 45,000 Da as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The amylase showed maximum activity at pH 9 and 50°C in the presence of 3.5 M NaCl. The Km was 3.0 mg/ml and Vmax 90.09 U/ml. It was found that extracellular amylase from Kocuria sp. has a high industrial potential. PMID:26813880

  16. Effect of 60Co-gamma whole-body irradiation on serum amylase level

    International Nuclear Information System (INIS)

    Changes of serum amylase activity in rats, after several doses of acut 60Co-gamma irradiation as a function of time were investigated. These changes proved to be of no diagnostic value in early radiation damage. (author)

  17. Plasma amylase activity as a biochemical indicator of radiation injury to salivary glands

    International Nuclear Information System (INIS)

    Irradiation of the salivary glands produces a rapid increase of salivary amylase in serum, released by the highly radiation sensitive serous cells of the glands. Serial assays of salivary amylase in serum were performed in patients treated by radiation to the upper neck region. The changes observed were compared with the amount of salivary gland mass irradiated and with the dose fractionation modality used. The irradiated volume included either the entire salivary gland mass or less than 50 per cent of the gland. Two fractionation modalities were used: a conventional fractionation of 2 Gy per day, 5 times a week, or a multiple daily fractionation of 2 Gy, 3 times a day in two series of 4 days with a 4-day interval. Both parameters (salivary gland mass irradiated and fractionation modality used) significantly influenced the shape of the amylase curve in the serum. Serum amylase may therefore be considered a reliable biologic indicator of early injury to the salivary glands. (Auth.)

  18. Augmentation of cholinergic-mediated amylase release by forskolin in mouse parotid gland

    International Nuclear Information System (INIS)

    Cholinergic-mediated amylase release in mouse parotid acini was augmented by forskolin; the potency but not the maximal response to carbachol was altered. Amylase released by carbachol plus forskolin was dependent on extracellular calcium and was mimicked by the calcium ionophore, A23187 plus forskolin. Forskolin was also shown to enhance carbachol-stimulated 45Ca2+ uptake into isolated acini. Hydroxylamine, nitroprusside, and 8-bromo-c-GMP each in combination with forskolin mimicked the effects of carbachol plus forskolin on amylase release. In the presence of carbachol (10-8M) forskolin did not augment c-AMP levels. However, in the presence of carbachol (5 x 10-7 M) or hydroxylamine (50 μM) forskolin did significantly augment c-AMP accumulation. These results suggest that calcium and c-GMP may mediate the augmentation of cholinergic-mediated amylase release by effects on c-AMP metabolism. 21 references, 1 figure, 3 tables

  19. Increased serum amylase in patients after radiotherapy as a probable bioindicator for radiation exposure

    International Nuclear Information System (INIS)

    The radiation-induced increase of serum amylase is investigated in 41 patients following either whole body irradiation or irradiation of the head- and neck-region. The radiation treatment caused a dose-independent serum amylase increase up to 80 times of the preirradiation measured in controls. This increase can only be induced if the salivary glands are within the radiation field. An isoenzyme analysis differentiated between salivary and pancreatic amylase. It was shown that also in case of whole body irradiation (wbi) pancreatic proteins either contribute only to a small extent to the increase or show no recognizable change. Although great variations in radiation response remain, the increase of serum amylase produced by salivary glands is highly significant and serves as a bioindicator for radiation exposures. (orig.)

  20. Effect of oilseed cakes on alpha-amylase production by Bacillus licheniformis CUMC305. (United States)

    Krishnan, T; Chandra, A K


    The effects of oilseed cakes on extracellular thermostable alpha-amylase production by Bacillus licheniformis CUMC305 was investigated. Each oilseed cake was made of groundnut, mustard, sesame, linseed, coconut copra, madhuca, or cotton. alpha-Amylase production was considerably improved in all instances and varied with the oilseed cake concentration in basal medium containing peptone and beef extract. Maximum increases were effected by a low concentration (0.5 to 1.0%) of groundnut or coconut, a high concentration (3%) of linseed or mustard, and an Rintermediate concentration (2%) of cotton, madhuca, or sesame. The oilseed cakes made of groundnut or mustard could completely replace the conventional peptone-beef extract medium as the fermentation base for the production of alpha-amylase by B. licheniformis. The addition of corn steep liquor to cotton, linseed, sesame, or madhuca cake in the medium improved alpha-amylase production. PMID:6181738

  1. The synergetic effect of starch and alpha amylase on the biodegradation of n-alkanes. (United States)

    Karimi, M; Biria, D


    The impact of adding soluble starch on biodegradation of n-alkanes (C10-C14) by Bacillus subtilis TB1 was investigated. Gas chromatography was employed to measure the residual hydrocarbons in the system. It was observed that the efficiency of biodegradation improved with the presence of starch and the obtained residual hydrocarbons in the system were 53% less than the samples without starch. The produced bacterial enzymes were studied through electrophoresis and reverse zymography for explaining the observations. The results indicated that the produced amylase by the bacteria can degrade hydrocarbons and the same was obtained by the application of a commercial alpha amylase sample. In addition, in silico docking of alpha-amylase with n-alkanes with different molecular weights was studied by Molegro virtual docker which showed high negative binding energies and further substantiated the experimental observations. Overall, the findings confirmed the catalytic effect of alpha amylase on n-alkanes degradation. PMID:26971168

  2. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds. (United States)

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C


    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds. PMID:26345793

  3. From carbohydrates to drug-like fragments: Rational development of novel α-amylase inhibitors. (United States)

    Al-Asri, Jamil; Fazekas, Erika; Lehoczki, Gábor; Perdih, Andrej; Görick, Cornelia; Melzig, Matthias F; Gyémánt, Gyöngyi; Wolber, Gerhard; Mortier, Jérémie


    Starch catabolism leading to high glucose level in blood is highly problematic in chronic metabolic diseases, such as type II diabetes and obesity. α-Amylase catalyzes the hydrolysis of starch, increasing blood sugar concentration. Its inhibition represents a promising therapeutic approach to control hyperglycaemia. However, only few drug-like molecule inhibitors without sugar moieties have been discovered so far, and little information on the enzymatic mechanism is available. This work aims at the discovery of novel small α-amylase binders using a systematic in silico methodology. 3D-pharmacophore-based high throughput virtual screening of small compounds libraries was performed to identify compounds with high α-amylase affinity. Twenty-seven compounds were selected and biologically tested, revealing IC50 values in the micromolar range and ligand efficiency higher than the one of the bound form of acarbose, which is used as a reference for α-amylase inhibition.

  4. Amylase Production by the Marine Yeast Aureobasidium pullulans N13d

    Institute of Scientific and Technical Information of China (English)

    LI Haifeng; CHI Zhenming; WANG Xiaohong; MA Chunling


    The marine yeast strain N13d, producing an extracellular amylase, was isolated from the deep sea sediments of the Pacific Ocean. This strain was identified to be Aureobasidium pullulans by 18S rRNA gene sequence analysis and routine yeast identification methods. The optimal sea water medium for amylase production by this yeast strain was 1.0% peptone and 1.0% soluble starch with pH 4.0. The optimal conditions for amylase production by this yeast strain were with temperature 28 ℃, aeration rate 6Lmin-1 and agitation speed 250 rmin-1. Under these conditions, 58.5 units of amylase activity per mg protein were produced within 56h of fermentation.

  5. Peptide-evoked release of amylase from isolated acini of the rat parotid gland

    DEFF Research Database (Denmark)

    Goll, R; Poulsen, J H; Schmidt, P;


    Investigations of the effects of the neuropeptides, substance P (SP), neurokinin A (NKA), neuropeptide K (NPK), gastrin releasing peptide (GRP), calcitonin gene related peptide (CGRP) and vasoactive intestinal peptide (VIP), and of acetylcholine on amylase secretion have been carried out on isola......Investigations of the effects of the neuropeptides, substance P (SP), neurokinin A (NKA), neuropeptide K (NPK), gastrin releasing peptide (GRP), calcitonin gene related peptide (CGRP) and vasoactive intestinal peptide (VIP), and of acetylcholine on amylase secretion have been carried out...... amylase release. VIP, however, with a rather low potency (EC50 at 155 nmol/l). Simultaneous stimulation with two compounds elicited additive responses, except for VIP and acetylcholine which elicited an effect significantly above additive response. Only SP, NKA, VIP and CGRP could be identified...... of NK1-receptors. Thus, the results of the present study support previous suggestions that the tachykinins and VIP are likely to be involved in amylase secretion in the rat parotid gland....

  6. Improved Production of a Heterologous Amylase in Saccharomyces cerevisiae by Inverse Metabolic Engineering

    DEFF Research Database (Denmark)

    Liu, Zihe; Liu, Lifang; Osterlund, Tobias;


    engineering to identify novel targets for improving protein secretion. Screening that combined UV-random mutagenesis and selection for growth on starch was performed to find mutant strains producing heterologous amylase 5-fold above the level produced by the reference strain. Genomic mutations that could...... be associated with higher amylase secretion were identified through whole-genome sequencing. Several single-point mutations, including an S196I point mutation in the VTA1 gene coding for a protein involved in vacuolar sorting, were evaluated by introducing these to the starting strain. By applying...... this modification alone, the amylase secretion could be improved by 35%. As a complement to the identification of genomic variants, transcriptome analysis was also performed in order to understand on a global level the transcriptional changes associated with the improved amylase production caused by UV mutagenesis....

  7. Effect of Static Magnetic Field on α-Amylase Activity and Enzymatic Reaction

    Institute of Scientific and Technical Information of China (English)

    JIA Shaoyi; LIU Yong; WU Songhai; WANG Zhibin


    The effect of magnetic field on α-amylase was studied. Under the experimental conditions, α-amylase solution was treated by 0.15 T, 0.30 T and 0.45 T static magnetic fields for a known period of time, then the activ-ity, kinetic parameters, and the secondary conformation were investigated. The results showed that there was a con-siderable effect of the magnetic exposure on the α-amylase. The activity was increased by 27%, 34.1%, 37.8% compared with the control. It was also found that both kinetic parameters Km and Vm could be decreased due to the increasing magnetic field, Km decreased from 2.20×102 to 0.87×102, whereas Vm decreased from 2.0×103 g/min to 1.1×103g/min. At the same time, there were some irregular changes in α-amylase secondary conformation.

  8. Interactions of barley alpha-amylase isozymes with Ca2+, substrates and proteinaceous inhibitors

    DEFF Research Database (Denmark)

    Abou Hachem, Maher; Bozonnet, Sophie; Willemoes, Martin;


    alpha-Amylases are endo-acting retaining enzymes of glycoside hydrolase family 13 with a catalytic (beta/alpha)(8)-domain containing an inserted loop referred to as domain B and a C-terminal anti-parallel beta-sheet termed domain C. New insights integrate the roles of Ca2+, different substrates......, and proteinaceous inhibitors for alpha-amylases. Isozyme specific effects of Ca2+ on the 80% sequence identical barley alpha-amylases AMY1 and AMY2 are not obvious from the two crystal structures, containing three superimposable Ca2+ with identical ligands. A fully hydrated fourth Ca2+ at the interface of the AMY2....../barley a-amylase/subtilisin inhibitor (BASI) complex interacts with catalytic groups in AMY2, and Ca2+ occupies an identical position in AMY1 with thiomaltotetraose bound at two surface sites. EDTA-treatment, DSC, and activity assays indicate that AMY1 has the highest affinity for Ca2+. Subsite mapping...

  9. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro


    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  10. Immunohistochemical and quantitative changes in salivary EGF, amylase and haptocorrin following radiotherapy for oral cancer

    DEFF Research Database (Denmark)

    Christensen, M E; Hansen, H S; Poulsen, Steen Seier;


    Epidermal growth factor (EGF), amylase and haptocorrin are molecules produced in the salivary glands. The aim of the present study was to determine immunohistochemical and quantitative alterations in EGF as compared with haptocorrin and amylase following radiotherapy for oral cancer. Changes...... in the salivary secretion of EGF are of interest because of the importance of EGF in mucosal regeneration. Immunohistochemical studies on normal tissue from parotid and submandibular glands have demonstrated EGF in the serous acini with a tendency to single cell expression in the parotid gland. Amylase has been...... found in the serous acini of both the submandibular and parotid glands. Haptocorrin was localized in the duct system of both glands. In the submandibular glands with radiotherapy induced sialoadenitis only very few acini with weak or no staining for EGF and amylase were demonstrated, while no changes...

  11. The frequency of marcroamylasemia and the diagnostic value of the amylase to creatinine clearance ratio in patients with elevated serum amylase activity. (United States)

    Dürr, H K; Bindrich, D; Bode, J C


    190 patients with elevated serum amylase levels were tested for macroamylasemia and the amylase to creatinine clearance ratio. Macroamylasemia was found in 3 patients. In these patients macroamylasemia persisted after the total activity of serum amylase had fallen to nearly normal levels. The Cam/Ccr-ratios were determined 14 times in the 3 macroamylasemic patients. Only one of the 14 values was clearly less than 1%. Cam/Ccr-ratios above 4% were found in 83 patients. In 56 of them the diagnosis of acute pancreatitis could not be confirmed. 19 out of 46 patients with the established diagnosis of acute pancreatitis had Cam/Ccr-ratios below 4%. Cam/Ccr-ratios below 1% were also found in patients without macroamylasemia. It is concluded that high and low Cam/Ccr-ratios are not specific for acute pancreatitis and macroamylasemia, respectively, and--moreover--that a normal Cam/Ccr-ratio excludes neither acute pancreatitis nor macroamylesemia.

  12. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Sivasangkary Gandhi


    Full Text Available Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX. Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL−1 at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg−1. The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0–8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t1/2 of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification.

  13. Ability to bind salivary alpha-amylase discriminates certain viridans group streptococcal species.


    Kilian, M.; Nyvad, B


    A collection of 144 viridans group streptococcal strains recently characterized as part of a taxonomic study was examined for the ability to bind salivary alpha-amylase. This property was found in most strains of Streptococcus gordonii and Streptococcus mitis and in occasional strains of Streptococcus anginosus and Streptococcus salivarius. In contrast, all strains of Streptococcus sanguis, Streptococcus oralis, Streptococcus vestibularis, and Streptococcus mutans lacked alpha-amylase-binding...

  14. Biosynthesis of rice seed alpha-amylase: proteolytic processing and glycosylation of precursor polypeptides by microsomes



    Microsomes prepared from the rice seed scutellum were incubated in wheat germ extracts (S-100 fraction) to direct the synthesis of alpha- amylase, a secretory protein subject to proteolytic processing (cleavage of the N-terminal signal sequence) as well as glycosylation during its biosynthesis. The characterization and identification of the immunoprecipitable products synthesized were performed by SDS gel electrophoresis and subsequent fluorography. The molecular weight of the alpha-amylase s...

  15. Effects of alpha-amylase on in vitro growth of Legionella pneumophila.


    Bortner, C A; Miller, R D; Arnold, R.R.


    Sterile parotid saliva inhibited growth of Legionella pneumophila on solid media, and the salivary component involved in this inhibition has been shown to be amylase. Disk diffusion and well plate assays were used to study possible mechanisms for this effect. The amylolytic activity of saliva copurified with inhibitory activity, and both activities were sensitive to proteinase K digestion and heat treatment. In addition, purified alpha-amylase from several sources (bacteria, fungi, porcine pa...

  16. Clinical Performance of a Salivary Amylase Activity Monitor During Hemodialysis Treatment


    Masaru Shimazaki; Takayuki Matsuki; Kazuaki Yamauchi; Michihiro Iwata; Hiroshi Takahashi; Kenichi Sakamoto; Junichi Ohata; Yuichi Nakamura; Yusuke Okazaki


    The hemodialysis procedure is thought to be a physical stressor in the majority of hemodialyzed patients. Previous studies suggest that elevated salivary amylase level may correlate with increased plasma norepinephrine level under psychological and physical stress conditions. In this study, we investigated biological stress reactivity during hemodialysis treatment using salivary amylase activity as a biomarker. Seven patients (male/female = 5/2, age:67.7+ /− 5.9 years) who had been receiving...



    Réka GYERGYAY; Béla KOVÁCS; Nagy, Előd; Krisztina MÁRTHA; Cristina BICĂ; Melinda SZÉKELY


    Dental treatment represents a stress factor for most children. The aim of the study was to analyse the variation of salivary alpha-amylase concentration in children after a video viewing on dental treatments. In this study, 7 to 10 year-old school children were evaluated (n=119). Unstimulated whole saliva was collected before and after viewing a 15 min video on dental treatments performed on children. Changes in salivary alpha-amylase levels have been assessed. Video viewing on dental ...

  18. Serum amylase and lipase in the evaluation of acute abdominal pain. (United States)

    Chase, C W; Barker, D E; Russell, W L; Burns, R P


    The purpose of this study was to determine 1) the incidence and magnitude of elevation in admission serum amylase and lipase levels in extrapancreatic etiologies of acute abdominal pain, and 2) the test most closely associated with the diagnosis of acute pancreatitis. Serum amylase and lipase levels were obtained in 306 patients admitted for evaluation of acute abdominal pain. Patients were categorized by anatomic location of identified pathology. Logistic regression analysis was used to compare the enzyme levels between patient groups and to determine the correlation between elevation in serum amylase and lipase. Twenty-seven (13%) of 208 patients with an extrapancreatic etiology of acute abdominal pain demonstrated an elevated admission serum amylase level with a maximum value of 385 units (U)/L (normal range 30-110 U/L). Twenty-six (12.5%) of these 208 patients had an elevated admission serum lipase value with a maximum of 3685 U/L (normal range 5-208 U/L). Of 48 patients with abdominal pain resulting from acute pancreatitis, admission serum amylase ranged from 30 to 7680 U/L and lipase ranged from 5 to 90,654 U/L. Both serum amylase and lipase elevations were positively associated with a correct diagnosis of acute pancreatitis (P pancreatic disease processes. Serum amylase and lipase levels may be elevated in nonpancreatic disease processes of the abdomen. Significant elevations (greater than three times upper limit of normal) in either enzyme are uncommon in these disorders. The strong correlation between elevations in the two serum enzymes in both pancreatic and extrapancreatic etiologies of abdominal pain makes them redundant measures. Serum lipase is a better test than serum amylase either to exclude or to support a diagnosis of acute pancreatitis.

  19. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation


    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma


    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital invest...

  20. Effect of decoyinine on the regulation of alpha-amylase synthesis in Bacillus subtilis.


    Nicholson, W L; Chambliss, G H


    Decoyinine, an inhibitor of GMP synthetase, allows sporulation in Bacillus subtilis to initiate and proceed under otherwise catabolite-repressing conditions. The effect of decoyinine on alpha-amylase synthesis in B. subtilis, an event which exhibits regulatory features resembling sporulation initiation, was examined. Decoyinine did not overcome catabolite repression of alpha-amylase synthesis in a wild-type strain of B. subtilis but did cause premature and enhanced synthesis in a mutant strai...

  1. Isolation, characterization and partial purification of alpha-amylase from a marine bacillus NH-25

    International Nuclear Information System (INIS)

    Total 399 marine strains were isolated from the sea water sample and screened for thermostable amylase production. Out of these 52 were to have amylogenic activity. Among them 2 isolates were able to grow and produce amylase at 55 degree C. Strain NH-25 tolerates 30% salt, a wide j-H range (4-8) and retained 64% activity at 50 degree C after 60 minutes. (author)

  2. Accuracy of Alpha Amylase in Diagnosing Microaspiration in Intubated Critically-Ill Patients


    Florent Dewavrin; Farid Zerimech; Alexandre Boyer; Patrice Maboudou; Malika Balduyck; Alain Duhamel; Saad Nseir


    OBJECTIVES: Amylase concentration in respiratory secretions was reported to be a potentially useful marker for aspiration and pneumonia. The aim of this study was to determine accuracy of α-amylase in diagnosing microaspiration in critically ill patients. METHODS: Retrospective analysis of prospectively collected data collected in a medical ICU. All patients requiring mechanical ventilation for at least 48 h, and included in a previous randomized controlled trial were eligible for this study,...

  3. Effect of oilseed cakes on alpha-amylase production by Bacillus licheniformis CUMC305.


    Krishnan, T.; Chandra, A. K.


    The effects of oilseed cakes on extracellular thermostable alpha-amylase production by Bacillus licheniformis CUMC305 was investigated. Each oilseed cake was made of groundnut, mustard, sesame, linseed, coconut copra, madhuca, or cotton. alpha-Amylase production was considerably improved in all instances and varied with the oilseed cake concentration in basal medium containing peptone and beef extract. Maximum increases were effected by a low concentration (0.5 to 1.0%) of groundnut or coconu...

  4. Potent α-amylase inhibitory activity of Indian Ayurvedic medicinal plants


    Bhargava Shobha Y; Zinjarde Smita S; P Sudha; Kumar Ameeta R


    Abstract Background Indian medicinal plants used in the Ayurvedic traditional system to treat diabetes are a valuable source of novel anti-diabetic agents. Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post-prandial hyperglycemia via control of starch breakdown. In this study, seventeen Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evalu...

  5. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase


    Gaurav Sapra; Yogesh Kumar Vyas; Rahul Agarwal; Ashish Aggarwal; K T Chandrashekar; Kanika Sharma


    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice...

  6. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    Directory of Open Access Journals (Sweden)

    Alex Chi Wu

    Full Text Available Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (biosynthesis of the chain-length distribution (CLD of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  7. Oral intercourse or secondary transfer? A Bayesian approach of salivary amylase and foreign DNA findings. (United States)

    Breathnach, Michelle; Moore, Elizabeth


    The Bayesian Approach allows forensic scientists to evaluate the significance of scientific evidence in light of two conflicting hypothesis. This aids the investigator to calculate a numerical value of the probability that the scientific findings support one hypothesis over conflicting opinions. In the case where oral intercourse is alleged, α-amylase, an indicator of saliva, is detected on penile swabs. The value of this finding is unknown as it may indicate the presence of saliva resulting from oral intercourse however it may also represent the presence of saliva due to innocent means such as background levels of salivary-α-amylase in the male population due to secondary transfer. Therefore, it is difficult to attach significance to this finding without background information and knowledge. A population study of the background levels of salivary-α-amylase was performed by analysing items of underwear worn under normal circumstances by 69 male volunteers. The Phadebas press test was used to screen the garments for amylase-containing stains and the positive areas were subjected to further confirmation of saliva by the RSID-Saliva kit. 44% of underwear screened had stains containing amylase. This study determined the background level of salivary-α-amylase and DNA on the inside front of male underwear which has potential implications on the interpretation of evidence in alleged oral intercourse. PMID:23683908

  8. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts

    Directory of Open Access Journals (Sweden)

    Mahsa Rahimzadeh


    Full Text Available Objective(s:One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Materials and Methods: Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhibition, Dixon plot was depicted. Acarbose was used as the standard inhibitor. Results: Both plant extracts showed time and concentration dependent inhibition of α-amylase. 60% inhibition was seen with 2 mg/ml of U. dioica and0.4 mg/ml of J. regia aqueous extract. Dixon plots revealed the type of α-amylase inhibition by these two extracts as competitive inhibition. Conclusion: Determination of the type of α-amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets.

  9. Purification and biochemical properties of a salivary α-amylase in Andrallus spinidens Fabricius (Hemiptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    M Fazeli-Dinan


    Full Text Available α-amylase is one of the enzymes that has crucial role in extra-oral digestion (EOD of hemipteran insects. An α-amylase was purified and biochemically characterized from the salivary glands of Andrallus spinidens showing its considerable role in EOD process. It was found an enzyme by specific activity of 4.22 U/mg protein, recovery of 14.67 % and purification fold of 13.83-fold as well as molecular weight of 26 kDa. By using two buffer solutions, optimal pH of the purified α-amylase was found to be 9 for both universal and Tris-HCl buffers. Our findings revealed that the purified α-amylase had the highest activity at the temperatures of 35 and 40 °C, and were stable for 96 h at these temperatures. Kinetic parameters of the purified enzyme show that both starch and glycogen, are the suitable substrates for the enzymatic assay, but a lower Km demonstrated glycogen as a more appropriate substrate. Among the cations used to show their possible involvement in active site of the enzyme, Ca2+2+, Mg and one concentration of Cu2+ increased the α-amylase activity but Na+ decreased the enzyme activity. Triton X-100 increased the enzyme activity but SDS, EDTA, EGTA and TTHA decreased it, indicating involvement of metal ions in the active site of the purified α-amylase.

