WorldWideScience

Sample records for amylase

  1. Amylase Test

    Science.gov (United States)

    ... in amylase level does not indicate severity of pancreatic disease. Amylase levels may also be significantly increased in ... damage to the amylase-producing cells in the pancreas. Decreased levels can also be due to kidney disease and toxemia of pregnancy . Increased blood amylase levels ...

  2. Advances in microbial amylases.

    Science.gov (United States)

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  3. Amylase, isoamylase and macroamylase.

    Science.gov (United States)

    Goldberg, D M; Spooner, R J

    1975-01-01

    Hyperamylasaemia has long been regarded as pathognomonic of acute pancreatitis. However, recent work has revealed a number of conditions where a gross elevation may be an incidental finding, notably diabetic ketoacidosis. The recent discovery of 'macroamylase', a high molecular weight amylase-protein complex capable of producing hyperamylasaemia with low urine amylase, has further complicated diagnosis and has led to the introduction of the ratio of amylase clearance to creatinine clearance as a diagnostic aid. Serum amylase may be resolved, by most electrophoretic media, into bands which correspond to those obtained when pancreatic homogenates or saliva are electrophoresed. The initial promise of this technique has not been realised at the routine diagnostic level. Duodenal juice amylase has been the classical enzyme used in assessing exocrine pancreatic function and although it is still of value it is being amplified by other enzyme tests.

  4. Amylase activity in human bile.

    Science.gov (United States)

    Donaldson, L A; Joffe, S N; McIntosh, W; Brodie, M J

    1979-03-01

    The mean amylase level in 42 human bile samples was 154 IU/l and there was no significant difference in the amylase activity of 32 paired serum and bile samples. Estimation of the amylase thermolability of bile showed it to be similar to that of serum. This suggests that the amylase activity in bile may have filtered through the liver from the hepatic circulation rather than refluxed from the pancreatic duct. The presence of amylase in human bile provides further evidence that the liver might have a role in the regulation of serum amylase.

  5. Detergent-compatible bacterial amylases.

    Science.gov (United States)

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  6. [The inhibiting effect of dimethylaminomethylferrocene on amylase].

    Science.gov (United States)

    Shevel'kova, A N; Riabov, A D; Sinitsyn, A P

    1993-06-01

    The effects of dimethylaminomethylferrocene (DMAMF) on amylose and maltodextrins destruction by gluco-, alpha- and beta-amylases have been studied. The nature of DMAMF effects depends on the action mechanism of amylases and structure of their active sites. The effect observed is interpreted in terms of a hypothesis on a subsite structure of the amylase active centers.

  7. Test for endo-amylase activity in the presence of exo-amylases

    Energy Technology Data Exchange (ETDEWEB)

    McHale, R.H.

    1988-11-01

    Increased hydroxypropylation of potato starch or amylose reduced the susceptibility of these substrates to attack by alpha and beta-amylases. By limited hydroxpropyl substitution (molar substitution: 0.18) of starch or amylose, substrates were obtained which were specifically degraded by alpha-amylase. These modified substrates enabled alpha-amylase to be determined in the presence of beta-amylase in extracts of malted barley.

  8. Amylase creatinine clearance ratio after biliary surgery.

    Science.gov (United States)

    Donaldson, L A; McIntosh, W; Joffe, S N

    1977-01-01

    The amylase creatinine clearance ratio (ACCR) is considered to be a more sensitive index of acute pancreatitis than the serum amylase level. Serial ACCR estimations were undertaken in 25 patients undergoing an elective cholecystectomy. Using accepted criteria, 28% of these patients developed, in the postoperative period, biochemical evidence of pancreatic gland damage, although the serum amylase level remained normal. This raised ACCR was particularly noted in patients who had undergone an exploration of the common bile duct. The ACCR would appear to be a more sensitive index of pancreatic gland disruption secondary to biliary surgery than the serum amylase level.

  9. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide;

    2011-01-01

    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  10. Amylase and lipase values in normal subjects

    NARCIS (Netherlands)

    Riet, H.G. van

    1968-01-01

    In 146 hospitalized individuals (71 men and 75 women), the simultaneous fasting serum amylase and lipase concentrations and the urinary amylase excretion per 24 h were determined. Patients with pancreatic abnormalities or other diseases which might produce abnormal enzyme values were ruled out from

  11. Biotechnological Processes in Microbial Amylase Production

    Directory of Open Access Journals (Sweden)

    Subash C. B. Gopinath

    2017-01-01

    Full Text Available Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi amylase is discussed along with its production methods from the laboratory to industrial scales.

  12. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii

    OpenAIRE

    Nikitkova, A.E.; Haase, E M; Scannapieco, F A

    2012-01-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amyla...

  13. Beta-Amylases from Alfalfa (Medicago sativa L.) Roots.

    Science.gov (United States)

    Doehlert, D C; Duke, S H; Anderson, L

    1982-05-01

    Amylase was found in high activity (193 international units per milligram protein) in the tap root of alfalfa (Medicago sativa L. cv. Sonora). The activity was separated by gel filtration chromatography into two fractions with molecular weights of 65,700 (heavy amylase) and 41,700 (light amylase). Activity staining of electrophoretic gels indicated the presence of one isozyme in the heavy amylase fraction and two in the light amylase fraction. Three amylase isozymes with electrophoretic mobilities identical to those in the heavy and the light amylase fractions were the only amylases identified in crude root preparations. Both heavy and light amylases hydrolyzed amylopectin, soluble starch, and amylose but did not hydrolyze pullulan or beta-limit dextrin. The ratio of viscosity change to reducing power production during starch hydrolysis was identical for both alfalfa amylase fractions and sweet potato beta-amylase, while that of bacterial alpha-amylase was considerably higher. The identification of maltose and beta-limit dextrin as hydrolytic end-products confirmed that these alfalfa root amylases are all beta-amylases.The pH optimum for both beta-amylase fractions was 6.0. Both light and heavy beta-amylases showed normal Michaelis-Menten kinetics, with soluble starch as substrate, and had respectively K(m) values of 5.9 and 6.8 milligrams starch per milliliter and V(max) of 640 and 130 international units per milligram protein. Arrhenius plots indicated that the energy of activation for the heavy beta-amylase remained relatively unchanged (12.7 to 13.0 kilocalories per mole) from 0 to 30 degrees C, whereas the energy of activation for the light amylase increased from 12.0 to about 28.0 kilocalories per mole at 8.7 degrees C as temperature was lowered. The light amylase was shown to be inhibited by maltose.

  14. Production of amylases by Aspergillus tamarii

    Directory of Open Access Journals (Sweden)

    Moreira Fabiana Guillen

    1999-01-01

    Full Text Available A strain of Aspergillus tamarii, a filamentous fungus isolated from soil, was able to produce both a-amylase and glucoamylase activities in mineral media supplemented with 1% (w/v starch or maltose as the carbon source. Static cultivation led to significantly higher yields than those obtained using shaking culture. The production of amylases was tolerant to a wide range of initial culture pH values (from 4 to 10 and temperature (from 25 to 42oC. Two amylases, one a-amylase and one glucoamylase, were separated by ion exchange chromatography. Both partially purified enzymes had optimal activities at pH values between 4.5 and 6.0 and were stable under acid conditions (pH 4.0-7.0. The enzymes exhibited optimal activities at temperatures between 50o and 60o C and were stable for more than ten hours at 55oC.

  15. Performance evaluation of salivary amylase activity monitor.

    Science.gov (United States)

    Yamaguchi, Masaki; Kanemori, Takahiro; Kanemaru, Masashi; Takai, Noriyasu; Mizuno, Yasufumi; Yoshida, Hiroshi

    2004-10-15

    In order to quantify psychological stress and to distinguish eustress and distress, we have been investigating the establishment of a method that can quantify salivary amylase activity (SMA). Salivary glands not only act as amplifiers of a low level of norepinephrine, but also respond more quickly and sensitively to psychological stress than cortisol levels. Moreover, the time-course changes of the salivary amylase activity have a possibility to distinguish eustress and distress. Thus, salivary amylase activity can be utilized as an excellent index for psychological stress. However, in dry chemistry system, a method for quantification of the enzymatic activity still needs to be established that can provide with sufficient substrate in a testing tape as well as can control enzymatic reaction time. Moreover, it is necessary to develop a method that has the advantages of using saliva, such as ease of collection, rapidity of response, and able to use at any time. In order to establish an easy method to monitor the salivary amylase activity, a salivary transcription device was fabricated to control the enzymatic reaction time. A fabricated salivary amylase activity monitor consisted of three devices, the salivary transcription device, a testing-strip and an optical analyzer. By adding maltose as a competitive inhibitor to a substrate Ga1-G2-CNP, a broad-range activity testing-strip was fabricated that could measure the salivary amylase activity with a range of 0-200 kU/l within 150 s. The calibration curve of the monitor for the salivary amylase activity showed R2=0.941, indicating that it was possible to use this monitor for the analysis of the salivary amylase activity without the need to determine the salivary volume quantitatively. In order to evaluate the assay variability of the monitor, salivary amylase activity was measured using Kraepelin psychodiagnostic test as a psychological stressor. A significant difference of salivary amylase activity was recognized

  16. Revisiting the cardiometabolic relevance of serum amylase

    OpenAIRE

    Munakata Hiromi; Muneyuki Toshitaka; Nakajima Kei; Kakei Masafumi

    2011-01-01

    Abstract Background The pancreas has dual functions as a digestive organ and as an endocrine organ, by secreting digestive enzymes and endocrine hormones. Some early studies have revealed that serum amylase levels are lower in individuals with chronic pancreatitis, severe long-term type 2 diabetes or type 1 diabetes. Regarding this issue, we recently reported that low serum amylase levels were associated with metabolic syndrome and diabetes in asymptomatic adults. In the light of this, we fur...

  17. Optimisation of amylase and xylanase addition in dependance of white flour amylase activity

    Directory of Open Access Journals (Sweden)

    Lončar Davor M.

    2016-01-01

    Full Text Available In this study the effect of different quantities of added amylase to white wheat flours characterized with different activities of naturally existing amylases is tested. Response surface methodology is chosen to test the effects of main applied technological parameters on bread quality responses. Independent variables are chosen to be: quantity of added amylase and bulk fermentation time, while analysed responses are: specific volume, grain structure, bulk fermentation. Bread quality responses are statistically significant, while predicted and observed responses correspond very well, which allows good prediction of bread quality parameters based on applied technological parameters and flour characteristics. Score analysis shows that optimum quantity of amylase addition regarding bread quality depends on the activity of naturally existing amylases. Optimal quantity of added xylanase in bread samples made from both flour types is 0.004%. Xylanase improved properties of white wheat bread and higher effect is experienced with flour that has more active naturally existing amylases. Addition of amylase has statistically significantly increased a* values of crust. Addition of xylanase has statistically significantly decreased values of b* in comparison to the respective bread sample with only added amylase.

  18. Effect of changes in circulating amylase levels on amylase output in bile.

    Science.gov (United States)

    Grendell, J H; Rothman, S S

    1982-07-01

    The relation between plasma and biliary amylase activity and their relationship to the functional state of the pancreas were studied in anesthetized rabbits. Repetitive intravenous injections of cholecystokinin resulted in a 25-fold rise in the secretion of amylase via the pancreatic duct, followed at first by a 50% increase in plasma amylase concentration and later by a 270% increase in biliary amylase concentration. There was then a gradual, roughly synchronous decline in both plasma and biliary values toward basal level despite a continued highly augmented rate of pancreatic ductal secretion. "Near-total" pancreatectomy completely abolished the effect. These observations are consistent with a cholecystokinin-induced basolateral secretion of amylase from pancreas into blood and its subsequent movement from blood into bile down a concentration gradient. The output of amylase in bile, however, was quite small and does not suggest that biliary transport of amylase has an important function either as a means of secreting and recycling digestive enzyme into the gut or as a major excretory pathway for circulating amylase in the rabbit.

  19. Application of microbial α-amylase in industry - A review

    OpenAIRE

    2010-01-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential f...

  20. Plant alpha-amylase inhibitors and their interaction with insect alpha-amylases.

    Science.gov (United States)

    Franco, Octávio L; Rigden, Daniel J; Melo, Francislete R; Grossi-De-Sá, Maria F

    2002-01-01

    Insect pests and pathogens (fungi, bacteria and viruses) are responsible for severe crop losses. Insects feed directly on the plant tissues, while the pathogens lead to damage or death of the plant. Plants have evolved a certain degree of resistance through the production of defence compounds, which may be aproteic, e.g. antibiotics, alkaloids, terpenes, cyanogenic glucosides or proteic, e.g. chitinases, beta-1,3-glucanases, lectins, arcelins, vicilins, systemins and enzyme inhibitors. The enzyme inhibitors impede digestion through their action on insect gut digestive alpha-amylases and proteinases, which play a key role in the digestion of plant starch and proteins. The natural defences of crop plants may be improved through the use of transgenic technology. Current research in the area focuses particularly on weevils as these are highly dependent on starch for their energy supply. Six different alpha-amylase inhibitor classes, lectin-like, knottin-like, cereal-type, Kunitz-like, gamma-purothionin-like and thaumatin-like could be used in pest control. These classes of inhibitors show remarkable structural variety leading to different modes of inhibition and different specificity profiles against diverse alpha-amylases. Specificity of inhibition is an important issue as the introduced inhibitor must not adversely affect the plant's own alpha-amylases, nor the nutritional value of the crop. Of particular interest are some bifunctional inhibitors with additional favourable properties, such as proteinase inhibitory activity or chitinase activity. The area has benefited from the recent determination of many structures of alpha-amylases, inhibitors and complexes. These structures highlight the remarkable variety in structural modes of alpha-amylase inhibition. The continuing discovery of new classes of alpha-amylase inhibitor ensures that exciting discoveries remain to be made. In this review, we summarize existing knowledge of insect alpha-amylases, plant alpha-amylase

  1. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    Science.gov (United States)

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation.

  2. Immobilization of -Amylase onto Luffa operculata Fibers

    Directory of Open Access Journals (Sweden)

    Ricardo R. Morais

    2013-01-01

    Full Text Available A commercial amylase (amy was immobilized by adsorption onto Luffa operculata fibers (LOFs. The derivative LOF-amy presented capacity to hydrolyze starch continuously and repeatedly for over three weeks, preserving more than 80% of the initial activity. This system hydrolyzed more than 97% of starch during 5 min, at room temperature. LOF-amy was capable to hydrolyze starch from different sources, such as maize (93.96%, wheat (85.24%, and cassava (79.03%. A semi-industrial scale reactor containing LOF-amy was prepared and showed the same yield of the laboratory-scale system. After five cycles of reuse, the LOF-amy reactor preserved over 80% of the initial amylase activity. Additionally, the LOF-amy was capable to operate as a kitchen grease trap component in a real situation during 30 days, preserving 30% of their initial amylase activity.

  3. Kidney ageing and renal excretion of amylase.

    Science.gov (United States)

    Brohée, D; Rondelez, L; Bain, H; de Maertelaer, V

    1982-01-01

    In a cross-sectional study, the amylase to creatinine clearance ratio (ACCR) was determined in 180 patients, age range 18-93 years. An inverse correlation was found between ACCR and creatinine clearance (r = -0.40, p less than 0.001) in keeping with the known inverse relationship between the sieving fraction of macromolecules and the glomerular filtration rate. The fractional clearance of amylase was not significantly affected by amylasemia nor by age when the creatinine clearance was also considered in a multiple regression analysis. No increase in ACCR was observed in patients with low molecular weight proteinuria or with induced urine dilution. The authors assume that the tubular reabsorption of amylase is minimal and that the enhancement of ACCR in the elderly mainly reflects modifications in the glomerular filtration dynamics.

  4. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii.

    Science.gov (United States)

    Nikitkova, A E; Haase, E M; Scannapieco, F A

    2012-08-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii.

  5. Influence of amylase assay technique on renal clearance of amylase-creatinine ratio.

    Science.gov (United States)

    Levitt, M D; Johnson, S G; Ellis, C J; Engel, R R

    1977-06-01

    The influence of amylase assay technique on the renal amylase/creatinine clearance measurement was determined by analysis of serum and urine specimens obtained from 10 normal subjects. CAm/CCr averaged 2.19 +/- 0.18% with a saccharogenic technique, 1.52 +/- 0.2% with an iodometric technique, and 0.80 +/- 0.08% with a chromogenic technique. Each of these values differed significantly (P less than 0.05) from the other two. Recovery studies were carried out by adding partially purified human salivary or pancreatic amylase to human newborn serum or urine (which contain minimal endogenous amylase). Equal amylase activity was recovered from serum and urine by the saccharogenic technique whereas recovery from urine was less than 50% of that from serum using the iodometric and chromogenic techniques. The accuracy of the chromogenic technique is markedly improved by the addition of albumin to the urine assay system. Although it appears that only the saccharogenic method provides an accurate estimate of CAm/CCr, each assay technique distinguished the elevated CAm/CCr of patients with pancreatitis from the normal range established for that technique. Accurate clinical interpretation of CAm/CCr measurment requires knowledge of the amylase assay technique used.

  6. Clinical evaluation of amylase-creatinine clearance ratio and amylase isoenzyme clearance in chronic renal failure.

    Science.gov (United States)

    Maeda, M; Otsuki, M; Okano, K; Yamasaki, T; Baba, S

    1981-01-01

    Amylase-creatinine clearance ratio (ACCR) and amylase isoenzyme clearance were determined simultaneously in patients with chronic renal failure. ACCR in patients with compensated renal failure (3.5 +/- 0.4%) was not significantly different from normals (2.6 +/- 0.2%), while that in patients with non-compensated renal failure (6.7 +/- 0.4%) was significantly higher than that in normals. Clearance ratio of pancreatic isoamylase (Amylase-1) relative to creatinine clearance (CAmy . 1/Ccr) in patients with both compensated (5.9 +/- 1.0%) and non-compensated (6.8 +/- 0.4%) renal failure was as high as that in patients with acute pancreatitis (6.6 +/- 0.5%). On the other hand, clearance ratio of salivary isoamylase (Amylase-3) relative to creatinine clearance (CAmy . 3/CCr) in patients with compensated renal failure (1.5 +/- 0.3%) was almost the same as that in normals (2.1 +/- 0.1%), while that in patients with non-compensated renal failure was 5.9 +/- 0.7%, which was significantly higher than that in normals. The present study revealed that elevated ACCR in patients with severely impaired renal function was due to the increase of the clearance ratio for both pancreatic and salivary amylase. These facts suggested that glomerular permeability and tubular reabsorption for pancreatic and salivary amylase might play an important role on ACCR in patients with severely impaired renal function.

  7. Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus.

    Science.gov (United States)

    Wang, Shihui; Jeyaseelan, Jenasia; Liu, Yun; Qin, Wensheng

    2016-09-01

    The costs of amylase represent ca. 24 % of the expenditures in the starch industry and an increase in amylase production and/or activity will greatly cut down on production costs. In the present study, we obtained a high amylase-producing strain of bacteria, WangLB, and identified it as a member of the Bacillus genus based on 16S rDNA analysis. The fermentation conditions for amylase production in the strain were optimized, and the maximum amylase activity we obtained was 26,670 ± 1390 U/mL, under the optimized conditions of 48-h incubation in liquid starch medium, 35 °C, pH 10, 1 % v/v inoculum concentration, 20 g/L starch concentration, and 0.1 % w/v peptone. The influences of 16 small organic inducers on amylase production were tested, and the results showed that 20 mmol/L alanine greatly enhanced amylase production to 290 % of the baseline level. We also conducted an amylase enzymology analysis. The molecular weight of the amylase was 55 kD, determined by SDS-PAGE. The optimum temperature and pH for the amylase were 55 °C and pH 9, respectively. The enzyme also showed high activity over a wide range of temperatures (50-85 °C) and pH values (3-10), and the activity of the amylase was Ca(2+) independent. The kinetic parameters K m and V max were 0.37 ± 0.02 mg/mL and 233 U/mg, respectively. Finally, the amylase was applied to the hydrolysis of five different brands of starch. It was found that the hydrolyzability of the substrate by amylase increased along with starch solubility.

  8. Bakers' asthma caused by alpha amylase.

    Science.gov (United States)

    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E

    1994-10-01

    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  9. Clinical use of amylase clearance and isoamylase measurements.

    Science.gov (United States)

    Levitt, M D

    1979-07-01

    Isoamylase determinations and measurements of the ratio of the renal clearance of amylase relative to creatinine (CAm/CCr) were employed in an attempt to improve the diagnostic accuracy of the standard amylase measurement. An elevated CAm/CCr reflects defective proximal tubular reabsorption of amylase which occurs in virtually all patients with clear-cut acute pancreatitis. However, other conditions that apparently are associated with acute defective tubular function, such as burns and diabetic acidosis, may cause an elevated ratio. Thus, elevations of CAm/CCr cannot be considered to be specific for acute pancreatitis. Pancreatic isoamylase represents, on the average, about 33% of the normal serum amylase activity, whereas about 66% is salivary-type isoamylase. Isoamylase measurements are useful in determining whether an elevated value for serum amylase activity is of pancreatic origin. However, this measurement is not useful for determining whether patients with normal serum amylase activity have pancreatitis.

  10. [Bifunctional inhibitor of alpha-amylase/trypsin from wheat grain].

    Science.gov (United States)

    Islamov, R A; Furusov, O V

    2007-01-01

    A trypsin inhibitor, isolated from whole-wheat grain (Triticum aestivum L.) by the method of bio-specific chromatography on trypsin-Sepharose, was potent in inhibiting human salivary alpha-amylase. The bi-functional alpha-amylase/trypsin inhibitor was characterized by a narrow specificity for other alpha-amylases and proteinases. The high thermostability of the inhibitor was lost in the presence of SH group-reducing agents. The inhibitor-trypsin complex retained its activity against alpha-amylase. The inhibitor-alpha-amylase complex was active against trypsin. Studies of the enzyme kinetics demonstrated that the inhibition of alpha-amylase and trypsin was noncompetitive. Our results suggest the existence of two independent active sites responsible for the interaction with the enzymes.

  11. Serum amylase determinations and amylase to creatinine clearance ratios in patients with chronic renal insufficiency.

    Science.gov (United States)

    Tedesco, F J; Harter, H R; Alpers, D H

    1976-10-01

    Patients with severe chronic renal failure may have significant hyperamylasemia in the absence of clinical symptoms or signs of acute pancreatitis. Amylase to creatinine clearance (CA/CC) ratios were usually elevated in patients with chronic renal failure and were not helpful in evaluating the possibility of acute pancreatitis. The mean amylase to creatinine clearance ratio for the controls with normal renal function was 1.24 +/- 0.13. In patients with chronic renal failure, it was 3.17 +/- 0.42 (P less than 0.001). Serum amylase isoenzyme patterns revealed no difference in salivary to pancreatic isoenzyme ratios between normals (1.04 +/- 0.12) and patients with severe renal insufficiency without evidence of pancreatic disease (1.07 +/- 0.13). The isoenzymes were helpful in excluding the diagnosis of pancreatic in 1 renal failure patient whose hyperamylasemia was primarily salivary in origin and in confirming the diagnosis in another who had only a pancreatic band.

  12. Amylase-creatinine clearance ratios and serum amylase isoenzymes in moderate renal insufficiency.

    Science.gov (United States)

    Banks, P A; Sidi, S; Gelman, M L; Lee, K H; Warshaw, A L

    1979-12-01

    Both the amylase-creatinine clearance ratio (normal 1.55%) and proportion of pancreatic isoamylase in serum (normal 41.0%) increase in acute pancreatitis, and are therefore useful measurements to support that diagnosis. Whether renal insufficiency interferes with the accuracy and specificity of these tests has been debated. Our study indicates that even moderate renal insufficiency (creatinine clearance 30.5 ml/minute) raises the amylase-creatinine clearance ratio (3.23%) close enough to values characteristic of acute pancreatitis (4.41%) to cause potential diagnostic confusion. The fraction of pancreatic isoamylase in serum is also increased (69.9%), but not to the levels of acute pancreatitis (91.0%). We therefore caution against the use of the amylase-creatinine clearance ratio for the diagnosis of acute pancreatitis in patients with moderate renal insufficiency.

  13. Activated effect of lignin on α-amylase.

    Science.gov (United States)

    Zhang, Juan; Cui, Jun-Hui; Yin, Tingting; Sun, Lizhou; Li, Genxi

    2013-12-01

    This paper reports a new kind of activator of α-amylase, lignin, which can greatly increase α-amylase activity. The promoted ratio of lignin is even much higher than that of chloride ion, the traditional activator of α-amylase. Further experimental results reveal that lignin may interact with α-amylase to form a 1:1 complex with a binding constant of 4.47×10(5) M(-1). The binding is spontaneous and lignin/α-amylase complex formation is an exothermal reaction. Hydrogen bonding plays a key role and non-radiation energy transfers from α-amylase to lignin in the binding process. Lignin, combining with α-amylase, conforms to a first-order exponential decay function. The formation of the lignin/α-amylase complex results in the reduction of α-helical content from 57.7% to 53.9%, the increase of the polarity around tryptophan residues, the decrease of the hydrophobicity, and the enlargement of protein granule volume. This work will give a deeper insight into lignin as a kind of dietary fibre, known as an important food functional factor. Furthermore, it also contributes to the exploration of an activator of α-amylase, used in the food industry.

  14. CHARACTERIZATION OF ALPHA - AMYLASE FROM THE SEEDS OF Mucuna pruriens

    Directory of Open Access Journals (Sweden)

    K S Chandrashekharaiah

    2013-11-01

    Full Text Available Amylase s are hydrolytic enzymes which are widely distributed in nature, animals, plants and microorganisms. Amylases are of great significance in present - day biotechnology. In present study, amylases are isolated from the soaked seeds of Mucuna pruriens under extreme acidic conditions. Conventional protein purification techniques such as salt fractionation, ion exchange chromatography on CM - cellulose and sephadex G - 75 was employed for the purification of amylase from the seeds of Mucuna pruriens . The amy lase activity was eluted in one peak. The specific activity and yield of the purified amylase was 6.25 and 29.99, respectively. Native PAGE, SDS - PAGE and gel electrofocussing were employed to establish homogeneity of the purified amylase. SDS - PAGE and gel - filtration chromatography on sephadex G - 75 was used to determine the molecular weight of the purified amylase. The purified amylase was nearly homogenous and its molecular weight was found to be 78.4 kDa. The optimum pH and temperature of th e purified amyl ase were 7.0 and 50 o C, respectively. The isolectric pH of the purified amylase was 7.2 and the activity was linear up to 60 minutes

  15. Functional significance of amylase polymorphism in Drosophila melanogaster. III. Ontogeny of amylase and some alpha-glucosidases.

    Science.gov (United States)

    Hoorn, A J; Scharloo, W

    1980-02-01

    Changes in amylase (E.C. 3.2.1.1), maltase (E.C. 3.2.1.20), sucrase, and PNPGase activities in relation to changes in wet weight and protein content were studied during the development of larvae and adult flies from two strains of Drosophila melanogaster, homozygous for different amylase alleles. All alpha-glucosidase activities increase exponentially during a large part of larval development, parallel to the increase in weight, and drop at the end of the third instar. Amylase activity of the Amy1 strain follows the same pattern. In contrast, amylase activity of the Amy4,6 strain continues its exponential increase longer. In the third larval instar amylase activity in the Amy4,6 strain becomes much higher than in the Amy1 strain. During the first hours of adult life amylase activity of the two strains does not differ. Then Amy4,6 activity starts to rise and becomes much higher (4-5 times) than Amy1 amylase activity, which remains approximately constant. All adult enzyme activities are much higher than in larvae. Comparison of enzyme activity of amylase and alpha-glucosidases in larvae and adults confirms that differences in amylase activities can become important only when starch is a limiting factor in the food.

  16. The effect of carbohydrates on alpha-amylase activity measurements

    NARCIS (Netherlands)

    Baks, T.; Janssen, A.E.M.; Boom, R.M.

    2006-01-01

    The Ceralpha method can be used for ¿-amylase activity measurements during the hydrolysis of starch at high substrate concentrations (>40 wt.%). However, the results are affected by the carbohydrates present in the samples. The effect of carbohydrates on the Ceralpha ¿-amylase activity measuremen

  17. Thermostable, Raw-Starch-Digesting Amylase from Bacillus stearothermophilus

    OpenAIRE

    Kim, Jaeyoung; Nanmori, Takashi; Shinke, Ryu

    1989-01-01

    An endospore-forming thermophilic bacterium, which produced amylase and was identified as Bacillus stearothermophilus, was isolated from soil. The amylase had an optimum temperature of 70°C and strongly degraded wheat starch granules (93%) and potato starch granules (80%) at 60°C.

  18. Method for using a yeast alpha-amylase promoter

    Science.gov (United States)

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  19. Distribution of alpha-amylase activity in selected broiler tissues.

    Science.gov (United States)

    Rodeheaver, D P; Wyatt, R D

    1986-02-01

    In an examination of broiler alpha-amylase, significant variation in the serum enzyme activity level was noted, adult levels were lower than those of young chicks. Analysis of alpha-amylase activity in various body fluids and tissues of 11-day and 7-week-old broilers indicated that the liver cannot be considered a source of alpha-amylase, although there was activity in both liver tissue and bile of 10 units/g wet weight and 35 units/100 ml, respectively. Fluid from the oral cavity had low levels of alpha-amylase activity, less than 100 units/100 ml, which decreased with age, indicating that the salivary glands may synthesize some alpha-amylase but are not a primary source. Sonication of the pancreatic homogenates was found to significantly increase the apparent activity of alpha-amylase 35-fold over unsonicated homogenates. The pancreas was the major source of alpha-amylase with activities ranging from 89 X 10(2) to 445 X 10(2) units/g wet weight. The level of activity increased with age of the bird. The electrophoretic zymograms of serum, liver, and pancreatic homogenates indicate a similar pancreatic origin for the alpha-amylase found in each tissue or fluid.

  20. Application of microbial α-amylase in industry - A review

    Directory of Open Access Journals (Sweden)

    Paula Monteiro de Souza

    2010-12-01

    Full Text Available Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  1. Application of microbial α-amylase in industry - A review.

    Science.gov (United States)

    de Souza, Paula Monteiro; de Oliveira Magalhães, Pérola

    2010-10-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  2. Adsorption of amylase enzyme on ultrafiltration membranes

    DEFF Research Database (Denmark)

    Beier, Søren; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios

    2007-01-01

    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of an amylase-F has been measured on two different ultrafiltration membranes, both with a cut-off value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-mo...... is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects can not be neglected. Therefore stagnant film theory and the osmotic pressure model can describe the dependency between flux and bulk concentration....

  3. The activity of granulocyte alpha-amylase in acute appendicitis.

    Science.gov (United States)

    Zakrzewska, I; Gajda, R

    1994-01-01

    The activity of alpha-amylase was measured in isolated granulocytes, serum and urine of 35 patients with acute appendicitis. The measurements were performed before operation and on the 7th day after operation. Slightly increased activity of alpha-amylase was found in the serum and urine of 15 patients. On the 7th day after operation the activity of this enzyme reached normal value. The activity of granulocyte alpha-amylase was elevated in 22 patients. In 2 of them the increased activity still maintained on the 7th day after operation. Positive correlation between the serum and granulocyte alpha-amylase activities was found. These observations allow to conclude that granulocytes are the source of increased alpha-amylase activity in the serum of patients with acute appendicitis.

  4. [Mechanism of amylase action on glucoside starch bonds].

    Science.gov (United States)

    Zherebtsov, N A; Zabelina, L F; Ektoba, A I

    1976-12-01

    Functional groups of glucoamylase and alpha-amylase from Asp. awamori, alpha-amylase from Asp. oryzae and alpha- and beta-amylases from barley malt are identified. Kinetic curves of the activity dependency on pH, values of ionization heats and photooxidative inactivation draw to the conclusion that carboxyl-imidazole system enters into the active site of the enzymes. A hypothetic mechanism of hydrolysis of alpha-1,4-glucoside bond in starch molecule by alpha- and beta-amylases and of alpha-1,4- and alpha-1,6-glucoside bonds by glucoamylase is given. A theory of induced correspondence of enzyme and substrate satisfactorily explains the specificity of the enzyme action and the cause of complete starch convertion into glucose under glucoamylase action and of terminal starch hydrolysis by alpha- and beta-amylases.

  5. The potato amylase inhibitor gene SbAI regulates cold-induced sweetening in potato tubers by modulating amylase activity.

    Science.gov (United States)

    Zhang, Huiling; Liu, Jun; Hou, Juan; Yao, Ying; Lin, Yuan; Ou, Yongbin; Song, Botao; Xie, Conghua

    2014-09-01

    Potato cold-induced sweetening (CIS) is critical for the postharvest quality of potato tubers. Starch degradation is considered to be one of the key pathways in the CIS process. However, the functions of the genes that encode enzymes related to starch degradation in CIS and the activity regulation of these enzymes have received less attention. A potato amylase inhibitor gene known as SbAI was cloned from the wild potato species Solanum berthaultii. This genetic transformation confirmed that in contrast to the SbAI suppression in CIS-resistant potatoes, overexpressing SbAI in CIS-sensitive potatoes resulted in less amylase activity and a lower rate of starch degradation accompanied by a lower reducing sugar (RS) content in cold-stored tubers. This finding suggested that the SbAI gene may play crucial roles in potato CIS by modulating the amylase activity. Further investigations indicated that pairwise protein-protein interactions occurred between SbAI and α-amylase StAmy23, β-amylases StBAM1 and StBAM9. SbAI could inhibit the activities of both α-amylase and β-amylase in potato tubers primarily by repressing StAmy23 and StBAM1, respectively. These findings provide the first evidence that SbAI is a key regulator of the amylases that confer starch degradation and RS accumulation in cold-stored potato tubers.

  6. Albumin activation of urinary amylase as determined with the Du Pont aca.

    Science.gov (United States)

    Garber, C C; Carey, R N

    1978-04-01

    Protein activation of urinary alpha-amylase (EC 3.2.1.1) activity was observed during an evaluation of the Du Pont aca procedure for the determination of urinary alpha-amylase. This activation effect became constant for urinary albumin concentrations exceeding 1.50 g/liter. It is recommended that urinary alpha-amylase be analyzed with sufficient albumin added to maximize this effect. The aca alpha-amylase procedure is compared to an amyloclastic method for both serum and urine analysis. Expected ranges are presented for the aca method for serum and urinary amylase, amylase clearance, and the amylase clearance/creatinine clearance ratio.

  7. The influence of hydrochlorothiazide and tripamide on serum and urinary amylase.

    Science.gov (United States)

    Conrad, K A; Fagan, T C; Simons, J A

    1988-05-01

    Pancreatitis and asymptomatic elevations of serum amylase have been reported after therapy with thiazide diuretics. In the current study, the effects of hydrochlorothiazide and tripamide treatment on serum and urinary amylase excretion were investigated in 12 hypertensive volunteers. Two patients developed modest elevations of the serum amylase above the normal range after 12 weeks of treatment with hydrochlorothiazide 50 mg daily, but the mean serum amylase did not change. Hydrochlorothiazide did not produce a statistically significant increase in urinary amylase excretion but did reduce the ratio of salivary amylase/creatinine clearance in a two-hour urine collection. Tripamide 10 mg daily had no effect on serum or urinary amylase.

  8. Sensitivity of the amylase-creatinine clearance ratio in acute pancreatitis.

    Science.gov (United States)

    Farrar, W H; Calkins, G

    1978-06-01

    An elevated amylase-creatinine clearance ratio has been established as being highly specific for the diagnosis of acute pancreatitis. In the present study, the sensitivity of this test was compared to that of the serum amylase and the one-hour urinary amylase test in 29 patients with acute pancreatitis. Abnormal elevations of the amylase-creatinine clearance ratio were found less frequently than abnormal elevations of the serum and one-hour urinary amylases. Moreover, abnormal elevations of the amylase-creatinine clearance ratio showed less deviation from normal and values returned to normal sooner than those of the serum and one-hour urinary amylases. When compared to the serum amylase and the one-hour urinary amylase tests, the amylase-creatinine clearance ratio is a relatively insensitive test in patients with acute pancreatitis.

  9. Bacillus thuringiensis HCB6 Amylase Immobilization by Chitosan Beads

    Science.gov (United States)

    Zusfahair; Ningsih, D. R.; Kartika, D.; Fatoni, A.; Zuliana, A. L.

    2017-02-01

    The purpose of this study was to optimize the amylase immobilization using a chitosan bead and to characterize immobilized amylase of Bacillus thuringiensis Bacteria HCB6. This study was started of amylase production, continued by immobilization optimization including ratio of chitosan:enzymes, enzyme-matrix contact time, substrate concentration, pH effect, incubation temperature effect, reaction time, and stability of immobilized enzyme. Amylase activity assay was dinitro salicylic (DNS) method. The results showed the optimum chitosan:enzyme ratio was 2.5: 1 (v/v), immobilization contact time of 18 hours and immobilization efficiency of 87.93%. Furthermore, immobilized amylase of B. thuringiensis HCB6 showed optimum substrate concentration of 1.5%, optimum pH of 6, optimum incubation temperature of 37 ° C, and the reaction time of 30 minutes. The Michaelis-Menten constant KM value for free and immobilized amylase were 5.30% and 1.33% respectively. Immobilized amylase can be used up to five times with the remaining activity of 43.3%.

  10. Amylase inhibits Neisseria gonorrhoeae by degrading starch in the growth medium.

    OpenAIRE

    Gregory, M.R.; Gregory, W W; Bruns, D E; Zakowski, J J

    1983-01-01

    Highly purified salivary alpha-amylase inhibited the growth of fresh isolates of Neisseria gonorrhoeae on GC agar base medium supplemented with 2% IsoVitaleX (BBL Microbiology Systems). Hydrolysis of starch in the medium by amylase resulted in a negative starch-iodine test. However, purified amylase did not inhibit gonococcal growth on agar plates that contained hemoglobin (chocolate agar). This effect was not caused by inhibition of amylase, since amylase activity was the same in the presenc...

  11. Primary Structures and Gene Expressions of Pseudomonas Isoamylase and Maltotetraose-Forming Amylase

    OpenAIRE

    藤田, 昌也; フジタ, マサヤ; Masaya, Fujita

    1990-01-01

    Isoamylase and maltotetraose-forming amylase (G_4-amylase) produced by Pseudomonas are important enzymes in the starch industry. The isoamylase hydrolyzes branching points with α-1,6-glucosidic linkages in amylopectin and glycogen, and produces linear maltodextrins. The G_4-amylase catalyzes the release of α-maltotetraose exoglycolytically from the nonreducing ends of starch, whereas other exo-type amylases (glucoamylase and β-amylase) release β-anomeric products by exoglycolytic cleavage, an...

  12. Characterisation of three starch degrading enzymes: thermostable β-amylase, maltotetraogenic and maltogenic α-amylases.

    Science.gov (United States)

    Derde, L J; Gomand, S V; Courtin, C M; Delcour, J A

    2012-11-15

    Maltogenic α-amylase from Bacillus stearothermophilus (BStA) is widely used as bread crumb anti-firming enzyme. A maltotetraose-forming α-amylase from Pseudomonas saccharophila (PSA) was recently proposed as alternative, hence the need to compare both exo-acting enzymes with some endo-action component. A purely exo-acting thermostable β-amylase from Clostridium thermosulfurogenes (CTB) was included for reference purposes. Under the experimental conditions used, temperature optima of the enzymes are rather similar (60-65 °C), but temperature stability decreased in the order BStA, PSA and CTB. The action of the enzymes on different substrates and their impact on the rheological behaviour of maize starch suspensions demonstrated that, while CTB acts exclusively through an exo-action mechanism, BStA displayed limited endo-action which became more pronounced at higher temperatures. PSA has more substantial endo-action than BStA, which is rather temperature independent. This is important for their impact in processes such as breadmaking, where temperature is gradually increased.

  13. Extracellular amylase(s) production by fungi Botryodiplodia theobromae and Rhizopus oryzae grown on cassava starch residue.

    Science.gov (United States)

    Ray, R C

    2004-10-01

    The fungi Botryodiplodia theobromae and Rhizopus oryzae produce extracellular amylase when grown on a liquid medium containing 2% (WN) soluble starch or cassava starch residue(CSR) (as starch equivalent), a waste generated after extraction of starch from cassava, as the sole carbon source. Using CSR as the sole carbon source, the highest amylase activity of 3.25 and 3.8 units (mg, glucose released x ml(-1) x h(-1)) were obtained in shake flask cultures during the late stationary phase of growth of B. theobromae and R. oryzae, respectively. These values were slightly lower than the values obtained using soluble starch as the carbon source. Maximum enzyme synthesis in CSR incorporated medium occurred at the growth temperature of 30 degrees C and pH 6.0. Presence of inorganic NH4+ salts like ammonium acetate and ammonium nitrate in culture medium yielded more amylase than the other nitrogen sources. Amylase(s) production in the controlled environment of a Table-Top glass Jar Fermenter (2-L capacity) was 4.8 and 5.1 units for B. theobromae and R. oryzae, respectively using CSR as the carbon substrate. It is concluded that CSR, a cheap agricultural waste obtained after starch extraction from cassava could replace soluble starch as carbon substrate for commercial production of fungal amylase(s).

  14. Inhibition of Sunn pest, Eurygaster integriceps, α-amylases by α-amylase inhibitors (T-αAI) from Triticale.

    Science.gov (United States)

    Mehrabadi, Mohammad; Bandani, Ali R; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the K(m) remained constant (0.58%) but the maximum velocity (V(max)) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T(50)) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase.

  15. Expression in Escherichia coli of cDNA encoding barley beta-amylase and properties of recombinant beta-amylase.

    Science.gov (United States)

    Yoshigi, N; Okada, Y; Sahara, H; Koshino, S

    1994-06-01

    To express the cloned beta-amylase cDNA in Escherichia coli under control of the tac promoter, a plasmid pBETA92 was constructed. The plasmid consisted of 6312 bp. An extract of E. coli JM109 harboring pBETA92 had beta-amylase activity that produced beta-maltose from soluble starch. The enzyme production started in the logarithmic phase, increased linearly, and reached a maximum after 12 h. The recombinant barley beta-amylase gave two major (pI 5.43 and 5.63) and four minor (pI 5.20, 5.36, 5.80, and 6.13) activity bands on isoelectric focusing, and their pIs didn't change throughout the incubation. But Western blot analysis found that one beta-amylase having a molecular weight of about 56,000 was synthesized. The recombinant beta-amylase was purified from the cells by consecutive column chromatography. The purified enzyme gave a single band of protein on SDS-PAGE but showed heterogeneity on isoelectric focusing. The N-terminal amino acid sequence showed that the recombinant beta-amylase lacked four amino acids at positions 2-5 (Glu-Val-Asn-Val) when compared with the presumed amino acid sequence of barley beta-amylase. Therefore, the recombinant beta-amylase consisted of 531 amino acids, and its molecular weight was calculated to be 59,169. The N-terminal amino acid sequence of the recombinant beta-amylase and the nucleotide sequence of the junction position in plasmid pBETA92 indicated that GTG (Val-5 in the case of barley beta-amylase) at positions 27-29 from the SD sequence (AGGA) was the translation initiation codon. The properties of the recombinant beta-amylase were almost the same as those of barley beta-amylase except for the pI and the Km values for maltohexaose and maltoheptaose.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. An Amylase-Responsive Bolaform Supra-Amphiphile.

    Science.gov (United States)

    Kang, Yuetong; Cai, Zhengguo; Tang, Xiaoyan; Liu, Kai; Wang, Guangtong; Zhang, Xi

    2016-02-01

    An amylase-responsive bolaform supra-amphiphile was constructed by the complexation between β-cyclodextrin and a bolaform covalent amphiphile on the basis of host-guest interaction. The bolaform covalent amphiphile could self-assemble in solution, forming sheet-like aggregates and displaying weak fluorescence because of aggregation-induced quenching. The addition of β-cyclodextrin led to the formation of the bolaform supra-amphiphile, prohibiting the aggregation of the bolaform covalent amphiphile and accompanying with the significant recovery of fluorescence. Upon the addition of α-amylase, with the degradation β-cyclodextrin, the fluorescence of the supra-amphiphile would quench gradually and significantly, and the quenching rate linearly correlated to the concentration of α-amylase. This study enriches the field of supra-amphiphiles on the basis of noncovalent interactions, and moreover, it may provide a facile way to estimate the activity of α-amylase.

  17. Related dipeptide and characteristic dipeptide of optimal pH in alpha-amylase.

    Science.gov (United States)

    Zhang, Ge-Xin; Li, Wei-Jiang

    2002-12-13

    Alpha-amylase is an enzyme of great significance to industry, but most alpha-amylases are unstable at lower pH. In this paper, we have studied the related dipeptide and characteristic dipeptide of optimal pH in alpha-amylase. On analysis, it gives the explicit results as follows: (1) Ten dipeptides are associated with alpha-amylase's optimal pH. AH, DV, EH, HR, and YV are of positive correlation, AM, IC, NG, NL, and PS are of negative correlation. (2) GE, RE, GS, and KS are higher pH alpha-amylase characteristic dipeptides; AS, GS, DY, and GI are high pH alpha-amylase characteristic dipeptides; TE, VR, DS, and ET are middle pH alpha-amylase characteristic dipeptides; DK, NT, PT, and RV are low pH alpha-amylase characteristic dipeptides; AT, DS, GR, and SR are lower pH alpha-amylase characteristic dipeptides.

  18. The structure of two distinct pancreatic amylase genes in mouse strain YBR

    DEFF Research Database (Denmark)

    Mikkelsen, BM; Clark, ME; Christiansen, Gunna;

    1985-01-01

    The amylase complex on mouse chromosome 3 encodes both salivary and pancreatic amylase. It appears that one active gene is present for salivary amylase, whereas pancreatic amylase in some strains is coded by at least 4, and perhaps by more than 10, genes. Strain YBR is different from other strains...... in that it produces twice as much salivary amylase. Pancreatic amylase in YBR is present as two different protein forms, A beta and B beta, the sum of which amounts to only one-third of that in, for instance, strain A/J. YBR chromosomal DNA was cloned in phage gamma, followed by restriction and heteroduplex analysis...... of recombinant phages carrying amylase genes. Among 32 phage isolates, 5 carried parts of the salivary amylase sequence. The remaining phage isolates contained pancreatic amylase-like sequences and represented three nonoverlapping genomic regions, i.e., one of 34 kb containing a complete gene, PAN-II beta...

  19. Study of Serum Amylase and Serum Cholinesterase in Organophosphorus Poisoning

    Directory of Open Access Journals (Sweden)

    Sharan Badiger

    2016-04-01

    Full Text Available Background: Poisoning due to organophosphorus compounds is most commonly seen. Earlier plasma cholinesterase level was used to assess the severity of poisoning. Presently serum amylase is being recommended as a better indicator of severity. Aims and Objectives: To study plasma cholinesterase and serum amylase levels in acute organophosphorus and to correlate serum amylase levels with clinical severity and outcome. Material and Methods: A total of 80 patients in the study admitted to a tertiary care centre within 24 hours with a history of organophosphorus poisoning were included in study. Estimation of plasma cholinesterase and serum rd amylase was done at the time of admission, and on 3 th day and on 5 day. Results: Occurrence of organophosphorus poisoning was more common among age group 21-30 years and among males (57.5%. They were 25 (31.2% farmers, 23 (28.8% st u d e n ts, a n d 2 2 ( 2 7 . 5% h o u s ewi v e s. Monocrotophos (45.0% was commonly used compound. Mean value of plasma cholinesterase and serum amylase at admission are 3693 U/L, and 185.4 U/L. There was significant inhibition of plasma cholinesterase and elevation of serum amylase at th admission with return to normal values on 5 day. Conclusion: Plasma cholinesterase inhibition 200 U/L has been associated with poor prognosis and proneness to respiratory failure.

  20. Production of Alpha Amylase by Bacillus cereus in Submerged Fermentation

    Directory of Open Access Journals (Sweden)

    Helen H. Raplong

    2014-09-01

    Full Text Available Microorganisms have the ability to secrete enzymes when they are grown in the presence of certain substrates. Amylases are among the most important industrial enzymes and are of great significance in biotechnological studies. Bacteria belonging to the genus Bacillus were isolated using mannitol egg yolk polymyxin B (MYP agar a highly selective media for Bacillus cereus isolation. The isolates were tested for α-amylase production on nutrient agar supplemented with starch and in submerged fermentation. The bacteria isolated and identified (using the Microgen Bacillus identification kit were all Bacillus cereus and SB2 had the largest zone of hydrolysis of 12mm on nutrient agar supplemented with starch as well as the highest enzyme activity of 1.62U/ml. Amylase activity of 2.56U/ml was obtained after 24 hours incubation in submerged fermentation. When amylase enzyme production parameters where optimized, maximum amylase activity was obtained at a pH of 6.5, temperature of 350C, incubation time of 24 hours and 4% inoculums concentration. Bacillus cereus SB2 is a potential isolate for alpha-amylase production with soluble starch as the sole carbon source in submerged fermentation.

  1. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    Energy Technology Data Exchange (ETDEWEB)

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. (State Univ. of New York, Buffalo (USA))

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  2. Elevated amylase creatinine clearance ratio and normal serum amylase levels in chronic relapsing pancreatitis after partial pancreatectomy.

    Science.gov (United States)

    Cattau, E L; Garcia-Torres, F

    1980-12-01

    A 29-year-old woman admitted for alcohol detoxification five years after a 90% distal pancreatectomy for chronic pancreatitis had abdominal pain similar to that associated with preoperative pancreatitis. Although her clinical course was consistent with recurrent pancreatitis, the serum amylase level remained normal, but the amylase creatinine clearance ratio became elevated and then returned to normal, paralleling her clinical course. The ACCR may be a useful laboratory method in diagnosing chronic recurrent pancreatitis in patients with decreased functional pancreatic tissue.

  3. Changes of serum amylase, its isozyme fractions and amylase-creatinine clearance ratio in dogs with experimentally induced acute pancreatitis.

    Science.gov (United States)

    Akuzawa, M; Morizono, M; Nagata, K; Hayano, S; Sakamoto, H; Yasuda, N; Okamoto, K; Kawasaki, Y; Deguchi, E

    1994-04-01

    To investigate the diagnostic application of amylase to canine pancreatic diseases, serum amylase activities, its isozyme fractions and amylase-creatinine clearance ratio (ACCR) were analyzed in normal intact dogs and dogs experimentally induced acute pancreatitis. There was no statistic difference between normal male and female dogs. Amylase specific activities in pancreatic tissue extracts were more than 2,300 times higher than that in serum, and were also higher than those in other tissues; parotid and mandibular salivary glands, lung, heart, liver, spleen, duodenum, jejunum, ileum and kidney. Following the chloroform injection into the pancreatic tissue, WBC increased from 6 to 240 hr and serum glucose significantly increased at 72 and 96 hr, and no urine glucose was detected. BUN as well as serum and urine creatinine showed normal levels. ACCR increased until 96 hr without statistic significance. Serum amylase activities increased significantly after 3 hr and its isozyme was separated into 4 fractions (Amy1-Amy4) in contrast to 3 fractions (Amy2-Amy4) in intact dogs. Since this extra Amy1 seen from 1 hr increasing after 6 hr similarly to other 3 fractions, the evaluation of serum amylase and its isozyme fractions was indicated to be useful for the diagnosis of acute pancreatitis in dogs.

  4. [Alpha-amylase determination in acute pancreatitis: selection of a reference standard].

    Science.gov (United States)

    Bachmann, C; Colombo, J P; Lorenz, E

    1979-09-01

    It has been investigated which of the amylase determinations agrees most closely with the clinical diagnosis in a group of patients with acute pancreatitis and in a group with other diseases producing amylase elevation. By measuring the amylase in a urine specimen related to its creatinine concentration fewer values within the range of reference in patients with pancreatitis and also fewer falsely elevated values in the second group were observed when compared to amylase in plasma, urinary amylase activity per volume or the amylase/creatinine clearance ratio.

  5. Adsorption of amylase enzyme on ultrafiltration membranes.

    Science.gov (United States)

    Beier, Søren Prip; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios M; Hansen, Ernst B; Jonsson, Gunnar

    2007-08-28

    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of amylase-F has been measured on two different ultrafiltration membranes, both with a cutoff value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-modified PVDF membrane). The adsorption follows the Langmuir adsorption theory. Thus, the static adsorption consists of monolayer coverage and is expressed both as a permeability drop and an adsorption resistance. From the adsorption isotherms, the maximum static permeability drops and the maximum static adsorption resistances are determined. The maximum static permeability drop for the hydrophobic PES membrane is 75%, and the maximum static adsorption resistance is 0.014 m2.h.bar/L. The maximum static permeability drop for the hydrophilic surface-modified PVDF membrane (ETNA10PP) is 23%, and the maximum static adsorption resistance is 0.0046 m2.h.bar/L. The difference in maximum static adsorption, by a factor of around 3, affects the performance during the filtration of a 5 g/L amylase-F solution at 2 bar. The two membranes behave very similarly during filtration with almost equal fluxes and retentions even though the initial water permeability of the PES membrane is around 3 times larger than the initial water permeability of the ETNA10PP membrane. This is mainly attributed to the larger maximum static adsorption of the PES membrane. The permeability drop during filtration exceeds the maximum static permeability drop, indicating that the buildup layer on the membranes during filtration exceeds monolayer coverage, which is also seen by the increase in fouling resistance during filtration. The accumulated layer on the membrane surface can be described as a continually increasing cake-layer thickness, which is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects cannot be neglected. Therefore, stagnant film theory and the osmotic

  6. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment

    OpenAIRE

    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng

    2016-01-01

    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using...