  10. Changes in serum and salivary amylase during radiotherapy for head and neck cancer

    International Nuclear Information System (INIS)

    The changes in serum amylase that occur when radiotherapy is given in the treatment of head and neck cancer has been studied in 41 patients, 29 treated by CHART and 12 by conventionally fractionated radiotherapy. The peak rise in serum amylase following the start of treatment is seen earlier and is greater in the patients receiving continuous hyperfractionated accelerated radiotherapy (CHART). The serum amylase returns to normal earlier in the CHART patients so that the area under the curve is the same for both groups. The difference probably reflects the more rapid delivery of treatment to the patients receiving CHART. A close correlation between the peak rise in serum amylase and the amount of parotid tissue in the treatment volume is demonstrated. For six patients the total amount of amylase secreted by the parotid gland during CHART was measured and found to decline rapidly within a few days of the start of radiotherapy. The rise in serum amylase that results from the irradiation of salivary tissue provides a unique biochemical measure of an early radiation effect in a normal tissue. This probably reflects the interphase cell death of serous salivary cells. Although these immediate changes are of considerable interest they may not relate to the late effects of radiation on salivary gland function. (author). 13 refs.; 4 figs

  11. Research on the mechanism of penicillin induction of α-amylase biosynthesis in wheat endosperm

    International Nuclear Information System (INIS)

    Penicillin induced the synthesis of α-amylase in wheat-endosperm (embryoless half-seeds) was studied. Of concentrations tried, 500 mg/L penicillin was the most effective, which increased the enzyme activity by 46.7∼75.3%. Penicillin also stimulated the content of the soluble protein (increased by 27.66%∼111.59%), which had significant positive correlation with the activity of α-amylase. The analysis of α-amylase isoenzymogram showed that a band was added with penicillin treatment. And tracing 3H-L-Leu showed the radioactivity of α-amylase with penicillin was 39.0% higher than that of the control. Penicillin induction of α-amylase could be prevented by the transcription inhibitor (AMD) and the translation inhibitor (CHI), indicating that the biosynthesis of α-amylase promoted by penicillin occurred in the transcriptional and translational levels. The contents of endogenous gibberellin in whole and embryoless half seeds were determined with high performance liquid chromatography (HPLC). The results showed that the contents of gibberellin in penicillin-treated seeds were 84.40% and 180.22% higher than that of the control, respectively, which indicated that penicillin probably induced gibberellin biosynthesis, which in turn regulated opening and transcription of gene

  12. Cholecystokinin receptors: disparity between phosphoinositide breakdown and amylase releasing activity of CCK analogues in pancreas

    International Nuclear Information System (INIS)

    Cholecystokinin (CCK) peptides are a family of hormones which also occur in brain. In pancreas CCK stimulates the release of amylase, a process that is dependent on the mobilization of intracellular Ca2+. Recent evidence suggests that inositol 1,4,5-trisphosphate, the breakdown product of phosphatidylinositol 4,5-bisphosphate, is responsible for the rise in intracellular Ca2+. Their laboratory has developed assays to study synthetic CCK analogues using radioligand binding, PI breakdown and amylase release. They have shown that there are good correlations among these three assay systems for the carboxy terminal fragments of CCK8. Recently, they have discovered synthetic analogues of CCK4 that are full agonists in amylase release but are ineffective in causing PI breakdown. In particular, A-61576, Boc-5-amino-2-indolemethylene-pent-2-ene-1-oyl-Leu-Asp-Phe-NH2, is a full agonist in the amylase releasing assay, but is devoid of PI stimulating activity. A-61576 completely reverses the stimulation of PI response induced by CCK8, indicative of an antagonist. Since a mechanism other than the PI breakdown is responsible for amylase release by A-61576, they suggest that separate receptors are responsible for PI breakdown and amylase release

  13. Effect of glucagon infusion on the renal clearance of amylase relative to creatinine. (United States)

    Tedesco, F J; Davila, E; Gardner, L B


    Recent data seem to support a tubular defect as the mechanism of the elevated renal clearance of amylase relative to creatinine in acute pancreatitis. Glucagon has been proposed by some to be an important factor in this phenomenon. To examine the role of glucagon as this "tubular dysfunction factor", we investigated the effect of intravenously infused glucagon on the fractional excretion of amylase and the tubular handling of a low molecular weight protein, beta2 microglobulin, in normal, healthy volunteers. At glucagon levels far in excess of those seen in pancreatitis, the clearance ratio of beta2 microglobulin relative to creatinine increased, whereas the clearance ratio of amylase relative to creatinine did not increase above the normal range. The dissociation between beta2 microglobulin clearance and amylase clearance allows one to question the theory that tubular dysfunction is the mechanism of the elevated renal clearance of amylase relative to creatinine in acute pancreatitis. Glucagon does not appear to be the sole factor responsible for the elevation of renal clearance of amylase relative to creatinine in acute pancreatitis.

  14. Amylase activity of aquatic actinomycetes isolated from the sediments of mangrove forests in south of Iran

    Directory of Open Access Journals (Sweden)

    Farshid Kafilzadeh


    Full Text Available In this study amylase producing actinomycetes were isolated from the sediments of mangrove forests in the south of Iran and the rate of amylase activity was measured. The samples of sediments were collected from one hundred different places in mangrove forests of the south of Iran. Collected samples were diluted then they were purified on the starch (casein agar culture and Woodruff. After that they were examined in terms of amylase production on agar–starch culture. The activity of the produced amylase by the isolated aquatic actinomycetes was measured by dinitrosalicylic acid (DNS method. The results showed that aquatic actinomycetes were isolated from 86 per 100 places in spring (86% and from 61 per 100 places in summer (61%. The highest rates of producing enzyme were related to isolated samples in spring (62.97 U/ml. Biochemical and Bergey’s book tests showed that the most isolated aquatic actinomycetes belonged to Streptomyces genus. As regards this, it is economical and easy to isolate the aquatic actinomycetes which produce amylase that is used in different industries in Iran from the sediments of mangrove forests of the south of Iran. So the isolated strains in this study can be suitable candidates for amylase production after genetic manipulation.

  15. Arabidopsis thaliana AMY3 Is a Unique Redox-regulated Chloroplastic α-Amylase

    DEFF Research Database (Denmark)

    Seung, David; Thalmann, Matthias; Sparla, Francesca;


    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from...... to be dependent on a conserved aspartic acid residue (Asp666), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion...... of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases...

  16. Evaluation of α-amylase inhibitory potential of three medicinally important traditional wild food plants of India


    K.S.N Jyothi; Hemalatha, P.; Suresh Challa


    Naturally available α-amylase inhibitors from medicinally important plants are shown to be effective in managing postprandial hyperglycemia (PPHG) which is of major concern in Type -2 diabetes. Three wild food plants namely Oxalis corniculata, Basella rubra , and Cocculus hirsutus with known traditional medicinal values were tested for α-amylase inhibition in order to evaluate their inhibitory potential on porcine pancreatic α-amylase. A total of 15 extracts obtained from three plants by aque...

  17. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus (United States)

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel


    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  18. A Study on Effect of different culture media on amylase enzyme production by a native strain of Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    ziba Akbari


    Full Text Available Introduction: Amylases are among the most important enzymes and have great significance in present-day biotechnology. Amylase with commercial applications is mainly derived from the genus Bacillus. The main purpose of this study is identification and isolatation amylase enzyme producer Bacillus, determining the amylase enzyme activity and affecting a number of culture medium on amylase enzyme production. Materials and methods: Soil, water and wastewater samples were collected from agricultural area, choghakhor lake in chahar mahal e bakhtiari province and from food factory in Esfahan. Bacillus isolates were screened for amylolytic properties by starch hydrolysis test on starch agar plate. Amylase producing Bacillus were identified biochemical tests and molecular experiments. Amylase enzyme activity of isolates was measured using di-nitro salicylic acid (DNS method. Enzyme production was studied in variose medium culture TSB, NB, Yeast extract, molases and milk medium. Results: The enzyme amylase-producing strains, one sample showed was the highest amylase activity. The Bacillus has been detected as a member of Bacillus subtilis according to Bergey's Manual of Systematic Bacteriology and molecular recognition. The enzyme activity of Bacillus subtilis was measured 7/21 (U/ml in production media. Trough medium culture maximum amylase production for Bacillus subtilis was achieved in molases medium. Discussion and conclusion: In this study, Bacillus subtilis strains isolated from wastewater of a significant amount of enzyme producing 7/21 (U/ml as indicated. Among the medium-amylase from Bacillus subtilis highest enzyme activity was observed in beet molasses. According to this study, the use of Bacillus strains is an efficient way to achieve the amylase enzyme.

  19. Role of Streptococcus gordonii Amylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation


    Rogers, Jeffrey D.; Palmer, Robert J.; Kolenbrander, Paul E; Scannapieco, Frank A.


    Interactions between bacteria and salivary components are thought to be important in the establishment and ecology of the oral microflora. α-Amylase, the predominant salivary enzyme in humans, binds to Streptococcus gordonii, a primary colonizer of the tooth. Previous studies have implicated this interaction in adhesion of the bacteria to salivary pellicles, catabolism of dietary starches, and biofilm formation. Amylase binding is mediated at least in part by the amylase-binding protein A (Ab...

  20. Study on Salivary Glands α-amylase In Wheat Bug Eurygaster maura (Hemiptera: Scutelleridae)


    Mohammad Mehrabadi; Ali R. Bandani


    α-amylase activity in the salivary glands of Eurygaster maura was determined by biochemical experiments. Some of adult insect was collected and their salivary glands isolated and characterized. Enzyme samples from salivary glands of adults were prepared by the method of Cohen with slight modifications. α-Amylase activity was assayed based on Bernfeld method by the dinitrosalicylic acid (DNS) procedure. The activity of α-amylase in salivary glands was 0.050 U/insect. The optimum...

  1. The relationship between the level of salivary alpha amylase activity and pain severity in patients with symptomatic irreversible pulpitis


    Ahmadi-Motamayel, Fatemeh; Shahriari, Shahriar; Goodarzi, Mohammad Taghi; Moghimbeigi, Abbas; Jazaeri, Mina; Babaei, Parisa


    Objectives Assessment of dental pain severity is very challenging in dentistry. Previous studies have suggested that elevated salivary alpha amylase may contribute to increased physical stresses. There is a close association between salivary alpha amylase and plasma norepinephrine under stressful physical conditions. The aim of this study was to evaluate the relationship between pain severity and salivary alpha amylase levels in patients with symptomatic irreversible pulpitis. Materials and M...

  2. The Effect of Trans-Chalcone on Amylase Activity, Blood Glucose and Lipid Levels in Diabetic and Non Diabetic Rats


    Najafian, M.; Ebrahim-Habibi, A.; P Yaghmaei; Parivar, K.; Larijani, B.


    Introduction & Objective: Alpha amylase is the most important decomposing enzyme in starch. Digestion and absorption of starch in the intestine can be prevented and also the blood sugar levels can be controlled by restrain and control of alpha amylase. The aim of this study was to evaluate the effect of trans-chalcone on amylase activity, blood glucose and lipid levels in diabetic and non diabetic rats. Materials & Methods: This experimental study was conducted in 1388 at Tehran Universit...

  3. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus. (United States)

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel


    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  4. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    Directory of Open Access Journals (Sweden)

    Leandro Rodríguez-Viera

    Full Text Available Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  5. Association among growth, food consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas


    Huvet, Arnaud; Jeffroy, F; Fabioux, C; Daniel, Jean-Yves; Quillien, Virgile; Van Wormhoudt, A; Moal, Jeanne; Samain, Jean-francois; Boudry, Pierre; Pouvreau, Stephane


    To examine further a previously reported association between amylase gene polymorphism and growth in the Pacific oyster Crassostrea gigas, ecophysiological parameters and biochemical and molecular expression levels of alpha-amylase were studied in Pacific oysters of different amylase genotypes. Genotypes that previously displayed significantly different growth were found to be significantly different for ingestion and absorption efficiency. These estimated parameters, used in a dynamic energy...

  6. Dissociation of beta-adrenoceptor-induced effects on amylase secretion and cyclic adenosine 3', 5' monophosphate accumulation.


    Carlsöö, B.; Danielsson, A; Henriksson, R.; Idahl, L A


    By using a multi-channel microperifusion system the effects of noradrenaline, the beta1-adrenoceptor agonist prenalterol, and the beta2-selective agonist terbutaline were studied on amylase pig submandibular glands. 2 Noradrenaline caused significant amylase discharge and cyclic AMP accumulation. 3 Prenalterol was as effective as noradrenaline in causing amylase release but did not significantly affect the cyclic AMP content. 4 Terbutaline stimulated cyclic AMP accumulation, but had little ef...

  7. Structure based protein engineering of Bacillus stearothermophilus α-amylase: toward a new substrate specificity

    International Nuclear Information System (INIS)

    Full text. Structural similarity is observed in all members of α-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to α-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus α-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated α-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacillus stearothermophilus α-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to α-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus α-amylase (using Bacillus

  8. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.L.; Carbonell, J.


    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  9. High-resolution α-amylase assay combined with high-performance liquid chromatography−solid-phase extraction−nuclear magnetic resonance spectroscopy for expedited identification of α-amylase inhibitors – proof of concept and α-amylase inhibitor in cinnamon

    DEFF Research Database (Denmark)

    Okutan, Leyla; Kongstad, Kenneth Thermann; Jäger, Anna;


    Type 2 diabetes affects millions of people worldwide, and new improved drugs or functional foods containing selective α-amylase inhibitors are needed for improved management of blood glucose. In this article the development of a microplate-based high-resolution α-amylase inhibition assay...... with direct photometric measurement of α-amylase activity is described. The inhibition assay is based on porcine pancreatic α-amylase with 2-chloro-4-nitrophenyl-α-d-maltotriose as substrate, which this gives a stable, sensitive, and cheap inhibition assay as requested for high-resolution purposes....... In combination with HPLC–HRMS–SPE–NMR, this provides an analytical platform that allows simultaneous chemical and biological profiling of α-amylase inhibitors in plant extracts. Proof-of-concept with an artificial mixture of six compounds—of which three are known α-amylase inhibitors—showed that the high...

  10. α-amylase assay and action pattern determination using radioactive substrate, HPLC, and a radioactive flow detector

    International Nuclear Information System (INIS)

    A new assay system is presented for the analysis of α-amylase. The disappearance of 14C-labeled starch substrate and the appearance of its radioactive degradation products were monitored by HPLC and a radioactive flow detector/integrator. The hydrolysis of radioactive substrate was proportional to enzyme concentration when two commercially available α-amylase preparations of Bacillus subtilis origin were studied. The method demonstrated an average recovery of 101.7 +/- 6.5% when modified food starch was spiked with amylase and analyzed. In addition, the method was shown to be useful for predicting detailed action patterns of various types of amylases

  11. Salivary amylase and stress during stressful environment: three Mars analog mission crews study. (United States)

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H


    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment. PMID:22554904

  12. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase. (United States)

    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek


    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  13. Chemical constituents of Swertia longifolia Boiss. with α-amylase inhibitory activity

    Directory of Open Access Journals (Sweden)

    Soodabeh Saeidnia


    Full Text Available α-Amylase inhibitors play a critical role in the control of diabetes and many of medicinal plants have been found to act as α-amylase inhibitors. Swertia genus, belonging to the family Gentianaceae, comprises different species most of which have been used in traditional medicine of several cultures as antidiabetic, anti-pyretic, analgesic, liver and gastrointestinal tonic. Swertia longifolia Boiss. is the only species of Swertia growing in Iran. In the present investigation, phytochemical study of S. longifolia was performed and α-amylase inhibitory effects of the plant fractions and purified compounds were determined. Aerial parts of the plant were extracted with hexane, chloroform, methanol and water, respectively. The components of the hexane and chloroform fractions were isolated by different chromatographic methods and their structures were determined by 1 H NMR and 13 C NMR data. α-Amylase inhibitory activity was determined by a colorimetric assay using 3,5-dinitro salysilic acid. During phytochemical examination, α-amyrin, β-amyrin and β-sitosterol were purified from the hexane fraction,while ursolic acid, daucosterol and swertiamarin were isolated from chloroform fraction. The results of the biochemical assay revealed α-amylase inhibitory activity of hexane, chloroform, methanol and water fractions, of which the chloroform and methanol fractions were more potent (IC 50 16.8 and 18.1 mg/ml, respectively. Among examined compounds, daucosterol was found to be the most potent α-amylase inhibitor (57.5% in concentration 10 mg/ml. With regard to α-amylase inhibitory effects of the plant extracts, purified constituents, and antidiabetic application of the species of Swertia genus in traditional medicine of different countries, S. longifolia seems more appropriate species for further mechanistic antidiabetic evaluations.

  14. Salivary amylase and stress during stressful environment: three Mars analog mission crews study. (United States)

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H


    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment.

  15. Relationship between post-ERCP pancreatitis and the change of serum amylase level after the procedure

    Institute of Scientific and Technical Information of China (English)


    AIM: To clarify the relationship between the change of serum amylase level and post-ERCP pancreatitis.METHODS: Between January 1999 and December 2002, 1291 ERCP-related procedures were performed.Serum amylase concentrations were measured before the procedure and 3, 6, and 24 h afterward. The frequency and severity of post-ERCP pancreatitis and the relationship between these phenomena and the change in amylase level were estimated.RESULTS: Post-ERCP pancreatitis occurred in 47 patients (3.6%). Pancreatitis occurred in 1% of patients with normal amylase levels 3 h after ERCP, and in 1%,5%, 20%, 31% and 39% of patients with amylase levels elevated 1-2 times, 2-3 times, 3-5 times, 5-10 times and over 10 times the upper normal limit at 3 h after ERCP,respectively (level < 2 times vs ≥ 2 times, P < 0.001).Of the 143 patients with levels higher than the normal limit at 3 h after ERCP followed by elevation at 6 h,pancreatitis occurred in 26%. In contrast, pancreatitis occurred in 9% of 45 patients with a level higher than two times the normal limit at 3 h after ERCP followed by a decrease at 6 h (26% vs 9%, P < 0.05).CONCLUSION: Post-ERCP pancreatitis is frequently associated with an increase in serum amylase level greater than twice the normal limit at 3 h after ERCP with an elevation at 6 h. A decrease in amylase level at 6 h after ERCP suggests the unlikelihood of development of post-ERCP pancreatitis.

  16. Production, Purification, and Characterization of Thermostable α-Amylase Produced by Bacillus licheniformis Isolate AI20

    Directory of Open Access Journals (Sweden)

    Yasser R. Abdel-Fattah


    Full Text Available An optimization strategy, based on statistical experimental design, is employed to enhance the production of thermostable α-amylase by a thermotolerant B. licheniformis AI20 isolate. Using one variant at time (OVAT method, starch, yeast extract, and CaCl2 were observed to influence the enzyme production significantly. Thereafter, the response surface methodology (RSM was adopted to acquire the best process conditions among the selected variables, where a three-level Box-Behnken design was employed to create a polynomial quadratic model correlating the relationship between the three variables and α-amylase activity. The optimal combination of the major constituents of media for α-amylase production was 1.0% starch, 0.75% yeast extract, and 0.02% CaCl2. The predicted optimum α-amylase activity was 384 U/mL/min, which is two folds more than the basal medium conditions. The produced α-amylase was purified through various chromatographic techniques. The estimated enzyme molecular mass was 55 kDa and the α-amylase had an optimal temperature and pH of 60–80°C and 6–7.5, respectively. Values of Vmax and Km for the purified enzyme were 454 mU/mg and 0.709 mg/mL. The α-amylase enzyme showed great stability against different solvents. Additionally, the enzyme activity was slightly inhibited by detergents, sodium dodecyl sulphate (SDS, or chelating agents such as EDTA and EGTA. On the other hand, great enzyme stability against different divalent metal ions was observed at 0.1 mM concentration, but 10 mM of Cu2+ or Zn2+ reduced the enzyme activity by 25 and 55%, respectively.

  17. Immobilization of diastase α-amylase on nano zinc oxide. (United States)

    Antony, Navya; Balachandran, S; Mohanan, P V


    Diastase α-amylase extracted from malt, catalyses break down of starch into maltose. It is commonly used in food and fermentation industry. In the present study nano zinc oxide is used as support for this starch hydrolyzing enzyme. IR study revealed that the enzyme got adsorbed via electrostatic interaction with the functional groups on the support. The immobilized enzyme possessed a better heat-resistance than free enzyme. The kinetic parameters were determined using Lineweaver-Burk plot. The immobilized enzyme showed higher Km 2.08mg/ml than the free enzyme whose Km is 0.45±.05mg/ml. The Vmax of immobilized enzyme was about 2.92±.02mg/ml/min and that of free enzyme was 7.14±.02mg/ml/min, showing decrease in activity after immobilization. The immobilized enzyme showed 70% activity after 30days of storage while free enzyme lost its activity within 7days. About 80% of enzyme retained activity after 4 cycles of reuse. PMID:27283676

  18. The amylase-creatinine clearance ratio following cardiopulmonary bypass. (United States)

    Murray, W R; Mittra, S; Mittra, D; Roberts, L B; Taylor, K M


    The incidence of unexplained pancreatitis in patients dying after cardiac operations has been recorded as 16%, with evidence to implicate ischemia in the pathogenesis of the pancreatitis. Increased amylase--to--creatinine clearance ratios (ACCR), suggesting pancreatic dysfunction, have been reported in patients following nonpulsatile cardiopulmonary bypass (CPB). Pulsatile CPB is increasingly recognized to be a more physiological form of perfusion, particularly with respect to capillary blood flow. In this study the ACCR has been determined before, during, and after cardiac operations performed with both nonpulsatile and pulsatile CPB. Twenty patients undergoing elective cardiac operations were studied. Ten patients had nonpulsatile CPB (nonpulsatile group) and 10 had pulsatile CPB (pulsatile group). The two groups were comparable as regards perioperative variables and perfusion parameters. In both groups the ACCR was estimated preoperatively, on three occasions during the operation, and daily on the first 5 postoperative days. A significant elevation in ACCR was observed in nine of 10 patients in the nonpulsatile group but in only one of 10 patients in the pulsatile group (p less than 0.001). The significant improvement of ACCR stability following pulsatile CPB may indicate that this form of perfusion will reduce the risk of pancreatitis following cardiac operations performed with CPB.

  19. The amylase-creatinine clearance ratio following cardiopulmonary bypass. (United States)

    Murray, W R; Mittra, S; Mittra, D; Roberts, L B; Taylor, K M


    The incidence of unexplained pancreatitis in patients dying after cardiac operations has been recorded as 16%, with evidence to implicate ischemia in the pathogenesis of the pancreatitis. Increased amylase--to--creatinine clearance ratios (ACCR), suggesting pancreatic dysfunction, have been reported in patients following nonpulsatile cardiopulmonary bypass (CPB). Pulsatile CPB is increasingly recognized to be a more physiological form of perfusion, particularly with respect to capillary blood flow. In this study the ACCR has been determined before, during, and after cardiac operations performed with both nonpulsatile and pulsatile CPB. Twenty patients undergoing elective cardiac operations were studied. Ten patients had nonpulsatile CPB (nonpulsatile group) and 10 had pulsatile CPB (pulsatile group). The two groups were comparable as regards perioperative variables and perfusion parameters. In both groups the ACCR was estimated preoperatively, on three occasions during the operation, and daily on the first 5 postoperative days. A significant elevation in ACCR was observed in nine of 10 patients in the nonpulsatile group but in only one of 10 patients in the pulsatile group (p less than 0.001). The significant improvement of ACCR stability following pulsatile CPB may indicate that this form of perfusion will reduce the risk of pancreatitis following cardiac operations performed with CPB. PMID:6166815

  20. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes. (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L


    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522

  1. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes. (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L


    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations.

  2. Individual differences in AMY1 gene copy number, salivary α-amylase levels, and the perception of oral starch.

    Directory of Open Access Journals (Sweden)

    Abigail L Mandel

    Full Text Available BACKGROUND: The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. PRINCIPAL FINDINGS: Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. CONCLUSIONS: By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status.

  3. Effects of germination on the activities of amylases and phenolic enzymes in sorghum varieties grouped according to food end-use properties

    NARCIS (Netherlands)

    Dicko, M.H.; Gruppen, H.; Zouzouho, O.C.; Traore, A.S.; Berkel, van W.J.H.; Voragen, A.G.J.