  7. SERUM AMYLASE: AN EARLY MARKER OF RENAL DAMAGE IN HYPERTENSION

    Directory of Open Access Journals (Sweden)

    Rangaswamy

    2014-08-01

    Full Text Available : INTRODUCTION: Hypertension is one of the risk factors for cardiovascular disease and causes progressive damage to kidney in a long term process. Hypertension impairs glomerular function and also leads to subclinical atherogenesis, there is a excretion of low molecular weight compounds like albumin and amylase in urine. This study was conducted to analyze the changes in amylase levels in hypertension. MATERIAL AND METHODS: This is a hospital based study. The patients attending the medicine department were selected for the study. 60 subjects were selected based on history and clinical examination consisting of 30 hypertensive patients and 30 normotensive subjects in the age group 35-60 years. Blood samples collected in vacutainers were analyzed in the clinical biochemistry laboratory. Serum samples were analyzed for total protein, albumin and amylase. RESULT: The study showed a statistically significant change in the levels of serum albumin and amylase. The level of serum albumin was 3.71 ± 0.22 g/dl in cases while it was 4.14 ± 0.20 g/dl in controls. The serum amylase levels were 99.79 ±13.63 U/L in cases while it was 137.76 ± 16.86 U/L in the control. The p-value was 0.0001 which was statistically significant. CONCLUSION: The initial damage to glomerulus can be detected by the alteration in serum amylase values in hypertension. Thus serum amylase can be considered as an early marker for detecting the renal damage in hypertension

  8. The mechanism of increased renal clearance of amylase in acute pancreatitis.

    Science.gov (United States)

    Warshaw, A L; Lee, K H

    1976-09-01

    Amylase isoenzymes, separated by polyacrylamide gel electrophoresis, were measures in 25 normal persons (mean amylase to creatinine clearance ratio 3.0%), 15 patients with acute pancreatitis (mean clearance ratio 9.5%, P less than 0.0001), and 6 patients with hyperamylasemia due to common duct stones (mean clearance ratio 4.1%). Two isoamylases (P1, P2) resembling pancreatic isoenzymes and three isoamylases (S1, S2, S3) resembling salivary isoenzymes appeared regularly in normal serum and urine. Salivary amylases predominated in serum, but pancreatic amylases predominated in urine. This finding is consistent with renal clearance of pancreatic amylases exceeding that of salivary amylases under normal conditions. In patients with pancreatitis or common duct stones, essentially all of the increased amylase activity in serum and urine was due to pancreatic isoamylases (P1 and P2) in their normal proportions. No new or altered amylase isoenzymes were detected. The fraction of pancreatic amylases in the serum or urine was identical for the two diseases. Whereas the difference in amylase to creatinine clearance ratios observed between the two groups of patients is not a function of different amylase isoenzymes presented to the kidney, we conclude that the increased amylase clearance in acute pancreatitis is caused by an alteration of renal transfer of amylase, either at the glomerulus or tubule.

  9. Amylase:creatinine clearance ratios, serum amylase, and lipase after operations with cardiopulmonary bypass.

    Science.gov (United States)

    Smith, C R; Schwartz, S I

    1983-09-01

    Forty-two adults who underwent cardiac operations were studied prospectively for evidence of clinical or subclinical pancreatitis. Clinically detectable pancreatitis was not seen. Serum amylase and lipase levels did not change significantly following operation. The amylase:creatinine clearance ratio (ACCR) immediately following operation was abnormally elevated in 31% of the samples obtained, and the mean ACCR increased from 2.08 +/- 1.85% before operation to 6.2% +/- 6.77% (P less than 0.05). An abnormally elevated ACCR was most often associated with a low urine creatinine concentration. The mean urine creatinine level decreased significantly from 78 +/- 53 mg/dl before operation to 38 +/- 49 mg/dl immediately following operation (P less than 0.02), and 73% of the samples obtained at that time had an abnormally low urine creatinine level (P less than 0.01). The abnormalities observed in ACCR and urine creatinine could not be related to any of several variables presumed to reflect the degree of perioperative physiologic stress, nor could they be related to postoperative hemodynamic performance. It was concluded that ACCR rises following cardiac operation because of perioperative changes in renal function, and not as a reflection of subclinical pancreatic injury.

  10. Topographies of Organized Monolayer of α-Amylase Observed by Atomic Force Microscopy

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    In this paper, a-amylase organized monolayer was assembled on the surface of the PET-CO2- substrate in different conditions. The different topography of the a-amylase/PET monolayer was obtained by AFM in tapping mode.

  11. Effects of a new microbial α-amylase inhibitor protein on Helicoverpa armigera larvae.

    Science.gov (United States)

    Zeng, Fanrong; Wang, Xiaojing; Cui, Jinjie; Ma, Yan; Li, Qiannan

    2013-03-06

    A new microbial α-amylase inhibitor gene was cloned and characterized. The encoded, recombinant, α-amylase inhibitor protein was induced and expressed by isopropyl β-d-1-thiogalactopyranoside (IPTG) in Escherichia coli M15 cells. The effects of the α-amylase inhibitor protein on Helicoverpa armigera larvae were studied. Compared to the control, the weight of H. armigera larvae fed the diet with recombinant α-amylase inhibitor protein added at a concentration of 20 μg/g was reduced by 49.8%. The total soluble protein of H. armigera larvae fed the diet with the α-amylase inhibitor protein added was also reduced by 36.8% compared to the control. The recombinant α-amylase inhibitor protein showed inhibition activity against α-amylase of H. armigera. These results suggested that this α-amylase inhibitor protein may be a promising bioinsecticide candidate for controlling H. armigera.

  12. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    Science.gov (United States)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  13. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    Science.gov (United States)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  14. The amylase creatinine clearance ratio in acute pancreatitis.

    Science.gov (United States)

    Murray, W R; Mackay, C

    1977-03-01

    One hundred and twenty-two patients have been studied in order to evaluate the usefulness of the amylase creatinine clearance ratio (ACCR) as a simple diagnostic test for acute pancreatitis. Sixteen out of 17 patients with acute pancreatitis had significant elevations in ACCR; in only 10 of these 17 cases was the serum amylase greater than 1200iu/l. The mean ACCR was within the normal range in control patients, in patients with chronic gastro-intestinal disease and in patients with acute abdominal conditions excluding pancreatitis; however, the mean serum amylase was significantly greater in patients with acute abdominal conditions than in the control group (P less than 0-05). The ACCR remained significantly elevated in patients with acute pancreatitis for longer than either serum or urine amylase values. The findings of the study suggest that the amylase creatinine clearance ratio is a simple yet reliable diagnostic test which could be used when screening patients suspected of having acute pancreatitis.

  15. Thermo Stability Study of Crude Amylase from Bacillus Isolate

    Directory of Open Access Journals (Sweden)

    Moti Lal

    2015-09-01

    Full Text Available An amylolytic strain was collected from rotten potato and its activity evaluated. The isolated strain was cultivated for amylase production in shake flasks at 35±2oC and the fermentation pattern was studied. Optimum temperature for maximum enzyme synthesis was observed at 35°C, when initial pH of fermentation medium was adjusted to 5.5. Maximum extracellular amylase activity of 7.9 U/mL and the maximum intracellular activity of 320 U/mL was recorded. Although maximum biomass was present at 12.6 g/L but highest growth rate was observed between 08 to 40h with maximum at 36h. The extracellular amylase present in the broth was partially purified with an overall yield of 44% through purification procedure of ammonium sulphate precipitation. After completed extraction and partial purification and stabilization, the stability of enzyme was observed in a range of temperature and pH between 60°C-90°C and 2-8 pH respectively. Maximum enzyme activity was demonstrated at 90°C, and pH of 5.5 and 6.5. The thermo stability of the amylases of this Bacillus species was comparable to that of amylases from other microbial sources.

  16. Hydrolytic activity of alpha-amylase in anaerobic digested sludge.

    Science.gov (United States)

    Higuchi, Y; Ohashi, A; Imachi, H; Harada, H

    2005-01-01

    Hydrolysis is usually considered to be a rate-limiting step in anaerobic digestion. For improving anaerobic solid waste treatments, it is essential to elucidate the mechanism of hydrolysis. In this study, alpha-amylase, one of the hydrolytic enzymes, was investigated for the elucidation of more precise mechanism of hydrolysis. Alpha-amylase activity of solid starch-degrading bacteria (SDB) was estimated through batch experiments with several different substrates and with distinction between cell-bound and cell-free alpha-amylase. Monitoring of newly isolated strains of SDB was done by fluorescence in situ hybridization. Results indicated that cell-bound alpha-amylase is chiefly responsible for the hydrolysis in the digested sludge, providing very useful information that the contact between microbial cells and solids is significantly important. The activity of alpha-amylase of the digested sludge remained quite low when not required, but increased as they recognized appropriate substrates. Several-fold higher activity was obtained for starch or maltose as compared to glucose only.

  17. [Sensitivity and specificity of blood amylase, amylase and creatinine clearance ratio and urinary amylase/urinary creatinine ratio in the diagnosis of acute pancreatitis].

    Science.gov (United States)

    Ligny, G; Meunier, J C; Hayard, P; Ligny, C; Van Cauter, J

    1987-12-01

    The sensitivity and specificity of amylasemia, the ratios of amylase/creatinine clearance and amylasuria/creatininuria were determined in four groups of patients: a control group (n = 43), patients with acute pancreatitis detected on computed tomography (n = 30, 25 cases of alcoholic pancreatitis), patients with an acute surgical abdomen without pancreatitis (n = 25), and patients with renal failure (n = 20). Sensitivity was defined for the acute pancreatitis group and specificity for the other groups. When amylasemia was greater than 20 UI/dl and the amylasuria/creatininuria ratio greater than 100, sensitivity was 98 per cent. The specificity of these two results in patients with an acute surgical abdomen was 98 per cent. When the ratio amylase/creatinine clearance ratio was greater than 4 sensitivity was 73 per cent and specificity in patients with acute surgical abdomen was 75 per cent. These two values were lower than those of the two preceding tests (p less than 0.01). Sensitivity of the association of an amylasemia greater than 13 UI/dl (m + 2SD) with a clearance ratio greater than 4 was 73 per cent. The amylase/creatinine clearance ratio did not seem to be reliable since its change was delayed with respect to the increase of amylasemia and amylasuria. This ratio has a poor specificity as it increased when the clearance of creatinine decreased in the group with an acute surgical abdomen associated with functional or organic renal failure. In these two groups, the correlation between the amylase/creatinine clearance ratio and creatininemia was significant. This suggested that the clearance of creatinine fell more rapidly than the clearance of amylase as renal failure increased.

  18. THE INFLUENCE OF BETA AMYLASE ON THE DOUGH OBTAINED FROM WHITE FLOURE TYPE 650

    OpenAIRE

    David, Ioan; Corina MISCĂ; Alexandru RINOVETZ; Gabriel BUJANCĂ; Calin JIANU; Marcel DANCI

    2014-01-01

    In this paper we are presenting the enzymatic activity of β-amylase used in different concentrations, in the bread dough. The rheological characteristics of the dough have been obtained by alveographic method. Together with α-amylase and limited dextrinase, β-amylases act on the degradetion of starch, the result being the production of carbohydrates. β-amylase acts on non-reducing end of the polysaccharide chain cleaving maltose residues. Maltose coming from the hydrolysis of starch is the ma...

  19. Regulation and genetic enhancement of beta-amylase production in Clostridium thermosulfurogenes.

    OpenAIRE

    Hyun, H H; Zeikus, J G

    1985-01-01

    We studied the general mechanism for regulation of beta-amylase synthesis in Clostridium thermosulfurogenes. beta-Amylase was expressed at high levels only when the organism was grown on maltose or other carbohydrates containing maltose units. Three kinds of mutants altered in beta-amylase production were isolated by using nitrosoguanidine treatment, enrichment on 2-deoxyglucose, and selection of colonies with large clear zones on iodine-stained starch-glucose agar plates. beta-Amylase was pr...

  20. General Biochemical Characterization of Thermostable Extracellular β-Amylase from Clostridium thermosulfurogenes

    OpenAIRE

    Hyun, H H; Zeikus, J G

    1985-01-01

    Clostridium thermosulfurogenes, an anaerobic bacterium which ferments starch into ethanol at 62°C, produced an active extracellular amylase and contained intracellular glucoamylase but not pullulanase activity. The extracellular amylase was purified 2.4-fold, and its general physicochemical and catalytic properties were examined. The extracellular amylase was characterized as a β-amylase (1,4-α-d-glucan maltohydrolase) based on demonstration of exocleavage activity and the production of malto...

  1. Measuring Stress and Ability to Recover from Stress with Salivary Alpha-Amylase Levels

    Science.gov (United States)

    2011-04-01

    to be resilient. So what is salivary alpha amylase ? To start, an amylase is enzyme in the body that hydrolyzes starch (breaks it down) into...Ability to Recover from Stress with Salivary α- Amylase Levels Authors Brandon L. Mulrine Michael F. Sheehan Lolita M. Burrell Michael...TITLE AND SUBTITLE Measuring Stress and Ability to Recover from Stress with Salivary Alpha Amylase Levels 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  2. Targeted Disruption of the α-Amylase Gene in the Hyperthermophilic Archaeon Sulfolobus solfataricus

    OpenAIRE

    Worthington, Penny; Hoang, Viet; Perez-Pomares, Francisco; Blum, Paul

    2003-01-01

    Sulfolobus solfataricus secretes an acid-resistant α-amylase (amyA) during growth on starch as the sole carbon and energy source. Synthesis of this activity is subject to catabolite repression. To better understand α-amylase function and regulation, the structural gene was identified and disrupted and the resulting mutant was characterized. Internal α-amylase peptide sequences obtained by tandem mass spectroscopy were used to identify the amyA coding sequence. Anti-α-amylase antibodies raised...

  3. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.;

    2005-01-01

    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... insight into the substrate binding by describing residues defining 9 subsites, namely -7 through +2. These structures support that the pseudotetrasaccharide inhibitor acarbose is hydrolyzed by the active enzymes. Moreover, sugar binding was observed to the starch granule-binding site previously determined...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...

  4. Culture medium for amylase production by toxigenic fungi

    Directory of Open Access Journals (Sweden)

    Figueira Edson Luiz Zangrando

    2000-01-01

    Full Text Available Mycelial growth and amylase production by a mycotoxigenic strain of Fusarium moniliforme and Aspergillus flavus were evaluated in a culture medium containing starch, glycerol, wheat bran or corn. With emphasis on corn, different fractions composed by germ, degermed seed, starch, milky stage corn and the respective starch or supernatant fraction were analyzed for F. moniliforme growth . The medium composed of milky stage corn supernatant promoted the best mycelial growth (p<0.05, and it was used to prepare amylase production medium in the next step. The medium composed with 2% ground corn in milky stage corn supernatant (350g of milky stage corn blended with 250mL water and centrifuged promoted the highest amylase production, which was at the 10th day of fermentation, both for F. moniliforme (42.32U/mL and A. flavus (4,745.54U/mL.

  5. Enhancement of the amylase-creatinine clearance ratio in pregnancy.

    Science.gov (United States)

    Naeije, R; Neuray, F; Van Melsen, A; Delcourt, A

    1979-01-01

    The renal clearance of amylase, expressed as a proportion of simultaneous creatinine clearance (Cam/-Ccr), was determined in 131 women in various stages of pregnancy. No abnormal serum levels of amylase were found. A moderate but significant increase in Cam/Ccr occurred during the last 15 weeks of pregnancy. Possible causes for this change were investigated in smaller groups of subjects. No increase in rapidly cleared isoamylase could be detected. No modification in renal tubular handling of protein could be evidenced, as assessed by measurements of the renal clearance of beta 2 microglobulin, expressed as a proportion of simultaneous creatinine clearance. An incrased glomerular permeability to amylase probably accounts for elevated Cam/Ccr in pregnancy.

  6. Anaerobic threshold determination with analysis of salivary amylase.

    Science.gov (United States)

    Calvo, F; Chicharro, J L; Bandrés, F; Lucía, A; Pérez, M; Alvarez, J; Mojares, L L; Vaquero, A F; Legido, J C

    1997-12-01

    The purpose of this study was to determine the anaerobic threshold from analysis of amylase concentration in total saliva during a laboratory exercise test. Each of 20 healthy young men performed both a submaximal and a maximal test on a treadmill. During the submaximal test, capillary blood and total saliva samples were collected for determination of anaerobic threshold (AT) and saliva threshold (Tsa), respectively. Tsa was defined as the point at which the first continuous increase in amylase concentration occurred during exercise. The results showed no significant difference between values of AT and Tsa when both were expressed either as running velocity or as heart rate. In addition, there existed a high correlation between AT and Tsa (r = .93, p < .001). It was therefore concluded that the analysis of amylase concentration in total saliva during exercise might be used as a valid new method for determining AT.

  7. ON THE ACTIVITY OF alpha-AMYLASE IN SOME SPECIES OF ASIAN CYPRINIDS

    Directory of Open Access Journals (Sweden)

    Gabriela Vasile

    2006-08-01

    amylase in two Asian cyprinids namely, bighead carp (Aristichthys nobilis and silver carp (Hypophthalmichthys molitrix. The activity of -amylase has been determined by the Métais-Bieth method, the results obtained being expressed as mg starch / ml x 30 min. Our experimental data evidence some differences between the activity of -amylase from the digestive tube, in the two species under study.

  8. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus... preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture... Bacillus stearothermophilus. Its characterizing enzyme activity is α-amylase (1,4 α-D...

  9. The role of α-amylase in the perception of oral texture and flavour in custards

    NARCIS (Netherlands)

    Wijk, R.A.de; Prinz, J.F.; Engelen, L.; Weenen, H.

    2004-01-01

    The role of salivary α-amylase in odour, flavour, and oral texture sensations was investigated in two studies in which the activity of salivary amylase present in the mouth of human subjects was either increased by presenting custards with added α-amylase or decreased by presenting custards with add

  10. The role of alpha-amylase in the perception of oral texture and flavour in custards

    NARCIS (Netherlands)

    Wijk, de R.A.; Prinz, J.F.; Engelen, L.; Weenen, H.

    2004-01-01

    The role of salivary a-amylase in odour, flavour, and oral texture sensations was investigated in two studies in which the activity of salivary amylase present in the mouth of human subjects was either increased by presenting custards with added alpha-amylase or decreased by presenting custards with

  11. Characterization of a new Bacillus stearothermophilus isolate : a highly thermostable α-amylase-producing strain

    NARCIS (Netherlands)

    Wind, R.D.; Buitelaar, R.M.; Eggink, G.; Huizing, H.J.; Dijkhuizen, L.

    1994-01-01

    A novel strain of Bacillus stearothermophilus was isolated from samples of a potato-processing industry. Compared to known α-amylases from other B. stearothermophilus strains, the isolate was found to produce a highly thermostable α-amylase. The half-time of inactivation of this α-amylase was 5.1 h

  12. The Effects of Curcumin on Alpha Amylase in Diabetics Rats

    Directory of Open Access Journals (Sweden)

    Mahmood Najafian

    2015-12-01

    Full Text Available Background One of the therapeutic approaches to lower postprandial blood glucose is to inhibition breakdown of starch by inhibiting carbohydrate hydrolysis enzymes. Alpha-amylase catalyzes the hydrolysis of α-(1, 4-D-glycosidic linkages of starch and other glucose polymers. Inhibitors of this enzyme could be used in the treatment of diabetes. Objectives Based on this purpose we examined the effect of curcumin on alpha amylase and its IC50 and Ki. Materials and Methods In this experimental study, 60 rats were divided into two major groups, normal and diabetic, and each was subsequently divided into five subgroups. One of them as control group that received grape seed oil and four of them as experimental groups that received curcumin at 10, 20, 40 and 80 mg/kg (each group include six rats. Blood glucose levels were measured every three days. Serum insulin levels were measured three times, in the first day, middle and end of the experimental period. The activity of serum alpha amylase was measured in the end of experimental period. Results The results showed that curcumin is a competitive inhibitor for alpha amylase with IC50 = 51.32 µM and Ki = 20.17 µM. In both diabetic and normal groups in all doses nearly dose dependent manner reduced blood glucose and insulin levels. In both diabetic and normal groups decreased levels of serum alpha amylase activity. Conclusions It may be concluded that curcumin is a potent inhibitor of alpha amylase and has beneficial effects in the treatment of overweight and diabetes

  13. Amylases from orange leaves. Characterization and relation to starch breakdown.

    OpenAIRE

    Sanz Grau, Amparo; Guardiola Bárcena, José Luis

    1988-01-01

    Starch content in adult orange (Citrus sinensis L. Osbeck) leaves was highest at the end of the winter rest period and decreased during flowering and fruit set. Young inflorescence leaves accumulated starch until the June drop period to decrease to a low value at the end of it. Both, α- and ß-amylase activities were found in the leaves and the enzymes separated through Sephadex G100 filtration. By electrophoresis in polyacrylamide gels with 0.25 % amylopectine, α-amylase was resolved in 5 ba...

  14. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    Science.gov (United States)

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  15. The influence of nitrogen sources on the alpha-amylase productivity of Aspergillus oryzae in continuous cultures

    DEFF Research Database (Denmark)

    Pedersen, Henrik; Nielsen, Jens

    2000-01-01

    The influence of the nitrogen source on the cc-amylase productivity of Aspergillus oryzae was quantified in continuous cultivations. Both inorganic and complex nitrogen sources were investigated and glucose was used as the carbon and energy sources. For production of alpha-amylase, nitrate...... in the cc-amylase productivity. The higher alpha-amylase productivity during growth on casein hydrolysate was not caused by increased transcription of the alpha-amylase genes but was caused by a faster secretion of alpha-amylase or by a lower binding of alpha-amylase to the biomass....

  16. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    Science.gov (United States)

    Brisman, J; Belin, L

    1991-09-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme.

  17. Effect of pancreatic stimulation on serum and urine amylase isoenzymes in man.

    Science.gov (United States)

    Derugin, N; MacGregor, I L

    1979-10-01

    Alpha amylase of pancreatic origin is cleared by the kidney more rapidly than the salivary isoamylase. To determine whether alterations in the ratio of pancreatic to salivary amylase in sera caused alterations in over all renal clearance, the clearance of amylase was measured before and after the exocrine pancreas was stimulated with a prolonged intravenous infusion of secretin plus cholecystokinin. Serum and urine samples collected prior to and following stimulation were analyzed for amylase activity and creatinine concentration. Amylase isoenzymes were separated using isoelectric focusing. Over all renal clearance of amylase and of the separated amylase isoenzymes were calculated as a percentage of the clearance of creatinine. The hormone infusion was associated with an increase in serum and urine amylase activities, this increase being mainly accounted for by pancreatic amylase. The renal clearance of the salivary and pancreatic isoamylases was not altered by the hormone infusion but the over all amylase clearance by the kidney rose from 2.31 +/- 0.74 to 3.42 +/- 1.46% of creatinine clearance. In some cases the renal clearance of amylase following stimulation entered the range considered diagnostic for acute pancreatitis.

  18. Macroamylasemia with a markedly increased amylase clearance ratio in a patient with renal cell carcinoma.

    Science.gov (United States)

    Kazmierczak, S C; Van Lente, F; McHugh, A M; Katzin, W E

    1988-02-01

    We report hyperamylasemia, macroamylasemia, and a markedly increased amylase clearance/creatinine clearance ratio in a patient with renal cell carcinoma. Serum amylase activity was characterized as macroamylase by gel exclusion chromatography. Electrophoretic separation revealed an atypical band of amylase, migrating anodal to the S2 control fraction. Electrophoresis of urine revealed the presence of both S1 and S2 fractions, but not the atypical band found in serum. Quantification of the salivary- and pancreatic-type amylase fractions showed amylase in urine to be 100% salivary. Immunofixation disclosed the macroamylase to consist of an immune complex between amylase and IgA-lambda antibody. Binding-capacity studies showed that the serum immunoglobulin was present in excess and could bind 46% and 49% additional S-type amylase activity derived from saliva and the patient's urine, respectively. The amylase clearance/creatinine clearance ratio was markedly supranormal (0.134), unexpected in a patient with macroamylasemia. A biopsy specimen of the renal cell tumor was found to contain significant salivary-type amylase activity. These results suggest production of amylase by tumor tissue in the renal carcinoma and secretion of S-type amylase into the patient's urine. Evidently, macroamylase should be confirmed by gel exclusion chromatography.

  19. Substrate-inhibitor interactions in the kinetics of alpha-amylase inhibition by ragi alpha-amylase/trypsin inhibitor (RATI) and its various N-terminal fragments.

    Science.gov (United States)

    Alam, N; Gourinath, S; Dey, S; Srinivasan, A; Singh, T P

    2001-04-10

    The ragi alpha-amylase/trypsin bifunctional inhibitor (RATI) from Indian finger millet, Ragi (Eleucine coracana Gaertneri), represents a new class of cereal inhibitor family. It exhibits a completely new motif of trypsin inhibitory site and is not found in any known trypsin inhibitor structures. The alpha-amylase inhibitory site resides at the N-terminal region. These two sites are independent of each other and the inhibitor forms a ternary (1:1:1) complex with trypsin and alpha-amylase. The trypsin inhibition follows a simple competitive inhibition obeying the canonical serine protease inhibitor mechanism. However, the alpha-amylase inhibition kinetics is a complex one if larger (> or =7 glucose units) substrate is used. While a complete inhibition of trypsin activity can be achieved, the inhibition of amylase is not complete even at very high molar concentration. We have isolated the N-terminal fragment (10 amino acids long) by CNBr hydrolysis of RATI. This fragment shows a simple competitive inhibition of alpha-amylase activity. We have also synthesized various peptides homologous to the N-terminal sequence of RATI. These peptides also show a normal competitive inhibition of alpha-amylase with varying potencies. It has also been shown that RATI binds to the larger substrates of alpha-amylase. In light of these observations, we have reexamined the binding of proteinaceous inhibitors to alpha-amylase and its implications on the mechanism and kinetics of inhibition.

  20. Drosophila melanogaster larvae control amylase secretion according to the hardness of food

    Directory of Open Access Journals (Sweden)

    Honami eSakaguchi

    2013-08-01

    Full Text Available Drosophila melanogaster larvae excrete amylase and perform external digestion of their food. In this study, to investigate whether their external digestion ability varies in response to changes in the external environment, we measured the relative amount of amylase excreted by larvae using a new method: the iodine starch agar method (ISAM. Analysis using this method revealed that the amount of amylase excreted by larvae increased in accordance with the increase in the agar concentration. In addition, we investigated the effect on the larval growth rate of adding amylase to the diet. Pupation occurred 24 h later in food containing 1% amylase than in food containing no amylase. These results suggest that the larvae adjust their amylase excretion in response to changes in the external environment, and that its level has a marked influence on the larval growth rate.

  1. Spatio-temporal profiling and degradation of α-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, S.; Østergaard, O.

    2007-01-01

    Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... identified only by immunostaining. Mass spectrometry identified 12 full-length forms and 12 fragments from the cultivar Barke. Products of both alpha-amylase 2 entries co-migrated in five full-length and one fragment spot. The alpha-amylase abundance and the number of fragments increased during germination...... and near the C-terminus. Only two shorter fragments were identified of the other alpha-amylase 2 (gi|166985). The 2D gels of dissected tissues showed alpha-amylase degradation to be confined to endosperm. In contrast, the aleurone layer contained essentially only full-length alpha-amylase forms. While only...

  2. Screening of polysaccharides for preparation of α-amylase conjugate to enhance stability and storage life.

    Science.gov (United States)

    Jadhav, Swati B; Singhal, Rekha S

    2013-02-15

    Nine polysaccharides differing in structure and chemical nature were screened for their ability to conjugate with α-amylase by covalent binding for enhancing the thermal and pH stability of α-amylase. Among these polysaccharides, agar, dextran, pectin and xanthan showed better results but dextran stood out among all the polysaccharide for providing both thermal and pH stability to α-amylase. α-Amylase conjugated with agar, dextran, pectin and xanthan showed antimicrobial property with added preservative (0.2% sodium benzoate) in liquid formulation of α-amylase challenged with Bacillus subtilis and Escherichia coli. Dextran was the only polysaccharide which showed significant reduction of microbial growth of challenged organisms and aerobic flora without any preservative added. Aerobic flora could flourish well in the liquid α-amylase, but low temperature (4 °C), dextran, and preservative showed synergistic effect in efficiently increasing the storage life of liquid α-amylase.

  3. Factors affecting the solubility of Bacillus halmapalus alpha-amylase

    DEFF Research Database (Denmark)

    Faber, Cornelius; Hobley, Timothy John; Mollerup, Jørgen

    2008-01-01

    A detailed study of the solubility of recombinant Bacillus halmapalus alpha-amylase has been conducted. A semi-purified preparation from a bulk crystallisation was chos en that contained six isoforms with pI-values of between 5.5 and 6.1. The solubility was strongly affected by pH and could...

  4. Production and properties of alpha-amylase from Citrobacter species

    Directory of Open Access Journals (Sweden)

    Ebuta N. Etim-Osowo

    2009-04-01

    Full Text Available Amylase production by Citrobacter sp. isolated from potato was optimized in batch culture studies under shake flask conditions. Effects and interactions of best sources and levels of carbon and nitrogen estimated by 4 x 5 and 4 x 4 factorial experimental arrangements were significant (P < 0.01 on amylase production. Optimal alpha-amylase yield was obtained in a medium containing sorghum flour (2.0 % w/v and a mixture of (NH42SO4 + soybean meal (1.5% w/v with an initial medium pH of 8.0. Under optimum conditions, amylase yield was maximal (0.499 U/ml after 60h incubation at room temperature (28oC ± 2oC. Characterization studies showed that the enzyme had maximum activity at 60oC, retained 100% of its original activities at 60oC for 2h, was maximally active at pH 7.0 and retained 100% of original activities at pH 9.0 for 2h. Enzyme activity was stimulated by urea, Mg2+, Ca2+ and Zn2+ but inhibited by Hg2+.

  5. Alternative method for quantification of alfa-amylase activity

    Directory of Open Access Journals (Sweden)

    DF. Farias

    Full Text Available A modification of the sensitive agar diffusion method was developed for macro-scale determination of alfa-amylase. The proposed modifications lower costs with the utilisation of starch as substrate and agar as supporting medium. Thus, a standard curve was built using alfa-amylase solution from Aspergillus oryzae, with concentrations ranging from 2.4 to 7,500 U.mL-1. Clear radial diffusion zones were measured after 4 hours of incubation at 20 °C. A linear relationship between the logarithm of enzyme activities and the area of clear zones was obtained. The method was validated by testing α-amylase from barley at the concentrations of 2.4; 60; 300 and 1,500 U.mL-1. The proposed method turned out to be simpler, faster, less expensive and able to determine on a macro-scale α-amylase over a wide range (2.4 to 7,500 U.mL-1 in scientific investigation as well as in teaching laboratory activities.

  6. Changing the thermostability of Bacillus licheniformis a-amylase

    OpenAIRE

    De Cordt, S.; Saraiva, J.; Hendrickx, M.; Maesmans, G.; Tobback, P

    1993-01-01

    We applied "solvent engineering" (i.e. variation of environmental conditions) to and/or irnrnobilized Baci//us licheniforrnis a-amylase covalently onto porous glass beads. In this way, important alterations in its thermostability characteristics (kinactrE Ainactw) ere achieved.

  7. 21 CFR 862.1070 - Amylase test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  8. General Biochemical Characterization of Thermostable Extracellular beta-Amylase from Clostridium thermosulfurogenes.

    Science.gov (United States)

    Hyun, H H; Zeikus, J G

    1985-05-01

    Clostridium thermosulfurogenes, an anaerobic bacterium which ferments starch into ethanol at 62 degrees C, produced an active extracellular amylase and contained intracellular glucoamylase but not pullulanase activity. The extracellular amylase was purified 2.4-fold, and its general physicochemical and catalytic properties were examined. The extracellular amylase was characterized as a beta-amylase (1,4-alpha-d-glucan maltohydrolase) based on demonstration of exocleavage activity and the production of maltose with a beta-anomeric configuration from starch. The beta-amylase activity was stable and optimally active at 80 and 75 degrees C, respectively. The pH optimum for activity and the pH stability range was 5.5 to 6 and 3.5 to 6.5, respectively. The apparent [S](0.5V) and V(max) for beta-amylase activity on starch was 1 mg/ml and 60 U/mg of protein. Similar to described beta-amylase, the enzyme was inhibited by p-chloromercuribenzoate, Cu, and Hg; however, alpha- and beta-cyclodextrins were not competitive inhibitors. The beta-amylase was active and stable in the presence of air or 10% (vol/vol) ethanol. The beta-amylase and glucoamylase activities enabled the organism to actively ferment raw starch in the absence of significant pullulanase or alpha-amylase activity.

  9. Amylase-producing lung cancer: case report and review of the literature.

    Science.gov (United States)

    Katayama, S; Ikeuchi, M; Kanazawa, Y; Akanuma, Y; Kosaka, K; Takeuchi, T; Nakayama, T

    1981-12-01

    A case of hyperamylasemia with lung cancer is described. Macroamylasemia was excluded by a normal amylase/creatinine clearance ratio and by a sedimentation constant obtained by sucrose density gradient centrifugation. Positive immunofluorescent staining of tumor cells with a specific antibody against human salivary amylase and significant amylase activity in the primary tumor and metastases support the hypothesis of independent production of amylase by the lung tumor. Cellulose--acetate membrane electrophoresis demonstrated three bands of amylase activity. The major component corresponded to normal salivary amylase in electrophoretic mobility, isoelectric point and molecular size. The minor bands, one of which occupied about 10% of the total amylase activity in serum, urine and tissue homogenates, demonstrated a lower electrophoretic mobility and a more acidic isoelectric point. Gel filtration and electrophoresis disclosed that these minor bands were derived from an amylase isozyme with a larger molecular size than that of normal salivary amylase. The results suggest ectopic tumor production of heterogenous amylase isozymes, with the larger form being secreted into the circulation.

  10. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents

    Science.gov (United States)

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-01-01

    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  11. Is There Consistency between the Binding Affinity and Inhibitory Potential of Natural Polyphenols as α-amylase Inhibitors?

    Science.gov (United States)

    Xu, Wei; Shao, Rong; Xiao, Jianbo

    2016-07-26

    The inhibitory potential of natural polyphenols for α-amylases has attracted great interests among researchers. The structure-affinity properties of natural polyphenols binding to α-amylase and the structure-activity relationship of dietary polyphenols inhibiting α-amylase were deeply investigated. There is a lack of consistency between the structure-affinity relationship and the structure-activity relationship of natural polyphenols as α-amylase inhibitors. Is it consistent between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors? It was found that the consistency between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors is not equivocal. For example, there is no consistency between the binding affinity and the inhibitory potential of quercetin and its glycosides as α-amylase inhibitors. However, catechins with higher α-amylase inhibitory potential exhibited higher affinity with α-amylase.

  12. Interaction of Salivary alpha-Amylase and Amylase-Binding-Protein A (AbpA of Streptococcus gordonii with Glucosyltransferase of S. gordonii and Streptococcus mutans

    Directory of Open Access Journals (Sweden)

    Tanzer Jason M

    2007-06-01

    Full Text Available Abstract Background Glucosyltransferases (Gtfs, enzymes that produce extracellular glucans from dietary sucrose, contribute to dental plaque formation by Streptococcus gordonii and Streptococcus mutans. The alpha-amylase-binding protein A (AbpA of S. gordonii, an early colonizing bacterium in dental plaque, interacts with salivary amylase and may influence dental plaque formation by this organism. We examined the interaction of amylase and recombinant AbpA (rAbpA, together with Gtfs of S. gordonii and S. mutans. Results The addition of salivary alpha-amylase to culture supernatants of S. gordonii precipitated a protein complex containing amylase, AbpA, amylase-binding protein B (AbpB, and the glucosyltransferase produced by S. gordonii (Gtf-G. rAbpA was expressed from an inducible plasmid, purified from Escherichia coli and characterized. Purified rAbpA, along with purified amylase, interacted with and precipitated Gtfs from culture supernatants of both S. gordonii and S. mutans. The presence of amylase and/or rAbpA increased both the sucrase and transferase component activities of S. mutans Gtf-B. Enzyme-linked immunosorbent assay (ELISA using anti-Gtf-B antibody verified the interaction of rAbpA and amylase with Gtf-B. A S. gordonii abpA-deficient mutant showed greater biofilm growth under static conditions than wild-type in the presence of sucrose. Interestingly, biofilm formation by every strain was inhibited in the presence of saliva. Conclusion The results suggest that an extracellular protein network of AbpA-amylase-Gtf may influence the ecology of oral biofilms, likely during initial phases of colonization.

  13. Purification of [alpha]-amylase from Bacillus lentus cultures

    Energy Technology Data Exchange (ETDEWEB)

    El-Aassar, S.A.; Omar, S.H.; Gouda, M.K.; Abdel-Fattah, A.F. (Alexandria Univ. (Egypt). Botany and Microbiology Dept.); Ismail, A.M. (National Research Center, Cairo (Egypt))

    1992-12-01

    Acetone fractionation of Bacillus lentus culture filtrate yielded the highest [alpha]-amylase activity and the 66.6% fraction reached 13-fold that of the crude enzyme preparation. Gel filtration and ion exchange chromatography afforded a pure [alpha]-amylase (relative molecular mass, 42 000). The pure enzyme was highly active on starch and dextrin. It produced a mixture of oligosaccharides as major products of starch hydrolysis. Maximal activity was reached at 70deg C and pH 6.1. Ca[sup 2+], Na[sup +], K[sup +] and Sr[sup 2+] ions stabilized or slightly stimulated the enzyme whereas Ag[sup +], Co[sup 2+], Hg[sup 2+], Zn[sup 2+], Cd[sup 2+] and Fe[sup 3+] ions strongly inhibited the activity. The enzyme contained 16 amino acids, of which aspartic and glutamic acids were present in the highest proportions. (orig.).

  14. [Amylase-creatinine clearance ratios in burned patients (author's transl)].

    Science.gov (United States)

    Minaire, Y; Marichy, J; Forichon, J; Motin, J

    1978-09-01

    The amylase/creatinine clearance ratio (ACCR) has been examined every 3 days, in 34 burned patients during the 20 days following the accident. This ratio was often abnormal since it was found increased at least on one occasion, in 75% of these patients, to be compared with 23 and 13% for amylase in serum and urine respectively. In another group of 9 burned patients, the ACCR was monitored for time-period between 10 to 52 days. It was observed that a high frequency in increased ACCR was associated with a fatal outcome. Finally simultaneous measurements of ACCR and of the beta2 microglobulin/creatinine clearance ratio (MCCR) showed that increased ACCR were statistically associated with increased MCCR suggesting a decreased renal tubular reabsorption of low molecular weight proteins in these burned patients.

  15. Stabilization of α-amylase by using anionic surfactant during the immobilization process

    Science.gov (United States)

    El-Batal, A. I.; Atia, K. S.; Eid, M.

    2005-10-01

    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10 mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher k/K and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

  16. Complete starch hydrolysis by the synergistic action of amylase and glucoamylase: impact of calcium ions.

    Science.gov (United States)

    Presečki, Ana Vrsalović; Blažević, Zvjezdana Findrik; Vasić-Rački, Durđa

    2013-11-01

    Starch hydrolysis was performed by the synergistic action of amylase and glucoamylase. For that purpose glucoamylase (Dextrozyme) and two amylases (Liquozyme and Termamyl) in different combinations were investigated. Experiments were carried out in the repetitive- and fed-batch modes at 65 °C and pH 5.5 with and without the addition of Ca(2+) ions. 100 % conversion of starch to glucose was achieved in batch experiments. Calcium ions significantly enhanced stability of the amylase Termamyl. The intensity of synergism between amylase Termamyl and glucoamylase Dextrozyme was higher than in the experiments carried out with amylase Liquozyme and Dextrozyme. Mathematical model of the complete reaction system was developed. Using the model, a possible explanation of the synergism between the amylase and glucoamylase was provided.

  17. Enzyme-coding genes as molecular clocks: the molecular evolution of animal alpha-amylases.

    Science.gov (United States)

    Hickey, D A; Benkel, B F; Boer, P H; Genest, Y; Abukashawa, S; Ben-David, G

    1987-01-01

    We constructed a cDNA library for the beetle, Tribolium castaneum. This library was screened using a cloned amylase gene from Drosophila melanogaster as a molecular probe. Beetle amylase cDNA clones were isolated from this bank, and the nucleotide sequence was obtained for a cDNA clone with a coding capacity for 228 amino acids. Both the nucleotide sequence and predicted amino acid sequence were compared to our recent results for D. melanogaster alpha-amylases, along with published sequences for other alpha-amylases. The results show that animal alpha-amylases are highly conserved over their entire length. A broader comparison, which includes plant and microbial alpha-amylase sequences, indicates that parts of the gene are conserved between prokaryotes, plants, and animals. We discuss the potential importance of this and other enzyme-coding genes for the construction of molecular phylogenies and for the study of the general question of molecular clocks in evolution.

  18. Molecular cloning of DNA complementary to Drosophila melanogaster alpha-amylase mRNA.

    Science.gov (United States)

    Benkel, B F; Abukashawa, S; Boer, P H; Hickey, D A

    1987-06-01

    Several lambda clones containing cDNAs from Drosophila melanogaster were identified in a lambda cDNA bank using two different approaches: (i) cross-species hybridization using a mouse amylase cDNA probe, and (ii) probing with a differential probe, generated from Drosophila RNA. An amylase cDNA fragment was used, in turn, for the isolation and characterization of amylase genomic clones. The size of the Drosophila amylase mRNA was estimated at 1650 b. This is comparable with the size of the murine amylase messenger that encodes a protein of similar molecular weight. In Drosophila larvae, amylase mRNA can account for as little as 0.01% of the poly(A)+ RNA under conditions of dietary glucose repression or greater than 1% of poly(A)+ RNA under derepressing dietary conditions.

  19. DNA rearrangement causes multiple changes in gene expression at the amylase locus in Drosophila melanogaster.

    Science.gov (United States)

    Hickey, D A; Benkel, B F; Abukashawa, S; Haus, S

    1988-12-01

    A spontaneous null mutation at the alpha-amylase locus in Drosophila melanogaster was recovered from a laboratory population. The mutant strain was found to lack amylase enzyme production and to produce low, but detectable, levels of amylase mRNA. Moreover, the null strain is also lacking the glucose repression of amylase mRNA production which is seen in wild-type strains. The mutant phenotype correlates with a rearrangement in genomic DNA which, in turn, corresponds to a simple inversion in the arrangement observed most frequently in North American populations of D. melanogaster, including the common laboratory strain, Oregon-R. These results have implications for our understanding of both the evolution of the duplicated amylase gene structure and the regulation of amylase gene expression.

  20. Imunohistochemical Localization of alpha-Amylase in Cotyledons of Vigna mungo Seedlings.

    Science.gov (United States)

    Tomura, H; Koshiba, T; Minamikawa, T

    1985-12-01

    We studied the localization of alpha-amylase with indirect fluorescence microscopy in transversely sectioned cotyledons of Vigna mungo seedlings. Tissue sections were fixed in periodate-lysine-paraformaldehyde and treated with anti-alpha-amylase immunoglobulin G followed by fluorescein isothiocyanate labeled goat anti-rabbit immunoglobulin G. alpha-Amylase appeared in the cells farthest from vascular bundles on the second day of growth and appeared gradually closer to the vascular bundles as growth progressed. The pattern of alpha-amylase appearance was similar in detached cotyledons, indicating that attachment of the embryonic axis has no effect on this pattern. However, in attached cotyledons, alpha-amylase disappeared from the regions where starch grains had been digested, but in detached cotyledons there was no disappearance of alpha-amylase, and digestion was slower than in intact cotyledons.

  1. Imunohistochemical Localization of α-Amylase in Cotyledons of Vigna mungo Seedlings 1

    Science.gov (United States)

    Tomura, Hideaki; Koshiba, Tomokazu; Minamikawa, Takao

    1985-01-01

    We studied the localization of α-amylase with indirect fluorescence microscopy in transversely sectioned cotyledons of Vigna mungo seedlings. Tissue sections were fixed in periodate-lysine-paraformaldehyde and treated with anti-α-amylase immunoglobulin G followed by fluorescein isothiocyanate labeled goat anti-rabbit immunoglobulin G. α-Amylase appeared in the cells farthest from vascular bundles on the second day of growth and appeared gradually closer to the vascular bundles as growth progressed. The pattern of α-amylase appearance was similar in detached cotyledons, indicating that attachment of the embryonic axis has no effect on this pattern. However, in attached cotyledons, α-amylase disappeared from the regions where starch grains had been digested, but in detached cotyledons there was no disappearance of α-amylase, and digestion was slower than in intact cotyledons. Images Fig. 1 Fig. 2 Fig. 3 PMID:16664548

  2. Stabilization of {alpha}-amylase by using anionic surfactant during the immobilization process

    Energy Technology Data Exchange (ETDEWEB)

    El-Batal, A.I. [National Center for Radiation Research and Technology, P.O. Box 29, Nasr City, Cairo (Egypt); Atia, K.S. [Nuclear Research Center, Radioisotopes Applications Division, Abo-Zable, P.O. Box 13759, Cairo (Egypt)]. E-mail: ks_atia@yahoo.com; Eid, M. [National Center for Radiation Research and Technology, P.O. Box 29, Nasr City, Cairo (Egypt)

    2005-10-01

    This work describes the entrapment of {alpha}-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using {gamma} irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized {alpha}-amylase were studied. Covering of {alpha}-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized {alpha}-amylase was increased below the critical micelle concentration (cmc) (10mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized {alpha}-amylase showed a higher k{sub cat}/K{sub m} and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of {alpha}-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

  3. Adrenergic effects on secretion of amylase from the rat salivary glands

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1988-01-01

    The present study was undertaken to investigate the effect of adrenergic agents on secretion of amylase from the salivary glands in vivo. Saliva was collected from the distal oesophagus in conscious rats. Adrenaline increased the concentration of amylase in saliva and serum significantly....... The result of infusion of alpha- and beta-adrenergic antagonists as well as noradrenaline and isoproterenol showed that secretion of salivary amylase is predominantly mediated by stimulation of beta-adrenergic receptors, especially of the beta 1-subtype. Investigation of the isoenzyme pattern in saliva......, pancreatic juice and serum demonstrated that the major component in serum is salivary amylase. This study has shown that beta-adrenergic agents stimulate secretion of amylase from the salivary glands in rats. Though the secretion is mainly exocrine small amounts of amylase is found in serum, which seems...

  4. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270) Using Solid State Fermentation.

    Science.gov (United States)

    Saha, Koel; Maity, Sujan; Roy, Sudeshna; Pahan, Koustav; Pathak, Rishija; Majumdar, Susmita; Gupta, Suvroma

    2014-01-01

    Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270). In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca(+2)), Nitrate (NO3 (-)), and chloride ions (Cl(-)) as well as in the presence of D-inositol and mannitol. Amylase needs calcium ion for the preservation of its structure, activity and stability that proves beneficial also for amylase production using solid state fermentation. The inclusion of ions and sugars in the SSF media is promising which can be explained by the protection offered by them against thermal decay of amylase at various incubation periods at 37°C.

  5. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270 Using Solid State Fermentation

    Directory of Open Access Journals (Sweden)

    Koel Saha

    2014-01-01

    Full Text Available Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270. In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca+2, Nitrate (NO3−, and chloride ions (Cl− as well as in the presence of D-inositol and mannitol. Amylase needs calcium ion for the preservation of its structure, activity and stability that proves beneficial also for amylase production using solid state fermentation. The inclusion of ions and sugars in the SSF media is promising which can be explained by the protection offered by them against thermal decay of amylase at various incubation periods at 37°C.

  6. Early changes of urinary amylase isoenzymes in diabetes mellitus.

    Science.gov (United States)

    Recio, F; Villamil, F; Recio, C; Ferrer, C

    1992-10-01

    The altered excretion of isoenzymes of amylase in urine was used as an early indicator of the loss of electric charges in the glomerular basement membrane, in 202 juvenile-onset insulin-dependent diabetic patients, compared with the pattern of excretion in 51 normal subjects matched for age and sex. Diabetics showed an increased excretion of salivary amylase. The salivary to pancreatic amylase ratio in urine (S/P ratio) was always below 1 in control subjects, but was elevated in 33.2% of diabetics, although microalbuminuria was present in only 26.2% of diabetic patients. The concentrations of other proteins in urine were within the reference ranges in nearly all patients, indicating that the kidney was not seriously affected. The increased salivary amylase excretion was not due to changes in the plasma concentration of any of the isoamylases, but to a real increase in excretion, as its fractional excretion in relation to creatinine clearance was clearly increased (1.0 +/- 0.7 vs. 1.52 +/- 1.99, p ratio of their clearances was also increased (0.35 +/- 0.18 vs. 0.49 +/- 0.61, p > 0.05). Moreover, the prevalence of altered S/P ratios was higher than the prevalence of microalbuminuria (36.6% vs. 18.8% of patients in the first decade of evolution of insulin-dependent diabetes mellitus). Altered S/P ratios were most prevalent in the first decade, whereas microalbuminuria was most prevalent in the second decade of the disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Microbial Alpha-Amylases and their Industrial Applications: A Review

    OpenAIRE

    2012-01-01

    The biotechnological potential of α-amylases from microorganisms has drawn a great deal of attention from various researchers worldwide as likely biological catalysts in a variety of industrial processes. The rapid developments in the field of genetic engineering have given a new impetus to the biotechnology. Biotechnology also offers the potential for new industrial processes that require less energy and are based on renewable raw materialsand environmentally healthy practices.This work repr...

  8. Thermal stability of -amylase in aqueous cosolvent systems

    Indian Academy of Sciences (India)

    Jay Kant Yadav; V Prakash

    2009-09-01

    The activity and thermal stability of -amylase were studied in the presence of different concentrations of trehalose, sorbitol, sucrose and glycerol. The optimum temperature of the enzyme was found to be 50 ± 2°C. Further increase in temperature resulted in irreversible thermal inactivation of the enzyme. In the presence of cosolvents, the rate of thermal inactivation was found to be significantly reduced. The apparent thermal denaturation temperature ()app and activation energy () of -amylase were found to be significantly increased in the presence of cosolvents in a concentration-dependent manner. In the presence of 40% trehalose, sorbitol, sucrose and glycerol, increments in the ()app were 20°C, 14°C, 13°C and 9°C, respectively. The of thermal denaturation of -amylase in the presence of 20% (w/v) trehalose, sorbitol, sucrose and glycerol was found to be 126, 95, 90 and 43 kcal/mol compared with a control value of 40 kcal/mol. Intrinsic and 8-anilinonaphathalene-1-sulphonic acid (ANS) fluorescence studies indicated that thermal denaturation of the enzyme was accompanied by exposure of the hydrophobic cluster on the protein surface. Preferential interaction parameters indicated extensive hydration of the enzyme in the presence of cosolvents.

  9. Biosynthesis of alpha-Amylase in Vigna mungo Cotyledon.

    Science.gov (United States)

    Tomura, H; Koshiba, T

    1985-12-01

    In vitro translation of RNA extracted from Vigna mungo cotyledons showed that alpha-amylase is synthesized as a polypeptide with a molecular mass of 45,000, while cotyledons contain a form of alpha-amylase with a molecular mass of 43,000. To find out whether the 45,000 molecular mass polypeptide is a precursor to the 43,000 found in vivo, the cell free translation systems were supplemented with canine microsomal membrane; when mRNA was translated in the wheat germ system supplemented with canine microsomes, the 45,000 molecular mass form was not processed to a smaller form but the precursor form was partly processed in the membrane-supplemented reticulocyte lysate system. When V. mungo RNA was translated in Xenopus oocyte system, only the smaller form (molecular mass 43,000) was detected. Involvement of contranslational glycosylation in the maturating process of the alpha-amylase was ruled out because there was no effect of tunicamycin, and the polypeptide was resistant to endo-beta-H or endo-beta-D digestion. We interpret these results to mean that the 45,000 molecular mass form is a precursor with a signal peptide or transit sequence, and that the 43,000 molecular mass is the mature form of the protein.

  10. Biosynthesis of α-Amylase in Vigna mungo Cotyledon 1

    Science.gov (United States)

    Tomura, Hideaki; Koshiba, Tomokazu

    1985-01-01

    In vitro translation of RNA extracted from Vigna mungo cotyledons showed that α-amylase is synthesized as a polypeptide with a molecular mass of 45,000, while cotyledons contain a form of α-amylase with a molecular mass of 43,000. To find out whether the 45,000 molecular mass polypeptide is a precursor to the 43,000 found in vivo, the cell free translation systems were supplemented with canine microsomal membrane; when mRNA was translated in the wheat germ system supplemented with canine microsomes, the 45,000 molecular mass form was not processed to a smaller form but the precursor form was partly processed in the membrane-supplemented reticulocyte lysate system. When V. mungo RNA was translated in Xenopus oocyte system, only the smaller form (molecular mass 43,000) was detected. Involvement of contranslational glycosylation in the maturating process of the α-amylase was ruled out because there was no effect of tunicamycin, and the polypeptide was resistant to endo-β-H or endo-β-D digestion. We interpret these results to mean that the 45,000 molecular mass form is a precursor with a signal peptide or transit sequence, and that the 43,000 molecular mass is the mature form of the protein. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16664549

  11. Stability and kinetics of a bifunctional amylase/trypsin inhibitor.

    Science.gov (United States)

    Alagiri, S; Singh, T P

    1993-11-10

    The stability of the bifunctional amylase/trypsin inhibitor from ragi (Indian finger millet, Eleusine coracana) has been studied by methods of circular dichroism, UV absorption and intrinsic fluorescence. The inhibitor is stable in 8 M urea and 6 M guanidine-HCl. In 150 mM NaCl, thermal denaturation does not occur up to 90 degrees C. However, it is irreversibly denatured in 5 mM NaCl if heated over 73 degrees C. The acidic denaturation is reversible in both high and low salt conditions, but it shows different behavior below pH 1.65 under similar salt conditions. The helical content is about 2-4% in the pH range of 7-9 at which the inhibitor is active maximally. The NaCl concentration does not have a significant effect on the secondary structure elements. The beta-strand form does not show much variation under various conditions. Arg34-Leu35 is the reactive peptide bond in the trypsin-binding site. Trp and Tyr are involved in the binding with amylase. The bifunctional inhibitor represents the sum of individual inhibitors of trypsin and amylase.