    Fifty sorghum varieties were screened to determine the effects of germination on levels of starch, -amylase, -amylase, phenylalanine ammonia lyase (PAL), peroxidase (POX) and polyphenol oxidase (PPO). Germination decreased starch content, with amylose being more degraded than amylopectin. In germina

  4. Carboxylic ester hydrolase and amylase in ischemic pancreatitis in the guinea pig. (United States)

    Blind, P J; Bläckberg, L; Lundström, E B; Emdin, S O; Hernell, O


    The observation that an elevated level of pancreatic carboxylic ester hydrolase (CEH) in serum is a more sensitive and specific marker of acute pancreatitis than is elevated serum amylase activity prompted us to explore whether these findings could be confirmed in an experimental model and, if so, to find the explanation behind this difference. We therefore developed a model for ischemic pancreatitis in the guinea pig and a sandwich enzyme-linked immunosorbent assay for determination of CEH in this species. There was a strong correlation between duration of ischemia and severity of pancreatic inflammation and between severity of inflammation and serum CEH level. In contrast, serum amylase was elevated only in animals with the most severe grade of inflammation. Amylase was, however, increased in urine in animals with mild inflammation, but the level did not increase with severity of inflammation. Only one of 31 animals had detectable CEH in urine. In animals with intermediate serum CEH levels the serum and biliary concentrations correlated, indicating that CEH may be cleared by the liver. Amylase was detectable in bile only in animals with high serum levels. The results confirm our observations made in previous clinical studies. A likely explanation for differences in serum levels of CEH and amylase is clearance from the circulation at different rates and, at least partly, via different routes, e.g., the liver and kidney, respectively.

  5. Antioxidant and α-amylase inhibition activities of phenolic compounds in the extracts of Indian honey

    Institute of Scientific and Technical Information of China (English)

    Subashini Devarajan; Subhashree Venugopal


    AIM:To evaluate the antioxidant and α-amylase inhibition potential of phenolic compounds in the extracts of Indian honey.METHODS:Phenolic compounds were extracted from Indian honey through column chromatography.The antioxidant potential of extracted phenolic compounds was measured by two different biochemical assays:ferric reducing antioxidant power (FRAP)assay and scavenging activity on 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals.Moreover,α-amylase inhibition assay of phenolic compounds of honey was also evaluated.RESULTS:The scavenging inhibition rate varied from 86.8% to 78.6% from the highest (6mg·mL-1) to the lowest (1.5 mg·mL-1) concentration,whereas,reducing power assay varied from 0.89 Abs to 0.19 Abs from the highest to the lowest concentration.Butylated hydroxytoluene (BHT) was used as reference compound for antioxidant assays.α-amylase inhibition assay is reported from the phenolic honey extracts for the first time.The inhibition rate for α-amylase varied from 88.8% to 30.5% from the highest (20 μg·mL-1) to the lowest concentration (4.μg·mL-1).CONCLUSION:Honey phenolic extract possessed antioxidant and α-amylase inhibition activity,thus increasing its potential therapeutic property.

  6. Effect of perioperative somatostatin administration of sphincteroplasty-induced increase of amylase. (United States)

    Roncoroni, L; De Bernardinis, M; Violi, V; Montanari, M; Peracchia, A


    Twenty patients undergoing sphincteroplasty for cholelithiasis were randomly divided into two groups of 10. The former (T) were treated with a 4-h somatostatin intravenous drip (250 micrograms/h), started at the beginning of operation, while the latter (C) made up the control group. Serum and urine amylase, amylase creatinine clearance ratio, and liver function tests were assessed for 2 days before surgery, after the operation and for a period of 5 postoperative days. Homogeneity between the two series was verified in experimental conditions. Statistical differences occurred postoperatively in amylase creatinine clearance ratio, which proved higher in C group, and gamma-GT, which was higher in T group. Short-term somatostatin administration proved effective in reducing the postoperative amylase creatinine clearance ratio, although more evident results are reported after long-term administration. Cholestasis or any serious impairment in liver function did not occur, suggesting the suitability of somatostatin use even in patients with jaundice. Since a relationship between postoperative amylase levels and risk of pancreatitis has not yet been proved, the value of somatostatin in the prevention of postoperative pancreatitis after sphincteroplasty needs to be further verified.

  7. Renal handling of beta-2-microglobulin, amylase and albumin in acute pancreatitis. (United States)

    Karlsson, F A; Jacobson, G


    The renal handling of beta-2-microglobulin, amylase and albumin was studied in patients with acute pancreatitis. The data were compared with results obtained from patients with glomerular proteinuria and from patients with tubular proteinuria. Initially during acute pancreatitis, the clearance ratio (clearance protein/clearance creatinine) for beta-2-microglobulin was increased dramatically (77-fold) compared to normals. After four to seven days this ratio had fallen and was elevated only 7-fold. The corresponding figures for amylase were 3.3 and 1.8 times and for albumin 9 and 5 times respectively. In glomerular disease, the clearance ratios for beta-2-microglobulin, amylase and albumin were increased 6, 1.1, and 154 times and in tubular disease 448, 1.1, and 28 times, respectively. The electrophoretic pattern of the urinary proteins during pancreatitis was mostly normal. In a few cases, slight tubular proteinuria was noticed. Amylase activity in serum and urine from patients with pancreatitis was found to sediment, (S20,W = 4.6) in a sucrose gradient, identical to amylase from normal serum and urine. The marked increase in the excretion of beta-2-microglobulin probably reflects interference of the kidney function at the proximal tubular level. Determinations of this protein in urine may be of value in studies of kidney dysfunction that can accompany pancreatitis.

  8. Acute Pancreatitis with Normal Serum Lipase and Amylase: A Rare Presentation

    Directory of Open Access Journals (Sweden)

    Arvind K Mathur


    Full Text Available Acute pancreatitis presenting with normal serum amylase and lipase levels is a rare phenomenon. It is thought that typically, acute inflammation and auto-digestion of the pancreas leads to the release of both amylase and lipase, leading to elevated levels in the blood. For this reason, normal serum amylase and lipase levels in a patient with acute abdominal pain would typically rule out acute pancreatitis in favor of another diagnosis. Here we present two cases of acutely ill patients that were confirmed to have acute pancreatitis radiologically but with serum amylase and lipase levels that remained within the normal range throughout their illnesses for both patients. These cases suggest that while an important diagnostic tool, serum amylase and lipase should not be used as the sole factor to either diagnose or rule out acute pancreatitis. Instead, these laboratory markers should be viewed in the context of the patient’s overall presentation, weighted equally with the presenting signs, symptoms, and imaging studies to help guide toward a diagnosis.


    Directory of Open Access Journals (Sweden)

    Mamatha J


    Full Text Available α-amylases are ubiquitous enzymes produced by plants, animals and microbes, where they play a dominant role in carbohydrate metabolism. In spite of the wide distribution of amylases, microbial sources, namely fungal and bacterial amylases, are used for the industrial production due to advantages such as cost effectiveness, consistency, less time and space required for production and ease of process modification and optimization. Filamentous fungi are known to be prolific producers of extracellular proteins; they are widely exploited for the production of different enzymes including a-amylase. SSF is generally defined as the growth of microorganisms on moist solid substrates with negligible free water, which is preferred than SmF because of simple technique, low capital investment, lower levels of catabolite repression, end- product inhibition, low waste water output, better product recovery and high quality production. Different substrates such as wheat bran, mollasses bran, rice bran, maize meal and sugarcane bagasse were used; out of which sugarcane bagasse has been reported to produce promising results. Different carbon and nitrogen supplements were given which increased the yield of the enzyme and optimized the pH as 6.0 and temperature 300C. Thus the maximum production of amylase was observed at optimized conditions, which can be employed in large scale.

  10. The Effect of an Intraperitoneal Injection of Melatonin on Serum Amylase Levels in Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    Cavit Çöl


    Full Text Available Context Several experimental studies have been carried out to explain the ph ysiopathological mechan isms and to introduce endocrinological, enzymatic, biochemical and histopathol ogical changes in organism s during acute pancreatitis. Objective To evaluate the effect of an intraperitoneal injection of melatonin on serum amylase levels. Design Experimental acut e pancreatitis was experimentally caused through panc reatic duct ligation in 20 Winstar Albino rats . The rats were then divided into two groups: control and melatonin groups. Intervention The serum amylase level was measured on the 7 th day after acute pancreatitis had developed. In the melatonin group, an intraperitoneal injecti on of melatonin (20 mg/kg/day was performed starting from the 2 nd day after pancreatic duct ligation. Main outcome measure The levels of serum amylase were measured with an auto analyzer. Results It was found that the mean (±SD level of serum amylase in th e control group was 947±182 IU/mL wh ile it was 358±177 IU/mL in the experimental group (P<0.001. Conclusions The 20 mg/kg/day intraperitoneal injection of melatonin which was carried out for one week attenuated the serum amylase levels to a statistically si gnificant degree. The researchers believe that intraperitoneal in jections of melatonin decrease the severity of acute pancreatitis.

  11. Hydroxyproline and proline inhibit α-amylase from isolated barley aleurone layers

    Directory of Open Access Journals (Sweden)

    Craig C. Freudenrich


    Full Text Available Previously, we reported that 1 mM hydroxyproline appeared to inhibit the gibberellic acid-induced release of α-amylase from isolated Hordeum vulgare L. cv. Himalaya aleurone layers into an incubation medium. Here, we report our attempts to determine the mechanism(s for this inhibition and whether this inhibition can be caused by other proline analogues. Both 1 mM hydroxyproline and proline inhibited extracellular a-amylase activity without affecting its intracellular activity. This suggested that neither hydroxyproline nor proline impaired the release of a-amylase. Lineweaver-Burk plots revealed that both hydroxyproline and proline uncompetitively inhibited α-amy-lase. Thus, the inhibition is probably an assay artifact resulting from the formation of an enzyme-substrate-hydroxyproline or -proline complex. Because azetidine-2-carboxylic acid, glutamic acid and pipecolic acid did not inhibit extracellular α-amylase activity, the uncompetitive inhibition of a-amylase must be unique to imino aicids as well as their precursors and derivatives which possess a five membered ring.

  12. Influence of carbon source on alpha-amylase production by Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens


    The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol and acet......The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol...... on sucrose, fructose, glycerol, mannitol and acetate. During growth on acetate there was no production of alpha -amylase, whereas addition of small amounts of glucose resulted in alpha -amylase production. A possible induction by alpha -methyl-D-glucoside during growth on glucose was also investigated......, but this compound was not found to be a better inducer of alpha -amylase production than glucose. The results strongly indicate that besides acting as a repressor via the CreA protein, glucose acts as an inducer....

  13. Taking the Starch out of Oral Biofilm Formation: Molecular Basis and Functional Significance of Salivary α-Amylase Binding to Oral Streptococci


    Nikitkova, Anna E.; Haase, Elaine M.; Scannapieco, Frank A.


    α-Amylase-binding streptococci (ABS) are a heterogeneous group of commensal oral bacterial species that comprise a significant proportion of dental plaque microfloras. Salivary α-amylase, one of the most abundant proteins in human saliva, binds to the surface of these bacteria via specific surface-exposed α-amylase-binding proteins. The functional significance of α-amylase-binding proteins in oral colonization by streptococci is important for understanding how salivary components influence or...

  14. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222

    Directory of Open Access Journals (Sweden)

    Shalini Singh


    Full Text Available Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best of production conditions. This study evaluates the influence of varying concentration of Ferrous sulphate (Fe2+ on microbial growth and amylase production for Aspergillus, Aspergillus fumigatus NTCC1222. Ferrous sulphate enhanced growth (concentration of 100mg/L by 1.83%, compared to the control. In contrast, it decreased amylase activity at all concentrations tested. As the concentration of ferrous sulphate increased, the amylase activity decreased. Amylases are metalloenzymes and the inhibition in amylase activity observed in the presence of ferrous ions may be due to competition between the exogenous cation and the protein associated cation, resulting in reduced metalloenzyme activity. Further studies will aim to evaluate the effect of different ferrous salts and different forms of iron on amylase production by Aspergillus fumigatus NTCC1222.

  15. Estimation of Salivary Amylase in Diabetic Patients and Saliva as a Diagnostic Tool in Early Diabetic Patients


    Malathi, L.; Masthan, K. M. K.; Balachander, N.; Babu, N. Aravindha; Rajesh, E.


    Aim: The aim of this study was to estimate the salivary amylase levels in non-insulin dependent diabetes mellitus patients and to correlate these findings with those in normal individuals, in order to provide salivary amylase level as a bio-chemical indicator for diagnosing and monitoring the glucose levels.

  16. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons (United States)

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylase that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization,...

  17. Breeding of high yield strain producing acid-stable α-amylase by N+ ion beam irradiation

    International Nuclear Information System (INIS)

    Bacillus subtilis BF7658, which produces medium-temperature α-amylase,was implanted with N+ ion beam to breed mutants. Under the optimal fluence of 1 x 1016 cm-2, a mutant TCCC 11525 producing the acid-stable and medium-temperature α-amylase was obtained. The activity of the mutagenised enzyme is 207 U/mL. (authors)

  18. A Kinetic Model to Explain the Maximum in alpha-Amylase Activity Measurements in the Presence of Small Carbohydrates

    NARCIS (Netherlands)

    Baks, T.; Janssen, A.E.M.; Boom, R.M.


    The effect of the presence of several small carbohydrates on the measurement of the -amylase activity was determined over a broad concentration range. At low carbohydrate concentrations, a distinct maximum in the -amylase activity versus concentration curves was observed in several cases. At higher

  19. Stress affects salivary alpha-Amylase activity in bonobos. (United States)

    Behringer, Verena; Deschner, Tobias; Möstl, Erich; Selzer, Dieter; Hohmann, Gottfried


    Salivary alpha-Amylase (sAA) is a starch digesting enzyme. In addition to its function in the context of nutrition, sAA has also turned out to be useful for monitoring sympathetic nervous system activity. Recent studies on humans have found a relationship between intra-individual changes in sAA activity and physical and psychological stress. In studies on primates and other vertebrates, non-invasive monitoring of short-term stress responses is usually based on measurements of cortisol levels, which are indicative of hypothalamic-pituitary-adrenal activity. The few studies that have used both cortisol levels and sAA activity indicate that these two markers may respond differently and independently to different types of stress such that variation in the degree of the activation of different stress response systems might reflect alternative coping mechanisms or individual traits. Here, we present the first data on intra- and inter-individual variation of sAA activity in captive bonobos and compare the results with information from other ape species and humans. Our results indicate that sAA activity in the bonobo samples was significantly lower than in the human samples but within the range of other great ape species. In addition, sAA activity was significantly higher in samples collected at times when subjects had been exposed to stressors (judged by changes in behavioral patterns and cortisol levels) than in samples collected at other times. Our results indicate that bonobos possess functioning sAA and, as in other species, sAA activity is influenced by autonomic nervous system activity. Monitoring sAA activity could therefore be a useful tool for evaluating stress in bonobos. PMID:21945369

  20. Agrobacterium-mediated transformation of chickpea with -amylase inhibitor gene for insect resistance

    Indian Academy of Sciences (India)

    S Ignacimuthu; S Prakash


    Chickpea is the world’s third most important pulse crop and India produces 75% of the world’s supply. Chickpea seeds are attacked by Callosobruchus maculatus and C. chinensis which cause extensive damage. The -amylase inhibitor gene isolated from Phaseolus vulgaris seeds was introduced into chickpea cultivar K850 through Agrobacterium-mediated transformation. A total of 288 kanamycin resistant plants were regenerated. Only 0.3% of these were true transformants. Polymerase chain reaction (PCR) analysis and Southern hybridization confirmed the presence of 4.9 kb -amylase inhibitor gene in the transformed plants. Western blot confirmed the presence of -amylase inhibitor protein. The results of bioassay study revealed a significant reduction in the survival rate of bruchid weevil C. maculatus reared on transgenic chickpea seeds. All the transgenic plants exhibited a segregation ratio of 3:1.

  1. Thermophilic amylase from Thermus sp. isolation and its potential application for bioethanol production

    Directory of Open Access Journals (Sweden)

    Amin Fatoni


    Full Text Available Limited reserves of fossil energy stimulate researchers to explore for a new alternative energy, such as bioethanol.A thermophilic amylase producing bacterium was isolated from local hot-springs and its characteristic and potential applicationfor bioethanol production was determined. The obtained amylase was studied to determine its optimum temperature, pH,enzymatic reaction time, and substrate concentration. Tapioca waste was used as the substrate to find the potential of theamylase for degrading starch into glucose, and then the process was continued by fermentation to produce bioethanol. Theamylase producer bacterium was proposed as genus Thermus sp. The crude amylase that was obtained has the optimumtemperature of 60°C and optimum pH of 8.0, optimum substrate concentration at 10% (w/w and optimum enzymatic reactiontime of 45 minutes. These enzymes convert the starches of waste tapioca at optimum conditions, with the result of 2.9%ethanol produced from raw materials.

  2. A highly efficient and thermostable α-amylase from soya bean seeds. (United States)

    Prakash, Om; Jaiswal, Nivedita


    The α-amylase from soya bean seeds was purified by affinity precipitation, resulting in approx. 20-fold purification with approx. 84% recovery. The purified α-amylase had an optimum pH of 5.5, optimum temperature of 75 °C, Arrhenius energy of activation of 6.03 kcal/mol (1 kcal≈4.184 kJ) and a Km of 2.427 mg/ml (starch substrate). The enzyme had maximum substrate specificity for starch. Among the various metal ions tested, Co2+ and Mn2+ were found to be strong activators. The effect of thiol group modifying agents showed that the thiols of soya bean α-amylase are not directly involved in catalysis. The thermostability of the enzyme makes it suitable for starch liquefaction and the detergent industry respectively.

  3. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications (United States)

    Mehta, Deepika; Satyanarayana, Tulasi


    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications.


    Directory of Open Access Journals (Sweden)

    Bhagath K


    Full Text Available The aim of the present study was to determine anti caries and α-amylase inhibitory activity of leaf extract of Jasminum arborescens Roxb. (Oleaceae. Anti caries activity was determined by Agar well diffusion assay against seven clinical isolates of Streptococcus mutans (Sm-01 to Sm-07 recovered from dental caries subjects. Enzyme inhibitory activity was tested against α-amylase by spectrophometric method using starch as substrate. The extract exhibited dose dependent inhibition against cariogenic isolates. Among seven isolates, isolate Sm-04 and Sm-06 were inhibited to higher and least extent respectively. The extract was found to cause inhibition of α-amylase activity in a dose dependent manner and its IC50 value was found to be 17.45 mg/ml. The inhibitory activity could be attributed to the presence of secondary metabolites. The plant may be a potential source for development of agents which are active against dental caries pathogens and for diabetes mellitus.

  5. Effect of radioactive isotope 32P upon alpha amylase activity and glucose concentration in chickens

    International Nuclear Information System (INIS)

    An attempt has been made to investigate whether alpha amylase activity and glucose concentration in blood plasma can serve as the help in establishing on early diagnosis of organic or functional damage caused by ionizing radiation in chickens. Fifty day old hybrid chickens of heavy 'Jata' breeds of both sexes, were treated by 32P administered intramusculary as sodium orthophosphate in a single dose of 333 MBq per kilogram of body weight. Blood samples was taken from the wing vein on day 1, 3, 5, 7 and 10 after administration of 32P. Alpha amylase activity and glucose concentration were determined spectrophotometrically using kits produced by 'Radonja', Sisak. Alpha amylase activity was decreased and glucose concentration was increased during investigated period. Yet, the further investigations are needed to find out whether these two parameters can be used for early diagnosis of injury in chicken organism by ionizing radiation. (author)

  6. The effect of gamma irradiation on the formation of alpha-amylase isoenzymes in germinating wheat

    International Nuclear Information System (INIS)

    The biosynthesis of alpha-amylase during seedling growth commenced after a prolonged lag-period in wheat (cv. Vijay), irradiated at a high dose (200 krad). Also, a different requirement for exogenous gibberellins (GA) to stimulate the enzyme synthesis was noted in control and irradiated seeds. Further, the developmental patterns of three major isoenzymes of alpha-amylase (designated as α1, α2- and α3) during germination were different. It was observed that α1-isoenzyme which appeared on the fourth day of germination of control seeds, was delayed in its development and was undetectable up to 4 days in samples irradiated with 200 krad. However, α1-isoenzyme appeared after 6 days or after 4 days in GA-treated samples in germinating seeds exposed to a high dose. These results suggested that two systems differing in their radiosensitivity and response to GA application were operating in germinating wheat for the synthesis of functional alpha-amylase molecules. (author)

  7. Changes in serum amylase and its isoenzymes after whole body irradiation

    International Nuclear Information System (INIS)

    A study was carried out to assess the effect of total body irradiation on pancreatic and parotid isoenzymes of amylase in patients about to undergo bone-marrow transplantation who had received high-dose cyclophosphamide. Twelve patients were studied, enzyme activity being measured before and at various times after total body irradiation. Serum total amylase activity rose rapidly within 12 hours of irradiation to a maximum at 36 hours, returning to normal by six days; most of the increase was derived from salivary damage, with a much smaller pancreatic component. These results confirm that radiation produces acute changes in amylase activity, which may be of use in assessing radiation-induced damage. (author)

  8. A high yield of amylase from Aspergillus niger by the effect of gamma irradiation

    International Nuclear Information System (INIS)

    When irradiated rice was used as a media for Aspergillus niger a noticeable increase of amylase production was observed. Molecular degradation of starch molecules did occure, and an increase in starch acidity and solubility was noticed, whereas a marked decrease in viscosity as well as swelling capacity was observed. Gelatinization time and temperature of irradiated starch became shorter or lower resp. These results showed that internal changes in irradiated starch molecules and an alteration in its molecular configuration occured. They may affect the pathway of the growth of the fungi Aspergillus niger. When the amount of amylase was determined by measuring enzyme activity, it was observed that amylases in the irradiated media were higher than in the control media. (orig.)

  9. Thermal stability of alpha-amylase from Aspergillus oryzae entrapped in polyacrylamide gel. (United States)

    Raviyan, Patcharin; Tang, Juming; Rasco, Barbara A


    To determine the suitability as a time-temperature indicator for dielectric pasteurization processes, the thermal stability (50-75 degrees C) of Aspergillus oryzae alpha-amylase immobilized in polyacrylamide gel in phosphate buffer, mashed potatoes, and minced shrimp was examined. Changing the cross-linking agent concentration from 3.3 to 5.3% and adding 2% salt did not markedly affect the thermal stability of the immobilized alpha-amylase. Thermal inactivation was first order, and immobilization generally improved the thermal stability of alpha-amylase. z values of the immobilized system in test food systems were 10.2 degrees C (phosphate buffer), 8.45 degrees C (minced shrimp), and 7.78 degrees C (mashed potatoes). PMID:12926898

  10. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications (United States)

    Mehta, Deepika; Satyanarayana, Tulasi


    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications. PMID:27516755

  11. Study on Salivary Glands α-amylase In Wheat Bug Eurygaster maura (Hemiptera: Scutelleridae

    Directory of Open Access Journals (Sweden)

    Mohammad Mehrabadi


    Full Text Available α-amylase activity in the salivary glands of Eurygaster maura was determined by biochemical experiments. Some of adult insect was collected and their salivary glands isolated and characterized. Enzyme samples from salivary glands of adults were prepared by the method of Cohen with slight modifications. α-Amylase activity was assayed based on Bernfeld method by the dinitrosalicylic acid (DNS procedure. The activity of α-amylase in salivary glands was 0.050 U/insect. The optimum pH and temperature for the enzyme activity was determined to be 6.5-7 and 30-35°C, respectively. The enzyme activity was inhibited by addition of EDTA (Ethylenediamine tetraacetic acid urea, CaCl2, MgCl2 and SDS but Mg2+, NaCl and KCl enhanced enzyme activity.

  12. Study of the solubility of a modified Bacillus licheniformis alpha-amylase around the isoelectric point

    DEFF Research Database (Denmark)

    Faber, Cornilius; Hobley, Timothy John; Mollerup, Jørgen;


    The solubility of a modified recombinant Bacillus licheniformis alpha-amylase (mBLA) has been studied by batch crystallization. A semi-pure preparation was chosen containing five isoforms with pI values from 6 to 7.3 (weighted average of 6.6). Small amounts (... sodium sulfate at all pH values and increased with 0.5 mol.L-1 sodium thiocyanate at pH 7 and pH 8. The effect of anions on alpha-amylase solubility followed the Hofmeister series, and only weak evidence of reversal was seen below the isoelectric point. Cations had little effect on solubility. The sign...... and magnitude of the alpha-amylase zeta potential was determined in the presence and absence of 0.1 mol.L-1 salt. Qualitatively, zeta potential correctly predicted the different salts influence on mBLA solubility....