  12. High maltose-producing. cap alpha. -amylase of Penicillium expansum

    Energy Technology Data Exchange (ETDEWEB)

    Doyle, E.M.; Kelly, C.T.; Fogarty, W.M.

    1989-05-01

    An ..cap alpha..-amylase capable of producing exceptionally high levels of maltose (74%) from starch has been identified from a strain of Penicillium expansum. The enzyme is produced extracellularly and was purified to homogeneity by starch adsorption and Sephadex gel filtration chromatography. P. expansum ..cap alpha..-amylase has a pH optimum of 4.5 and is stable in the pH range of 3.6-6.0. Other properties include a temperature optimum of 60/sup 0/C, a molecular weight of 69 000 and and isoelectrtic point of 3.9. The most outstanding feature of the P. expansum enzyme is its ability to yield 14% more maltose and 17.1% less maltotriose than a currently used commercial enzyme. This may be partly explained by the greater affinity of this new enzyme for maltotriose (K/sub m/=0.76 mM) relative to the commercial enzyme, Fungamyl (K/sub m/=2.9 mM). The enzyme reported here is unique among fungal ..cap alpha..-amylases in being able to produce such high levels of maltose and its physicochemical properties suggest that it has potential for commercial development.

  13. Response of fatty acid synthesis genes to the binding of human salivary amylase by Streptococcus gordonii.

    Science.gov (United States)

    Nikitkova, Anna E; Haase, Elaine M; Vickerman, M Margaret; Gill, Steven R; Scannapieco, Frank A

    2012-03-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment.

  14. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii

    OpenAIRE

    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.; Scannapieco, Frank A.

    2012-01-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were di...

  15. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    OpenAIRE

    Sivasangkary Gandhi; Abu Bakar Salleh; Raja Noor Zaliha Raja Abd. Rahman; Thean Chor Leow; Siti Nurbaya Oslan

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Met...

  16. The screening value of the amylase-creatinine clearance ratio in acute pancreatitis.

    Science.gov (United States)

    Van Hee, R; Hubens, A

    1979-01-01

    The screening value of the amylase creatinine clearance ratio in acute pancreatitis is studied. A series of 28 patients with pancreatic disease is compared with 80 controls and 82 patients with other intra-abdominal disease. The greatest specificity of the amylase creatinine clearance ratio value is reached at the 3.5 level. The amylase creatinine clearance ratio value proves to be of interest, not only in the diagnosis of acute pancreatitis but also in differentiating mild and heavy forms of pancreatitis.

  17. The value of the amylase/creatinine clearance ratio in the diagnosis of acute pancreatitis.

    Science.gov (United States)

    Solomon, A R

    1978-01-01

    Acute pancreatitis usually confronts the clinician with a difficult diagnostic task. For years, the primary laboratory diagnostic tests were the serum and urine amylase and the serum lipase determinations. Recent studies have introduced the concept of the amylase/creatinine clearance ratio as a means of increasing the specificity of the laboratory diagnosis. This paper reviews the laboratory evaluation of acute pancreatitis with emphasis on the rationale, derivation, and specificity of the amylase/creatinine clearance ratio.

  18. Classification of microbial α-amylases for food manufacturing using proteinase digestion

    OpenAIRE

    2014-01-01

    Enzymes produced by microorganisms and plants are used as food additives to aid the processing of foods. Identification of the origin of these enzyme products is important for their proper use. Proteinase digestion of α-amylase products, followed by high performance liquid chromatography (HPLC) analysis, was applied to α-amylase from the mold Aspergillus species, the bacteria Bacillus species, and the actinomycetes Saccharomonospora species. Eighteen commercial products of α-amylase were dige...

  19. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270) Using Solid State Fermentation

    OpenAIRE

    2014-01-01

    Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270). In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca+2), Nitrate (NO3 −), and chloride ions (Cl−) as well as in the presen...

  20. Specificity of serum amylase and amylase creatinine clearance ratio in the diagnosis of acute and chronic pancreatitis.

    Science.gov (United States)

    Grosberg, S J; Wapnick, S; Purow, E; Purow, J R

    1979-07-01

    In 31 patients with pancreatitis, the amylase to creatinine clearance ratio (CACR) was significantly greater than for controls (10.7 +/- 1.7 vs. 2.6 +/- 0.3, P less than .001). Sixteen pancreatitis patients with serum amylase (SAm) within the normal range had a mean CACR significantly greater than that of 19 hospital control patients with normal SAm (9.2 +/- 1.5 vs. 3.0 +/- 0.4, P less than .001). For control patients a highly significant inverse correlation between SAm and CACR was observed. No relationship was detected between these parameters for pancreatitis patients. The results suggest that the CACR may be of aid in establishing the diagnosis of pancreatitis even in patients without hyperamylasemia.

  1. Regulation and genetic enhancement of beta-amylase production in Clostridium thermosulfurogenes.

    Science.gov (United States)

    Hyun, H H; Zeikus, J G

    1985-12-01

    We studied the general mechanism for regulation of beta-amylase synthesis in Clostridium thermosulfurogenes. beta-Amylase was expressed at high levels only when the organism was grown on maltose or other carbohydrates containing maltose units. Three kinds of mutants altered in beta-amylase production were isolated by using nitrosoguanidine treatment, enrichment on 2-deoxyglucose, and selection of colonies with large clear zones on iodine-stained starch-glucose agar plates. beta-Amylase was produced only when maltose was added to cells growing on sucrose in wild-type and catabolite repression-resistant mutant strains, but the differential rate of enzyme synthesis in constitutive mutants was constant regardless of the presence of maltose. In carbon-limited chemostats of wild-type and catabolite repression-resistant mutant stains, beta-amylase was expressed on maltose but not on glucose or sucrose. beta-Amylase synthesis was immediately repressed by the addition of glucose. Therefore, we concluded that beta-amylase synthesis in C. thermosulfurogenes was inducible and subject to catabolite repression. The addition of cAMP did not eliminate the repressive effect of glucose. The mutants were generally characterized in terms of beta-amylase production, growth properties, fermentation product formation, and alterations in glucose isomerase and glucoamylase activities. A hyperproductive mutant produced eightfold more beta-amylase on starch medium than the wild type and more rapidly fermented starch to ethanol.

  2. The Effect of Colloidal Silica Nanoparticles on the Activity of α-Amylase

    Directory of Open Access Journals (Sweden)

    G. R. Behbehani

    2012-12-01

    Full Text Available The effect of silica nanoparticles on the activity of α-amylase is determinations using isothermal titration calorimetry. It was found that the immobilized enzyme activity increased as evidenced by the stability parameters recovered from the extended solvation theory. The stability indexes of the immobilized α-amylase was less than of the free enzyme, thereby the activity of the enzyme was increased as a result of its interaction with silica nanoparticles. The present report shows that silica nanoparticles are activator of -amylase, as the complexes of silica+ -amylase are less stable than the free enzyme.

  3. Cloning and starch degradation profile of maltotriose-producing amylases from Streptomyces species.

    Science.gov (United States)

    Kashiwagi, Norimasa; Miyake, Michiru; Hirose, Shuichi; Sota, Masahiro; Ogino, Chiaki; Kondo, Akihiko

    2014-11-01

    The end products from starch hydrolysis by amylases have important applications in various industries. Here, two amylases derived from two Streptomyces species that hydrolyze soluble starch from potato produced maltotriose as the primary maltooligosaccharide product. The genes, annotated as putative glycoside hydrolases, were cloned and expressed in Streptomyces lividans. These amylases displayed hydrolysis activity from pH 3 to 9.5 and were not affected by Ca(2+.) Optimal production of maltotriose was between 20 and 30 °C at pH 6.5. At the optimal temperature, both amylases produced maltotriose-rich end products rather than either maltose or maltotetraose.

  4. Unique features of several microbial α-amylases active on soluble and native starch

    OpenAIRE

    Sarian, Fean Davisunjaya

    2016-01-01

    Starch is the main energy store of major agricultural crops such as corn, potato, rice and wheat. Various amylase type enzymes are used to convert cooked starch to glucose that goes into bioethanol fermentation. Only a few amylase type enzymes have been described that can act on the starch granule itself. Granular starch has a complex crystalline structure that prevents most amylases to directly act on it. In this PhD thesis the action of several amylases on native granular starch was studied...

  5. A very high amylase can be benign in paediatric Crohn's disease.

    Science.gov (United States)

    Venkataraman, Devasmitha; Howarth, Lucy; Beattie, Robert Mark; Afzal, Nadeem Ahmad

    2012-07-10

    A 12.5-year-old boy with Crohn's disease with abdominal pain had a raised amylase of 1835 IU/l with normal lipase levels. Ultrasound showed no evidence of inflammation of pancreas. The amylase to creatinine clearance ratio, was 0.8% (reference interval 2%-5%; >6% consistent with acute pancreatitis; amylase with a corresponding reduced clearance of amylase in his urine, positively supporting the diagnosis of macroamylasemia. Macroamylasemia has no clinical significance other than misdiagnosis as acute pancreatitis. Awareness of this condition is important and a positive diagnosis should always be made to avoid unnecessary changes in treatments.

  6. Determination of renal clearances of amylase/creatinine with chromogenic and enzymatic methods.

    Science.gov (United States)

    Hohenwallner, W; Wimmer, E; Sommer, R

    1979-12-01

    Urinary amylase was estimated by chromogenic (amylochrome Roche) as well as enzymatic methods (SKI and Beckman: substrate starch and substrate maltotetraose respectively). Random and timed urines (24 hour collections) were analysed. Clearances of amylase gave different results dependent upon the amylase-test used and the glomerular filtration rate. Correlation between chromogenic and enzymatic methods (starch as substrate) was poor. The ratio of amylase and creatinine clearance was used to test different methods. Reference values for this ratio for the amylochrome method (N = 106) were 2.85 +/- 0.99% and for the Beckman-DS method (N = 60) 2.82 +/- 0.87%.

  7. Amylase: creatinine clearance ratio and urinary excretion of lysozyme in acute pancreatitis and acute duodenal perforation.

    Science.gov (United States)

    Berger, G M; Cowlin, J; Turner, T J

    1976-09-18

    The amylase:creatinine clearance ratio in patients suffering from acute pancreatitis or acute duodenal perforation was higher than normal in both groups of patients. These findings cast doubt on the value of this parameter as a specific index of acute pancreatitis. The mechanism or mechanisms underlying the increased amylase excretion have not been determined. However, the markedly elevated urinary excretion of lysozyme observed in some patients suggests, by analogy, that diminished tubular reabsorption of amylase may contribute towards the elevated amylase:creatinine ratio.

  8. Renal clearance of pancreatic and salivary amylase relative to creatinine in patients with chronic renal insufficiency.

    Science.gov (United States)

    Keogh, J B; McGeeney, K F; Drury, M I; Counihan, T B; O'Donnell, M D

    1978-12-01

    Pancreatic and salivary amylase/creatinine clearance ratios in patients with various degrees of renal impairment were compared with those obtained for control subjects. In chronic renal insufficiency (mean GFR 30 ml/min +/- 15 SD; n = 13) the clearance ratios for pancreatic (mean 3.5 +/- 1.85 SD) and salivary (mean 2.3 +/- 1.3 SD) amylase were significantly higher (P less than 0.05) than those in controls. Corresponding control values (n = 26) were 2.64 +/- 0.86 (pancreatic) and 1.64 +/- 0.95 (salivary). Three patients showed values above the normal limit. In the diabetic group (mean GFR 41 ml/min +/- 22 SD; n = 10) salivary amylase/creatinine clearance ratios (mean 2.36 +/- 1.55 SD) were significantly higher than in controls (P less than 0.05). Three patients showed raised values. Pancreatic amylase clearance was raised in only one of these patients. Three patients with terminal disease (mean GFR 10 ml/min) showed markedly raised (two- to threefold) clearance ratios for both salivary and pancreatic amylase. Of a total of 26 patients, eight had increased total amylase/creatinine clearance ratios. Pancreatic amylase/creatinine clearance was increased in seven patients, while nine patients showed raised salivary amylase/creatinine ratios. Patients with raised clearance ratios did not have clinical evidence of pancreatitis. We suggest that, in the presence of impaired renal function, a high amylase/creatinine clearance ratio need not be indicative of pancreatic disease.

  9. AMYLASE PRODUCTION BY ASPERGILLUS NIGER UNDER SOLID STATE FERMENTATION USING AGROINDUSTRIAL WASTES

    Directory of Open Access Journals (Sweden)

    Suganthi

    2011-02-01

    Full Text Available Solid state fermentation holds tremendous potentials for the production of the enzyme amylase by Aspergillus niger. Different solid substrates like rice bran, wheat bran, black gram bran, coconut oil cake, gingely oil cake and groundnut oil cake are rich in starch. These agro industrial residues are cheap raw materials for amylase production. Aspergillus niger BAN3E was identified to be the best producer of amylase. When A. niger BAN3E was incubated for 6 days at 37°C it showed high yield of amylase in groundnut oil cake substratein solid state fermentation. Sucrose and nitrogen improved the yield in the same medium.

  10. Paper-based α-amylase detector for point-of-care diagnostics.

    Science.gov (United States)

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar

    2016-04-15

    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase.

  11. [Amylase inhibitors from Streptomyces lucensis VKPM Ac-1743 and Streptomyces violaceus VKPM Ac-1734].

    Science.gov (United States)

    Sharova, N Iu

    2015-01-01

    Inhibitors synthesized by the Streptomyces lucensis VKPM AS-1743 and Streptomyces violaceus VKPM AS-1734 strains were studied for their influence on amylases of different origin. The effect of the inhibitors was shown to be different on fungal amylase, pancreatic amylase, and amylase from human blood. It has been found that the studied inhibitors are substances of a pseudooligosaccharide nature and exhibit their activity and stability over a wide range of pH and temperature values. The physico-chemical and biochemical properties of isolated inhibitors were compared with those of known microbial inhibitors of α-glucosidases.

  12. Development of a nutritious low viscosity weaning mix using natural ingredients and microbial amylases.

    Science.gov (United States)

    Chakravarthi, S; Kapoor, Rashmi

    2003-09-01

    A nutritious weaning food was developed using natural ingredients; namely, staple cereals and pulses, groundnut, Spirulina and gooseberry. The nutritive value of the developed weaning mix was found to be better than a commercial mix. The viscosity of the mixes was reduced by the addition of bacterial and fungal amylases. Addition of amylases at a concentration of 0.1-0.4% drastically reduced the viscosity in all the formulated mixes. The maximum viscosity reduction effect was evident at 0.2% for bacterial amylase and at 0.4% for fungal amylases.

  13. Influence of addition of amylase preparation to dough on fermentative activity of baker's yeast

    Directory of Open Access Journals (Sweden)

    Dodić Jelena M.

    2005-01-01

    Full Text Available Dough samples with different content of amylases were investigated immediately after mixing and after 7, 14 and 30 days of frozen storage. The obtained results show that the fermentation time is shorter, both in fresh and frozen samples, when amylase sample 1 was added, compared to dough without enzymes. The addition of amylase 2 to dough resulted in minimal decrease of "rising" time, both is frozen and fresh dough samples. The rising time of fresh samples was shorter when amylase 3 was added to dough. The specific fermentative activity of fresh dough samples is increasing by about 10% compared to the control sample, for all amounts of amylase 1 and 2 added to the do- ugh. The fermentative activity of yeast in frozen samples increased by 5-10%, after keeping of dough with the addition of amylase 1 for 14 days. The specific fermentative activity of fresh dough samples increased compared to the control, for all amounts of added amylase 3 to the dough. In frozen dough samples the fermentative activity of yeast decreased by 10% for all added amounts of amylase 3. Baked goods made of fresh and frozen dough, prepared with the addition of amylase 1, are better than the ones made of control dough sample, considering all evaluated parameters.

  14. Production and characterization of amylases from Zea mays malt

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus

    2009-08-01

    Full Text Available In this work the α and β-amylase enzymes were obtained from maize (Zea mays malt and were biochemistry characterized. A germination study to obtain the maize malt with good amylase activity was made. The maize seeds were germinated in laboratory and the enzymatic activity was measured daily. Activity dependence to germination time were fitted to an exponential model (A=A0eµt, which showed that the behaviour of enzymatic activity in the germination process was similar to the growth of the microorganism. Its model could be applied to describe the mechanism of α-amylase production for each maize varieties and others cereals. Maize malt characterization showed that α and β-amylase had optimal pH between 4-6.5, optimal temperature 50 and 90ºC, and molecular weight of 67.4 and 47.5kDa, respectively. This work contributed with the advances in biotechnology generating of conditions for application of a new and of low price amylases source.Neste trabalho as enzimas α e β-amilases foram obtidas de malte de milho e depois foram caracterizadas bioquimicamente. Um estudo da germinação foi feito para obtenção do malte com boa atividade amilásica. A germinação ocorreu em escala laboratorial e a atividade enzimática foi medida diariamente. Um modelo exponencial do tipo A=A0eµt foi ajustado a dependência do tempo de germinação com a atividade, mostrando que o comportamento da atividade enzimática no processo de germinação é semelhante ao crescimento de microorganismos. Este modelo pode ser aplicado para descrever o mecanismo de produção da α-amilase para cada variedade de milho e de outros cereais. A caracterização do malte de milho mostrou que as α e β-amilase têm pH ótimo entre 4,0-6,5, temperatura ótima de 50 e 90ºC, e massa molar de 67,4 e 47,5 kDa, respectivamente. Este trabalho contribuiu com os avanços da biotecnologia gerando condições de emprego de uma nova e barata fonte de amilases.

  15. Starch supplementation modulates amylase enzymatic properties and amylase B mRNA level in the digestive gland of the Pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Huvet, A; Jeffroy, F; Daniel, J Y; Quéré, C; Le Souchu, P; Van Wormhoudt, A; Boudry, P; Moal, J; Samain, J F

    2012-09-01

    In the oyster Crassostrea gigas consumption-related traits, amylase properties and growth were found to be linked through genotypes that differed for polymorphism in the two amylase genes AMYA and AMYB. Modulation of AMYA mRNA level had already been observed in response to food availability, whereas the functional role of AMYB was still unknown. To improve knowledge about the regulation of amylase expression in C. gigas and the respective roles of the two genes, we made an assay of amylase expression at mRNA and enzymatic levels in the digestive gland of oysters that had received dietary supplements of starch. After 18 days, a significant increase of translatable mRNA for AMYB was observed, with a correlated increase in Michaelis-Menten constant Km values and a decrease in total amylase activity. This modulation is the first evidence of observable functioning of AMYB in digestive processes. Amylase B is suggested to display a higher Km than amylase A, offering a means of adapting to high substrate concentrations. The highest starch supplement level (10 mgL(-1)) induced alteration in oyster physiology. The 1 mgL(-1) treatment should be tested as a practical food supplement that could lead to growth benefits for oysters.

  16. High-resolution α-amylase assay combined with high-performance liquid chromatography−solid-phase extraction−nuclear magnetic resonance spectroscopy for expedited identification of α-amylase inhibitors – proof of concept and α-amylase inhibitor in cinnamon

    DEFF Research Database (Denmark)

    Okutan, Leyla; Kongstad, Kenneth Thermann; Jäger, Anna

    2014-01-01

    -resolution α-amylase inhibition profiles allowed detection of sub-microgram amounts of the α-amylase inhibitors. Furthermore, the high-resolution α-amylase inhibition assay/HPLC–HRMS–SPE–NMR platform allowed identification of cinnamaldehyde as the α-amylase inhibitor in cinnamon (Cinnamomum verum Presl.).......Type 2 diabetes affects millions of people worldwide, and new improved drugs or functional foods containing selective α-amylase inhibitors are needed for improved management of blood glucose. In this article the development of a microplate-based high-resolution α-amylase inhibition assay...... with direct photometric measurement of α-amylase activity is described. The inhibition assay is based on porcine pancreatic α-amylase with 2-chloro-4-nitrophenyl-α-d-maltotriose as substrate, which this gives a stable, sensitive, and cheap inhibition assay as requested for high-resolution purposes...

  17. Characterization of barley [beta]-amylase for application in maltose production

    Energy Technology Data Exchange (ETDEWEB)

    Thacker, S.P.; Ramamurthy, V.; Kothari, R.M.

    1992-09-01

    A simple procedure is devised to extract [beta]-amylase preparation in a form suitable for commercial applications from germinated barley. [alpha]-Amylase activity in the [beta]-amylse preparation was neglibible to warrant its further purification. This preparation showed enzymatic activity over a braod pH and temperature range, suitable for conversion of starch to high purity maltose. (orig.).

  18. Phylogenetic and biochemical characterization of a novel cluster of intracellular fungal alpha-amylase enzymes

    NARCIS (Netherlands)

    van der Kaaij, R. M.; Janecek, S.; van der Maarel, M. J. E. C.; Dijkhuizen, L.; Janeček, Š.

    2007-01-01

    Currently known fungal alpha-amylases are well-characterized extracellular enzymes that are classified into glycoside hydrolase subfamily GH13_1. This study describes the identification, and phylogenetic and biochemical analysis of novel intracellular fungal a-amylases. The phylogenetic analysis sho

  19. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation.

    Science.gov (United States)

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  20. Structure and expression of alpha-amylase gene from Vigna mungo.

    Science.gov (United States)

    Yamauchi, D; Takeuchi, H; Minamikawa, T

    1994-06-01

    A single copy of the alpha-amylase gene, composed of three introns and four exons, was found in Vigna mungo. Examination of levels of alpha-amylase and its mRNA in detached cotyledons indicated that attachment of the embryonic axis is not required for expression of the gene in cotyledons of germinating seeds.

  1. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    Science.gov (United States)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  2. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    Science.gov (United States)

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  3. Use of activated carbons to remove undesirable residual amylase from factory and refinery streams

    Science.gov (United States)

    In recent years, there has been increased world-wide concern over residual (carry-over) activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were develope...

  4. A simplified method for detecting macroamylasemia by measuring serum amylase activity at different reaction temperatures.

    Science.gov (United States)

    Koda, T; Kuratsune, H; Kurahori, T

    1983-06-01

    Amylase activity in serum and urine, and isoamylase, were measured in 300 patients with abdominal pain to detect cases of macroamylasemia. Of these patients, 9 had hyperamylasemia and 2 were diagnosed as cases of macroamylasemia on the basis of their amylase/creatinine clearance ratio, the gel filtration pattern of their amylase on a dextran column, and results of immunological analysis. Amylase activity in macroamylasemia is reported to show an anomalous response to increase in reaction-temperature. In this report, measurements of the temperature-activity relationships of serum amylase confirmed that the ratio of serum amylase activity at 50 degrees C to that at 25 degrees C (AMY-50 degrees C/AMY-25 degrees C ratio) in patients with macroamylasemia was higher than that in normal subjects or patients with pancreatitis. Moreover, when macromolecular amylase in the sera of patients with macroamylasemia was separated from amylase of normal molecular weight by dextran gel chromatography, it showed a significantly higher AMY-50 degrees C/AMY-25 degrees C ratio than the latter. Measurement of this AMY-50 degrees C/AMY-25 degrees C ratio seems to be a convenient and useful method for differential diagnosis of hyperamylasemia.

  5. Copy number polymorphism of the salivary amylase gene: implications in human nutrition research.

    Science.gov (United States)

    Santos, J L; Saus, E; Smalley, S V; Cataldo, L R; Alberti, G; Parada, J; Gratacòs, M; Estivill, X

    2012-01-01

    The salivary α-amylase is a calcium-binding enzyme that initiates starch digestion in the oral cavity. The α-amylase genes are located in a cluster on the chromosome that includes salivary amylase genes (AMY1), two pancreatic α-amylase genes (AMY2A and AMY2B) and a related pseudogene. The AMY1 genes show extensive copy number variation which is directly proportional to the salivary α-amylase content in saliva. The α-amylase amount in saliva is also influenced by other factors, such as hydration status, psychosocial stress level, and short-term dietary habits. It has been shown that the average copy number of AMY1 gene is higher in populations that evolved under high-starch diets versus low-starch diets, reflecting an intense positive selection imposed by diet on amylase copy number during evolution. In this context, a number of different aspects can be considered in evaluating the possible impact of copy number variation of the AMY1 gene on nutrition research, such as issues related to human diet gene evolution, action on starch digestion, effect on glycemic response after starch consumption, modulation of the action of α-amylases inhibitors, effect on taste perception and satiety, influence on psychosocial stress and relation to oral health.

  6. Halophiles as a source of polyextremophilic α-amylase for industrial applications

    Directory of Open Access Journals (Sweden)

    Sumit Kumar

    2016-02-01

    Full Text Available Halophiles are perceived as an excellent source of novel enzymes possessing inherent ability to function under saline and hypersaline environment conditions. The article covers and puts in perspective the structural and biocatalytic features of α-amylases from halophilic sources. The choice of α-amylase as the target enzyme is based on the fact that this is among the largest selling enzymes. Oligosaccharide synthesis is favored in presence of organic solvents and at high temperature. For this reason, the demand for α-amylases that are functional at high temperature and salt as well as stable towards organic solvents, is on the rise in recent years. Halophilic α-amylases are deemed to possess all the above characteristics. They are generally salt stable. In terms of water activity, saline environments are similar to non-aqueous systems. Therefore halophilic α-amylases also exhibit stability in organic solvents. In this context, the review encompasses α-amylase producing predominant halophilic microorganisms from saline habitats; strategies adopted for purification of halophilic α-amylase; their salient structural features and unique functional characteristics. Halophilic α-amylase applications and future aspects in research are also analyzed.