  13. Metabolism of glycosylated human salivary amylase: in vivo plasma clearance by rat hepatic endothelial cells and in vitro receptor mediated pinocytosis by rat macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Niesen, T.E.; Alpers, D.H.; Stahl, P.D.; Rosenblum, J.L.


    Salivary-type amylase normally comprises about 60% of the amylase activity in human serum, but only a small fraction is a glycosylated isoenzyme (amylase A). In contrast, 1/3 of amylase in human saliva is glycosylated. Since glycosylation can affect circulatory clearance, we studied the clearance of amylase A in rats and its uptake by rat alveolar macrophages. Following intravenous injection, /sup 125/I-labeled amylase A disappeared rapidly from plasma (t 1/2 . 9 min) and accumulated in the liver. Simultaneous injection of mannose-albumin slowed its clearance to a rate comparable to that of /sup 125/I-labeled nonglycosylated salivary amylase (t 1/2 . 45 min). In contrast, galactose-albumin had no effect. Electron microscope autoradiography of the liver following injection of /sup 125/I-labeled amylase A revealed a localization of grains over the hepatic endothelial cells. In vitro studies indicated that amylase A is taken up by alveolar macrophages via receptor-mediated pinocytosis. Uptake was linear over time, saturable, and inhibited by mannan and mannose-albumin, but not by galactose-albumin. We conclude that amylase A, which is a naturally occurring human glycoprotein with at most three terminal L-fucose residues per molecule, is recognized in rats by a mannose receptor located on hepatic endothelial cells. We speculate that this receptor, by rapidly clearing circulating amylase A, may be responsible for the low level of amylase A in human serum.

  14. Spatio-temporal appearance of α-amylase and limit dextrinase in barley aleurone layer in response to gibberellic acid, abscisic acid and salicylic acid

    DEFF Research Database (Denmark)

    Shahpiri, Azar; Talaei, Nasim; Finnie, Christine


    Release of LD was found to differ from that of amylase and was suggested to depend on programmed cell death (PCD). Despite detection of intracellular amylase in untreated aleurone layers or aleurone layers treated with ABA or SA, α-amylase was not released from these samples. Nevertheless, the re...

  15. Heterologous expression, biochemical characterization, and overproduction of alkaline α-amylase from Bacillus alcalophilus in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Li Jianghua


    Full Text Available Abstract Background Alkaline α-amylases have potential applications for hydrolyzing starch under high pH conditions in the starch and textile industries and as ingredients in detergents for automatic dishwashers and laundries. While the alkaline α-amylase gains increased industrial interest, the yield of alkaline α-amylases from wild-type microbes is low, and the combination of genetic engineering and process optimization is necessary to achieve the overproduction of alkaline α-amylase. Results The alkaline α-amylase gene from Bacillus alcalophilus JN21 (CCTCC NO. M 2011229 was cloned and expressed in Bacillus subtilis strain WB600 with vector pMA5. The recombinant alkaline α-amylase was stable at pH from 7.0 to 11.0 and temperature below 40°C. The optimum pH and temperature of alkaline α-amylase was 9.0 and 50°C, respectively. Using soluble starch as the substrate, the Km and Vmax of alkaline α-amylase were 9.64 g/L and 0.80 g/(L·min, respectively. The effects of medium compositions (starch, peptone, and soybean meal and temperature on the recombinant production of alkaline α-amylase in B. subtilis were investigated. Under the optimal conditions (starch concentration 0.6% (w/v, peptone concentration 1.45% (w/v, soybean meal concentration 1.3% (w/v, and temperature 37°C, the highest yield of alkaline α-amylase reached 415 U/mL. The yield of alkaline α-amylase in a 3-L fermentor reached 441 U/mL, which was 79 times that of native alkaline α-amylase from B. alcalophilus JN21. Conclusions This is the first report concerning the heterologous expression of alkaline α-amylase in B. subtilis, and the obtained results make it feasible to achieve the industrial production of alkaline α-amylase with the recombinant B. subtilis.

  16. Optimization of the growth conditions for amylase production by bacillus licheniformis 208 isolated from local hotsprings of karachi

    International Nuclear Information System (INIS)

    Studies on the optimum conditions for the production of extracellular amylase were carried out with a newly isolated strain of Bacillus 208 from the hotsprings in Karachi. The optimum temperature, initial medium pH and incubation period for amylase production were 50 degree C, 7.0 and 24 hrs respectively. Furthermore, cells when grown in the complex media showed high amylase production compared to the minimal medium. Effect of different carbon sources revealed that soluble starch (1%) increased the amylase yield significantly. Peptone (as nitrogen source) gave higher yield as compared to other nitrogen sources tested. Under optimized conditions, the organism entered the stationary phase after 12 hrs and amylase production was observed to be maximum at 24th hrs of cultivation. Enzyme production regulation is influenced by catabolite repression. Reduction in enzyme production was observed in the presence of EDTA while addition of tween 20 and CaCl/sub 2/ helped to enhance the enzyme production. (author)

  17. Effect of low energy N+ ion beam implantation on the secondary structure and activity of α-amylase

    International Nuclear Information System (INIS)

    Samples of the α-amylase were treated with 1015-1016 ions/cm2 of 20 keV N+. The secondary structure of the ion-implanted α-amylase was studied by circular dichroism, and activity change of the α-amylase was analyzed. The results showed that in the dose range under investigation, the N+ implantation affected the relative contents of α-helix, β-sheet, β-turn and random coil of the α-amylase, but no significant differences were found between the samples implanted to different doses. The activity of the N+-implanted α-amylase changed, with a relationship between the activity increase and the conformation change. (authors)

  18. Regulation of amylase, cellulase and chitinase secretion in the digestive tract of the two-spotted field cricket, Gryllus bimaculatus. (United States)

    Weidlich, Sandy; Müller, Sonja; Hoffmann, Klaus H; Woodring, Joseph


    The secretion of amylase and cellulase in Gryllus bimaculatus is determined by increased food intake, whereby shortly after molting food consumption increases. About half of the standing amylase concentration (activity) in the endothelial cells can be secreted within 30 min. The peak of amylase and cellulase secretion that occurs in the photophase is related to the feeding peak in the previous scotophase. The secretion of chitinase on the other hand is primarily controlled by the molting cycle. Only amylase secretion was affected by calcium in the incubation medium, suggesting an apocrine release mechanism. Refeeding experiments (after 5 days without food) suggest that the release of amylase in response to a nutrient in the lumen (glucose) is not due to simple stimulation of exocytosis, but rather a stimulation of synthesis. PMID:23585293

  19. a-淀粉酶的应用研究进展%Research Progress of the a-amylase Application

    Institute of Scientific and Technical Information of China (English)

    丁皓; 王冠; 徐丽; 程瑛


    Amylase is the general term for a class of catalytic decomposition of starch, glycogen, dextrin, the glycosidic bond enzymes. Amylase included a-amylase, β-amylase and glucoamylase enzymes. This article focused on the research progress application, detection methods, and enzymatic properties of the a-amylase.%淀粉酶是指一类能催化分解淀粉(糖原、糊精)的糖苷键的酶总称,包括a-淀粉酶、β-淀粉酶、葡萄糖淀粉酶等。文章综述了a-淀粉酶的研究进展、应用、检测方法以及酶争陛质。

  20. Two-step purification and partial characterization of an extra cellular α-amylase from Bacillus licheniformis

    Directory of Open Access Journals (Sweden)

    Zare Mirakabadi, A.


    Full Text Available The aim of this study was production and partial purification of α-amylase enzyme by Bacillus licheniformis. B. Licheniformis was allowed to grow in broth culture for purpose of inducing α-amylase enzyme. Optimal conditions for amylase production by B. Licheniformis are incubation period of 120 h, temperature of 37 °C and pH 7.0. The α-amylase enzyme was purified by ion exchange chromatography on DEAE-sepharose CL-6B and sephadex G-100 gel filtration with a 19.1-fold increase in specific activity as compared to the concentrated supernatant and with a specific activity of 926.47 U/mg. The α-amylase had the highest activity at pH 7.0 and 65 °C. According to the data on native polyacrylamide gel electrophoresis, the molecular weight of the purified enzyme was 72 kDa.

  1. Cloning, Purification and Characterization of a Highly Thermostable Amylase Gene of Thermotoga petrophila into Escherichia coli. (United States)

    Zafar, Asma; Aftab, Muhammad Nauman; ud Din, Zia; Aftab, Saima; Iqbal, Irfana; ul Haq, Ikram


    A putative α-amylase gene of Thermotoga petrophila was cloned and expressed in Escherichia coli BL21 (DE3) using pET-21a (+), as an expression vector. The growth conditions were optimized for maximal expression of the α-amylase using various parameters, such as pH, temperature, time of induction and addition of an inducer. The optimum temperature and pH for the maximum expression of α-amylase were 22 °C and 7.0 pH units, respectively. Purification of the recombinant enzyme was carried out by heat treatment method, followed by ion exchange chromatography with 34.6-fold purification having specific activity of 126.31 U mg(-1) and a recovery of 56.25%. Molecular weight of the purified α-amylase, 70 kDa, was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 100 °C temperature and at pH of 7.0. The enzyme activity was increased in the presence of metal ions especially Ca(+2) and decreased in the presence of EDTA indicating that the α-amylase was a metalloenzyme. However, addition of 1% Tween 20, Tween 80 and β-mercaptoethanol constrained the enzyme activity to 87, 96 and 89%, respectively. No considerable effect of organic solvents (ethanol, methanol, isopropanol, acetone and n-butanol) was observed on enzyme activity. With soluble starch as a substrate, the enzyme activity under optimized conditions was 73.8 U mg(-1). The α-amylase enzyme was active to hydrolyse starch forming maltose. PMID:26526464

  2. Identification of a new oat β-amylase by functional proteomics. (United States)

    Ben Halima, Nihed; Khemakhem, Bassem; Fendri, Imen; Ogata, Hiroyuki; Baril, Patrick; Pichon, Chantal; Abdelkafi, Slim


    Oat (Avena sativa L.) seed extracts exhibited a high degree of catalytic activity including amylase activities. Proteins in the oat seed extracts were optimized for their amylolytic activities. Oat extract with amylolytic activity was separated by SDS-PAGE and a major protein band with an apparent molecular mass of 53 kDa was subjected to tryptic digestion. The generated amino acid sequences were analyzed by liquid chromatography–tandem mass spectrometry (LC/ESI/MS/MS) and database searches. These sequences were used to identify a partial cDNA from expressed sequence tags (ESTs) of A. sativa L. Based upon EST sequences, a predicted full-length gene was identified, with an open reading frame of 1464 bp encoding a protein of 488 amino acid residues (AsBAMY), with a theoretical molecular mass of 55 kDa identified as a β-amylase belonging to the plant β-amylase family. Primary structure of oat β-amylase (AsBAMY) protein indicated high similarity with other β-amylase from other cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare), and rye (Secale cereale) with two conserved Glu residues (E184 and E378) assigned as the “putative” catalytic residues which would act as an acid and base pair in the catalytic process. In addition, a 3D-model of AsBAMY was built from known X-ray structures and sequence alignments. A similar core (β/α)8-barrel architecture was found in AsBAMY like the other cereal β-amylases with a specific location of the active site in a pocket-like cavity structure made at one end of this core (β/α)8-barrel domain suggesting an accessibility of the non-reducing end of the substrate and thus confirming the results of AsBAMY exo-acting hydrolase.




    Welker, N. E. (Western Reserve University, Cleveland, Ohio) and L. Leon Campbell. Effect of carbon sources on formation of alpha-amylase by Bacillus stearothermophilus. J. Bacteriol. 86:681-686. 1963.-A chemically defined medium was devised for use in alpha-amylase induction studies. The addition of 0.1% casein hydrolysate to the chemically defined medium permitted growth on fructose, and with glucose, sucrose, maltose, starch, and glycerol it shortened the lag period and increased both the growth rate and the total enzyme produced. Growth did not occur when gluconate, acetate, or succinate were used as carbon sources. alpha-Amylase was produced during the logarithmic phase of growth; the amount produced was inversely proportional to the rate of growth. The poorer the carbon source for growth (glycerol, k = 0.24; glucose, k = 0.26; sucrose, k = 0.42), the higher was the amount of enzyme produced (glycerol, 109 units/ml; glucose, 103 units/ml; sucrose, 45 units/ml). Cells grown on technical-grade maltose (k = 0.26) or starch (k = 0.42) did not conform to this relationship in that unusually large amounts of alpha-amylase were produced (362 and 225 units/ml, respectively). Cells grown on fructose or sucrose had the same growth rate (k = 0.42), but smaller amounts of alpha-amylase were produced on fructose (fructose, 0 to 4 units/ml; sucrose, 45 units/ml). An intracellular alpha-amylase was not detected in Bacillus stearothermophilus.

  4. Componential profile and amylase inhibiting activity of phenolic compounds from Calendula officinalis L. leaves. (United States)

    Olennikov, Daniil N; Kashchenko, Nina I


    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6'-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6''-acetyl)-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase. PMID:24683352

  5. In silico approach for alpha-amylase inhibitory activity of diosmetin and galangin


    Arumugam Madeswaran; Kuppusamy Asokkumar; Muthuswamy Umamaheswari; Thirumalaisamy Sivashanmugam; Varadharajan Subhadradevi


    Objective: The objective of the current study is to evaluate the α-amylase inhibitory activity of diosmetin and galangin using in silico docking studies.Methods: In this perspective, diosmetin and galangin were prepared for the docking evaluation. Acarbose, a known α-amylase inhibitor was used as the standard. In silico docking studies were carried out using recent version of AutoDock 4.2, which has the basic principle of Lamarckian genetic algorithm.Results: The results showed that the selec...

  6. Amylase-Binding Protein B of Streptococcus gordonii Is an Extracellular Dipeptidyl-Peptidase▿


    Chaudhuri, Biswendu; Paju, Susanna; Haase, Elaine M.; Vickerman, M. Margaret; Tanzer, Jason M; Scannapieco, Frank A.


    The oral commensal bacterium Streptococcus gordonii interacts with salivary amylase via two amylase-binding proteins, AbpA and AbpB. Based on sequence analysis, the 20-kDa AbpA protein is unique to S. gordonii, whereas the 82-kDa AbpB protein appears to share sequence homology with other bacterial dipeptidases. The aim of this study was to verify the peptidase activity of AbpB and further explore its potential functions. The abpB gene was cloned, and histidine-tagged AbpB (His-AbpB) was expre...

  7. Salivary α-amylase levels as a biomarker of experienced fear


    Buchanan, Tony W.; Bibas, David; Adolphs, Ralph


    We recently reported data related to emotions collected in conjunction with a museum exhibit on emotion (Goose Bumps!—The Science of Fear).1 In this addendum, we present additional data collected as part of that study. We collected two commonly measured indices of emotional arousal, salivary cortisol and α-amylase, before and after participants had gone through a realistic fear challenge course as part of the exhibit. We found that α-amylase, but not cortisol, showed a highly specific increas...

  8. Thermostable a-amylase from moderately halophilic Halomonas sp. AAD21


    UZYOL, Kamil Serkan; Akbulut, Berna Sariyar; DENİZCİ, Aziz Akın; KAZAN, Dilek


    The moderately halophilic Halomonas sp. strain AAD21, which produces extracellular thermostable a-amylase, was isolated from the Çamaltı Saltern area located in İzmir, Turkey. NaCl, carbon, and nitrogen sources in the growth medium were optimized to enhance a-amylase yield. The highest enzyme yield was measured in the presence of 20% NaCl with peptone as the nitrogen and starch as the carbon sources in the fermentation broth. This microorganism was also found to utilize waste potato peel as a...

  9. Production of α-Amylase by the Ruminal Anaerobic Fungus Neocallimastix frontalis


    Mountfort, Douglas O.; Asher, Rodney A.


    α-Amylase production was examined in the ruminal anaerobic fungus Neocallimastix frontalis. The enzyme was released mainly into the culture fluid and had temperature and pH optima of 55°C and 5.5, respectively, and the apparent Km for starch was 0.8 mg ml−1. The products of α-amylase action were mainly maltotriose, maltotetraose, and longer-chain oligosaccharides. No activity of the enzyme was observed towards these compounds or pullulan, but activity on amylose was similar to starch. Evidenc...

  10. Influence of cysteamine on plasmatic amylase and S.G.O.T. activities in irradiated rats

    International Nuclear Information System (INIS)

    Alterations in plasmatic amylase and SGOT (Serum Glutamic Oxalacetic Transaminase) activities were determined in rats after exposure to gamma radiation at two doses: 900 R (LD50/30) and 1200 R (LF100/30). These determinations were carried out 6 and 24 hours after irradiation. The rats were given intraperitoneal injection of cysteamine (100 mg/kg) 15 minutes before irradiation. A comparative study with non protected rats was performed. It was observed that plasmatic amylase activity was not affected either by irradiation or by cysteamine. Lethal or semi-lethal irradiation increased plasmatic SGOT activity. But no correlation was established between this increase and rat survival time

  11. Serum amylase as a semiquantitative indicator of an exposure to ionizing radiation

    International Nuclear Information System (INIS)

    Quantitative aspects of amylase-activity increase in serum after a single irradiation of the salivary glands in man are considered. The threshold is about 0,4 Gy; in the range 0,4 - 5 Gy the dose can be estimated semi-quantitatively after 24 hours if the salivary glands were irradiated completely and homogeneously. To obtain a (pre-irradiation) reference level the 72-hour value is used. Non-complete and inhomogeneous irradiation of the glands and fractionated irradiation invalidate the dose assessment. It is concluded that at present serum amylase measurement is the only available biochemical indicator of irradiation dose in man. 7 refs., 2 figs. (qui)

  12. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.


    Mielenz, J R


    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also co...

  13. Different agroresidues used in solid substrate fermentation for alpha- amylase production by bacillus subtilis-329

    International Nuclear Information System (INIS)

    The best mass ratio for agroresidue fermentation for a-amylase production by locally isolated Bacillus subtilis-239 was found to be wheat bran to rice bran 2:1 with 70% initial moisture content for 60 h incubation time. Among different inorganic nitrogen sources supplemented, sodium nitrate and ammonium chloride (0.5% w/w) increased the enzyme yield upto 178 U/ml and 176 U/ml, respectively, whereas all the organic nitrogen sources decreased the enzyme production. Addition of glucose (1% w/w) as a carbon source enhanced a-amylase synthesis to 185 U/ml as compared to the control (134 U/ml). (author)

  14. [Ratio of amylase clearance and creatinine clearance in the diagnosis of acute pancreatitis]. (United States)

    Haffter, D; Reichlin, B; Gyr, K


    In 21 healthy volunteers the ratio of amylase clearance and creatinine clearance (Cam/Ccr) was determined in urine collected at admission, after a 1-hour collection period and after a 2-hour collection period. The normal values were 1.8 +/- 1.6%, 1.9 +/- 2% and 2.0 +/- 1.7% respectively. They were comparable with those published by others. The reproducibility of the method was acceptable (r = 0.62). When compared with serum amylase determinations, Cam/Ccr showed neither better sensitivity in 19 patients suffering an acute episode of proven pancreatitis, nor better specificity in 19 patients with acute abdomen but no evidence of pancreatitis.

  15. Amylase production by solid-state fermentation of agro-industrial wastes using Bacillus sp.


    Saxena, Rajshree; Singh, Rajni


    Solid state fermentation was carried out using various agro- industrial wastes with the best amylase producing strain isolated from soil. Different physicochemical conditions were varied for maximum enzyme production. The strain produced about 5400 units/g of amylase at 1:3 moisture content, 20% inoculum, after 72 h of incubation with Mustard Oil seed cake as the substrate. The optimum temperature and pH of the enzyme activity were found to be 50°C and 6 respectively. The enzyme was found to ...

  16. alpha-Amylase and programmed cell death in aleurone of ripening wheat grains. (United States)

    Mrva, Kolumbina; Wallwork, Meredith; Mares, Daryl J


    Late maturity alpha-amylase (LMA) in wheat is a genetic defect that may result in the accumulation of unacceptable levels of high pI alpha-amylase in grain in the absence of germination or weather damage. During germination, gibberellin produced in the embryo triggers expression of alpha-Amy genes, the synthesis of alpha-amylase and, subsequently, cell death in the aleurone. LMA also involves the aleurone and whilst LMA appears to be independent of the embryo there is nevertheless some evidence that gibberellin is involved. The aim of this investigation was to determine whether the increase in alpha-amylase activity in LMA-prone genotypes, like alpha-amylase synthesis by aleurone cells in germinating or GA-challenged grains, is followed by aleurone cell death. Programmed cell death was seen in aleurone layers from developing, ripe and germinated grains using confocal microscopy and fluorescent probes specific for dead or living cells. Small pockets of dying cells were observed distributed at random throughout the aleurone of ripening LMA-affected grains and by harvest-ripeness these cells were clearly dead. The first appearance of dying cells, 35 d post-anthesis, coincided with the later part of the 'window of sensitivity' in grain development in LMA-prone wheat cultivars. No dead or dying cells were present in ripening or fully ripe grains of control cultivars. In germinating grains, dying cells were observed in the aleurone adjacent to the scutellum and, as germination progressed, the number of dead cells increased and the affected area extended further towards the distal end of the grain. Aside from the obvious differences in spatial distribution, dying cells in 20-24 h germinated grains were similar to dying cells in developing LMA-affected grains, consistent with previous measurements of alpha-amylase activity. The increase in high pI alpha-amylase activity in developing grains of LMA-prone cultivars, like alpha-amylase synthesis in germinating grains, is

  17. Assessment of salivary amylase as a stress biomarker in pregnant patients. : Salivary alpha-amylase: a stress biomarker in pregnant patients


    Guglielminotti, Jean; Dehoux, Monique; Mentré, France; Bedairia, Ennoufous; Montravers, Philippe; Desmonts, Jean-Marie; Longrois, Dan


    BACKGROUND: Chronic stress during pregnancy has been associated with worsened maternal and fetal outcomes. Acute stress immediately before spinal anaesthesia for caesarean section may contribute to hypotension. Therefore objective measures of acute stress may help identify women at risk of adverse outcomes. Salivary alpha-amylase is a stress biomarker that has so far been poorly investigated during pregnancy. The reference change value is the difference between two sequential results that mus...

  18. Effects of Carbon Sources and Various Chemicals on the Production of a Novel Amylase from a Thermophilic Bacillus sp. K-12


    KIRAN, Özlem; ÇÖMLEKÇİOĞLU, Uğur; Arikan, Burhan


    The amylase producer thermophilic Bacillus sp. K-12 was isolated from soil samples from Zeytinli hot spring in Kahramanmaraş. Enzyme synthesis occurred at 20-55 ºC with an optimum of 42 ºC. There was a slight variation in amylase synthesis within the pH range 4.5-10.5. Effects of various carbon sources and chemicals on a-amylase production were examined and maximum a-amylase production was obtained in a medium containing 1% starch in 60 h. MnSO4, ZnSO4 and EDTA inhibited a-amylase production ...

  19. 大豆β-淀粉酶在生产麦芽糖浆上的优势%Advantages of soybeanβ-amylase in maltose production

    Institute of Scientific and Technical Information of China (English)

    许永苗; 李惠安; 伍伯良; 黄玉新; 黄智钧


    介绍了β-淀粉酶和α-淀粉酶的酶种来源及其在生产麦芽糖浆中的作用机理,并对大豆β-淀粉酶、大麦β-淀粉酶、小麦β-淀粉酶、真菌α-淀粉酶、普鲁兰酶的适用条件、失活条件进行了比较,得出大豆β-淀粉酶在生产麦芽糖浆上的优势。%This paper summarized the resources and mechanisms ofβ-amylase and α-amylase. Optimum condi-tions and inactivated conditions of the soybeanβ-amylase, barleyβ-amylase, wheatβ-amylase, fungalα-amylase, and pullulanase were compared. Advantage of soybeanβ-amylase in maltose production was pointed out.

  20. Advantages of soybeanβ-amylase in maltose production%大豆β-淀粉酶在生产麦芽糖浆上的优势

    Institute of Scientific and Technical Information of China (English)

    许永苗; 李惠安; 伍伯良; 黄玉新; 黄智钧


    介绍了β-淀粉酶和α-淀粉酶的酶种来源及其在生产麦芽糖浆中的作用机理,并对大豆β-淀粉酶、大麦β-淀粉酶、小麦β-淀粉酶、真菌α-淀粉酶、普鲁兰酶的适用条件、失活条件进行了比较,得出大豆β-淀粉酶在生产麦芽糖浆上的优势。%This paper summarized the resources and mechanisms ofβ-amylase and α-amylase. Optimum condi-tions and inactivated conditions of the soybeanβ-amylase, barleyβ-amylase, wheatβ-amylase, fungalα-amylase, and pullulanase were compared. Advantage of soybeanβ-amylase in maltose production was pointed out.

  1. NMR-based metabolomics for identification of α-amylase inhibitors in rowan berries (Sorbus spp.)

    DEFF Research Database (Denmark)

    Broholm, Sofie L.; Gramsbergen, Simone; Nyberg, Nils;

    Type 2 diabetes is a metabolic disorder estimated to affect millions of people all over the world.1 One way of reducing diabetes-related complications is to control postprandial glucose.2 Inhibition of the carbohydrate digestive enzyme α-amylase is a therapeutic target for maintaining low blood g...... a 1H-NMR method suitable for NMR-based metabolomics...

  2. Homogeneity and heterogeneity in amylase production by Bacillus subtilis under different growth conditions

    NARCIS (Netherlands)

    Ploss, Tina N.; Reilman, Ewoud; Monteferrante, Carmine G.; Denham, Emma L.; Piersma, Sjouke; Lingner, Anja; Vehmaanpera, Jari; Lorenz, Patrick; van Dijl, Jan Maarten


    Background: Bacillus subtilis is an important cell factory for the biotechnological industry due to its ability to secrete commercially relevant proteins in large amounts directly into the growth medium. However, hyper-secretion of proteins, such as alpha-amylases, leads to induction of the secretio

  3. Determinants of salivary evening alpha-amylase in a large sample free of psychopathology

    NARCIS (Netherlands)

    Veen, Gerthe; Giltay, Erik J.; Vreeburg, Sophie A.; Licht, Carmilla M. M.; Cobbaert, Christa M.; Zitman, Frans G.; Penninx, Brenda W. J. H.


    Objective: Recently, salivary alpha-amylase (sAA) has been proposed as a suitable index for sympathetic activity and dysregulation of the autonomic nervous system (ANS). Although determinants of sAA have been described, they have not been studied within the same study with a large sample size withou

  4. Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations

    DEFF Research Database (Denmark)

    Møller, Kasper; Sharif, M.Z.; Olsson, Lisbeth


    Heterologous protein production by the yeast Saccharomyces kluyveri was investigated under aerobic glucose-limited conditions. alpha-Amylase from Aspergillus oryzae was used as model protein and the gene was expressed from a S. cerevisiae 2 mu plasmid. For comparison, strains of both S. kluyveri...

  5. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase (United States)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  6. In silico approach for alpha-amylase inhibitory activity of diosmetin and galangin

    Directory of Open Access Journals (Sweden)

    Arumugam Madeswaran


    Full Text Available Objective: The objective of the current study is to evaluate the α-amylase inhibitory activity of diosmetin and galangin using in silico docking studies.Methods: In this perspective, diosmetin and galangin were prepared for the docking evaluation. Acarbose, a known α-amylase inhibitor was used as the standard. In silico docking studies were carried out using recent version of AutoDock 4.2, which has the basic principle of Lamarckian genetic algorithm.Results: The results showed that the selected flavonoids showed binding energy ranging between -6.84 kcal/mol to  -5.96 kcal/mol when compared with that of the standard (-1.97 kcal/mol. Inhibition constant (9.73 µM to 42.76 µM and intermolecular energy (-8.33 kcal/mol to -7.15 kcal/mol of the ligands also coincide with the binding energy.Conclusion: Diosmetin and galangin contributed excellent α-amylase inhibitory activity than the standard because of its structural parameters. These molecular docking analyses of the selected compounds could lead to the further development to find the potent α-amylase inhibitors for the treatment of diabetes.  

  7. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    Directory of Open Access Journals (Sweden)

    Gaurav Sapra


    Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations.

  8. How Do Detergents Work? A Qualitative Assay to Measure Amylase Activity (United States)

    Novo, M. Teresa; Casanoves, Marina; Garcia-Vallvé, Santi; Pujadas, Gerard; Mulero, Miquel; Valls, Cristina


    We present a practical activity focusing on two main goals: to give learners the opportunity to experience how the scientific method works and to increase their knowledge about enzymes in everyday situations. The exercise consists of determining the amylase activity of commercial detergents. The methodology is based on a qualitative assay using a…

  9. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion. (United States)

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng


    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits.

  10. A rapid lateral flow immunoassay for the detection of fungal alpha-amylase at the workplace

    NARCIS (Netherlands)

    Koets, M.; Sander, I.; Bogdanovic, J.; Doekes, G.; Amerongen, van A.


    Fungal alpha-amylase is a flour supplement which is added to improve the quality of bakery products. Various studies have shown that exposure to this enzyme is an important risk factor for the development of bakers allergy and this allergy is reported to be one of the most frequent causes of occupat

  11. Identification of amylase inhibitor deficient mutants in pigeonpea (Cajanus cajan (L.) Millisp.). (United States)

    Chougule, N P; Giri, A P; Hivrale, V K; Chhabda, P J; Kachole, M S


    We have developed and analyzed several mutant lines (M6 generation) of pigeonpea (Cajanus cajan (L.) Millsp.) for the content of defensive proteins and antinutritional factors. Inhibitors of proteinase and of amylase, lectins, and raffinose family oligosaccharides were analyzed in mature seeds of different pigeonpea accessions (untreated) and compared with mutant lines. Proteinase inhibitor profiles were similar in terms of number and intensities of activity bands but they differ marginally in the activity units in pigeonpea accessions and mutants. Pigeonpea mutants showed significant differences in amylase inhibitor profiles as well as activity units from those of pigeonpea accessions. Interestingly, two mutants (A6-5-1 and A7-3-2) were identified to have absence of amylase inhibitor isoforms. Hemagglutinating activity and raffinose family oligosaccharides content were found to be significantly higher in mutants than in accessions. It is evident from the results that proteinase inhibitors of pigeonpea are stable while amylase inhibitors, lectins, and raffinose family oligosaccharides show altered expression upon mutagen treatments. These mutants will be ideal candidates for further evaluation. PMID:15260142

  12. Salivary alpha-amylase as a marker for stress response, caused by laryngoscopy and endotracheal intubation


    Nataļja Jakušenko


    Salivary alpha-amylase as a marker for stress response, caused by laryngoscopy and endotracheal intubation Annotation Endotracheal intubation by the direct laryngoscopy during anaesthesia is the anaesthesiologists’ routine practice. Industries of medical technology are working at the manufacturing of alternative and much safer intubation appliances, for instance, firobronchoscope, videolaryngoscope, etc. In order to estimate various intubation appliances, one has to assess the pat...

  13. Salivary Amylase Level in Bronchoalveolar Fluid as a Marker of Chronic Pulmonary Aspiration in Children


    Abu-Hasan, Mutasim; Elmallah, Mai; Neal, Dan; Brookes, James


    Background: Chronic pulmonary aspiration is a common cause of chronic respiratory symptoms in children. However, there is no gold standard diagnostic test for aspiration. In this study, we explore the diagnostic value of measuring salivary amylase in bronchoalveolar lavage (BAL) fluid as a marker of chronic aspiration in children with different chronic respiratory illnesses.

  14. Fucoidan - An α-amylase inhibitor from Sargassum wightii with relevance to NIDDM. (United States)

    Lakshmana Senthil, S; Vinoth Kumar, T; Geetharamani, D; Suja, G; Yesudas, Rincy; Chacko, Amrutha


    The present experiment was conducted to screen the α-amylase inhibitory activity of fucoidan extracted from Sargassum wightii collected at the coastal area of Mandapam, Tamil Nadu, India. Fucoidan was extracted from the sporophyll of S. Wightii by ethanol and CaCl2 precipitation method. The average yield was 1.8±0.16% and the extracted fucoidan was found to contain 53±0.52% of fucose and 36±0.60% of sulphate. Structural elucidation (FT-IR and NMR) and in vitro α-amylase activity of purified fucoidon were performed. Fucoidan at the concentration of 62.5, 125 and 250μg exhibited 24.81, 62.50 and 99.24% inhibition against α-amylase, respectively, in a dose dependent manner. Fucoidan from S. wightii also inhibits α-glucosidase which clearly indicates dual inhibitory activity of the compound. The IC50 value against α-amylase of fucoidan is found to be 103.83μg which is more effective than that of acarbose (16mg). PMID:26325676

  15. Amylosucrase, a glucan-synthesizing enzyme from the alpha-amylase family

    DEFF Research Database (Denmark)

    Skov, L K; Mirza, Osman Asghar; Henriksen, A;


    Amylosucrase (E.C. is a member of Family 13 of the glycoside hydrolases (the alpha-amylases), although its biological function is the synthesis of amylose-like polymers from sucrose. The structure of amylosucrase from Neisseria polysaccharea is divided into five domains: an all helical N...

  16. Halotolerant Ability and α-Amylase Activity of Some Saltwater Fungal Isolates (United States)

    Niknejad, Farhad; Moshfegh, Mahsa; Najafzadeh, Mohammad Javad; Houbraken, Jos; Rezaei, Shahla; Zarrini, Gholamreza; Faramarzi, Mohammad Ali; Nafissi-Varcheh, Nastaran


    Four halotolerant fungal isolates originating from the saltwater Lake Urmia in Iran were selected during a screening program for salt resistance and α-amylase activity. The isolates were identified based on sequencing the ITS region and a part of the β-tubulin gene, as Penicillium chrysogenum (isolate U1; CBS 132820), Fusarium incarnatum (isolate U2; CBS 132821), and Penicillium polonicum (isolate U3; CBS 132822, and isolate U4; CBS 132823). The growth of these isolates was determined by measuring the colony diameter and mycelia dry weight in Sabouraud dextrose agar and yeast nitrogen base medium supplemented with NaCl, KCl, and LiCl. Isolate U4 showed a growth up in 15% NaCl and U1 was the only isolate that could grow in 20% KCl. None of the strains grew in a media containing LiCl. The salt supplemented medium did not increase the size of colony diameter in all isolates (p > 0.05). The ability of the selected isolates for amylase production was quantitatively tested and showed that P. polonicum isolate U4 was the most potent producer of amylase with a yield of 260.9 U/L after 60 h, whereas P. polonicum isolate U3 was the lowest one with a production level of 97.9 U/L after 48 h. P. polonicum isolate U4 could be a suitable candidate for production of amylase on an industrial scale after optimization. PMID:24250679

  17. Halotolerant ability and α-amylase activity of some saltwater fungal isolates

    NARCIS (Netherlands)

    Niknejad, F.; Moshfegh, M.; Najafzadeh, M.J.; Houbraken, J.; Rezaei, S.; Zarrini, G.; Faramarzi, M.A.; Nafissi-Varcheh, N.


    Four halotolerant fungal isolates originating from the saltwater Lake Urmia in Iran were selected during a screening program for salt resistance and α-amylase activity. The isolates were identified based on sequencing the ITS region and a part of the β-tubulin gene, as Penicillium chrysogenum (iso

  18. Enhanced starch hydrolysis using α-amylase immobilized on cellulose ultrafiltration affinity membrane. (United States)

    Konovalova, Viktoriia; Guzikevich, Kateryna; Burban, Anatoliy; Kujawski, Wojciech; Jarzynka, Karolina; Kujawa, Joanna


    In order to prepare ultrafiltration membranes possessing biocatalytic properties, α-amylase has been immobilized on cellulose membranes. Enzyme immobilization was based on a covalent bonding between chitosan and a surface of cellulose membrane, followed by an attachment of Cibacron Blue F3G-A dye as affinity ligand. Various factors affecting the immobilization process, such as enzyme concentration, pH of modifying solution, zeta-potential of membrane surface, and stability of immobilized enzyme were studied. The applicability of immobilized α-amylase has been investigated in ultrafiltration processes. The immobilization of α-amylase on membrane surface allows to increase the value of mass transfer coefficient and to decrease the concentration polarization effect during ultrafiltration of starch solutions. The enzyme layer on the membrane surface prevents a rapid increase of starch concentration due to the amylase hydrolysis of starch in the boundary layer. The presented affinity immobilization technique allows also for the regeneration of membranes from inactivated enzyme. PMID:27516322

  19. Identification a Novel Raw-Starch-Degrading-α-Amylase from a Tropical Marine Bacterium

    Directory of Open Access Journals (Sweden)

    Zeily Nurachman


    Full Text Available Problem statement: Bacteria from the surface of the tropical marine hard coral Acropora sp. were screened for producing raw-starch-degrading-á-amylase. Approach: Based on its 16s rDNA sequence, a bacterium that produced the highest amylolitic activity was identified as Bacillus amyloliquifaciens ABBD. The bacterial isolate secreted a á-amylase extracellularly and then the enzyme was partially purified by ammonium sulfate precipitation followed by anion exchange chromatography. Results: Electrophoresis results both SDS-PAGE and native PAGE suggested that the enzyme was a heterodimeric protein (97 kDa consisting of 45 and 55 kDa subunits. The á-amylase had an optimum pH of 7.0 and temperature of 60°C. More than 80% activity of the enzyme was retained under high salt conditions (up to 20% NaCl. The enzyme remained stable at 50°C for 1 h. Starch hydrolysis by the enzyme at 70°C yielded oligosaccharides (G2-G4 and at room temperature yielded glucose/maltose (G1 and G2. Conclusion: The B. amyloliquifaciens ABBD á-amylase was capable of degrading various raw starch granules from corn, rice, cassava and sago at room temperature.

  20. Serum-amylase - a semiquantitative indicator of exposure to ionizing radiation

    International Nuclear Information System (INIS)

    Earlier works by Kashima et al. and Chen et al. have shown that it might be possible to use the radiation induced activity changes in s-amylase as an indicator of exposure to ionizing radiation. It is the aim of our investigations to check and possibly make more precise the results these authors arrived at. (orig.)

  1. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion (United States)

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  2. Kinetic Analysis of Amylase Using Quantitative Benedict's and Iodine Starch Reagents (United States)

    Cochran, Beverly; Lunday, Deborah; Miskevich, Frank


    Quantitative analysis of carbohydrates is a fundamental analytical tool used in many aspects of biology and chemistry. We have adapted a technique developed by Mathews et al. using an inexpensive scanner and open-source image analysis software to quantify amylase activity using both the breakdown of starch and the appearance of glucose. Breakdown…

  3. The studies on radiation mutation breeding of Bacillus subtilis with high-yield of amylase

    International Nuclear Information System (INIS)

    The mutagenesis effects on the yield of amylase have been investigated with Bacillus subtilis irradiated by γ-rays and fast neutrons in once or twice irradiation at various dose rates and total irradiation doses. Several parameters such as flat transparent circle, colony diameter, transparent circle diameter and the ratio of flat transparent circle to colony diameter (HC) are used to estimate the radiation mutation of Bacillus subtilis. A series of results has been obtained as (1) Irradiation both with neutrons and γ-rays could make Bacillus subtilis mutationed to produce high-yield amylase effectively. (2) The average colony diameter of Bacillus subtilis irradiated by γ-rays or fast neutrons is smaller than that of control group at various total doses and dose rates. And their colony diameter becomes smaller slightly with the increment of γ-rays irradiation dose. (3) After the second neutrons irradiation, the values of average colony diameter, the biggest colony diameter, average transparent circle diameter and the biggest transparent circle diameter of all mutationed Bacillus subtilis exceed that of original strains greatly. (4) Three kinds of mutationed Bacillus subtilis strains with high-yield amylase have been screened out, in which two strains can produce high-yield amylase steadily after 15 times breeding. Their biggest colony diameter, the biggest transparent circle diameter and the biggest HC value are up to 8.32 mm, 22.38 mm and 5.39 respectively. (authors)

  4. Occurrence of toxicity among protease, amylase, and color mutants of a nontoxic soy sauce koji mold

    International Nuclear Information System (INIS)

    A soy sauce koji mold, Aspergillus flavus var. columnaris Raper and Fennel (ATCC 44310), was treated with UV irradiation to obtain mutant strains possessing high protease activities, high amylase activities, and light-colored conidia. Selected mutant strains were tested for toxicity, and some were found acutely toxic to weanling rats, although all were negative for aflatoxin production


    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  6. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners (United States)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  7. Radiation immobilization of α-amylase on poly methyl methacrylate Pt. 2

    International Nuclear Information System (INIS)

    Bacterial α-amylase Bacillus substilis has been immobilized by the method of emulsion polymerization of methyl methacrylate initiated with γ60Co radiation; a product of high activity and stability has been obtained. Optimum process parameters have been established. (author)

  8. Validation of an assay for quantification of alpha-amylase in saliva of sheep. (United States)

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa


    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep. PMID:27408332

  9. Radiation immobilization of α-amylase on poly methyl methacrylate Pt. 1

    International Nuclear Information System (INIS)

    The effect of γ60Co radiation on bacterial α-amylase Bacillus substilis and on the bacterial post-culture fluid has been studied. IR spectrum analysis has been carried out and the concentration of free radicals formed on irradiation and the degree on enzyme inactivation have been determined. (author)

  10. Enhancing Maritime Education and Training: Measuring a Ship Navigator's Stress Based on Salivary Amylase Activity (United States)

    Murai, Koji; Wakida, Shin-Ichi; Miyado, Takashi; Fukushi, Keiichi; Hayashi, Yuji; Stone, Laurie C.


    Purpose: The purpose of this paper is to propose that the measurement of salivary amylase activity is an effective index to evaluate the stress of a ship navigator for safe navigation training and education. Design/methodology/approach: Evaluation comes from the simulator and actual on-board experiments. The subjects are real captains who have…

  11. Specificity of increased amylase to creatinine clearance ratio in acute pancreatitis. (United States)

    Lankisch, P G; Koop, H; Otto, J; Oberdieck, U; Winckler, K; Wolfrum, D I


    The amylase to creatinine clearance ratio was found to be normal in 11 of 33 patients with acute pancreatitis. The ratio was elevated in 10 of 19 patients with renal insufficiency. Thus, it does not seem to be a specific index in the diagnosis of acute pancreatitis.

  12. Mechanism of increased renal clearnace of amylase/creatinine in acute pancreatitis. (United States)

    Johnson, S G; Ellis, C J; Levitt, M D


    We investigated three possible causes of the increased ratio of amylase/creatinine clearance observed in acute pancreatitis. The presence of rapidly cleared isoamylase was excluded by studies of serum and urine, which demonstrated no anomalous isoamylases. In pancreatitis, the ratios (+/-1 S.E.M.) of both pancreatic isoamylase (9.2+/-0.6 per cent) and salivary isoamylase (8.6+/-1.6 per cent) were significantly (P less than 0.01) elevated over respective control values (2.4+/-0.2 and 1.8+/-0.2 per cent). Increased glomerular permeability to amylase was excluded by the demonstration of normal renal clearance of dextrans. We tested tubular reabsorption of protein by measuring the renal clearance of beta2-microglobulin, which is relatively freely filtered at the glomerulus and then avidly reabsorbed by the normal tubule. During acute pancreatitis the ratio of the renal clearance of beta2-microglobulin to that of creatinine was 1.22+/-0.52 per cent, an 80-fold increase over normal (0.015+/-0.002 per cent), with a rapid return toward normal during convalescence. Presumably, this reversible renal tubular defect also reduces amylase reabsorption and accounts for the elevated renal clearance of amylase/creatinine observed in acute pancreatitis.

  13. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase (United States)

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.


    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  14. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva (United States)

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka


    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  15. Improvement of Starch Digestion Using α-Amylase Entrapped in Pectin-Polyvinyl Alcohol Blend

    Directory of Open Access Journals (Sweden)

    Maurício Cruz


    Full Text Available Polyvinyl alcohol (PVA and pectin blends were used to entrap α-amylase (Termamyl using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25% on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM, tensile strength (TS, elongation, and rate of dissolution in water (pH 5.7, ruminal buffering solution (pH 7.0, and reactor containing 0.1 mol L−1 sodium phosphate buffer (pH 6.5, were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h, in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications.

  16. Partial characterization of cold active amylases and proteases of Streptomyces sp. from Antarctica

    Directory of Open Access Journals (Sweden)

    Mihaela Cotârleţ


    Full Text Available The aim of this study was to isolate novel enzyme-producing bacteria from vegetation samples from East Antarctica and also to characterize them genetically and biochemically in order to establish their phylogeny. The ability to grow at low temperature and to produce amylases and proteases cold-active was also tested. The results of the 16S rRNA gene sequence analysis showed that the 4 Alga rRNA was 100% identical to the sequences of Streptomyces sp. rRNA from Norway and from the Solomon Islands. The Streptomyces grew well in submerged system at 20ºC, cells multiplication up to stationary phase being drastically increased after 120 h of submerged cultivation. The beta-amylase production reached a maximum peak after seven days, while alpha-amylase and proteases were performing biosynthesis after nine days of submerged cultivation at 20ºC. Newly Streptomyces were able to produce amylase and proteases in a cold environment. The ability to adapt to low temperature of these enzymes could make them valuable ingredients for detergents, the food industry and bioremediation processes which require low temperatures.

  17. Production of a raw starch saccharifying amylase byBacillus alvei grown on different agricultural substrates. (United States)

    Achi, O K; Nijoku-Obi, A N


    Maximum activity of the amylase ofBacillus alvei was attained after growth of the organism on sorghum starch. Rice, corn, yam, cassava and potato starch gave high enzyme activities as did soluble starch. Glucose, maltose and glycerol were less effective. Optimum conditions for both growth and enzyme production were pH 6.8 at 40°C.

  18. Comparative study on production of α-Amylase from Bacillus licheniformis strains

    Directory of Open Access Journals (Sweden)

    Dibu Divakaran


    Full Text Available Alpha amylase (α-1, 4-glucan-glucanhydrolase, EC, an extracellular enzyme, degrades α, 1-4 glucosidic linkages of starch and related substrates in an endo-fashion producing oligosaccharides including maltose, glucose and alpha limit dextrin (7. The present study deals with the production and comparative study of production of α-amylase from two strains of Bacillus licheniformis, MTCC 2617 and 2618, by using four different substrates, starch, rice, wheat and ragi powder as carbon source by submerged fermentation. The effect of varying pH and incubation temperature, activator, inhibitor, and substrate concentration was investigated on the activity of α-amylase produced by MTCC strain 2618. The results shows that the production of the α-amylase by the B.licheniformis strain MTCC 2618, using four different substrates were found to be maximum (Starch 3.64 IU/ml/minutes, Rice powder 2.93 IU/ml/minutes, Wheat powder 2.67 IU/ml/minutes, Ragi powder 2.36 IU/ml/minutes on comparing the enzyme production of two strains. It was also observed that the maximum production was found on the 3rd day (i.e. 72 hr and characterization of crude enzyme revealed that optimum activity was at pH 7 and 37ºC.

  19. A calorimetric study of solute effects on the kinetic stability of a-amylase

    DEFF Research Database (Denmark)

    Olsen, Søren Nymand; Andersen, Kim Bruno; Øgendal, Lars Holm;


    In this study we evaluated the applications of isothermal titration calorimetry (ITC) to Study solute effects on the kinetics of irreversible protein denaturation. More specifically, denaturation of Bacillus Halmapalus alpha-amylase (BHA) was initiated by addition of EDTA to the calorimetric cell...

  20. Salivary amylase induction by tannin-enriched diets as a possible countermeasure against tannins

    DEFF Research Database (Denmark)

    da Costa, G; Lamy, E; Capela e Silva, F;


    proteins, some of them showing more than one isoform. Tannin-enriched diets were observed to change the salivary protein profile. One isoform of alpha-amylase was overexpressed with both types of tannins. Aldehyde reductase was only identified in saliva of the quebracho group. Additionally, a hypertrophy...