  7. CHARACTERIZATION OF A NEW BACILLUS-STEAROTHERMOPHILUS ISOLATE - A HIGHLY THERMOSTABLE ALPHA-AMYLASE-PRODUCING STRAIN

    NARCIS (Netherlands)

    WIND, RD; BUITELAAR, RM; EGGINK, G; HUIZING, HJ; DIJKHUIZEN, L

    1994-01-01

    A novel strain of Bacillus stearothermophilus was isolated from samples of a potato-processing industry. Compared to known alpha-amylases from other B. stearothermophilus strains, the isolate was found to produce a highly thermostable alpha-amylase. The half-time of inactivation of this alpha-amylas

  8. Phylogenetic and biochemical characterization of a novel cluster of intracellular fungal α-amylase enzymes

    NARCIS (Netherlands)

    Kaaij, R.M. van der; Janeček, Š.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2007-01-01

    Currently known fungal α-amylases are well-characterized extracellular enzymes that are classified into glycoside hydrolase subfamily GH13_1. This study describes the identification, and phylogenetic and biochemical analysis of novel intracellular fungal α-amylases. The phylogenetic analysis shows t

  9. Further Experiments on Gibberellin-Stimulated Amylase Production in Cereal Grains

    Science.gov (United States)

    Coppage, Jo; Hill, T. A.

    1973-01-01

    Experiments conducted on wheat and barley grains to analyze activities of alpha- and beta-amylase enzymes. Gibberellins were used exogenously. Techniques are described in detail. Results on different cultivars revealed that beta-amylase was not an invariable result of imbibition. Techniques employed can be used by school students. (PS)

  10. Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations

    DEFF Research Database (Denmark)

    Spohr, Anders Bendsen; Carlsen, Morten; Nielsen, Jens Bredal;

    1997-01-01

    Three alpha-amylase producing strains of Aspergillus oryzae used for recombinant protein production have been studied with respect to growth and protein production. By comparing the three strains with respect to morphology and protein production it is shown that a morphological mutant with a more...... dense mycelium is more efficient in producing alpha-amylase....

  11. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121 Using Solid State Fermentation

    Directory of Open Access Journals (Sweden)

    Dibyangana Raul

    2014-01-01

    Full Text Available Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF for α-amylase production has been used in lieu of submerged fermentation (SmF due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30–70% (NH42SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  12. Binding of carbohydrates and protein inhibitors to the surface of alpha-amylases

    DEFF Research Database (Denmark)

    Bozonnet, Sophie; Bønsager, Birgit Christine; Kramhoft, B.

    2005-01-01

    This review on barley alpha-amylases 1 (AMY1) and 2 (AMY2) addresses rational mutations at distal subsites to the catalytic site, polysaccharide hydrolysis, and interactions with proteinaceous inhibitors. Subsite mapping of barley alpha-amylases revealed 6 glycone and 4 aglycone substrate subsite...

  13. Oral Fusobacterium nucleatum subsp. polymorphum binds to human salivary α-amylase.

    Science.gov (United States)

    Zulfiqar, M; Yamaguchi, T; Sato, S; Oho, T

    2013-12-01

    Fusobacterium nucleatum acts as an intermediate between early and late colonizers in the oral cavity. In this study, we showed that F. nucleatum subsp. polymorphum can bind to a salivary component with a molecular weight of approximately 110 kDa and identified the protein and another major factor of 55 kDa, as salivary α-amylase by time-of-flight mass spectrometry and immuno-reactions. Salivary α-amylase is present in both monomeric and dimeric forms and we found that formation of the dimer depends on copper ions. The F. nucleatum adhered to both monomeric and dimeric salivary α-amylases, but the numbers of bacteria bound to the dimeric form were more than those bound to the monomeric form. The degree of adherence of F. nucleatum to four α-amylases from different sources was almost the same, however its binding to β-amylase was considerably decreased. Among four α-amylase inhibitors tested, acarbose and type 1 and 3 inhibitors derived from wheat flour showed significant activity against the adhesion of F.nucleatum to monomeric and dimeric amylases, however voglibose had little effect. Moreover F. nucleatum cells inhibited the enzymatic activity of salivary α-amylase in a dose-dependent manner. These results suggest that F. nucleatum plays more important and positive role as an early colonizer for maturation of oral microbial colonization.

  14. Unique features of several microbial α-amylases active on soluble and native starch

    NARCIS (Netherlands)

    Sarian, Fean Davisunjaya

    2016-01-01

    Starch is the main energy store of major agricultural crops such as corn, potato, rice and wheat. Various amylase type enzymes are used to convert cooked starch to glucose that goes into bioethanol fermentation. Only a few amylase type enzymes have been described that can act on the starch granule i

  15. Serum amylase activity and renal amylase activity clearance in patients with severely impaired renal function and in patients treated with renal allotransplantation.

    Science.gov (United States)

    Pedersen, E B; Brock, A; Kornerup, H J

    1976-03-01

    Serum amylase activity was measured in 29 nondialysed patients with severe renal failure, in 24 uraemic patients treated with chronic haemodialysis, and in 29 patients treated with renal allotransplantation. Simultaneous measurement of renal amylase activity clearance (CAm) and creatinine clearance (CCr) was performed in 25 patients with severe renal failure and in 19 transplanted patients. Serum amylase activity was elevated in all three groups. CAm was significantly correlated to CCr both in the group with severe renal failure and in the transplanted group. Unlike in the group of transplanted patients, the ratio CAm/CCr was significantly increased in patients with severe impaired renal function. It is concluded that the elevation of serum amylase activity in patients with impaired renal function is primarily due to decreased glomerular filtration rate. The value of CAm/CCr for diagnosing acute pancreatitis is doubtful in patients with severe renal disease.

  16. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    OpenAIRE

    Kuhn, H.; Fietzek, P P; Lampen, J O

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  17. Kontrasepsi Hormonal Meningkatkan Kadar α-Amylase Saliva

    Directory of Open Access Journals (Sweden)

    Juni Handajani

    2014-06-01

    Full Text Available Salivary α-amylase atau α-amylase saliva (SAA adalah salah satu enzim dalam saliva yang berperan penting pada inisiasi digesti karbohidrat dan fungsi interaksi bakteri. Kontrasepsi hormonal sangat populer di Indonesia untuk mencegah kehamilan. Penelitian ini bertujuan untuk mengetahui kadar SAA wanita pemakai kontrasepsi pil dan suntik. Subjek penelitian sebanyak 30 perempuan usia 20-35 tahun. Prosedur penelitian telah mendapat persetujuan dari Komite Etik Fakultas Kedokteran Universitas Gadjah Mada Yogyakarta. Subjek dibagi menjadi 3 kelompok (pemakai kontrasepsi pil, suntik, dan kontrol, masing-masing 10 perempuan. Kriteria subjek antara lain subjek sehat, tidak menggunakan alat ortodontik, protesa atau mahkota, serta menggunakan kontrasepsi hormonal lebih dari 3 bulan. Sampel saliva dikumpulkan pada sore hari (16.00-18.00 WIB selama 1 menit dengan metode tanpa stimulasi. Kadar tingkat SAA diukur menggunakan ELISA kit (Salimetrics LLC dengan Optical Density (OD pada 405 nm. Data dianalisis menggunakan ANOVA (p<0,05. Hasil penelitian menunjukkan kadar SAA tertinggi pada perempuan pemakai kontrasepsi  pil dan ada perbedaan yang signifikan diantara tiga kelompok. Disimpulkan bahwa kontrasepsi hormonal meningkatkan kadar SAA. Hormonal Contraceptive Increased The Level of Salivary Α-Amylase. Salivary α-amylase (SAA is one of the most important enzymes in saliva. This enzyme was mainly involved in the initiation of the digestion of starch in the oral cavity and has significant bacterial interactive function. Hormonal contraceptives are very popular in Indonesia to avoid pregnancy. This study aimed to evaluate the level of SAA in woman who taking pill and by injection contraceptives. Thirty women were in subjects, 20-35 years old, approval ethical clearance from Ethic Committee Medical Faculty of Gadjah Mada University, Yogyakarta Indonesia. Subjects were divided into three groups (taking pill contraceptive, by injection contraceptive and

  18. Transglycosylation of neohesperidin dihydrochalcone by Bacillus stearothermophilus maltogenic amylase.

    Science.gov (United States)

    Cho, J S; Yoo, S S; Cheong, T K; Kim, M J; Kim, Y; Park, K H

    2000-02-01

    Neohesperidin dihydrochalcone (NHDC), a sweet compound derived from citrus fruits, was modified to a series of its oligosaccharides by transglycosylation activity of Bacillus stearothermophilus maltogenic amylase (BSMA). Maltotriose as a donor was reacted with NHDC as an acceptor to glycosylate for the purpose of increasing the solubility of NHDC. Maltosyl-NHDC was a major transglycosylation product among the several transfer products by TLC analysis. The structure of the major transglycosylation product was determined to be maltosyl-alpha-(1,6)-neohesperidin dihydrochalcone by MALDI-TOF/MS and (1)H and (13)C NMR. Maltosyl-NHDC was 700 times more soluble in water and 7 times less sweet than NHDC.

  19. Amylase production by endophytic fungi Cylindrocephalum sp. isolated from medicinal plant Alpinia calcarata (Haw. Roscoe

    Directory of Open Access Journals (Sweden)

    V. H. Sunitha.

    2012-09-01

    Full Text Available Amylases are among the most important enzymes used in modern biotechnology particularly in the process involving starch hydrolysis. Fungal amylase has large applications in food and pharmaceutical industries. Considering these facts, endophytic fungi isolated from the plant Alpinia calcarata (Haw. Roscoe were screened for amylolytic activity on glucose yeast extract peptone agar (GYP medium. Among thirty isolates of endophytic fungi, isolate number seven identified as Cylindrocephalum sp. (Ac-7 showed highest amylolytic activity and was taken for further study. Influence of various physical and chemical factors such as pH, temperature, carbon and nitrogen sources on amylase production in liquid media were studied. The maximal amylase production was found to be at 30ºC and at pH 7.0 of the growth medium. Among the various carbon and nitrogen sources tested, maltose at 1.5% and Sodium nitrate at 0.3% respectively gave optimum amylase production.

  20. Repeated batch fermentation from raw starch using a maltose transporter and amylase expressing diploid yeast strain.

    Science.gov (United States)

    Yamakawa, Syun-ichi; Yamada, Ryosuke; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

    2010-06-01

    We successfully demonstrated batch ethanol fermentation repeated ten times from raw starch with high ethanol productivity. We constructed a yeast diploid strain coexpressing the maltose transporter AGT1, alpha-amylase, and glucoamylase. The introduction of AGT1 allows maltose and maltotriose fermentation as well as the improvement of amylase activities. We also found that alpha-amylase activity during fermentation was retained by the addition of 10 mM calcium ion and that the highest alpha-amylase activity was 9.26 U/ml during repeated fermentation. The highest ethanol productivity was 2.22 g/l/h at the fourth batch, and after ten cycles, ethanol productivity of more than 1.43 g/l/h was retained, as was alpha-amylase activity at 6.43 U/ml.

  1. Clinical Performance of a Salivary Amylase Activity Monitor During Hemodialysis Treatment

    Directory of Open Access Journals (Sweden)

    Masaru Shimazaki

    2008-01-01

    Full Text Available The hemodialysis procedure is thought to be a physical stressor in the majority of hemodialyzed patients. Previous studies suggest that elevated salivary amylase level may correlate with increased plasma norepinephrine level under psychological and physical stress conditions. In this study, we investigated biological stress reactivity during hemodialysis treatment using salivary amylase activity as a biomarker. Seven patients (male/female = 5/2, age:67.7+ /− 5.9 years who had been receiving regular 4 h hemodialysis were recruited. Salivary amylase activity was measured using a portable analyzer every hour during the hemodialysis session. Salivary amylase activity was shown to be relatively stable and constant throughout hemodialysis, whereas there were significant changes in systolic blood pressure and pulse rate associated with blood volume reduction. Our results show that hemodialysis treatment per se dose not affect salivary amylase activity.

  2. Clinical significance of elevated serum and urine amylase levels in patients with appendicitis.

    Science.gov (United States)

    Swensson, E E; Maull, K I

    1981-12-01

    During the 45 month period beginning January 1977, 251 patients with a pathologically confirmed diagnosis of acute appendicitis underwent celiotomy at the Medical College of Virginia Hospital. A preoperative serum or urine amylase determination was recorded in 155 of the patients (62 percent). Of this group, 15 patients (10 percent) had elevation of serum amylase or 2 hour urine amylase. Hyperamylasemia or hyperamylasuria directly led to misdiagnosis or treatment delay in 5 of the 15 patients. Appendiceal rupture occurred in three patients, two of whom had prolonged (greater than 1 month) hospitalizations directly attributable to the misdiagnosis. As a result of this study, we conclude that (1) acute appendicitis and elevated amylase levels may occur concurrently, (2) hyperamylasemia or hyperamylasuria should not dissuade the surgeon from early operation if other clinical features suggest appendicitis, and (3) abdominal pain and elevation of amylase level define significant intraabdominal disease, not specifically pancreatic disease.

  3. Amylase/creatinine clearance ratio in diabetic ketoacidosis: a case report.

    Science.gov (United States)

    Boybeyi, Ozlem; Ergür, Ayça Törel; Dursun, Zarife Esra; Gülerman, Fulya

    2014-11-01

    Diabetic ketoacidosis (DKA) accompanies any other intra-abdominal pathology. Serum amylase/lipase levels are commonly used in order to rule out acute pancreatitis in patients having abdominal pain in DKA. A more specific and noninvasive diagnostic tool - amylase/creatinine clearance ratio (ACCR) - can be used to rule out pancreatitis in patients with DKA. A 14-year-old girl was admitted with abdominal pain and nausea. She had been followed up for type 1 diabetes mellitus for the last 5 years. The serum amylase levels were increased up to 687 U/L (normal: 28-120 U/L) on the third day of hospitalization. Simultaneous serum and urinary amylase concentrations were measured, and ACCR was calculated (1.2%). The diagnosis of pancreatitis was ruled out. The serum amylase levels decreased in the following days, and she was discharged. ACCR determination is a simple and specific test to diagnose pancreatitis, especially in patients with DKA.

  4. Spatio-temporal profiling and degradation of alpha-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, Sabrina; Østergaard, Ole

    2007-01-01

    Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... increased during germination. Assessing the fragment minimum chain length by peptide mass fingerprinting suggested that alpha-amylase 2 ( gi vertical bar 4699831) initially was cleaved just prior to domain B that protrudes from the (beta alpha)(8)-barrel between beta-strand 3 and alpha-helix 3, followed...... by cleavage on the C-terminal side of domain B and near the C-terminus. Only two shorter fragments were identified of the other alpha-amylase 2 (gi vertical bar 166985). The 2D gels of dissected tissues showed alpha-amylase degradation to be confined to endosperm. In contrast, the aleurone layer contained...

  5. Classification of microbial α-amylases for food manufacturing using proteinase digestion.

    Science.gov (United States)

    Akiyama, Takumi; Yamazaki, Takeshi; Tada, Atsuko; Ito, Yusai; Otsuki, Noriko; Akiyama, Hiroshi

    2014-09-01

    Enzymes produced by microorganisms and plants are used as food additives to aid the processing of foods. Identification of the origin of these enzyme products is important for their proper use. Proteinase digestion of α-amylase products, followed by high performance liquid chromatography (HPLC) analysis, was applied to α-amylase from the mold Aspergillus species, the bacteria Bacillus species, and the actinomycetes Saccharomonospora species. Eighteen commercial products of α-amylase were digested with trypsin and endoproteinase Lys-C and HPLC analyzed. For some proteinase/sample combinations, the area of the intact α-amylase peak decreased and new peaks were detected after digestion. The presence and retention times of the novel peaks were used to group the products. The results from this method, called the proteinase digestion-HPLC method, allowed the classification of the α-amylase products into 10 groups, whereas the results from sodium dodecyl sulfate polyacrylamide gel electrophoresis allowed their classification into seven groups.

  6. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji;

    2004-01-01

    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors.......-type trypsin inhibitor family of the beta-trefoil fold proteins. Diverse approaches including site-directed mutagenesis, hybrid constructions, and crystallography have been used to characterise the structures and contact residues in the AMY2/BASI complex. The three-dimensional structure of the AMY2/BASI...

  7. Improved detection of amylase activity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with copolymerized starch.

    Science.gov (United States)

    Martínez, T F; Alarcón, F J; Díaz-López, M; Moyano, F J

    2000-08-01

    An improved method, based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for detection of amylase activity is described. This method will allow better characterization of certain amylases than that obtained by the Davis technique. The main features of the technique are: (i) identification of amylase bands and molecular mass determination are possible in the same gel; (ii) the hydrolysis of copolymerized substrate during electrophoretic separation is prevented using very low temperatures instead of inactivating agents such as chelating agents; and (iii) the technique is applicable to reveal amylase activity in a wide range of biological samples. The method is not useful for enzymes sensitive to SDS and for high molecular mass amylases.

  8. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    OpenAIRE

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  9. Low serum amylase in association with metabolic syndrome and diabetes: A community-based study

    Directory of Open Access Journals (Sweden)

    Kakei Masafumi

    2011-04-01

    Full Text Available Abstract Background Low serum amylase levels may reflect impaired exocrine-endocrine relationship in the pancreas. However, few clinical studies have addressed this issue. Therefore, in this epidemiological study, we investigated whether low serum amylase was associated with the pathogenesis of impaired insulin action: metabolic syndrome (MetS and diabetes. Research Design and Methods Serum amylase, cardiometabolic risk factors, MetS (Adult Treatment Panel III criteria, and diabetes were examined in 2,425 asymptomatic subjects aged 30-80 years who underwent medical checkups recently (April 2009-March 2010 and 5 years ago. Results Clinical variables, except for age and estimated glomerular filtration rate (eGFR, shifted favorably with increasing serum amylase levels. Plasma glucose levels at 1- and 2-hr during OGTT increased significantly with decreasing serum amylase levels. Multiple logistic analyses showed that, compared with highest quartile of serum amylase, lowest quartile was associated with increased risk for MetS and diabetes after adjustment for confounding factors [odds ratio (95% CI, 2.07 (1.39-3.07 and 2.76 (1.49-5.11, respectively]. In subjects who underwent checkups 5 years ago (n = 571, lower amylase at the previous checkup were associated with larger numbers of metabolic abnormalities at the recent checkup. The fluctuation over time in serum amylase levels in subjects with low serum amylase at the previous checkup was slight and was unaffected by kidney dysfunction. Conclusions Our results indicate that low serum amylase is associated with increased risk of metabolic abnormalities, MetS and diabetes. These results suggest a pancreatic exocrine-endocrine relationship in certain clinical conditions.

  10. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.

    Science.gov (United States)

    Houba, R; Heederik, D J; Doekes, G; van Run, P E

    1996-07-01

    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers.

  11. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation

    Institute of Scientific and Technical Information of China (English)

    Kei; Nakajima

    2016-01-01

    For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations(CNVs) in the salivary amylase gene(AMY1), which range more broadly than the pancreatic amylase gene(AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent(minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance(major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome.

  12. Study of conformation and thermodynamics of α-amylase interaction with ethylene in vitro.

    Science.gov (United States)

    Hu, Yiwei; Zhang, Guangxian; Zhang, Fengxiu

    2016-10-01

    In this article, the conformation and thermodynamics of α-amylase interaction with ethylene in vitro were investigated. The ultraviolet (UV) absorption showed a strong peak of α-amylase treated with 6.04, 29.32 and 262.11μmolL(-1) ethylene appears at ~222nm and a weak peak at 278nm blue-shifted 1nm. Circular dichroism (CD) spectra indicated that the conformations of α-amylase treated with 29.32 and 262.11μmolL(-1) ethylene were obviously changed in which α-helix content were decreased by 20 and 31% respectively, and β-sheet, β-turn and random coil contents were increased by contrast. Fluorescence spectra suggested that the peak intensities of α-amylase at 342nm were obviously increased with the ethylene increase from 6.04 to 525.75μmolL(-1) and more than control group. The binding constants K between ethylene and α-amylase were 3.318×10(6), 4.407×10(6) and 5.125×10(6)Lmol(-1) at 288, 298 and 308K, respectively. And the calculated values of ΔH(0) and ΔS(0) are positive, which suggests that the interaction between ethylene and α-amylase is an endothermic reaction. The negative ΔG(0) values implied that the direct effect of ethylene on α-amylase conformation was spontaneous. The possible reason is that ethylene molecules were easily embedded into the interior of α-amylase in term of the hydrophobic force between α-amylase and ethylene, causing the conformation and thermodynamics changes of α-amylase.

  13. ISOLATION AND IDENTIFICATION OF AMYLASE PRODUCING YEASTS IN ‘TELLA’ (ETHIOPIAN LOCAL BEER AND THEIR AMYLASE CONTRIBUTION FOR ‘TELLA’ PRODUCTION

    Directory of Open Access Journals (Sweden)

    Berhanu Andualem

    2013-08-01

    Full Text Available ‘Tella’ is local beer which is used in most part of Ethiopia. It is made from cereals, such as barley, wheat, maize and other crops. Rhamnus prinoides is also used to provide a special aroma and flavor as well as antiseptic agent. The objective of this study is to determine the contribution of amylases from tella yeast isolates and compare with the role of amylase from malt. House hold ‘tella’ samples were collected and plated on starch agar and then amylase positive isolates of yeast were identified by folding iodine solution over the starch agar. Amylase assay and activities were investigated by standard methods and compared with amylase from malt. According to this study, the activity of amylases which was extracted from yeast isolates was very low and may have no contribution in the conversion of starch into fermentable sugars. Thus, it is better to avoid such organisms from ‘tella’ fermentation in order to discriminate unwanted bio-products. In conclusion, the substrates and ingredients should be sterilized and introduced into the fermentation system aseptically.

  14. Salivary Alpha-Amylase Reactivity in Breast Cancer Survivors

    Directory of Open Access Journals (Sweden)

    Cynthia Wan

    2016-03-01

    Full Text Available The two main components of the stress system are the hypothalamic-pituitary-adrenal (HPA and sympathetic-adrenal-medullary (SAM axes. While cortisol has been commonly used as a biomarker of HPA functioning, much less attention has been paid to the role of the SAM in this context. Studies have shown that long-term breast cancer survivors display abnormal reactive cortisol patterns, suggesting a dysregulation of their HPA axis. To fully understand the integrity of the stress response in this population, this paper explored the diurnal and acute alpha-amylase profiles of 22 breast cancer survivors and 26 women with no history of cancer. Results revealed that breast cancer survivors displayed identical but elevated patterns of alpha-amylase concentrations in both diurnal and acute profiles relative to that of healthy women, F (1, 39 = 17.95, p < 0.001 and F (1, 37 = 7.29, p = 0.010, respectively. The average area under the curve for the diurnal and reactive profiles was 631.54 ± 66.94 SEM and 1238.78 ± 111.84 SEM, respectively. This is in sharp contrast to their cortisol results, which showed normal diurnal and blunted acute patterns. The complexity of the stress system necessitates further investigation to understand the synergistic relationship of the HPA and SAM axes.

  15. Antidiabetic Indian Plants: A Good Source of Potent Amylase Inhibitors

    Directory of Open Access Journals (Sweden)

    Menakshi Bhat

    2011-01-01

    Full Text Available Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG. Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L. Sprengel; Ocimum tenuflorum (L. (syn: Sanctum; Syzygium cumini (L. Skeels (syn: Eugenia jambolana; Linum usitatissimum (L. and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor.

  16. Supplementation of laying japanese quail with amylase, phytase and protease

    Directory of Open Access Journals (Sweden)

    Josimar Santana Ribeiro

    2015-07-01

    Full Text Available The objective of this study was to evaluate the effects of supplementation of diets for laying Japanese quail with amylase, phytase and protease alone or in combination. Three-hundred quail were assigned to a completely randomized design consisting of five treatments and six repetitions, with 10 animals per experimental unit. The treatments were: a control diet and diets supplemented with 300 ppm amylase, 300 ppm protease and 500 phytase units (FTU/kg and the combination of these enzymes. In the diets containing the enzymes, the nutritional requirements of one or more of the following components were reduced: protein, digestible amino acids, energy, calcium and phosphorus, giving priority to the use of enzymes. The evaluations were performed over four periods of 21 days each. Performance (mean egg production, feed intake, mean egg weight, and feed conversion, egg quality (proportion of egg constituents and specific egg weight, and dietary nutrient digestibility (apparent digestibility coefficient of dry matter and crude protein were evaluated. There was no significant effect of the treatments on the variables analyzed (P>0.05, indicating that the enzymes, alone or in combination, have beneficial effects, maintaining performance and egg quality of Japanese quail.

  17. Effects of dietary amylase and sucrose on productivity of cows fed low-starch diets.

    Science.gov (United States)

    Vargas-Rodriguez, C F; Engstrom, M; Azem, E; Bradford, B J

    2014-07-01

    Recent studies have observed positive effects of both sucrose and exogenous amylase on the productivity of dairy cattle. Our objective was to evaluate direct effects and interactions of amylase and sucrose on dry matter intake (DMI), milk production, and milk components. Forty-eight multiparous Holstein cows between 70 and 130 d in milk were randomly assigned to each of 4 pens (12 cows/pen). Pens were randomly assigned to treatment sequence in a 4 × 4 Latin square design, balanced for carryover effects. Treatment periods were 28 d, with 24 d for diet adaptation and 4d for sample and data collection. The treatments were a control diet (36% NDF and 21% starch), the control diet with amylase [0.5 g/kg of DM; Ronozyme RumiStar 600 (CT); DSM Nutritional Products Ltd., Basel, Switzerland], a diet with sucrose replacing corn grain at 2% of DM, and the sucrose diet with amylase (0.5 g/kg of DM). All data were analyzed with mixed models, including the fixed effects of sugar, amylase, and their interaction, and the random effects of period and pen. Milk data included the random effects of cow nested within pen and pen × period to provide the error term for the pen-level analysis. Dry matter intake was not affected by treatments. Milk yield and milk composition were not altered by the inclusion of sucrose or amylase; however, a tendency for an amylase × sucrose interaction was observed for milk protein content, reflecting slightly lower milk protein concentrations for amylase and sucrose treatments (3.00 and 2.99 ± 0.03%) compared with the control and amylase + sucrose treatments (3.02 and 3.03 ± 0.03%). Solids-corrected and fat-corrected milk yields were not significantly altered by treatment, although the direct effect of amylase approached significance for both variables, suggesting possible small increases with amylase supplementation (~0.5 kg/d). Feed efficiency (energy-corrected milk divided by dry matter intake) numerically increased with either amylase (1.57 ± 0

  18. Protein engineering in the alpha-amylase family: catalytic mechanism, substrate specificity, and stability.

    Science.gov (United States)

    Svensson, B

    1994-05-01

    Most starch hydrolases and related enzymes belong to the alpha-amylase family which contains a characteristic catalytic (beta/alpha)8-barrel domain. Currently known primary structures that have sequence similarities represent 18 different specificities, including starch branching enzyme. Crystal structures have been reported in three of these enzyme classes: the alpha-amylases, the cyclodextrin glucanotransferases, and the oligo-1,6-glucosidases. Throughout the alpha-amylase family, only eight amino acid residues are invariant, seven at the active site and a glycine in a short turn. However, comparison of three-dimensional models with a multiple sequence alignment suggests that the diversity in specificity arises by variation in substrate binding at the beta-->alpha loops. Designed mutations thus have enhanced transferase activity and altered the oligosaccharide product patterns of alpha-amylases, changed the distribution of alpha-, beta- and gamma-cyclodextrin production by cyclodextrin glucanotransferases, and shifted the relative alpha-1,4:alpha-1,6 dual-bond specificity of neopullulanase. Barley alpha-amylase isozyme hybrids and Bacillus alpha-amylases demonstrate the impact of a small domain B protruding from the (beta/alpha)8-scaffold on the function and stability. Prospects for rational engineering in this family include important members of plant origin, such as alpha-amylase, starch branching and debranching enzymes, and amylomaltase.