  1. Role of electrostatic repulsion on colloidal stability of Bacillus halmapalus alpha-amylase

    DEFF Research Database (Denmark)

    Olsen, Søren Nymand; Andersen, Kim Bruno; Randolf, Theodor;


    Bacillus halmapalus α-amylase (BHA) as a model protein. Repulsive forces between partly unfolded monomers were shown to strongly affect aggregation. Adding salt, increasing valence of counter ions or decreasing pH in the direction of pI resulted in a shift in the rate-limiting step from association...

  2. Salivary alpha-amylase : a measure associated with satiety and subsequent food intake in humans

    NARCIS (Netherlands)

    Harthoorn, L.F.


    Food intake regulation in humans involves various central and peripheral mechanisms. In this study salivary -amylase was examined for functioning as a measure of satiety and food intake. In a 1.25-h session, 32 fasted subjects were given a preload of starch-based custard (849 kJ) followed by ad libi

  3. Surface binding sites in amylase have distinct roles in recognition of starch structure motifs and degradation

    DEFF Research Database (Denmark)

    Cockburn, Darrell; Nielsen, Morten M.; Christiansen, Camilla;


    degrading enzymes and critically important for their function. The affinity towards a variety of starch granules as well as soluble poly- and oligosaccharides of barley alpha-amylase 1 (AMY1) wild-type and mutants of two SBSs (SBS1 and SBS2) was investigated using Langmuir binding analysis, confocal laser...

  4. Salivary a-amylase protects enamel surface against acid induced softening

    DEFF Research Database (Denmark)

    Lazovic, Maja Bruvo; Moe, Dennis; Kirkeby, Svend;

    -TOF mass fingerprinting following trypsin digestion. Each persistent peak in the HPLC chromatograms was related to the protective effect against acid-induced enamel softening obtained by the corresponding saliva sample by multiple regression analysis. Results: One peak identified as a-amylase had...... an explanatory power of 39% in the analysis with high concentrations being most protective (pamylase on protective effect to 65...

  5. Effects of calcium ion concentration on starch hydrolysis of barley α-amylase isozymes

    DEFF Research Database (Denmark)

    Yuk, Jeong-Bin; Choi, Seung-Ho; Lee, Tae-Hee;


    Barley (x-amylase genes, amyl and amy2, were separately cloned into the expression vector of pPICZ alpha A and recombinant Pichia strains were established by homologous recombination. Both AMYs from Pichia shared almost identical hydrolysis patterns on short maltooligosaccharides to result...

  6. Amylase activity is associated with AMY2B copy numbers in dog: implications for dog domestication, diet and diabetes. (United States)

    Arendt, Maja; Fall, Tove; Lindblad-Toh, Kerstin; Axelsson, Erik


    High amylase activity in dogs is associated with a drastic increase in copy numbers of the gene coding for pancreatic amylase, AMY2B, that likely allowed dogs to thrive on a relatively starch-rich diet during early dog domestication. Although most dogs thus probably digest starch more efficiently than do wolves, AMY2B copy numbers vary widely within the dog population, and it is not clear how this variation affects the individual ability to handle starch nor how it affects dog health. In humans, copy numbers of the gene coding for salivary amylase, AMY1, correlate with both salivary amylase levels and enzyme activity, and high amylase activity is related to improved glycemic homeostasis and lower frequencies of metabolic syndrome. Here, we investigate the relationship between AMY2B copy numbers and serum amylase activity in dogs and show that amylase activity correlates with AMY2B copy numbers. We then describe how AMY2B copy numbers vary in individuals from 20 dog breeds and find strong breed-dependent patterns, indicating that the ability to digest starch varies both at the breed and individual level. Finally, to test whether AMY2B copy number is strongly associated with the risk of developing diabetes mellitus, we compare copy numbers in cases and controls as well as in breeds with varying diabetes susceptibility. Although we see no such association here, future studies using larger cohorts are needed before excluding a possible link between AMY2B and diabetes mellitus.

  7. Production of α-Amylase by Aspergillus terreus NCFT 4269.10 Using Pearl Millet and Its Structural Characterization (United States)

    Sethi, Bijay K.; Jana, Arijit; Nanda, Prativa K.; DasMohapatra, Pradeep K.; Sahoo, Santi L.; Patra, Jayanta Kumar


    In this investigation, Aspergillus terreus NCFT4269.10 was employed in liquid static surface (LSSF) and solid state (SSF) fermentation to assess the optimal conditions for α-amylase biosynthesis. One-variable-at-a-time approach (quasi-optimum protocol) was primarily used to investigate the effect of each parameter on production of amylase. The maximum amylase production was achieved using pearl millet (PM) as substrate by SSF (19.19 ± 0.9 Ug−1) and also in presence of 1 mM magnesium sulfate, 0.025% (w/v) gibberellic acid, and 30 mg/100 ml (w/v) of vitamin E (~60-fold higher production of amylase) with the initial medium pH of 7.0 and incubation at 30 °C for 96 h. In addition, maltose, gelatin and isoleucine also influenced the α-amylase production. Amylase was purified to homogeneity with molecular mass around 15.3 kDa. The enzyme comprised of a typical secondary structure containing α-helix (12.2%), β-pleated sheet (23.6%), and β-turn (27.4%). Exploitation of PM for α-amylase production with better downstream makes it the unique enzyme for various biotechnological applications. PMID:27242841

  8. High-throughput hydrolysis of starch during permeation across α-amylase-immobilized porous hollow-fiber membranes (United States)

    Miura, Suguru; Kubota, Noboru; Kawakita, Hidetaka; Saito, Kyoichi; Sugita, Kazuyuki; Watanabe, Kohei; Sugo, Takanobu


    Two kinds of supporting porous membranes, ethanolamine (EA) and phenol (Ph) fibers, for immobilization of α-amylase were prepared by radiation-induced graft polymerization of an epoxy-group-containing monomer, glycidyl methacrylate, onto a porous hollow-fiber membrane, and subsequent ring-opening with EA and Ph, respectively. An α-amylase solution was forced to permeate radially outward through the pores of the EA and Ph fibers. α-Amylase was captured at a density of 0.15 and 6.6 g/L of the membrane by the graft chain containing 2-hydroxyethylamino and phenyl groups, respectively. A permeation pressure of 0.10 MPa provided a space velocity of 780 and 1500 h -1 for the α-amylase-immobilized EA and Ph fibers, respectively. Quantitative hydrolysis of starch during permeation of a 20 g/L starch solution in the buffer across the α-amylase-immobilized Ph fiber was attained up to a space velocity of about 2000 h -1; this was achieved because of negligible diffusional mass-transfer resistance of the starch to the α-amylase due to convective flow, whereas an enzyme reaction-controlled system was observed for the α-amylase-immobilized EA fiber.

  9. Amylase activity is associated with AMY2B copy numbers in dog: implications for dog domestication, diet and diabetes. (United States)

    Arendt, Maja; Fall, Tove; Lindblad-Toh, Kerstin; Axelsson, Erik


    High amylase activity in dogs is associated with a drastic increase in copy numbers of the gene coding for pancreatic amylase, AMY2B, that likely allowed dogs to thrive on a relatively starch-rich diet during early dog domestication. Although most dogs thus probably digest starch more efficiently than do wolves, AMY2B copy numbers vary widely within the dog population, and it is not clear how this variation affects the individual ability to handle starch nor how it affects dog health. In humans, copy numbers of the gene coding for salivary amylase, AMY1, correlate with both salivary amylase levels and enzyme activity, and high amylase activity is related to improved glycemic homeostasis and lower frequencies of metabolic syndrome. Here, we investigate the relationship between AMY2B copy numbers and serum amylase activity in dogs and show that amylase activity correlates with AMY2B copy numbers. We then describe how AMY2B copy numbers vary in individuals from 20 dog breeds and find strong breed-dependent patterns, indicating that the ability to digest starch varies both at the breed and individual level. Finally, to test whether AMY2B copy number is strongly associated with the risk of developing diabetes mellitus, we compare copy numbers in cases and controls as well as in breeds with varying diabetes susceptibility. Although we see no such association here, future studies using larger cohorts are needed before excluding a possible link between AMY2B and diabetes mellitus. PMID:24975239

  10. In Vivo Synthesis and Turnover of α-Amylase in Attached and Detached Cotyledons of Vigna mungo Seeds 1 (United States)

    Koshiba, Tomokazu; Minamikawa, Takao


    α-Amylase activity increased in attached cotyledons of germinated Vigna mungo seeds until the 5th day after imbibition and decreased thereafter, whereas in detached and incubated cotyledons the activity continuously increased and, at the 6th day, reached the value more than three times that of the maximum activity of attached cotyledons. Zymograms of the activities and Ouchterlony double immunodiffusion test on the activities of attached and detached cotyledons showed that the increase of activity in detached cotyledons was due to the identical enzyme as in attached tissues. α-Amylase contents, determined by single radial immunodiffusion method, changed in parallel with enzyme activity in both attached and detached cotyledons, which also suggested the de novo synthesis of α-amylase in V. mungo cotyledons. The rate of incorporation of the label from [3H]leucine into α-amylase and the ratios of dpm in α-amylase/dpm in trichloroacetic acid-insoluble fraction did not show significant difference between attached and detached cotyledons. The results indicated that in attached cotyledons fluctuation of α-amylase activity was regulated by both synthesis and degradation of the enzyme, whereas in detached cotyledons α-amylase was synthesized and accumulated, because of low degrading activity during incubation. Images Fig. 1 Fig. 2 Fig. 4 PMID:16662780

  11. In Vivo Synthesis and Turnover of alpha-Amylase in Attached and Detached Cotyledons of Vigna mungo Seeds. (United States)

    Koshiba, T; Minamikawa, T


    alpha-Amylase activity increased in attached cotyledons of germinated Vigna mungo seeds until the 5th day after imbibition and decreased thereafter, whereas in detached and incubated cotyledons the activity continuously increased and, at the 6th day, reached the value more than three times that of the maximum activity of attached cotyledons. Zymograms of the activities and Ouchterlony double immunodiffusion test on the activities of attached and detached cotyledons showed that the increase of activity in detached cotyledons was due to the identical enzyme as in attached tissues. alpha-Amylase contents, determined by single radial immunodiffusion method, changed in parallel with enzyme activity in both attached and detached cotyledons, which also suggested the de novo synthesis of alpha-amylase in V. mungo cotyledons.The rate of incorporation of the label from [(3)H]leucine into alpha-amylase and the ratios of dpm in alpha-amylase/dpm in trichloroacetic acid-insoluble fraction did not show significant difference between attached and detached cotyledons. The results indicated that in attached cotyledons fluctuation of alpha-amylase activity was regulated by both synthesis and degradation of the enzyme, whereas in detached cotyledons alpha-amylase was synthesized and accumulated, because of low degrading activity during incubation.

  12. α-Amylase sensor based on the degradation of oligosaccharide hydrogel films monitored with a quartz crystal sensor. (United States)

    Gibbs, Martin John; Biela, Anna; Krause, Steffi


    α-Amylase hydrolyses starch molecules to produce smaller oligosaccharides and sugars. Amylases are of great importance in biotechnology and find application in fermentation, detergents, food and the paper industry. The measurement of α-amylase activity in serum and urine has been used in the diagnosis of acute pancreatitis. Salivary amylase has also been shown to be a stress indicator. Sensor coatings suitable for the detection of α-amylase activity have been developed. Oligosaccharides such as glycogen and amylopectin were spin-coated onto gold coated quartz crystals with a base frequency of 10 MHz. The films were subsequently cross-linked with hexamethylene diisocyanate. Film degradation was monitored with a quartz crystal microbalance (QCM) and electrochemical impedance measurements. The films were shown to be stable in phosphate buffered saline (PBS). Addition of α-amylase to the solution resulted in the rapid degradation of the films. The maximum rate of degradation was found to be strongly dependent on the amylase activity in the range typically found in serum when diagnosing pancreatitis (0.08-8 U/ml). Sensor responses in serum were found to be very similar to those obtained in buffer indicating the absence of non-specific binding. PMID:25266253

  13. High-throughput hydrolysis of starch during permeation across α-amylase-immobilized porous hollow-fiber membranes

    International Nuclear Information System (INIS)

    Two kinds of supporting porous membranes, ethanolamine (EA) and phenol (Ph) fibers, for immobilization of α-amylase were prepared by radiation-induced graft polymerization of an epoxy-group-containing monomer, glycidyl methacrylate, onto a porous hollow-fiber membrane, and subsequent ring-opening with EA and Ph, respectively. An α-amylase solution was forced to permeate radially outward through the pores of the EA and Ph fibers. α-Amylase was captured at a density of 0.15 and 6.6 g/L of the membrane by the graft chain containing 2-hydroxyethylamino and phenyl groups, respectively. A permeation pressure of 0.10 MPa provided a space velocity of 780 and 1500 h-1 for the α-amylase-immobilized EA and Ph fibers, respectively. Quantitative hydrolysis of starch during permeation of a 20 g/L starch solution in the buffer across the α-amylase-immobilized Ph fiber was attained up to a space velocity of about 2000 h-1; this was achieved because of negligible diffusional mass-transfer resistance of the starch to the α-amylase due to convective flow/ whereas an enzyme reaction-controlled system was observed for the α-amylase-immobilized EA fiber.

  14. Polyaniline-graphene based α-amylase biosensor with a linear dynamic range in excess of 6 orders of magnitude. (United States)

    Teixeira, Sofia Rodrigues; Lloyd, Catherine; Yao, Seydou; Andrea Salvatore Gazze; Whitaker, Iain S; Francis, Lewis; Conlan, R Steven; Azzopardi, Ernest


    α-amylase is an established marker for diagnosis of pancreatic and salivary disease, and recent research has seen a substantial expansion of its use in therapeutic and diagnostic applications for infection, cancer and wound healing. The lack of bedside monitoring devices for α-amylase detection has hitherto restricted the clinical progress of such applications. We have developed a highly sensitive α-amylase immunosensor platform, produced via in situ electropolymerization of aniline onto a screen-printed graphene support (SPE). Covalently binding an α-amylase specific antibody to a polyaniline (PANI) layer and controlling device assembly using electrochemical impedance spectroscopy (EIS), we have achieved a highly linear response against α-amylase concentration. Each stage of the assembly was characterized using a suite of high-resolution topographical, chemical and mechanical techniques. Quantitative, highly sensitive detection was demonstrated using an artificially spiked human blood plasma samples. The device has a remarkably wide limit of quantification (0.025-1000IU/L) compared to α-amylase assays in current clinical use. With potential for simple scale up to volume manufacturing though standard semiconductor production techniques and subsequently clinical application, this biosensor will enable clinical benefit through early disease detection, and better informed administration of correct therapeutic dose of drugs used to treat α-amylase related diseases. PMID:27196256

  15. Production and immobilization of alpha amylase using biotechnology techniques for use in biological and medical applications

    International Nuclear Information System (INIS)

    The immobilized enzymes on polymeric supports are prepared for purpose of repeated use and the possibilities of continuous reaction system. One of the most important properties is the stability of proteins when they are used in some medical and industrial applications. The immobilization of the enzymes improves this property as well as many other properties.In this study, alpha amylase was purified and immobilized onto two different polymers. α- amylase was used in this study for its biological and industrial applications. It is used in paper textile, pharmaceutical applications, food, and detergent industries. α- amylase was found in plants, animals, and microorganisms. Purification of α-amylase from microorganisms is the main source of α-amylase because it was excreted from many bacteria and fungi. In this study, α-amylase was purified from Aspergillus niger. Fractional precipitation of the α- amylase produced by A. niger with 80% ammonium sulphate saturation. The crude enzyme was applied on column chromatography packed with Sephadex G 100 for purification. The active eluents containing partially purified enzyme were collected for further investigation. The specific activity of α-amylase was (34.9 U/mg) which was corresponding to 2.09 fold purification for the tested organism. The purified α-amylase was immobilized by entrapment method into two types of polymers. One of them was natural consist of chitosan and alginate. The other polymer was synthetic consist of N- isopropyl acrylamide and alginate. The temperature optimum and thermal inactivation showed a severe loss in the activity of the free enzymes, while the temperature profile of the immobilized enzymes was much broader at higher temperatures demonstrating the effectiveness of the polymer protecting the enzymes. Also, the immobilized enzymes (natural polymer and synthetic polymer) showed higher thermal stability. Optimum ph and stability showed that immobilization of enzymes resulted in more

  16. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase (United States)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.


    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  17. The predominantly nonhydrolytic action of alpha amylases on alpha-maltosyl fluoride. (United States)

    Okada, G; Genghof, D S; Hehre, E J


    Crystalline alpha amylases from a number of sources utilized alpha-maltosyl fluoride as a glycosyl donor and acceptor at high rates (approximately 10 to approximately 1550 mumol/min/mg of protein, for 30 mM substrate). All enzymes catalyzed conversion of this compound into maltooligosaccharides in preference to causing its hydrolysis. Maltotetraosyl flouride and maltooligosaccharides of d.p. 3 to 6+ accounted for 75--93% (by weight) of early reaction-products. At a late stage, the yield of maltooligosaccharides was 2--5 times that of maltose, with chains as long as 12 D-glucosyl residues formed by one amylase (from Asp. oryzae), which utilized alpha-maltosyl fluoride as a donor and as an acceptor at extremely high rates. These results indicate that alpha amylases have a substantial capacity for binding two molecules of this small substrate in a distinctive way, with the C--F glycosylic bond of one and the free C-4 hydroxyl group of the other located in the region of the enzyme's catalytic groups, therby favoring glycosylation of the suitably positioned acceptor over solvent water. Hydrolysis is assumed to prevail when only a single substrate molecule or segment binds to alpha amylase with a (1 linked to 4)-alpha-D-glucosidic linkage of glycosylic C--F bond positioned at the catalytic center. The present demonstration that glycosyl-transfer reactions can be dominantly expressed by alpha amylases, given an appropriate substrate, illustrates the inadequacy of the usual characterization of these enzymes as hydrolases that produce overwhelming hydrolysis of all substrates.

  18. Are salivary amylase and pH – Prognostic indicators of cancers? (United States)

    Ramya, Atmakuri Shanmukha; Uppala, Divya; Majumdar, Sumit; Surekha, Ch.; Deepak, K.G.K.


    Background Saliva, “Mirror of body's health” has long been of particular interest as a substitute for blood for disease diagnosis and monitoring. The radiation effects on salivary glands are of particular interest in which salivary amylase is a good indicator of salivary glands function. Thus, estimation of these parameters represents a reasonable approach in evaluation of patient's risk for disease occurrence, intensity and prognosis. Aim of study To evaluate and compare the pH and amylase levels in saliva of cancer patients prior to treatment, patients during treatment. Materials and methods Saliva samples of 90 individuals were taken which were divided into 3 groups - 30 individuals without cancer, 30 cancer patients prior treatment and 30 cancer patients during treatment. Materials used were pH strips and pH meter, Salivary Amylase assay. Results Statistical analysis – ANOVA with post-hoc Tukey's test. 1) Significant decrease in salivary amylase levels – in cancer patients, during treatment when compared to others. 2) Significant decrease in salivary pH levels in newly diagnosed cancer patients prior to treatment. Conclusion To conclude, pH strips and pH meter showed to be a useful tool in the measurement of pH of saliva in individuals with and without cancer. This study showed that cancer patients without treatment have a lower pH of saliva. Treatment increased the pH of the saliva to a more alkaline level whereas amylase levels decreased in those subjects. Therefore those parameters can be an area of further research with an increased sample size, which in-turn may help in opening the doors for new dimension in non invasive prognostic markers. PMID:26258019

  19. Remarkable evolutionary relatedness among the enzymes and proteins from the α-amylase family. (United States)

    Janeček, Štefan; Gabriško, Marek


    The α-amylase is a ubiquitous starch hydrolase catalyzing the cleavage of the α-1,4-glucosidic bonds in an endo-fashion. Various α-amylases originating from different taxonomic sources may differ from each other significantly in their exact substrate preference and product profile. Moreover, it also seems to be clear that at least two different amino acid sequences utilizing two different catalytic machineries have evolved to execute the same α-amylolytic specificity. The two have been classified in the Cabohydrate-Active enZyme database, the CAZy, in the glycoside hydrolase (GH) families GH13 and GH57. While the former and the larger α-amylase family GH13 evidently forms the clan GH-H with the families GH70 and GH77, the latter and the smaller α-amylase family GH57 has only been predicted to maybe define a future clan with the family GH119. Sequences and several tens of enzyme specificities found throughout all three kingdoms in many taxa provide an interesting material for evolutionarily oriented studies that have demonstrated remarkable observations. This review emphasizes just the three of them: (1) a close relatedness between the plant and archaeal α-amylases from the family GH13; (2) a common ancestry in the family GH13 of animal heavy chains of heteromeric amino acid transporter rBAT and 4F2 with the microbial α-glucosidases; and (3) the unique sequence features in the primary structures of amylomaltases from the genus Borrelia from the family GH77. Although the three examples cannot represent an exhaustive list of exceptional topics worth to be interested in, they may demonstrate the importance these enzymes possess in the overall scientific context. PMID:27154042

  20. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.


    Uozumi, N; Sakurai, K.(Theoretical Particle Physics and Cosmology Group, Department of Physics, King’s College London, WC2R 2LS, London, UK); Sasaki, T.; Takekawa, S.; Yamagata, H; Tsukagoshi, N; Udaka, S


    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...

  1. Mutational analysis of target enzyme recognition of the beta-trefoil fold barley alpha-amylase/subtilisin inhibitor

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine; Nielsen, Per K.; Abou Hachem, Maher;


    The barley alpha-amylase/subtilisin inhibitor ( BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics of...

  2. [The amylase-creatinine clearance ratio in the differential diagnosis of pancreatitis and gastroduodenal ulcer with hyperamylasemia]. (United States)

    Pezzangora, V; Della Dora, R; Pagliarini, A; Dell'Olivo, I


    The Authors followed 29 patients, hospitaled with a diagnosis of pancreatitis. They all presented the same sympotomatology and a considerable increase of the serum amylase ad urinary amylase. The examination of the ratio between the clearance of amylasis and creatinine permitted to make a differential diagnosis for 8 cases (4rd group) that were nothing but peptic ulcera. Such a diagnosis was confirmed by the radiological contrastographic examination or by the intraoperative report. So if the ratio between the clearance of amylase and creatinine is normal we must think about a pathological situation were the iperamylasemia has a pathogenetic cause different from pancreatitis.

  3. Purification and Characterization of a Maltotetraose-Forming Alkaline (alpha)-Amylase from an Alkalophilic Bacillus Strain, GM8901


    Kim, T U; Gu, B. G.; Jeong, J Y; Byun, S. M.; Shin, Y. C.


    An alkalophilic bacterium, Bacillus sp. strain GM8901, grown at pH 10.5 and 50(deg)C, produced five alkaline amylases in culture broth. At an early stage of the bacterial growth, amylase I (Amyl I) was produced initially and then, as cultivation progressed, four alkaline amylases, Amyl II, Amyl III, Amyl IV, and Amyl V, were produced from proteolytic degradation of Amyl I. A serine protease present in the culture medium was believed to be involved in Amyl I degradation. We purified Amyl I fro...