  19. α-Amylase: an enzyme specificity found in various families of glycoside hydrolases

    DEFF Research Database (Denmark)

    Janeček, Štefan; Svensson, Birte; MacGregor, E. Ann

    2014-01-01

    α-Amylase (EC 3.2.1.1) represents the best known amylolytic enzyme. It catalyzes the hydrolysis of α-1,4-glucosidic bonds in starch and related α-glucans. In general, the α-amylase is an enzyme with a broad substrate preference and product specificity. In the sequence-based classification system...... of all carbohydrate-active enzymes, it is one of the most frequently occurring glycoside hydrolases (GH). α-Amylase is the main representative of family GH13, but it is probably also present in the families GH57 and GH119, and possibly even in GH126. Family GH13, known generally as the main α-amylase...... family, forms clan GH-H together with families GH70 and GH77 that, however, contain no α-amylase. Within the family GH13, the α-amylase specificity is currently present in several subfamilies, such as GH13_1, 5, 6, 7, 15, 24, 27, 28, 36, 37, and, possibly in a few more that are not yet defined. The α-amylases...

  20. Ultrasonic effect on the desizing efficiency of α-amylase on starch-sized cotton fabrics.

    Science.gov (United States)

    Hao, Longyun; Wang, Rui; Fang, Kuanjun; Liu, Jingquan

    2013-07-25

    Enzymatic desizing by α-amylase and ultrasound irradiation are the two important clean technologies in the textile industry. In the present work, with the aim of giving a further insight to the influence of ultrasound on α-amylase activity and its desizing efficiency, the ultrasound-based experiments were afforded in two ways: (i) step-wise treatment of α-amylase by ultrasound and then enzymatic desizing, as well as; (ii) simultaneous utilization of ultrasound and α-amylase for the desizing. By the step-wise strategy, it is found that the ultrasound has negative impact on the α-amylase activity using soluble starch as substrate. However, the sonicated α-amylase possesses higher desizing efficiency because there are higher hydrophobic interactions between sonicated α-amylase protein and starch-sized cotton and thus intensifies its catalytic activity. By the simultaneous procedure, the enhancement to desizing efficiency is more pronounced than that by the step-wise procedure. This can be attributed to comprehensive actions of several reasons such as more effective stirring/mixing mechanism, damages or changes to substrate, more effective catalysis to hydrolytic reactions and faster removal of loosened products from the fabric bulk.

  1. An analytical method for measuring α-amylase activity in starch-containing foods.

    Science.gov (United States)

    Koyama, Kazuo; Hirao, Takashi; Toriba, Akira; Hayakawa, Kazuichi

    2013-05-01

    The quality of starch-containing foods may be significantly impaired by contamination with very small amounts of α-amylase, which can enzymatically hydrolyze the starch and cause viscosity loss. Thus, for quality control, it is necessary to have an analytical method that can measure low amylase activity. We developed a sensitive analytical method for measuring the activity of α-amylase (from Bacillus subtilis) in starch-containing foods. The method consists of six steps: (1) crude extraction of α-amylase by centrifugation and filtration; (2) α-amylase purification by desalting and anion-exchange chromatography; (3) reaction of the purified amylase with boron-dipyrromethene (BODIPY)-labeled substrate, which releases a fluorescent fragment upon digestion of the substrate, thus avoiding interference from starch derivatives in the sample; (4) stopping the reaction with acetonitrile; (5) reversed-phase solid-phase extraction of the fluorescent substrate to remove contaminating dye and impurities; and (6) separation and measurement of BODIPY fluorescence by HPLC. The proposed method could quantify α-amylase activities as low as 10 mU/mL, which is enough to reduce the viscosity of starch-containing foods.

  2. Repeated fermentation from raw starch using Saccharomyces cerevisiae displaying both glucoamylase and α-amylase.

    Science.gov (United States)

    Yamakawa, Syun-ichi; Yamada, Ryosuke; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

    2012-05-10

    A diploid yeast strain displaying both α-amylase and glucoamylase was developed for repeated fermentation from raw starch. First, the construct of α-amylase was optimized for cell surface display, as there have been no reports of α-amylase-displaying yeast. The modified yeast displaying both glucoamylase and α-amylase produced 46.5 g/l of ethanol from 200 g/l of raw corn starch after 120 h of fermentation, and this was 1.5-fold higher when compared to native α-amylase-displaying yeast. Using the glucoamylase and modified α-amylase co-displaying diploid strain, we repeated fermentation from 100g/l of raw starch for 23 cycles without the loss of α-amylase or glucoamylase activity. The average ethanol productivity and yield during repeated fermentation were 1.61 g/l/h and 76.6% of the theoretical yield, respectively. This novel yeast may be useful for reducing the cost of bio-ethanol production and may be suitable for industrial-scale bio-ethanol production.

  3. Enhancement of amylase production by Aspergillus sp. using carbohydrates mixtures from triticale

    Directory of Open Access Journals (Sweden)

    Dojnov Biljana

    2015-01-01

    Full Text Available For the purpose of finding a suitable available inducer in combination with starvation, carbohydrate mixtures from triticale was used as inducers and compared with well-known amylase inducers in fungi. Carbohydrate mixtures from triticale induced production of amylase cocktail (α-amylase and glucoamylase in Aspergillus niger, unlike induction with well-known inducers which induce only glucoamylase, showed by zymogram and TLC analysis of carbohydrates mixtures before and after fermentations. Glucoamylase production by A. niger was highest in the presence of extract obtained after autohydrolysis of starch from triticale (95.88 U/mL. Carbohydrate mixtures from triticale induced production of α-amylase in A. oryzae. More α-amylase isoforms were detected upon using complex carbohydrate mixture, compared to induction with maltose or starch. The 48 h induction was the most efficient by using triticale extract (101.35 U/mL. Carbohydrates from triticale extracts can be used as very good cheap amylase inducers. Triticale, still not fully utilized, could be taken into consideration as the inducer in amylase production by Aspergillus sp, such a way it could be used as sole substrate in fermentation. [Projekat Ministarstva nauke Republike Srbije, br. 172048

  4. Functional conservation of a glucose-repressible amylase gene promoter from Drosophila virilis in Drosophila melanogaster.

    Science.gov (United States)

    Magoulas, C; Loverre-Chyurlia, A; Abukashawa, S; Bally-Cuif, L; Hickey, D A

    1993-03-01

    Previous studies have demonstrated that the expression of the alpha-amylase gene is repressed by dietary glucose in Drosophila melanogaster. Here, we show that the alpha-amylase gene of a distantly related species, D. virilis, is also subject to glucose repression. Moreover, the cloned amylase gene of D. virilis is shown to be glucose repressible when it is transiently expressed in D. melanogaster larvae. This cross-species, functional conservation is mediated by a 330-bp promoter region of the D. virilis amylase gene. These results indicate that the promoter elements required for glucose repression are conserved between distantly related Drosophila species. A sequence comparison between the amylase genes of D. virilis and D. melanogaster shows that the promoter sequences diverge to a much greater degree than the coding sequences. The amylase promoters of the two species do, however, share small clusters of sequence similarity, suggesting that these conserved cis-acting elements are sufficient to control the glucose-regulated expression of the amylase gene in the genus Drosophila.

  5. Isolation and characterization of a novel thermostable alpha-amylase from Korean pine seeds.

    Science.gov (United States)

    Azad, Md Abul Kalam; Bae, Jae-Han; Kim, Jong-Sang; Lim, Jin-Kyu; Song, Kyung-Sik; Shin, Beom-Soo; Kim, Hak-Ryul

    2009-10-31

    Amylases have significant importance in broad industrial application including bio-ethanol production. Although amylases are widely distributed in microbes, plants and animals, it has been sought for new amylases from various sources with special industrial potential. In this study we firstly isolated and characterized a novel thermostable alpha-amylase from Korean pine seed. Enzyme was purified to homogeneity level with purification fold of 1286.1 using several techniques such as self-precipitation, (NH(4))(2)SO(4) fractionation, DEAE anion exchange and starch affinity chromatography. The purified alpha-amylase showed two bands in SDS-PAGE with molecular weight of 44 and 45 kDa. The apparent molecular weight of native enzyme was calculated to be 46.7 kDa. Internal peptide sequencing confirmed that the purified alpha-amylase was a novel enzyme. The optimum pH and temperature for enzyme activity were pH 4.5 and 65 degrees C, respectively. This enzyme was fully stable for 48h at 50 degrees C and retained 80% activity up to 96h. The K(m) and V(max) were 0.84 mg/ml and 3.71 micromol/min, respectively. On the basis of high thermal stability and a broad range of pH stability, the pine seed alpha-amylase showed a good prospect of industrial application.

  6. Addition of Amylase from Aspergillus Awamori to the Diet of Broiler Chickens

    Directory of Open Access Journals (Sweden)

    HS Morgado

    Full Text Available ABSTRACT Two experiments were performed to evaluate the hematological and blood biochemistry parameters, biometry of digestive organs, enzyme activities, protein content and absolute weight of the pancreas of broilers fed pre-starter and pre-starter diets supplemented or not with amylase from Aspergillus awamori. In total, 120 male Cobb chicks were housed in heated cages in each experiment. A completely randomized experimental design, with two treatments (feed with and without amylase and six replicates per treatment of 10 birds each was applied. The data were subjected to analysis of variance using the F-test at 5% probability level. The dietary amylase addition did not affect hematological and blood biochemistry parameters and the biometry of the gastrointestinal tract of 7- and 21-d-old broilers, nor the absolute weight, enzyme activities or protein concentration of the pancreas of 7-d-old broilers. However, the inclusion of amylase in the diet reduced amylase activity and pancreatic protein concentration in 21-d-old broilers. The application of amylase to broiler chicken pre-starter and starter feeds is not justified given the pancreatic amylase activity and protein concentrations.

  7. β-amylase in developing apple fruits: activities, amounts and subcellular localization

    Institute of Scientific and Technical Information of China (English)

    ZHANG; Dapeng; (张大鹏); WANG; Yongzhang(王永章)

    2002-01-01

    Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuberous roots, and fleshy fruit development. Based on previously reported in vitro assays, β-amylase is considered one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was shown often extrachloroplastic in living cells. The present experiment showed that β-amylase activity was progressively increasing concomitantly with decreasing starch concentrations during apple (Malus domestica Borkh cv. Starkrimson) fruit development. The apparent amount of β-amylase assessed by Western blotting also increased during the fruit development, which is consistent with the seasonal changes in the enzyme activity. The subcellular-localization studies via immunogold electron-microscopy technique showed that β-amylase visualized by gold particles was predominantly located in plastids especially at periphery of starch granules, but the gold particles were scarcely found in other subcellular compartments. These data proved for the first time that the enzyme is compartmented in its functional sites in plant living cells. The predominantly plastid-distributed pattern of β-amylase in cells was shown unchanged throughout the fruit development. The density of gold particles (β-amylase) in plastids was increasing during the fruit development, which is consistent with the results of Western blotting. So it is considered that β-amylase is involved in starch hydrolysis in plastids of the fruit cells.

  8. RBI, a one-domain alpha-amylase/trypsin inhibitor with completely independent binding sites.

    Science.gov (United States)

    Maskos, K; Huber-Wunderlich, M; Glockshuber, R

    1996-11-11

    The bifunctional inhibitor from Ragi (Eleusine coracana Gaertneri) (RBI) is the only member of the alpha-amylase/trypsin inhibitor family that inhibits both trypsin and alpha-amylase. Here, we show that both enzymes simultaneously and independently bind to RBI. The recently solved three-dimensional NMR structure of RBI has revealed that the inhibitor possesses a hitherto unknown fold for serine proteinase and alpha-amylase inhibitors. Despite its different fold, RBI obeys the standard mechanism observed for most protein inhibitors of serine proteinases and is a strong, competitive inhibitor of bovine trypsin (Ki = 1.2 +/- 0.2 nM). RBI is also a competitive inhibitor of porcine alpha-amylase (Ki = 11 +/- 2 nM) when a disaccharide is used as a substrate of alpha-amylase. However, the inhibition mode becomes complex when larger (> or = 7 saccharide units) alpha-amylase substrates are used. A second saccharide binding site on porcine alpha-amylase may enable larger oligosaccharides to displace RBI from its binding site in an intramolecular reaction.

  9. Effects of Pulsed Electric Field (PEF) Treatment on Enhancing Activity and Conformation of α-Amylase.

    Science.gov (United States)

    Tian, Mei-ling; Fang, Ting; Du, Mu-ying; Zhang, Fu-sheng

    2016-04-01

    To explore an efficient, safe, and speedy application of pulsed electric field (PEF) technology for enzymatic modification, effects of PEF treatment on the enzymatic activity, property and kinetic parameters of α-amylase were investigated. Conformational transitions were also studied with the aid of circular dichroism (CD) and fluorescence spectra. The maximum enzymatic activity of α-amylase was obtained under 15 kV/cm electric field intensity and 100 mL/min flow velocity PEF treatment, in which the enzymatic activity increased by 22.13 ± 1.14% compared with control. The activation effect could last for 18 h at 4 °C. PEF treatment could widen the range of optimum temperature for α-amylase, however, it barely exerted any effect on the optimum pH. On the other hand, α-amylase treated by PEF showed an increase of Vmax, t1/2 and ΔG, whereas a decrease of Km and k were observed. Furthermore, it can be observed from fluorescence and CD spectra that PEF treatment had increased the number of amino acid residues, especially that of tryptophan, on α-amylase surface with enhanced α-helices by 34.76% and decreased random coil by 12.04% on α-amylase when compared with that of untreated. These changes in structure had positive effect on enhancing α-amylase activity and property.

  10. The Prognostic Value of Drain Amylase on Post-Operative Day One after the Whipple Procedure

    Directory of Open Access Journals (Sweden)

    Kristina Hasselgren

    2016-03-01

    Full Text Available Introduction For patients with periampullary tumors, the only treatment with curative intention is resection. One potentially serious complication is a postoperative pancreatic fistula. The reported risk factors are a soft pancreas and a small pancreatic duct as well as overweight/ obesity. The aim of this study was to investigate the prognostic value for a postoperative pancreatic fistula of elevated drain amylase (>3 times the upper limit in serum on postoperative day 1. Results In total, 170 patients underwent a pancreaticoduodenectomy at Linköping University Hospital between 2011 and 2014; 27 patients (16% had a postoperative complication ≥ grade 3b, and the postoperative mortality was 3%. The patients with elevated drain amylase on postoperative day one (n=65 had more complications (≥3b than the patients without elevated levels (n=80, although the difference was not significant (p=0.054. Two patients (3% without elevated amylase on postoperative day 1 developed postoperative pancreatic fistula (p<0.001 compared to 29 patients (45% with elevated amylase. Conclusion Normal drain amylase on postoperative day 1 is associated with a lower risk of postoperative complications than is elevated drain amylase. Elevated amylase in the drain fluid on postoperative day 1 is significantly correlated with POPF and is associated with an increased risk of postoperative complications.

  11. Studies on the Thermodenaturation Behavior of Bacillus subtilis α-Amylase on Chromatographic Media

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The thermodenaturation behavior of Bacillus subtilis α-amylase on some chromatographic media was studied by determining their adsorption parameters with frontal analysis. The experimental results show that on a RP-C18 reversed-phase medium, a Chelating Sepharose Fast-Flow chelated by Zn2+ affinity medium and a WCX-1 cation-exchange medium, a stable conformation of a-amylase molecule separately exists below or over 30℃; while on a PEG-400 hydrophobic medium and a modified PEG-400 medium, a stable conformation of α-amylase mole-cule separately exists below 40 and 30℃, and when the experimental temperatures are separately over 40 and 30℃,a drastically conformational change of α-amylase molecules can continuously take place. And by combining the in-trinsic fluorescence emission spectrum and thermal inactivation profile of α-amylase in free solution and on the PEG-400 and modified PEG-400 hydrophobic media, it can be concluded that in liquid chromatographic procedure,chromatographic media can induce the conformational change of a-amylase molecules and promote their ther-modenaturation; and in hydrophobic interaction chromatography, the higher the hydrophobicity of chromatographicmedium, the lower the conformational change temperature of a-amylase molecules on the chromatographic me-dium.

  12. Beta-AMYLASE4, a noncatalytic protein required for starch breakdown, acts upstream of three active beta-amylases in Arabidopsis chloroplasts.

    Science.gov (United States)

    Fulton, Daniel C; Stettler, Michaela; Mettler, Tabea; Vaughan, Cara K; Li, Jing; Francisco, Perigio; Gil, Manuel; Reinhold, Heike; Eicke, Simona; Messerli, Gaëlle; Dorken, Gary; Halliday, Karen; Smith, Alison M; Smith, Steven M; Zeeman, Samuel C

    2008-04-01

    This work investigated the roles of beta-amylases in the breakdown of leaf starch. Of the nine beta-amylase (BAM)-like proteins encoded in the Arabidopsis thaliana genome, at least four (BAM1, -2, -3, and -4) are chloroplastic. When expressed as recombinant proteins in Escherichia coli, BAM1, BAM2, and BAM3 had measurable beta-amylase activity but BAM4 did not. BAM4 has multiple amino acid substitutions relative to characterized beta-amylases, including one of the two catalytic residues. Modeling predicts major differences between the glucan binding site of BAM4 and those of active beta-amylases. Thus, BAM4 probably lost its catalytic capacity during evolution. Total beta-amylase activity was reduced in leaves of bam1 and bam3 mutants but not in bam2 and bam4 mutants. The bam3 mutant had elevated starch levels and lower nighttime maltose levels than the wild type, whereas bam1 did not. However, the bam1 bam3 double mutant had a more severe phenotype than bam3, suggesting functional overlap between the two proteins. Surprisingly, bam4 mutants had elevated starch levels. Introduction of the bam4 mutation into the bam3 and bam1 bam3 backgrounds further elevated the starch levels in both cases. These data suggest that BAM4 facilitates or regulates starch breakdown and operates independently of BAM1 and BAM3. Together, our findings are consistent with the proposal that beta-amylase is a major enzyme of starch breakdown in leaves, but they reveal unexpected complexity in terms of the specialization of protein function.

  13. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch

    Energy Technology Data Exchange (ETDEWEB)

    Say, R. [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Şenay, R. Hilal [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Akgöl, Sinan, E-mail: sinanakgol@yahoo.co.uk [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Denizli, Adil [Hacettepe University, Faculty of Science, Chemistry Department, 06532 Ankara (Turkey)

    2013-05-01

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. K{sub m} values were 0.26 and 0.87 mM and V{sub max} values were 0.36 IU mg{sup −1} and 22.32 IU mg{sup −1} for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70–80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. - Highlights: ► Developing to prepare nanoprotein particles carrying α-amylase ► Characterization of nanostructured α-amylase ► Usability of α-amylase nanoparticles in hydrolysis of starch.

  14. Spectroscopic study on the interaction of Bacillus subtilis {alpha}-amylase with cetyltrimethylammonium bromide

    Energy Technology Data Exchange (ETDEWEB)

    Omidyan, R., E-mail: r.omidyan@sci.ui.ac.i [Department of Chemistry, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of); Kazemi, S.H. [Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of); Bordbar, A.K. [Department of Chemistry, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Zaynalpour, S. [Department of Chemistry, Institute for Advanced Studies in Basic Sciences (IASBS), Zanjan 45137-66731 (Iran, Islamic Republic of)

    2011-06-15

    The interaction between {alpha}-amylase from Bacillus subtilis and cetyltrimethylammonium bromide (CTAB) has been investigated at various temperature conditions using fluorescence and circular dichroism (CD) spectroscopic methods. Fluorescence data revealed that the fluorescence quenching of {alpha}-amylase by CTAB is the result of complex formation between CTAB and {alpha}-amylase. The thermodynamic analysis on the binding interaction data shows that the interactions are strongly exothermic ({Delta}H{sup o}=-17.92 kJ mol{sup -1}) accompanied with increase in entropy ({Delta}S{sup o} between 109 to 135 J mol{sup -1} K{sup -1}). Thus the binding of CTAB to {alpha}-amylase is both enthalpic and entropic driven, which represent the predominate role of both electrostatic and hydrophobic interactions in complex formation process. The values of 2.17x10{sup -3} M{sup -1} and 1.30 have been obtained from associative binding constant (K{sub a}) and stoichiometry of binding number (n), from analysis of fluorescence data, respectively. Circular dichroism spectra showed the substantial conformational changes in secondary structure of {alpha}-amylase due to binding of CTAB, which represents the complete destruction of both secondary and tertiary structure of {alpha}-amylase by CTAB. - Research highlights: {yields} The Fluorescence quenching effect of {alpha}-amylase by CTAB is a consequence of formation {alpha}-amylase-CTAB complex. {yields} The {alpha}-helical analyzing from the CD spectra in the various concentration of CTAB shows strongly deformation of {alpha}-amylase. {yields} Thermodynamic analysis of quenching verify that the interactions are both enthalpy and entropic driven.

  15. Purification and characterization of α-Amylase from Miswak Salvadora persica

    OpenAIRE

    Mohamed, Saleh A.; Almulaiky, Yaaser Q.; Youssri M. Ahmed; Al-Bar, Omar AM; Ibrahim, Ibrahim H.

    2014-01-01

    Background The miswak (Salvadora persica) is a natural toothbrush. It is well known that very little information has been reported on enzymes in miswak as medicinal plant. Recently, we study peroxidase in miswak. In the present study, the main goal of this work is to purify and characterize α-amylase from miswak. The second goal is to study the storage stability of α-amylase in toothpaste. Method The purification method included chromatographaphy of miswak α-amylase on DEAE-Sepharose column a...

  16. Chemical synthesis of a dual branched malto-decaose: A potential substrate for alpha-amylases

    DEFF Research Database (Denmark)

    Damager, Iben; Jensen, Morten; Olsen, Carl Erik;

    2005-01-01

    . Using this chemically defined branched oligosaccharide as a substrate, the cleavage pattern of seven different alpha-amylases were investigated. alpha-Amylases from human saliva, porcine pancreas, barley alpha-amylose 2 and recombinant barley alpha-amylase 1 all hydrolysed the decasaccharide selectively...... tetrasaccharide. In addition, the enzymes were tested on the single branched octasoccharide 6-alpha-maltosyl-maltohexaose, which was prepared from 6,6""-bis(alpha-maltosyl)-maltohexoose by treatment with malt limit dextrinose. A similar cleavage pattern to that found for the corresponding linear malto...

  17. Limitation of amylase creatinine clearance ratio as a diagnostic test for postoperative pancreatitis.

    Science.gov (United States)

    Wapnick, S; Evans, M I; Hadas, N; Grosberg, S J

    1980-05-01

    The mean +/- S.E.M. ratio of amylase to creatinine clearance significantly increased at 24 hours after operations on the stomach and gallbladder but not after operations at sites remote from the abdominal cavity. Clinically, the elevated amylase to creatinine clearance ratio was not accompanied by pancreatitis. In dogs, surgical handling of the pancreas alone caused a significant increase in this measurement. The amylase to creatinine clearance ratio is not likely to be helpful in predicting the rare, but serious, postoperative complication of pancreatitis.

  18. Effect of Cerium on Activity of α-Amylase from Porcine Pancreas

    Institute of Scientific and Technical Information of China (English)

    王雪峰; 洪法水; 沈颂东; 苏国兴; 潘兴法

    2002-01-01

    The activity of α-amylase from porcine pancreas was enhanced under the treatment by Ce3+ of low concentration (0.5~10 μmol*L-1), but was inhibited by Ce3+ of high concentration (>10 μmol*L-1). Ce3+ at high concentration displaced Ca2+ from α-amylase competitively. The equilibrium dialysis demonstrates that α-amylase has five Ca2+-binding sites with different affinities. The fluorescence titration shows that Ce3+ can bind to Ca2+-binding sites.

  19. Functionality of porous starch obtained by amylase or amyloglucosidase treatments.

    Science.gov (United States)

    Dura, A; Błaszczak, W; Rosell, C M

    2014-01-30

    Porous starch is attracting very much attention for its absorption and shielding ability in many food applications. The effect of two different enzymes, fungal α-amylase (AM) or amyloglucosidase (AMG), on corn starch at sub-gelatinization temperature was studied as an alternative to obtain porous starch. Biochemical features, thermal and structural analyses of treated starches were studied. Microscopic analysis of the granules confirmed the enzymatic modification of the starches obtaining porous structures with more agglomerates in the case of AMG treated starches. Several changes in thermal properties and hydrolysis kinetics were observed in enzymatically modified starches. Hydration properties were significantly affected by enzymatic modification being greater influenced by AMG activity, and the opposite trend was observed in the pasting properties. Overall, results showed that enzymatic modification at sub-gelatinization temperatures really offer an attractive alternative for obtaining porous starch granules to be used in a variety of foods applications.

  20. Purification and characterization of a. beta. -amylase of Hendersonula toruloidea

    Energy Technology Data Exchange (ETDEWEB)

    Odibo, F.J.C.; Okafor, N.; Tom, M.U.; Oyeka, C.A. (Anambra State Univ. of Technology, Awka (Nigeria). Dept. of Applied Microbiology and Brewing)

    1992-05-01

    {beta}-amylase produced by Hendersonula toruloidea was purified to homogeneity by salting out with ammonium sulphate, ion-exchange chromatography on DEAE-cellulose and gel-filtration on Sephadex G-75. The relative molecular mass of the enzyme was estimated to be 60,000 by gel filtration. The enzyme was optimally active at pH 6.0 and 60deg C, stable between pH 6 and 8 (24 h) and retained 74% activity at 70deg C (30 min). It was strongly activated by Na{sup +} but inhibited by Hg{sup 2+}, Zn{sup 2+} and Cu{sup 2+}. The enzyme hydrolyzed amylopectin (Km 0.42 mg/ml) forming maltose, maltotetraose and unidentified maltooligosaccharide, and hydrolyzed soluble starch (Km 0.3 mg/ml) and glycogen (Km 0.5 mg/ml) forming maltose and unidentified maltooligosaccharide. (orig.).