  4. A rapid response of beta-amylase to nitric oxide but not gibberellin in wheat seeds during the early stage of germination. (United States)

    Zhang, Hua; Shen, Wen-Biao; Zhang, Wei; Xu, Lang-Lai


    The effects of nitric oxide (NO) and gibberellic acid (GA(3)) on the responses of amylases in wheat (Triticum aestivum L.) seeds (caryopses) were investigated during the first 12 h of germination. GA(3) had no effects on the activities of alpha-amylase (EC or beta-amylase (EC, either in intact seeds or embryoless halves within 12 h. In contrast, addition of sodium nitroprusside (SNP), an NO donor, was able to induce a rapid increase in beta-amylase activity without affecting alpha-amylase. Furthermore, the rapid response of beta-amylase to SNP in wheat seeds could be attributed to NO and was approximately dose-dependent. Some other aspects of SNP induction of amylase isozymes were also characterized. Further investigations showed that SNP might play an interesting role in the dissociation of free beta-amylase from small homopolymers or heteropolymers. Furthermore, SNP also directly induced the release of bound beta-amylase from glutenin and its crude enzyme preparation. However, the slight increase in protease also induced by SNP might not be responsible for this action. Interestingly, based on the fact that the rapid response of beta-amylase to NO also existed in seeds of other species, such as barley, soybean, rice and watermelon, it might be a universal event in early seed germination. PMID:15517355


    International Nuclear Information System (INIS)

    Amylases are one of the most important and oldest industrial enzymes. The optimization of production of α -amylase from Aspergillus niger and Aspergillus oryzae fungi, using different agro-wastes as sole carbon sources, was performed. The highest productivity of α -amylase by the two organisms was recorded at pH 6 and incubation temperature at 300C when the two organisms were grown on potato peels (PPs) and/or wheat straw (Ws) after days of cultivation. Pre-treated PPs and Ws with 20 kGy gave the best enzyme productivity by the two organisms compared with untreated ones. Also, exposing the inoculums of A. niger and A.oryzae to 0.5 and 0.75 kGy, respectively, led to enhancement of α-amylase to 48 and 46 μ/ml, respectively

  6. [Amylase in the mixed saliva of diabetics and nondiabetics on an empty stomach and during the glucose tolerance test]. (United States)

    Fekete, Z; Gol'denberg, A; Lukach, I; Korets, R; Shval'b, O; Platilova, G; Bandura, A


    The catalytic activity of alpha-amylase is significantly elevated in salivary pool from 146 diabetics (2176 +/- 149.3 mu catal.l-1) vs. the salivary pool from 78 nondiabetics (1159 +/- 97.3 mu catal X l-1), the difference in the concentrations of the saliva condensation index (the chloride concentration) in the diabetics and nondiabetics being negligible. Glucose tolerance test has been carried out in 54 subjects. Glucose intake has increased the alpha-amylase catalytic activity and augmented glycosialia in 14 diabetics, in 13 subjects with abnormal glucose tolerance, and in 16 nondiabetics; a negligible rise of glycosialia and a reduction of alpha-amylase catalytic activity have been observed in 11 subjects with a flat glycemia curve. Basing on these data, the authors claim that oral glucose activates amylase and glucose secretion by the salivary glands. PMID:2481117

  7. Fermentation Kinetics of Media Optimization for the Production of Alpha Amylase by a New Isolate of Aspergillus Oryzae

    Institute of Scientific and Technical Information of China (English)

    Ikram-ul-Haq; Roheena Abdullah; Hamid Mukhtar; Muhammad Nauman Aftab


    The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested,Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35. Kinetic analysis revealed that the values of product yield coefficient (Yp/x) and specific product yield coefficient( qp ) were found highly significant (p ≤ 0.05 ) when medium M1 was used for the enzyme production.

  8. Downregulation of chloroplast-targeted beta-amylase leads to a starch-excess phenotype in leaves

    DEFF Research Database (Denmark)

    Scheidig, A.; Fröhlich, A.; Schulze, S.;


    A functional screen in Escherichia coli was established to identify potato genes coding for proteins involved in transitory starch degradation. One clone isolated had a sequence very similar to a recently described chloroplast-targeted 5-amylase of Arabidopsis. Expression of the gene in E. coli...... showed that the protein product was a functional beta-amylase that could degrade both starch granules and solubilized amylopectin, while import experiments demonstrated that the beta-amylase was imported and processed into pea chloroplasts. To study the function of the protein in transitory starch...... degradation, transgenic potato plants were generated where its activity was reduced using antisense techniques. Analysis of plants reduced in the presence of this beta-amylase isoform showed that their leaves had a starch-excess phenotype, indicating a defect in starch degradation. In addition, it was shown...

  9. 大豆β-淀粉酶和大麦β-淀粉酶糖化特性的比较%Comparison of Enzymatic Properties of the Soybean β-amylase and Barley β-amylase

    Institute of Scientific and Technical Information of China (English)



    In this paper, the activity of the soybean β-amylase and barley β-amylase were compared under the conditions of the existing saccharification for producing maltose. The impact of low pH and high temperature on the activity of the two enzymes were studied The results showed that 1.2 dosage of soybeanβ-amylase and 1 dosage of the barley β-amylase has the same maltose throughput, and the soybean β-amylase is more suitable for low pH and high temperature condition compared to soybean β-amylase.%本实验参照淀粉糖车间现有糖化工艺条件,对大豆β-淀粉酶和正在使用的大麦β-淀粉酶糖化能力及两种酶的低pH和高温的耐受性进行了对比研究.结果显示大豆β-淀粉酶添加量为大麦淀粉酶的1.2倍时与其有等效的麦芽糖生产能力,且大豆β-淀粉酶比大麦β-淀粉酶对低pH和高温有更好的耐受性.

  10. Isolation, purification and characterization of β-amylase from Dioscorea hispida Dennst (United States)

    Oktiarni, Dwita; Lusiana, Simamora, Febri Yanti; Gaol, Jusni M. Lumban


    β-amylase (E.C is an enzyme commonly found in plants and bacteria. The enzyme is an exo-acting carbohydrolase which hydrolyzes α-1.4-glucosidic linkages of starch, removing maltose units from the non-reducing end of the polysaccharide chain, producing β-maltose and β-limit dextrin as the final product. β-amylase is widely distributed in the higher plants such as sweet potato. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-stalling agents in baking. This enzyme was extracted from Dioscorea hispida Dennst in 0.05 M acetate buffer pH 4.8 and followed by ammonium sulfate fractionation at cold temperature (10°C). Ammonium sulfate fractionation was shared into fraction of 0-60%, 60-70%, 70-80% and 80-100%. The fraction containing high of specific activity (determined by Somogyi-Nelson and Lowry methods) was futher purified by dialysis. Fraction with high enzyme activity of β-amylase were fraction 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst were 1.32 and 1.55 mg protein-1.minute-1, whereas specific activity of crude extract enzyme was 0.21 mg protein-1.minute-1. After purified with dialysis, fraction with high enzyme activity of β-amylase were fraction of 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst was 2.72 and 4.24 mg protein-1.minute-1. The purified Dioscorea hispida Dennst β-amylase from dialysis showed increasing in spesific activity the crude enzyme as much as 24 folds. The characterization of enzyme showed that Dioscorea hispida Dennst derived enzyme had optimum pH of 5.5 and temperature of 70°C. The kinetic parameters of purified Dioscorea hispida Dennst β-amylase showed that the KMapp, Vmaxapp value and Hill constant were 0.0211 mg/ml, 9.63 mg sugar.minute-1 and 1.34, respectively.

  11. Phospholipase A2 as a point of care alternative to serum amylase and pancreatic lipase (United States)

    Liu, Nathan J.; Chapman, Robert; Lin, Yiyang; Bentham, Andrew; Tyreman, Matthew; Philips, Natalie; Khan, Shahid A.; Stevens, Molly M.


    Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to serve as high lipase (n = 20), CA19-9 positive (n = 15), and healthy (n = 20) controls. sPLA2-IB concentration correlated well with the serum activity of both amylase and lipase, and performed at least as well as either markers in the differentiation of pancreatitis from controls.Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to

  12. α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest

    Directory of Open Access Journals (Sweden)

    Oliveira-Neto Osmundo B


    Full Text Available Abstract Background Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei, is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an α-amylase inhibitor gene (α-AI1, which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. Results We transformed C. arabica with the α-amylase inhibitor-1 gene (α-AI1 from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L. The presence of the α-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against α-AI1 inhibitor showed a maximum α-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the α-AI1 protein against H. hampei α-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. Conclusions This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee.

  13. Comparative study of alpha amylase inhibitory activity of flavonoids of Vitex negundo Linn. and Andrographis paniculata Nees


    Keerti Gautam; Padma Kumar; Chitra Jain


    Background: One important therapeutic approach for the treatment of Type 2 Diabetes Mellitus is by decreasing the postprandial increase of glucose. This is possible by inhibiting certain carbohydrate hydrolyzing enzymes like alpha-amylase. Aim: The objective of the present study was to evaluate the alpha amylase inhibitory activity of flavonoids extracts of different parts of Vitex negundo Linn and Andrographis paniculata Nees. Materials and Methods: In the present study, the percentage inhib...

  14. The Effect of a Brief Salivary α-Amylase Exposure During Chewing on Subsequent in Vitro Starch Digestion Curve Profiles


    Brennan, Charles S.; Woolnough, James W.; Bird, Anthony R.; Monro, John A.


    There is inconsistency between current in vitro digestion methods with regard to accommodation of a (salivary) α-amylase exposure during the oral phase. The effect of a salivary α-amylase pre-exposure on subsequent in vitro starch digestion curve profiles for various foods was investigated. Foods were chewed, expectorated and the boluses left to rest for 0–15 min. During pancreatic digestion, aliquots were taken and hydrolysis curves constructed for comparison against those of the same foods ...

  15. Normative references of heart rate variability and salivary alpha-amylase in a healthy young male population


    Kobayashi Hiromitsu; Park Bum-Jin; Miyazaki Yoshifumi


    Abstract Background This study aimed to present normative reference values of heart rate variability and salivary alpha-amylase in a healthy young male population with a particular focus on their distribution and reproducibility. Methods The short-term heart rate variability of 417 young healthy Japanese men was studied. Furthermore, salivary alpha-amylase was measured in 430 men. The average age of the subjects were 21.9 years with standard deviation of 1.6 years. Interindividual variations ...

  16. Inheritance of a Parotid Secretory Protein in Mice and Its Use in Determining Salivary Amylase Quantitative Variants


    Owerbach, David; Hjorth, J. Peter


    Among inbred strains of mice, a major protein, PSP, produced and secreted by the parotid glands, shows variation in electrophoretic mobility and in the peptides produced by cyanogen bromide treatment. This variation is inherited as a single Mendelian factor with two alleles showing co-dominant expression. In genetic crosses, it segregates independently from the amylase complex and is closely linked to the agouti locus on chromosome 2. The protein ratios between amylase and PSP in saliva, obta...

  17. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222


    Shalini Singh; Sahibjot Kaur Cheema; Bineypreet Kaur,; Navreet Kaur Mann


    Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best o...

  18. The Construction of the Probe for Amylase Ⅱ Gene Cloning from Bacillus halodurans Strain 38C1-1

    Institute of Scientific and Technical Information of China (English)


    Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Thermus sp. IM6501, B. stearothermophilus ET-1, and B. acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.

  19. Amylase level in extrahepatic bile duct in adult patients with choledochal cyst plus anomalous pancreatico-biliary ductal union

    Institute of Scientific and Technical Information of China (English)

    In-Ho Jeong; Jin-Hong Kim; Jae-Ho Han; Wook-Hwan Kim; Yong-Sik Jung; Hong Kim; Bong-Wan Kim; Jung-Woon Kim; Jeong Hong; Hee-Jung Wang; Myung-Wook Kim; Byung-Moo Yoo


    AIM: To investigate the relationship between pancreatic amylase in bile duct and the clinico-pathological features in adult patients with choledochal cyst and anomalous pancreatico-biliary ductal union (APBDU).METHODS: From 39 patients who underwent surgery for choledochal cyst between March 1995 and March 2003,we selected 15 adult patients who had some symptoms and were radiologically diagnosed as APBDU, and their clinico-pathological features were subsequently evaluated retrospectively. However, we could not obtain biliary amylase in all the patients because of the surgeon's slip.Therefore, we measured the amylase level in gall bladder of 10 patients and in common bile duct of 11 patients.RESULTS: Levels of amylase in common bile duct and gall bladder ranged from 11 500 to 212 000 IU/L, and the younger the patients, the higher the biliary amylase level (r= -0.982, P<0.01). Pathologically, significant correlation was found between the size of choledochal cyst and the grade of inflammation (r= 0.798,P<0.01). And, significant correlation was found between the level of amylase in gall bladder and the grade of hyperplasia. On the other hand, there was no correlation to the age of symptomatic onset or inflammatory grade (r = 0.743, P<0.05). Level of lipase was elevated from 6 000 to 159 000 IU/L in bile duct and from 14 400 to 117 000 IU/L in the gall bladder;however, there was no significant correlation with age or clinico-pathological features.CONCLUSION: The results support the notion that amylase has a particular role in the onset of symptoms, and suggest that a large amount of biliary amylase induces early onset of symptom, thereby making early diagnosis possible.

  20. Growth temperature of different local isolates of Bacillus sp. in the solid state affects production of raw starch digesting amylases

    Directory of Open Access Journals (Sweden)

    Šokarda-Slavić Marinela


    Full Text Available Natural amylase producers, wild type strains of Bacillus sp., were isolated from different regions of Serbia. Strains with the highest amylase activity based on the starch-agar plate test were grown on solid-state fermentation (SSF on triticale. The influence of the substrate and different cultivation temperature (28 and 37°C on the production of amylase was examined. The tested strains produced α-amylases when grown on triticale grains both at 28 and at 37°C, but the activity of amylases and the number and intensity of the produced isoforms were different. Significant hydrolysis of raw cornstarch was obtained with the Bacillus sp. strains 2B, 5B, 18 and 24B. The produced α-amylases hydrolyzed raw cornstarch at a temperature below the temperature of gelatinization, but the ability for hydrolysis was not directly related to the total enzyme activity, suggesting that only certain isoforms are involved in the hydrolysis. [Projekat Ministarstva nauke Republike Srbije, br. 172048

  1. Chloride Activated Halophilic α-Amylase from Marinobacter sp. EMB8: Production Optimization and Nanoimmobilization for Efficient Starch Hydrolysis

    Directory of Open Access Journals (Sweden)

    Sumit Kumar


    Full Text Available Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Present work encompasses production optimization and nanoimmobilization of an α-amylase from moderately halophilic Marinobacter sp. EMB8. Media ingredients and culture conditions were optimized by “one-at-a-time approach.” Starch was found to be the best carbon source at 5% (w/v concentration. Glucose acted as catabolic repressor for amylase production. Salt proved critical for amylase production and maximum production was attained at 5% (w/v NaCl. Optimization of various culture parameters resulted in 48.0 IU/mL amylase production, a 12-fold increase over that of unoptimized condition (4.0 IU/mL. α-Amylase was immobilized on 3-aminopropyl functionalized silica nanoparticles using glutaraldehyde as cross-linking agent. Optimization of various parameters resulted in 96% immobilization efficiency. Starch hydrolyzing efficiency of immobilized enzyme was comparatively better. Immobilized α-amylase retained 75% of its activity after 5th cycle of repeated use.

  2. Estimation of salivary amylase and total proteins in leukemia patients and its correlation with clinical feature and radiographic finding

    Directory of Open Access Journals (Sweden)

    Ashok L


    Full Text Available Background: Leukemia is a fatal disease. The oral manifestations of the leukemias occur early in the course of the disease and these oral features can at times act as a diagnostic indicator. Saliva has been used as a diagnostic aid in a number of systemic diseases. Materials and Methods: In our study, samples of unstimulated saliva of 30 leukemia patients who were not on chemotherapy were collected and analyzed for salivary amylase and total protein. The oral manifestations and radiographic changes (OPG were recorded. The correlation between the oral manifestations and the salivary components (salivary amylase and total protein was assessed for prognostic significance. Results: In the present study when the mean values of salivary amylase (1280±754 U/ml and total protein (647.2±320.7 mg% were compared with that in control subjects. There was a statistically significant difference for amylase levels (P<.05. On intraoral examination the study subjects showed pallor, gingivitis, gingival enlargement, petechiae, and ecchymosis. On the OPG, the radiographic features included generalized rarefaction of bone (20%, thinning of lamina dura (3.4%, generalized alveolar crest bone resorption (30%, thinning of walls of alveolar crypts (6.7%, besides others, e.g., periapical abscess (10%. Conclusions: The saliva of leukemic patients demonstrated obvious changes in composition. A rise in salivary amylase and total protein levels was evident, with the increase in amylase levels being statistically significant.

  3. Supplementation of Carbohydrate to Enhance the α-amylase Production by Bacillus licheniformis ATCC 6346 in Presence of Seed Cakes

    Directory of Open Access Journals (Sweden)

    Vengadaramana, A.


    Full Text Available Aims: The effect of carbohydrate and amino acids on the production of a-amylase by Bacillus licheniformis ATCC 6346 was investigated. Methodology and results: To find out the influence of carbohydrate the total carbohydrate content of the medium containing different concentration (2-18 g/L of defatted seed cake powder of sesamum and mustard containing medium was kept constant by the addition of soluble starch separately. The highest a-amylase activity obtained in the medium containing 18g/L mustard (59.11+b1.48 U/mL and sesamum seed cake powder (55.23+b1.55 U/mL. The results indicated that under these conditions the carbohydrate content had no effect on the production of a-amylase. Effect of amino acids (0.2g/L of glycine, methionine, proline, lysine, leucine, threonine, serine, arginine, alanine, glutamic acid, tryptophan, glutamine, asparagine, histidine, valine, phenylalanine, isoleucine and mixture of amino acids on the production of a-amylase in fermentation medium was investigated. Among the different amino acids supplemented, eight amino acids improved the a-amylase production but casaminoacids slightly inhibited the enzyme production. In presence of tryptophan highest enzyme activity was obtained than control. Conclusion, significance and impact of study: In these study amino acids especially tryptophan takes part in a particular role rather than carbohydrate in the production of a-amylase from B. licheniformis ATCC 6346.

  4. Control of α-amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    International Nuclear Information System (INIS)

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA3) with or without 5 millimolar CaCl2 shows that α-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca2+. No difference was observed in α-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA3 with 5 millimolar CaCl2 and layers incubated in GA3 alone. RNA isolated from layers incubated for 12 hours in GA3 with and without CA2+. A cDNA clone for α-amylase was isolated and used to measure α-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca2+ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca2+ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for α-amylase synthesized in Ca2+-deprived aleurone layers was translatable. Ca2+ is required for the synthesis of α-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing

  5. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    Energy Technology Data Exchange (ETDEWEB)

    Deikman, J.; Jones, R.L.


    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  6. Primer extension studies on alpha-amylase mRNAs in barley aleurone. II. Hormonal regulation of expression. (United States)

    Chandler, P M; Jacobsen, J V


    Relative levels of different alpha-amylase mRNAs were assessed by primer extension experiments using RNA prepared from aleurone of barley (Hordeum vulgare L. cv. Himalaya). Three different aleurone systems were studied: protoplasts prepared from aleurone layers, isolated aleurone layers, and aleurone from germinated grain. Oligonucleotide primers specific for the low-pI and high-pI alpha-amylase groups allowed the levels of different alpha-amylase mRNAs to be assessed both within and between the two groups. In all aleurone systems the same set of alpha-amylase mRNAs was produced in response to either applied gibberellic acid (aleurone protoplasts, isolated aleurone layers) or, presumably, native gibberellin(s) (germinated grain). This result indicates that the same set of genes is being expressed in each case. Differences were observed between the different aleurone systems in regulation of levels of alpha-amylase mRNAs. In particular, the regulation of alpha-amylase mRNA levels in aleurone of germinated grain has unique features which are not adequately explained by the response of isolated aleurone layers to gibberellic acid.

  7. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey


    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  8. Amylase production by solid-state fermentation of agro-industrial wastes using Bacillus sp.

    Directory of Open Access Journals (Sweden)

    Rajshree Saxena


    Full Text Available Solid state fermentation was carried out using various agro- industrial wastes with the best amylase producing strain isolated from soil. Different physicochemical conditions were varied for maximum enzyme production. The strain produced about 5400 units/g of amylase at 1:3 moisture content, 20% inoculum, after 72 h of incubation with Mustard Oil seed cake as the substrate. The optimum temperature and pH of the enzyme activity were found to be 50ºC and 6 respectively. The enzyme was found to be thermostable at 70ºC for about 2 h without any salt. It showed stability at pH range 5-7. The metal ions as Na+, Ca++, Mg++ and Co++ enhanced the enzyme activity.

  9. Low copy number of the salivary amylase gene predisposes to obesity. (United States)

    Falchi, Mario; El-Sayed Moustafa, Julia Sarah; Takousis, Petros; Pesce, Francesco; Bonnefond, Amélie; Andersson-Assarsson, Johanna C; Sudmant, Peter H; Dorajoo, Rajkumar; Al-Shafai, Mashael Nedham; Bottolo, Leonardo; Ozdemir, Erdal; So, Hon-Cheong; Davies, Robert W; Patrice, Alexandre; Dent, Robert; Mangino, Massimo; Hysi, Pirro G; Dechaume, Aurélie; Huyvaert, Marlène; Skinner, Jane; Pigeyre, Marie; Caiazzo, Robert; Raverdy, Violeta; Vaillant, Emmanuel; Field, Sarah; Balkau, Beverley; Marre, Michel; Visvikis-Siest, Sophie; Weill, Jacques; Poulain-Godefroy, Odile; Jacobson, Peter; Sjostrom, Lars; Hammond, Christopher J; Deloukas, Panos; Sham, Pak Chung; McPherson, Ruth; Lee, Jeannette; Tai, E Shyong; Sladek, Robert; Carlsson, Lena M S; Walley, Andrew; Eichler, Evan E; Pattou, Francois; Spector, Timothy D; Froguel, Philippe


    Common multi-allelic copy number variants (CNVs) appear enriched for phenotypic associations compared to their biallelic counterparts. Here we investigated the influence of gene dosage effects on adiposity through a CNV association study of gene expression levels in adipose tissue. We identified significant association of a multi-allelic CNV encompassing the salivary amylase gene (AMY1) with body mass index (BMI) and obesity, and we replicated this finding in 6,200 subjects. Increased AMY1 copy number was positively associated with both amylase gene expression (P = 2.31 × 10(-14)) and serum enzyme levels (P 9) and bottom (copy number < 4) 10% of the copy number distribution. Our study provides a first genetic link between carbohydrate metabolism and BMI and demonstrates the power of integrated genomic approaches beyond genome-wide association studies. PMID:24686848

  10. Functionalized graphene sheets as immobilization matrix for Fenugreek β-amylase: enzyme kinetics and stability studies.

    Directory of Open Access Journals (Sweden)

    Garima Srivastava

    Full Text Available β-Amylase finds application in food and pharmaceutical industries. Functionalized graphene sheets were customised as a matrix for covalent immobilization of Fenugreek β-amylase using glutaraldehyde as a cross-linker. The factors affecting the process were optimized using Response Surface Methodology based Box-Behnken design of experiment which resulted in 84% immobilization efficiency. Scanning and Transmission Electron Microscopy (SEM, TEM and Fourier Tansform Infrared (FTIR spectroscopy were employed for the purpose of characterization of attachment of enzyme on the graphene. The enzyme kinetic studies were carried out for obtaining best catalytic performance and enhanced reusability. Optimum temperature remained unchanged, whereas optimum pH showed shift towards acidic range for immobilized enzyme. Increase in thermal stability of immobilized enzyme and non-toxic nature of functionalized graphene can be exploited for production of maltose in food and pharmaceutical industries.

  11. Componential Profile and Amylase Inhibiting Activity of Phenolic Compounds from Calendula officinalis L. Leaves

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov


    Full Text Available An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6′-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6′′-acetyl-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase.


    Directory of Open Access Journals (Sweden)

    R. Vadivelan et al


    Full Text Available Herbal medicine has been used for many years by different cultures around the world for the treatment of diabetes. There has been an enormous interest in the development of alternative medicines for type 2 diabetes, specifically screening for phytochemicals with the ability to delay or prevent glucose absorption. The goal of the present study is to evaluate the invitro antidiabetic activity of Raphanus sativus ethanolic extract and fractions by α-glucosidase and α -amylase inhibitory activity. Raphanus sativus ethanolic extract and fractions showed dose dependent inhibition of α-glucosidase and α -amylase enzyme and exhibited lower inhibitory activity than acarbose. The study revealed the antidiabetic potential and could be helpful to develop medicinal preparations and nutraceuticals and function foods for diabetes.

  13. Serum α-amylase and radioinduced changes in the parotid salivary glands

    International Nuclear Information System (INIS)

    Using the inhibitory chromogenic method of O'Donel et al. the authors determined α-amylase and salivary isoenzyme activities in 30 patients with oncologic diseases (19 men and 11 women), 14 to 71 years of age, with localized tumors in the epipharynx, tonsils, hypopharynx, maxillary sinuses, lingual base, in whom the two parotid salivary glands had come within the range of the external beam gamma-therapy at different involvement degree. Measurements were performed within the 30-40 Gy interval, and the results were compared with those in a control group of normal subjects. There was increase in total amylase and salivary isomerase activities, mostly when 100% of the parotid glands had been involved. This is a sound reason for clinical search of radioinduced changes in the glands

  14. Response surface methodology for the optimization of alpha amylase production by serratia marcescens SB08

    International Nuclear Information System (INIS)

    In this work, central composite design combining with response surface methodology was successfully employed to optimize medium composition for the production of alpha amylase by Serratia marcescens SB08 in submerged fermentation. The process parameters that influence the enzyme production were identified using Plackett- Burman design. Among the various factors screened, inoculum concentration, pH, NaCl and CaCl/sub 2/ were found to be most significant. The optimum level of pH was 5.0, inoculum concentration 3%, NaCl 0.30 g/l and CaCl/sub 2/ 0.13 g/l. The actual enzyme yield before and after optimization was 56.43 U/ml and 87.23 U/ml, respectively. Thus, it is advisable to the microbial industry sponsors to apply such profitable bioprocess to maintain high yield for mass production of alpha amylase. (author)

  15. Amylase production in solid state fermentation by the thermophilic fungus Thermomyces lanuginosus. (United States)

    Kunamneni, Adinarayana; Permaul, Kugen; Singh, Suren


    The production of extracellular amylase by the thermophilic fungus Thermomyces lanuginosus was studied in solid state fermentation (SSF). Solid substrates such as wheat bran, molasses bran, rice bran, maize meal, millet cereal, wheat flakes, barley bran, crushed maize, corncobs and crushed wheat were studied for enzyme production. Growth on wheat bran gave the highest amylase activity. The maximum enzyme activity obtained was 534 U/g of wheat bran under optimum conditions of an incubation period of 120 h, an incubation temperature of 50 degrees C, an initial moisture content of 90%, a pH of 6.0, an inoculum level of 10% (v/w), a salt solution concentration of 1.5:10 (v/w) and a ratio of substrate weight to flask volume of 1:100 with soluble starch (1% w/w) and peptone (1% w/w) as supplements. PMID:16198259

  16. Evolution of serum amylase, lipase and immunoreactive trypsin during pancreatitis attacks. (United States)

    Courtois, P; Art, G; Vertongen, F; Franckson, J R


    The characteristics of the blood curves of alpha-amylase (SA), pancreatic lipase (SL) and immunoreactive trypsin (SIT) have been analyzed in a series of patients daily explored throughout the evolution of pancreatitis attacks; urines were also collected to estimate the amylase-creatinine clearance ratio (ACCR). The following results were obtained. a). The 3 enzymes profiles ran roughly parallel during an acute attack. b). SL rose far higher than SA at the onset of the attack but its decay displayed a shorter half-life than the latter; these features resulted in an absence of systematic difference between their times of return to normal levels at the end of the attack. c). SIT more closely correlated with SL than with SA. d). In common hospital practice, simultaneous SA and SL determinations were proving a more reliable help to diagnose pancreatitis attack than ACCR. PMID:3878108

  17. Activity of α-amylase and its isoenzymes in the blood and the saliva in the radiochemotherapy of head and neck tumours

    International Nuclear Information System (INIS)

    The activity of α-amylase in the saliva is significantly higher in patients with head and neck tumours than in the saliva of healthy persons. Initial radiation doses lead to hyperamylasemia and, at the same time, to a statistically significant increase in the α-amylase activity in the saliva. After the end of radiotherapy, or rather radiochemotherapy, there was a statistically significant decrease of the α-amylase activity in the serum and saliva. Application of monochemotherapy did not bring about any significant changes in the activity of α-amylase in the serum and saliva. A good correlation was observed between the decrease in the α-amylase activity in the serum and saliva and postactinic hyposialosis and mucositis. After a temporary escalation radiotherapy and radiochemotherapy are followed by a significant decrease in the percentual representation of a sialoisoenzyme of α-amylase in the serum. (author)

  18. Componential Profile and Amylase Inhibiting Activity of Phenolic Compounds from Calendula officinalis L. Leaves


    Olennikov, Daniil N.; Nina I. Kashchenko


    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6′-O-vanilloyl- β -D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. Th...

  19. Componential Profile and Amylase Inhibiting Activity of Phenolic Compounds from Calendula officinalis L. Leaves


    Olennikov, Daniil N.; Nina I. Kashchenko


    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6′-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The ...

  20. Chylous ascites secondary to hyperlipidemic pancreatitis with normal serum amylase and lipase


    Khan, Fahmi Yousef; Matar, Issa


    A 54-year old man with a family history of hyperlipidemia was admitted with a 12 h history of severe generalized abdominal pain associated with nausea, vomiting and abdominal distension. Examination of the abdomen revealed tenderness in the periumblical area with shifting dullness. Serum pancreatic amylase was 29 IU/L and lipase 44 IU/L, triglyceride 36.28 mmol/L. Ultrasound showed ascites. CT of the abdomen with contrast showed inflammatory changes surrounding the pancreas consistent with ac...

  1. Evaluation of Traditional Indian Antidiabetic Medicinal Plants for Human Pancreatic Amylase Inhibitory Effect In Vitro

    Directory of Open Access Journals (Sweden)

    Sudha Ponnusamy


    Full Text Available Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post prandial hyperglycemia via control of starch breakdown. Eleven Ayurvedic Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evaluate their inhibitory potential on pancreatic α-amylase. Analysis of 91 extracts, showed that 10 exhibited strong Human Pancreatic Amylase (HPA inhibitory potential. Of these, 6 extracts showed concentration dependent inhibition with IC50 values, namely, cold and hot water extracts from Ficus bengalensis bark (4.4 and 125 μgmL-1, Syzygium cumini seeds (42.1 and 4.1 μgmL-1, isopropanol extracts of Cinnamomum verum leaves (1.0 μgmL-1 and Curcuma longa rhizome (0.16 μgmL-1. The other 4 extracts exhibited concentration independent inhibition, namely, methanol extract of Bixa orellana leaves (49 μgmL-1, isopropanol extract from Murraya koenigii leaves (127 μgmL-1, acetone extracts from C. longa rhizome (7.4 μgmL-1 and Tribulus terrestris seeds (511 μgmL-1. Thus, the probable mechanism of action of the above fractions is due to their inhibitory action on HPA, thereby reducing the rate of starch hydrolysis leading to lowered glucose levels. Phytochemical analysis revealed the presence of alkaloids, proteins, tannins, cardiac glycosides, flavonoids, saponins and steroids as probable inhibitory compounds.

  2. Evaluation of traditional Indian antidiabetic medicinal plants for human pancreatic amylase inhibitory effect in vitro. (United States)

    Ponnusamy, Sudha; Ravindran, Remya; Zinjarde, Smita; Bhargava, Shobha; Ravi Kumar, Ameeta


    Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post prandial hyperglycemia via control of starch breakdown. Eleven Ayurvedic Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evaluate their inhibitory potential on pancreatic α-amylase. Analysis of 91 extracts, showed that 10 exhibited strong Human Pancreatic Amylase (HPA) inhibitory potential. Of these, 6 extracts showed concentration dependent inhibition with IC(50) values, namely, cold and hot water extracts from Ficus bengalensis bark (4.4 and 125 μgmL(-1)), Syzygium cumini seeds (42.1 and 4.1 μgmL(-1)), isopropanol extracts of Cinnamomum verum leaves (1.0 μgmL(-1)) and Curcuma longa rhizome (0.16 μgmL(-1)). The other 4 extracts exhibited concentration independent inhibition, namely, methanol extract of Bixa orellana leaves (49 μgmL(-1)), isopropanol extract from Murraya koenigii leaves (127 μgmL(-1)), acetone extracts from C. longa rhizome (7.4 μgmL(-1)) and Tribulus terrestris seeds (511 μgmL(-1)). Thus, the probable mechanism of action of the above fractions is due to their inhibitory action on HPA, thereby reducing the rate of starch hydrolysis leading to lowered glucose levels. Phytochemical analysis revealed the presence of alkaloids, proteins, tannins, cardiac glycosides, flavonoids, saponins and steroids as probable inhibitory compounds. PMID:20953430

  3. Salivary alpha-amylase and cortisol responsiveness following electrically stimulated physical stress in bipolar disorder patients


    Tanaka Y; Maruyama Y; Ishitobi Y; Kawano A; Ando T; Ikeda R; Inoue A.; Imanaga J; Okamoto S.; Kanehisa M; Ninomiya T; Tsuru J; Akiyoshi J


    Yoshihiro Tanaka, Yoshihiro Maruyama, Yoshinobu Ishitobi, Aimi Kawano, Tomoko Ando, Rie Ikeda, Ayako Inoue, Junko Imanaga, Shizuko Okamoto, Masayuki Kanehisa, Taiga Ninomiya, Jusen Tsuru, Jotaro Akiyoshi Department of Neuropsychiatry, Faculty of Medicine, Oita University, Hasama-Machi, Oita, Japan Background: Bipolar disorder (BP) is often associated with a change in hypothalamus–pituitary–adrenal axis function change due to chronic stress. Salivary α-amylase (sAA) levels in...

  4. Differences in salivary α-amylase levels among women ith different taste sensitivities.


    Sequeira, Márcia; Rodrigues, Lénia; R Costa, Ana; Antunes, Célia; Pinheiro, Cristina; Lamy, Elsa


    Saliva is the main component of taste receptor cells external environment, and consequently it may have a decisive role in taste perception. Taste sensitivity varies among different individuals. Sensitivity to the compound n-6-propylthiouracil (PROP) has been considerably studied and besides the known influence of genetic background, the contribution of perireceptor environment is not completely clear yet. Salivary α-amylase (one of the main proteins of saliva) is involved in carbohydrate dig...

  5. Differences in salivary α-amylase levels among women with different taste sensitivities


    Sequeira, Márcia; Rodrigues, Lénia; Costa, Ana R; Pinheiro, C.; Antunes, Célia M.; Lamy, Elsa


    Saliva is the main component of taste receptor cells external environment, and consequently it may have a decisive role in taste perception. Taste sensitivity varies among different individuals. Sensitivity to the compound n-6-propylthiouracil (PROP) has been considerably studied and besides the known influence of genetic background, the contribution of perireceptor environment is not completely clear yet. Salivary α-amylase (one of the main proteins of saliva) is involved in carbohydrate dig...

  6. Growth Factors Polymerized Within Fibrin Hydrogel Promote Amylase Production in Parotid Cells


    McCall, Andrew D.; Joel W. Nelson; Leigh, Noel J.; Duffey, Michael E.; Lei, Pedro; Andreadis, Stelios T.; Baker, Olga J.


    Salivary gland cell differentiation has been a recurring challenge for researchers as primary salivary cells show a loss of phenotype in culture. Particularly, parotid cells show a marked decrease in amylase expression, the loss of tight junction organization and proper cell function. Previously, Matrigel has been used successfully as an extracellular matrix; however, it is not practical for in vivo applications as it is tumorigenic. An alternative method could rely on the use of fibrin hydro...

  7. Sensitivity and specificity of canine serum total amylase and isoamylase activity determinations.


    Jacobs, R M; Swenson, C L; Davenport, D J; Murtaugh, R J


    Serum isoamylases were determined prospectively in dogs with pancreatic and extrapancreatic diseases. Mean serum isoamylase determinations were significantly different (p less than 0.05) between normal dogs and dogs with pancreatitis and exocrine pancreatic insufficiency. The sensitivity of serum isoamylase determination exceeded that of total amylase activity for the diagnosis of pancreatitis. Serum isoamylase determinations were less influenced by extrapancreatic diseases compared to total ...

  8. Effect of Solvent extraction on Phenolic content, Antioxidant and - Amylase Inhibition activities of Swertia chirata

    Directory of Open Access Journals (Sweden)

    Alak Kanti Dutta


    Full Text Available Swertia chirata is an indigenous medicinal plant of temperate Himalaya which has been widely used in herbal and folk medicine. The study aimed to evaluate the phenolic content, antioxidant and andiabetic potential of S. chirata in different solvents. The edible portion (stem of the plant was extracted with distilled water and different concentrations of methanol, ethanol and acetone to determine total phenolic content (TPC, antioxidant properties by ferric reducing antioxidant power (FRAP, total antioxidant capacity (TAC, DPPH free radical scavenging activities and antidiabetic property by inhibition of %-amylase. All the extracts showed antioxidant and antidiabetic properties although they varied significantly (P<0.05 among the different extractions. TPC varied between 20 ± 2 mg GAE/100g (ethanol 100% to 221 ± 12 mg GAE/100g (water extracts, FRAP ranged between 18 ± 4 mg AAE/100g (acetone 100% to 162 ± 4 mg AAE/100g (water extracts and TAC ranged between 139 ± 17 mg AAE/100g (acetone 100% to 707 ± 71 mg AAE/100g (acetone 50%. DPPH radical scavenging and alpha amylase inhibition activities were determined in dose dependent manner ranging between 3-15 mg/mL and 7-21 mg/mL respectively. Acetone 50% showed the most prominent dose dependent scavenging of DPPH radical while alpha amylase inhibition by ethanol 100%, methanol 100% and acetone 100% were comparable with each other. The study revealed the influence of solvent extraction on phenolic compound, antioxidant and %-amylase inhibition activities of S. chirata. These findings support the use of the plant as a traditional and folk medicine.

  9. Comparison of Antibodies with Amylase Activity from Cerebrospinal Fluid and Serum of Patients with Multiple Sclerosis.

    Directory of Open Access Journals (Sweden)

    Vasilii B Doronin

    Full Text Available We have recently shown that IgGs from serum and cerebrospinal fluid (CSF of MS patients are active in hydrolysis of DNA and myelin basic protein. According to literature data, anti-DNA and anti-MBP abzymes may promote important neuropathologic mechanisms in this chronic inflammatory disorder and in MS pathogenesis development. At the same time, the involvement of antibodies with amylase activity in the pathogenesis of any autoimmune disease has not yet been identified. Electrophoretically and immunologically homogeneous IgGs were obtained by a sequential affinity chromatography of the CSF proteins on protein G-Sepharose and FPLC gel filtration. We are able to present the first unpredictable evidence showing that IgGs from CSF possess amylase activity and efficiently hydrolyze maltoheptaose; their average specific Ab activity is ~30-fold higher than that of antibodies from sera of the same MS patients. Specific average RA (SAA for IgGs from healthy volunteers was approximately ~1000 lower than that for MS patients. In addition, it was shown that a relative SAA of total proteins of CSF (including Abs ~15-fold lower than that for purified IgGs, while the relative SAA of the total sera protein is higher than that of sera IgGs by a factor of 1033. This result speaks in favor of the fact that amylolytic activity of CSF proteins is mainly caused by the activity of amylase abzymes. One cannot exclude, that amylase abzymes of CSF can play a, as yet unknown, role in the pathogenesis of MS. Some possible reasons of these findings are discussed.

  10. Alpha-Amylase Reactivity in Relation to Psychopathic Traits in Adults


    Glenn, Andrea L.; Remmel, Rheanna J.; Raine, Adrian; Schug, Robert A.; Gao, Yu; Granger, Douglas A.


    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individ...

  11. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortiol and Alpha-Amylase


    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.


    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = .33) completed a measure of peer victimization, teachers rated children’s aggression, and children’s saliva was collected prior to, and following, participation in a laboratory-based pee...

  12. Activities of amylase, proteinase, and lipase enzymes from Lactococcus chungangensis and its application in dairy products. (United States)

    Konkit, Maytiya; Kim, Wonyong


    Several enzymes are involved in the process of converting milk to lactic acid and coagulated milk to curd and, therefore, are important in dairy fermented products. Amylase, proteinase, and lipase are enzymes that play an important role in degrading milk into monomeric molecules such as oligosaccharides, amino acids, and fatty acids, which are the main molecules responsible for flavors in cheese. In the current study, we determined the amylase, proteinase, and lipase activities of Lactococcus chungangensis CAU 28(T), a bacterial strain of nondairy origin, and compared them with those of the reference strain, Lactococcus lactis ssp. lactis KCTC 3769(T), which is commonly used in the dairy industry. Lactococcus chungangensis CAU 28(T) and L. lactis ssp. lactis KCTC 3769(T) were both found to have amylase, proteinase, and lipase activities in broth culture, cream cheese, and yogurt. Notably, the proteinase and lipase activities of L. chungangensis CAU 28(T) were higher than those of L. lactis ssp. lactis KCTC 3769(T), with proteinase activity of 10.50 U/mL in tryptic soy broth and 8.64 U/mL in cream cheese, and lipase activity of 100 U/mL of tryptic soy broth, and 100 U/mL of cream cheese. In contrast, the amylase activity was low, with 5.28 U/mL in tryptic soy broth and 8.86 U/mL in cream cheese. These enzyme activities in L. chungangensis CAU 28(T) suggest that this strain has potential to be used for manufacturing dairy fermented products, even though the strain is of nondairy origin. PMID:27108177

  13. Rapid detection of malto-oligosaccharide-forming bacterial amylases by high performance anion-exchange chromatography

    DEFF Research Database (Denmark)

    Duedahl-Olesen, Lene; Larsen, K. L.; Zimmermann, W.


    High performance anion-exchange chromatography with pulsed amperometric detection was applied for the rapid analysis of malto-oligosaccharides formed by extracellular enzyme preparations from 49 starch-degrading bacterial strains isolated from soil and compost samples. Malto-oligosaccharide-formi......-oligosaccharide-forming amylases, indicated by a predominant formation of maltohexaose from starch, were produced by enzyme preparations from four of the isolates growing at pH 7.0 and 10....

  14. Prediction of radiation inactivation of presonicated a-amylase in terms of kinetic parameters

    International Nuclear Information System (INIS)

    Full text: In-vitro radiation inactivation of enzyme amylase denies display of optimum enzyme function owing to alterations in active site. Certain extent of enzyme activity seems to be protected in case of radiation inactivated enzyme, prior-exposed to ultrasonic frequencies. The present investigation, exploring trends of changes in kinetic parameters and its dependence on ultrasonic frequencies and gamma doses, will be discussed to highlight the functional status of active site under situation

  15. Genetically Modified α-Amylase Inhibitor Peas Are Not Specifically Allergenic in Mice


    Rui-Yun Lee; Daniela Reiner; Gerhard Dekan; Moore, Andrew E.; Higgins, T. J. V.; Epstein, Michelle M.


    Weevils can devastate food legumes in developing countries, but genetically modified peas (Pisum sativum), chickpeas and cowpeas expressing the gene for alpha-amylase inhibitor-1 (αAI) from the common bean (Phaseolus vulgaris) are completely protected from weevil destruction. αAI is seed-specific, accumulated at high levels and undergoes post-translational modification as it traverses the seed endomembrane system. This modification was thought to be responsible for the reported allergenicity ...

  16. Drying of α-amylase by spray drying and freeze-drying - a comparative study


    S. S. de Jesus; R. MACIEL FILHO


    This study is aimed at comparing two traditional methods of drying of enzymes and at verifying the efficiency of each one and their advantages and disadvantages. The experiments were performed with a laboratory spray dryer and freeze-dryer using α-amylase as the model enzyme. An experimental design in star revealed that spray drying is mainly influenced by the inlet air temperature and feed flow rate, which were considered to be the main factors influencing the enzymatic activity and water ac...

  17. Optimization of Thermostable Alpha-Amylase Production Via Mix Agricultural-Residues and Bacillus amyloliquefaciens

    Directory of Open Access Journals (Sweden)

    Shalini RAI


    Full Text Available This study reports utilization of mixture of wheat and barley bran (1:1 for the production of thermostable alpha-amylase enzyme through a spore former, heat tolerant strain of Bacillus amyloliquefaciens in solid state fermentation. Maximum yield of alpha-amylase (252.77 U mL-1 was obtained in following optimized conditions, inoculums size 2 mL (2 × 106 CFU/mL, moisture 80%, pH 7±0.02, NaCl (3%, temperature 38±1°C, incubation for 72 h, maltose (1% and tryptone (1%. After SSF crude enzyme was purified via ammonium sulfate precipitation, ion exchange and column chromatography by DEAE Cellulose. Purified protein showed a molecular weight of 42 kDa by SDS-PAGE electrophoresis. After purification, purified enzyme was characterized against several enzymes inhibitors such as temperature, NaCl, pH, metal and surfactants. Pure enzyme was highly active over broad temperature (50-70°C, NaCl concentration (0.5-4 M, and pH (6-10 ranges, indicating it’s a thermoactive and alkali-stable nature. Moreover, CaCl2, MnCl2, =-mercaptoethanol were found to stimulate the amylase activity, whereas FeCl3, sodium dodecyl sulfate (SDS, CuCl3 and ethylenediaminetetraacetic acid (EDTA strongly inhibited the enzyme. Moreover, enzyme specificity and thermal stability conformed by degradation of different soluble starch up to 55°C. Therefore, the present study proved that the extracellular alpha-amylase extracted through wheat flour residues by organism B. amyloliquefaciens MCCB0075, both have considerable potential for industrial application owing to its properties.

  18. [Influence of amaranth on the production of alpha-amylase using Aspergillus niger NRRL 3112]. (United States)

    Mariani, D D; Lorda, G; Balatti, A P


    In this paper the influence of the amaranth seed meal and the aeration conditions on the alpha-amylase production by Aspergillus niger NRRL 3112 were studied. The assays of selection of culture medium were carried out in a rotary shaker at 250 rpm and 2.5 cm stroke. The aeration conditions were studied in a mechanically stirred fermentor New Brunswick type. A concentration of alpha-amylase of 2750 U.Dun/ml was achieved at 120 h with a dry weight of 8.0 g/l, using a base medium with 5.0 g/l Amaranthus cruentus seed meal. In the experiment performed in a New Brunswick fermentor, the highest value was 2806 U.Dun/ml. This result was obtained after 120 h, operating at 300 rpm and an airflow of 1 l/l. min. in a limited dissolved oxygen concentration. It was determined that the increase in the agitation rate was not favorable to the enzyme production, despite that an increase was verified in the dissolved oxygen. The morphology of the microorganism, in long and ramified hyphae, was the critical factor to obtain higher levels of alpha-amylase.

  19. Influence of gallic acid on α-amylase and α-glucosidase inhibitory properties of acarbose

    Directory of Open Access Journals (Sweden)

    Ganiyu Oboh


    Full Text Available Acarbose is an antidiabetic drug which acts by inhibiting α-amylase and α-glucosidase activities but with deleterious side effects. Gallic acid (GA is a phenolic acid that is widespread in plant foods. We therefore investigated the influence of GA on α-amylase and α-glucosidase inhibitory properties of acarbose (in vitro. Aqueous solutions of acarbose and GA were prepared to a final concentration of 25μM each. Thereafter, mixtures of the samples (50% acarbose + 50% GA; 75% acarbose+25% GA; and 25% acarbose+75% GA were prepared. The results revealed that the combination of 50% acarbose and 50% GA showed the highest α-glucosidase inhibitory effect, while 75% acarbose+25% GA showed the highest α-amylase inhibitory effect. Furthermore, all the samples caused the inhibition of Fe2+-induced lipid peroxidation (in vitro in rat pancreatic tissue homogenate, with the combination of 50% acarbose and 50% GA causing the highest inhibition. All the samples also showed antioxidant properties (reducing property, 2,2'-azino-bis (-3-ethylbenzthiazoline-6-sulphonate [ABTS*] and 1,1-diphenyl-2-picrylhydrazyl [DPPH] free radicals scavenging abilities, and Fe2+ chelating ability. Therefore, combinations of GA with acarbose could be employed as antidiabetic therapy, with a possible reduction of side effects of acarbose; nevertheless, the combination of 50% acarbose and 50% GA seems the best.

  20. Preparation of glucosamine by hydrolysis of chitosan with commercial α-amylase and glucoamylase

    Institute of Scientific and Technical Information of China (English)

    Sai-kun PAN; Sheng-jun WU; Jin-moon KIM


    Objective: In order to overcome the defects of chemical hydrolysis approach to prepare glucosamine,an enzymatic hydrolysis method was developed.Methods: Glucosamine was prepared by hydrolyzing chitosan,employing α-amylase initially,and subsequently,glucoamylase.Results: The optimal hydrolyzing conditions were as follows: reaction time,4 h; pH,5.0; temperature,50 ℃; and,α-amylase,80 U/g for the initial reaction.Subsequently,glucoamylase was added in the presence of a-amylase.The optimal reaction conditions were found to be: reaction time,8 h; pH,4.5; temperature,55 ℃; and,glucoamylase,4000 U/g.The hydrolysates were subject to filtrating,concentrating to about 20% (w/w),precipitating with five volumes of ethanol,and drying at 60 ℃ for 2 h.The content and the yield of glucosamine in the dried precipitate were 91.3% (w/w) and 86.2% (w/w),respectively.Conclusions:The method developed in this study is a promising option in the preparation of glucosamine.