  1. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  2. Amylase Production by the Marine Yeast Aureobasidium pullulans N13d

    Institute of Scientific and Technical Information of China (English)

    LI Haifeng; CHI Zhenming; WANG Xiaohong; MA Chunling

    2007-01-01

    The marine yeast strain N13d, producing an extracellular amylase, was isolated from the deep sea sediments of the Pacific Ocean. This strain was identified to be Aureobasidium pullulans by 18S rRNA gene sequence analysis and routine yeast identification methods. The optimal sea water medium for amylase production by this yeast strain was 1.0% peptone and 1.0% soluble starch with pH 4.0. The optimal conditions for amylase production by this yeast strain were with temperature 28 ℃, aeration rate 6Lmin-1 and agitation speed 250 rmin-1. Under these conditions, 58.5 units of amylase activity per mg protein were produced within 56h of fermentation.

  3. The synergetic effect of starch and alpha amylase on the biodegradation of n-alkanes.

    Science.gov (United States)

    Karimi, M; Biria, D

    2016-06-01

    The impact of adding soluble starch on biodegradation of n-alkanes (C10-C14) by Bacillus subtilis TB1 was investigated. Gas chromatography was employed to measure the residual hydrocarbons in the system. It was observed that the efficiency of biodegradation improved with the presence of starch and the obtained residual hydrocarbons in the system were 53% less than the samples without starch. The produced bacterial enzymes were studied through electrophoresis and reverse zymography for explaining the observations. The results indicated that the produced amylase by the bacteria can degrade hydrocarbons and the same was obtained by the application of a commercial alpha amylase sample. In addition, in silico docking of alpha-amylase with n-alkanes with different molecular weights was studied by Molegro virtual docker which showed high negative binding energies and further substantiated the experimental observations. Overall, the findings confirmed the catalytic effect of alpha amylase on n-alkanes degradation.

  4. Immunohistochemical and quantitative changes in salivary EGF, amylase and haptocorrin following radiotherapy for oral cancer

    DEFF Research Database (Denmark)

    Christensen, M E; Hansen, H S; Poulsen, Steen Seier

    1996-01-01

    Epidermal growth factor (EGF), amylase and haptocorrin are molecules produced in the salivary glands. The aim of the present study was to determine immunohistochemical and quantitative alterations in EGF as compared with haptocorrin and amylase following radiotherapy for oral cancer. Changes...... in the salivary secretion of EGF are of interest because of the importance of EGF in mucosal regeneration. Immunohistochemical studies on normal tissue from parotid and submandibular glands have demonstrated EGF in the serous acini with a tendency to single cell expression in the parotid gland. Amylase has been...... found in the serous acini of both the submandibular and parotid glands. Haptocorrin was localized in the duct system of both glands. In the submandibular glands with radiotherapy induced sialoadenitis only very few acini with weak or no staining for EGF and amylase were demonstrated, while no changes...

  5. Comparison of alpha-amylase and protease activities of a zoophytophagous and two phytozoophagous Heteroptera.

    Science.gov (United States)

    Zeng, F; Cohen, A C

    2000-05-01

    To better understand the nature of facultative phytophagy in the zoophytophagous Geocoris punctipes (Say), and facultative zoophagy in phytozoophagous Lygus hesperus (Knight) and Lygus lineolaris (Palisot de Beauvois), we compared the activities of both the starch digesting enzyme alpha-amylase and of general proteases in these species. The alpha-amylases and proteases were demonstrated in L. hesperus, L. lineolaris and G. punctipes. The presence of alpha-amylase in the salivary gland complexes of G. punctipes indicates a disposition of this species toward utilization of nutrients that can be derived only from plants, either directly from ingestion of plant macromolecules or from second-hand ingestion of plant material from the digestive system of their prey. The alpha-amylase activity in G. punctipes was much less than those of phytozoophagous L. hesperus and L. lineolaris. The relative importance of amylolytic activity and proteolytic activity is also discussed.

  6. Enhanced starch hydrolysis using α-amylase immobilized on cellulose ultrafiltration affinity membrane.

    Science.gov (United States)

    Konovalova, Viktoriia; Guzikevich, Kateryna; Burban, Anatoliy; Kujawski, Wojciech; Jarzynka, Karolina; Kujawa, Joanna

    2016-11-05

    In order to prepare ultrafiltration membranes possessing biocatalytic properties, α-amylase has been immobilized on cellulose membranes. Enzyme immobilization was based on a covalent bonding between chitosan and a surface of cellulose membrane, followed by an attachment of Cibacron Blue F3G-A dye as affinity ligand. Various factors affecting the immobilization process, such as enzyme concentration, pH of modifying solution, zeta-potential of membrane surface, and stability of immobilized enzyme were studied. The applicability of immobilized α-amylase has been investigated in ultrafiltration processes. The immobilization of α-amylase on membrane surface allows to increase the value of mass transfer coefficient and to decrease the concentration polarization effect during ultrafiltration of starch solutions. The enzyme layer on the membrane surface prevents a rapid increase of starch concentration due to the amylase hydrolysis of starch in the boundary layer. The presented affinity immobilization technique allows also for the regeneration of membranes from inactivated enzyme.

  7. Arabidopsis thaliana AMY3 Is a Unique Redox-regulated Chloroplastic α-Amylase

    DEFF Research Database (Denmark)

    Seung, David; Thalmann, Matthias; Sparla, Francesca;

    2013-01-01

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from......-amylases, with a pH optimum of 7.5–8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between...... Cys499 and Cys587 is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast....

  8. Effect of Static Magnetic Field on α-Amylase Activity and Enzymatic Reaction

    Institute of Scientific and Technical Information of China (English)

    JIA Shaoyi; LIU Yong; WU Songhai; WANG Zhibin

    2009-01-01

    The effect of magnetic field on α-amylase was studied. Under the experimental conditions, α-amylase solution was treated by 0.15 T, 0.30 T and 0.45 T static magnetic fields for a known period of time, then the activ-ity, kinetic parameters, and the secondary conformation were investigated. The results showed that there was a con-siderable effect of the magnetic exposure on the α-amylase. The activity was increased by 27%, 34.1%, 37.8% compared with the control. It was also found that both kinetic parameters Km and Vm could be decreased due to the increasing magnetic field, Km decreased from 2.20×102 to 0.87×102, whereas Vm decreased from 2.0×103 g/min to 1.1×103g/min. At the same time, there were some irregular changes in α-amylase secondary conformation.

  9. Kinetic studies of acid inactivation of alpha-amylase from Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens Bredal; Villadsen, John

    1996-01-01

    The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on-line by ......The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on...

  10. Biochemical features and kinetic properties of α-amylases from marine organisms.

    Science.gov (United States)

    Homaei, Ahmad; Ghanbarzadeh, Mehri; Monsef, Ferial

    2016-02-01

    Marine organisms have the ability of producing enzymes with unique properties compared to those of the same enzymes from terrestrial organisms. α-Amylases are among the most important extracellular enzymes found in various groups of organisms such as plants, animals and microorganisms. They play important roles in their carbohydrates metabolism of each organism. Microbial production of α-amylases is more effective than other sources of the enzyme. Many microorganisms are known to produce α-amylase including bacteria, yeasts, fungi and actinomycetes. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. This review deals with what is known about the kinetics, biochemical properties and applications of these enzymes that have only been found in them and not in other α-amylases, and discussing their mechanistic and regulatory implications.

  11. From carbohydrates to drug-like fragments: Rational development of novel α-amylase inhibitors.

    Science.gov (United States)

    Al-Asri, Jamil; Fazekas, Erika; Lehoczki, Gábor; Perdih, Andrej; Görick, Cornelia; Melzig, Matthias F; Gyémánt, Gyöngyi; Wolber, Gerhard; Mortier, Jérémie

    2015-10-15

    Starch catabolism leading to high glucose level in blood is highly problematic in chronic metabolic diseases, such as type II diabetes and obesity. α-Amylase catalyzes the hydrolysis of starch, increasing blood sugar concentration. Its inhibition represents a promising therapeutic approach to control hyperglycaemia. However, only few drug-like molecule inhibitors without sugar moieties have been discovered so far, and little information on the enzymatic mechanism is available. This work aims at the discovery of novel small α-amylase binders using a systematic in silico methodology. 3D-pharmacophore-based high throughput virtual screening of small compounds libraries was performed to identify compounds with high α-amylase affinity. Twenty-seven compounds were selected and biologically tested, revealing IC50 values in the micromolar range and ligand efficiency higher than the one of the bound form of acarbose, which is used as a reference for α-amylase inhibition.

  12. The frequency of marcroamylasemia and the diagnostic value of the amylase to creatinine clearance ratio in patients with elevated serum amylase activity.

    Science.gov (United States)

    Dürr, H K; Bindrich, D; Bode, J C

    1977-01-01

    190 patients with elevated serum amylase levels were tested for macroamylasemia and the amylase to creatinine clearance ratio. Macroamylasemia was found in 3 patients. In these patients macroamylasemia persisted after the total activity of serum amylase had fallen to nearly normal levels. The Cam/Ccr-ratios were determined 14 times in the 3 macroamylasemic patients. Only one of the 14 values was clearly less than 1%. Cam/Ccr-ratios above 4% were found in 83 patients. In 56 of them the diagnosis of acute pancreatitis could not be confirmed. 19 out of 46 patients with the established diagnosis of acute pancreatitis had Cam/Ccr-ratios below 4%. Cam/Ccr-ratios below 1% were also found in patients without macroamylasemia. It is concluded that high and low Cam/Ccr-ratios are not specific for acute pancreatitis and macroamylasemia, respectively, and--moreover--that a normal Cam/Ccr-ratio excludes neither acute pancreatitis nor macroamylesemia.

  13. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    Directory of Open Access Journals (Sweden)

    Alex Chi Wu

    Full Text Available Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (biosynthesis of the chain-length distribution (CLD of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  14. Extracellular production of beta-amylase by a halophilic isolate, Halobacillus sp. LY9.

    Science.gov (United States)

    Li, Xin; Yu, Hui-Ying

    2011-11-01

    A moderately halophilic strain LY9 with high amylolytic activity was isolated from soil sample obtained from Yuncheng, China. Biochemical and physiological characterization along with 16S rRNA sequence analysis placed the isolate in the genus Halobacillus. Amylase production started from the post-exponential phase of bacterial growth and reached a maximum level during the early-stationary phase. The isolate LY9 was found to secrete the amylase, the production of which depended on the salinity of the growth medium. Maximum amylase production was observed in the presence of 10% KCl or 10% NaCl. Maltose was the main product of soluble starch hydrolysis, indicating a β-amylase activity. The enzyme showed optimal activity at 60°C, pH 8.0, and 10-12.5% of NaCl. It was highly active over broad temperature (50-70°C), NaCl concentration (5.0-20.0%), and pH (4.0-12.0) ranges, indicating its thermoactive and alkali-stable nature. However, activity dropped off dramatically at low NaCl concentrations, showing the amylase was halophilic. Ca(2+) was found to stimulate the β-amylase activity, whereas ethylenediaminetetraacetic acid (EDTA), phenylarsine oxide (PAO), and diethyl pyrocarbonate (DEPC) strongly inhibited the enzyme, indicating it probably was a metalloenzyme with cysteine and histidine residues located in its active site. Moreover, the enzyme exhibited remarkable stability towards sodium dodecyl sulfate (SDS) and Triton X-100. This is the first report of β-amylase production from moderate halophiles. The present study indicates that the extracellular β-amylase of Halobacillus sp. LY9 may have considerable potential for industrial application owing to its properties.

  15. Serum amylase and lipase in the evaluation of acute abdominal pain.

    Science.gov (United States)

    Chase, C W; Barker, D E; Russell, W L; Burns, R P

    1996-12-01

    The purpose of this study was to determine 1) the incidence and magnitude of elevation in admission serum amylase and lipase levels in extrapancreatic etiologies of acute abdominal pain, and 2) the test most closely associated with the diagnosis of acute pancreatitis. Serum amylase and lipase levels were obtained in 306 patients admitted for evaluation of acute abdominal pain. Patients were categorized by anatomic location of identified pathology. Logistic regression analysis was used to compare the enzyme levels between patient groups and to determine the correlation between elevation in serum amylase and lipase. Twenty-seven (13%) of 208 patients with an extrapancreatic etiology of acute abdominal pain demonstrated an elevated admission serum amylase level with a maximum value of 385 units (U)/L (normal range 30-110 U/L). Twenty-six (12.5%) of these 208 patients had an elevated admission serum lipase value with a maximum of 3685 U/L (normal range 5-208 U/L). Of 48 patients with abdominal pain resulting from acute pancreatitis, admission serum amylase ranged from 30 to 7680 U/L and lipase ranged from 5 to 90,654 U/L. Both serum amylase and lipase elevations were positively associated with a correct diagnosis of acute pancreatitis (P pancreatic disease processes. Serum amylase and lipase levels may be elevated in nonpancreatic disease processes of the abdomen. Significant elevations (greater than three times upper limit of normal) in either enzyme are uncommon in these disorders. The strong correlation between elevations in the two serum enzymes in both pancreatic and extrapancreatic etiologies of abdominal pain makes them redundant measures. Serum lipase is a better test than serum amylase either to exclude or to support a diagnosis of acute pancreatitis.

  16. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    Science.gov (United States)

    Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K; Gilbert, Robert G

    2014-01-01

    Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  17. [Studies on determination of alpha-amylase with p-nitrophenyl-alpha-D-maltotetraoside].

    Science.gov (United States)

    Kruse-Jarres, J D; Schott, F J; Klein, B; Rastetter, N; Wallenfels, K

    1982-11-01

    Nitrophenylmaltodextrins are alpha-amylase substrates which allow a continuous determination with a zero order kinetics over a period of at least 10 min, without deviations from linearity. Only one auxiliary enzyme is necessary. Practicability and clinical evidence of alpha-amylase determinations by means of p-nitrophenyl-alpha-D-maltotetraoside are demonstrated. The interserial precision of 0.84% cannot conceal an only moderate correlation with previous methods. This fact, however, does not negate the advantages.

  18. Thermophilic amylase from Thermus sp. isolation and its potential application for bioethanol production

    OpenAIRE

    Amin Fatoni; Zusfahair

    2012-01-01

    Limited reserves of fossil energy stimulate researchers to explore for a new alternative energy, such as bioethanol.A thermophilic amylase producing bacterium was isolated from local hot-springs and its characteristic and potential applicationfor bioethanol production was determined. The obtained amylase was studied to determine its optimum temperature, pH,enzymatic reaction time, and substrate concentration. Tapioca waste was used as the substrate to find the potential of theamylase for degr...

  19. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Sivasangkary Gandhi

    2015-01-01

    Full Text Available Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX. Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL−1 at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg−1. The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0–8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t1/2 of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification.

  20. Screening and characterization of amylase and cellulase activities in psychrotolerant yeasts

    OpenAIRE

    2016-01-01

    Background Amylases and cellulases have great potential for application in industries such as food, detergent, laundry, textile, baking and biofuels. A common requirement in these fields is to reduce the temperatures of the processes, leading to a continuous search for microorganisms that secrete cold-active amylases and cellulases. Psychrotolerant yeasts are good candidates because they inhabit cold-environments. In this work, we analyzed the ability of yeasts isolated from the Antarctic reg...

  1. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    OpenAIRE

    Gaurav Sapra; Yogesh Kumar Vyas; Rahul Agarwal; Ashish Aggarwal; Chandrashekar, K. T.; Kanika Sharma

    2013-01-01

    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice...

  2. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts

    Directory of Open Access Journals (Sweden)

    Mahsa Rahimzadeh

    2014-06-01

    Full Text Available Objective(s:One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Materials and Methods: Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhibition, Dixon plot was depicted. Acarbose was used as the standard inhibitor. Results: Both plant extracts showed time and concentration dependent inhibition of α-amylase. 60% inhibition was seen with 2 mg/ml of U. dioica and0.4 mg/ml of J. regia aqueous extract. Dixon plots revealed the type of α-amylase inhibition by these two extracts as competitive inhibition. Conclusion: Determination of the type of α-amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets.

  3. Production of itaconic acid in Escherichia coli expressing recombinant α-amylase using starch as substrate.

    Science.gov (United States)

    Okamoto, Shusuke; Chin, Taejun; Nagata, Keisuke; Takahashi, Tetsuya; Ohara, Hitomi; Aso, Yuji

    2015-05-01

    Several studies on fermentative production of a vinyl monomer itaconic acid from hydrolyzed starch using Aspergillus terreus have been reported. Herein, we report itaconic acid production by Escherichia coli expressing recombinant α-amylase, using soluble starch as its sole carbon source. To express α-amylase in E. coli, we first constructed recombinant plasmids expressing α-amylases by using cell surface display technology derived from two amylolytic bacteria, Bacillus amyloliquefaciens NBRC 15535(T) and Streptococcus bovis NRIC 1535. The recombinant α-amylase from S. bovis (SBA) showed activity at 28°C, which is the optimal temperature for production of itaconic acid, while α-amylase from B. amyloliquefaciens displayed no noticeable activity. E. coli cells expressing SBA produced 0.15 g/L itaconic acid after 69 h cultivation under pH-stat conditions, using 1% starch as the sole carbon source. In fact, E. coli cells expressing SBA had similar growth rates when grown in the presence of 1% glucose or starch, thereby highlighting the expression of an active α-amylase that enabled utilization of starch to produce itaconic acid in E. coli.

  4. Purification and biochemical properties of a salivary α-amylase in Andrallus spinidens Fabricius (Hemiptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    M Fazeli-Dinan

    2012-03-01

    Full Text Available α-amylase is one of the enzymes that has crucial role in extra-oral digestion (EOD of hemipteran insects. An α-amylase was purified and biochemically characterized from the salivary glands of Andrallus spinidens showing its considerable role in EOD process. It was found an enzyme by specific activity of 4.22 U/mg protein, recovery of 14.67 % and purification fold of 13.83-fold as well as molecular weight of 26 kDa. By using two buffer solutions, optimal pH of the purified α-amylase was found to be 9 for both universal and Tris-HCl buffers. Our findings revealed that the purified α-amylase had the highest activity at the temperatures of 35 and 40 °C, and were stable for 96 h at these temperatures. Kinetic parameters of the purified enzyme show that both starch and glycogen, are the suitable substrates for the enzymatic assay, but a lower Km demonstrated glycogen as a more appropriate substrate. Among the cations used to show their possible involvement in active site of the enzyme, Ca2+2+, Mg and one concentration of Cu2+ increased the α-amylase activity but Na+ decreased the enzyme activity. Triton X-100 increased the enzyme activity but SDS, EDTA, EGTA and TTHA decreased it, indicating involvement of metal ions in the active site of the purified α-amylase.

  5. The small GTPase Rab33A participates in regulation of amylase release from parotid acinar cells.

    Science.gov (United States)

    Imai, Akane; Tsujimura, Maiko; Yoshie, Sumio; Fukuda, Mitsunori

    2015-06-05

    Amylase is released from exocrine parotid acinar cells via typical exocytosis. Exocytosis of amylase-containing granules occurs through several steps, including formation, maturation, and transport of granules. These steps are thought to be regulated by members of the small GTPase Rab family. We previously demonstrated that Rab27 and its effectors mediate amylase release from parotid acinar cells, but the functional involvement of other Rab proteins in exocrine granule exocytosis remains largely unknown. Here, we studied isoproterenol (IPR)-induced amylase release from parotid acinar cells to investigate the possible involvement of Rab33A, which was recently suggested to regulate exocytosis in hippocampal neurons and PC12 cells. Rab33A was endogenously expressed in parotid acinar cells and present in secretory granules and the Golgi body. Functional ablation of Rab33A with anti-Rab33A antibody or a dominant-negative Rab33A-T50N mutant significantly reduced IPR-induced amylase release. Our results indicated that Rab33A is a novel component of IPR-stimulated amylase secretion from parotid acinar cells.

  6. Screening of. alpha. -amylase suitable for evaluating the degree of starch retrogradation

    Energy Technology Data Exchange (ETDEWEB)

    Tsuge, Haruhito; Tatsumi, Eizo; Ohtani, Naoko; Nakazima, Akiko (Gifu Univ. (Japan). Inst. for Food Science)

    1992-01-01

    To estimate the degrees of starch retrogradation in the complex foods, an enzymatic method using {alpha}-amylase from Bacillus subtilis was proposed in the previous report (Tsuge, H. et al.: Starch/Staerke 42 (1990), 213-216). However, actual digestibility of the enzyme for the native starch granules was not checked at that time. A comparative study to see the digestibility of native starch granules was carried out using four different {alpha}-amylase preparations and digestion of retrograded wheat starch was tested by two {alpha}-amylase preparations. Pancreas {alpha}-amylase preparation digested some native starch granules to a great extent, while Aspergillus oryzae enzyme did not digest native starch granules virtually. In conclusion, {alpha}-amylase preparation from A. oryzae was an ideal enzyme as the tool to distinguish between raw and gelatinized starches. It was justified for the use of A. oryzae enzyme as well as B. subtilis {alpha}-amylase to evaluate the retrograded starch contents in the complex foods. (orig.).

  7. POTENTIAL USE OF AN EXTRACELLULAR ENZYME OF a-AMYLASE FROM INDIGENOUS INDONESIAN MESOPHILIC BACTERIA

    Directory of Open Access Journals (Sweden)

    Puji Lestari

    2013-04-01

    Full Text Available Amylase enzyme has a great significance for industrial usages in  Indonesia. However, this enzyme is still imported. The use of bacteria in biotechnological process of industrial products such as enzyme production has stimulated the exploration of extracellular amylase producing  bacteria. This study aimed to identify and analyze the potential use of amylolytic bacterial enzymes for hydrolyzing cassava starch. Two bacterial isolates, i.e. MII-10 and DKW-8 originated from Indonesia soil were identified based on their morphological, physiological and biochemical properties according to the standard protocol. The isolates were then  cultivated on fermentation medium and their growth pattern and  enzymatic assays were observed. The acetone-precipitated crude enzyme harvested based on predetermined cultivation time was used for  enzymatic hydrolysis product characterization on cassava starch using thin layer chromatography (TLC. The results showed that the mesophilicbacteria isolates (MII-10 and DKW-8 were belonged to Bacillus licheniformis. The maximum bacterial cell growth and enzyme activity were reached at 48 hours after incubation. The MII-10 isolate was found more stable than DKW-8 in producing amylase enzyme. Amylase produced by the MII-10 and DKW- 8 isolates was identified to be an endo-a-amylase as confirmed by oligosaccharides and dextrin of the random hydrolysisproducts. Relatively high dextrose equivalence (DE value of a-amylase of MII-10 (DE of 9.96 suggests that the enzyme is prospective for  saccharification of starchy material in glucose syrup industry.

  8. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].

    Science.gov (United States)

    Wüthrich, B; Baur, X

    1990-03-31

    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed.

  9. THE INFLUENCE OF BETA AMYLASE ON THE DOUGH OBTAINED FROM WHITE FLOURE TYPE 650

    Directory of Open Access Journals (Sweden)

    Ioan DAVID

    2014-12-01

    Full Text Available In this paper we are presenting the enzymatic activity of β-amylase used in different concentrations, in the bread dough. The rheological characteristics of the dough have been obtained by alveographic method. Together with α-amylase and limited dextrinase, β-amylases act on the degradetion of starch, the result being the production of carbohydrates. β-amylase acts on non-reducing end of the polysaccharide chain cleaving maltose residues. Maltose coming from the hydrolysis of starch is the main fermentable sugar which is fermented and therefore provides necessary gas volume in the final part of the technological process. An insuficient fermentation results in a smaller increase of bread. Addition of β-amylase modifies the rheological characteristics of dough. Dough extensibility increases and the resistance and specific mechanical work consumption also decreases proportionally with increasing doses of enzyme. Due to the fact that the enzyme is active in the finished product, the enzyme activity is likely to go too far. Furthermore maintain freshness, the core may become sticky. The initial dosage of the enzyme is very important to prevent this.The influence of amylase enzyme in the dough for bread can help evaluate and improve the insufficiently developed technology and the nutritive value of the products.

  10. Effect of glucagon infusion on the renal clearance of amylase relative to creatinine.

    Science.gov (United States)

    Tedesco, F J; Davila, E; Gardner, L B

    1978-10-01

    Recent data seem to support a tubular defect as the mechanism of the elevated renal clearance of amylase relative to creatinine in acute pancreatitis. Glucagon has been proposed by some to be an important factor in this phenomenon. To examine the role of glucagon as this "tubular dysfunction factor", we investigated the effect of intravenously infused glucagon on the fractional excretion of amylase and the tubular handling of a low molecular weight protein, beta2 microglobulin, in normal, healthy volunteers. At glucagon levels far in excess of those seen in pancreatitis, the clearance ratio of beta2 microglobulin relative to creatinine increased, whereas the clearance ratio of amylase relative to creatinine did not increase above the normal range. The dissociation between beta2 microglobulin clearance and amylase clearance allows one to question the theory that tubular dysfunction is the mechanism of the elevated renal clearance of amylase relative to creatinine in acute pancreatitis. Glucagon does not appear to be the sole factor responsible for the elevation of renal clearance of amylase relative to creatinine in acute pancreatitis.

  11. Inhibitory Effect of Heracleum persicum and Ziziphus jujuba on Activity of Alpha-Amylase

    Directory of Open Access Journals (Sweden)

    Reza Afrisham

    2015-01-01

    Full Text Available Postprandial hyperglycemia plays an important role in the development of type 2 diabetes. Inhibition of alpha-amylase was led to a delay in breaks down of starch and glycogen and prevented a rapid rise in blood sugar. Alpha-amylase was isolated by gel filtration chromatography Sephadex G-75 from bovine pancreas. Then, total methanolic extracts of plants were prepared and IC50 values of extracts on alpha-amylase were obtained and compared with acarbose IC50. The polyphenolic content of extracts and antioxidant capacity were determined by Folin-Ciocalteu test and DPPH test, respectively. The specific activity of alpha-amylase was 48.2 U/mg. For inhibition of alpha-amylase, IC50 values of H. persicum, Z. jujuba, and acarbose were 307, 827, and 113 μg/ml, respectively. For inhibition of DPPH radical, IC50 values of extracts were 235 and 701 μg/ml. Total phenolic contents of methanol extracts were 73.8±3.2 and 44.2±1.8 μg tannic acid equivalent/mg extract. Acarbose causes gastrointestinal symptoms and liver toxicity, but H. persicum and Z. jujuba decrease these side effects and prevent gastrointestinal disorders. Due to the high polyphenolic content and antioxidant capacity of these plants and significant inhibitory effect of the plants on alpha-amylase, these plants can be proposed for treatment of diabetic patients.

  12. [Microbial alpha-amylases: physicochemical properties, substrate specificity and domain structure].

    Science.gov (United States)

    Avdiiuk, K V; Varbanets', L D

    2013-01-01

    The current literature data on producers, physico-chemical properties and substrate specificity of a-amylases produced by microbes from different taxonomic groups such as bacteria, fungi and yeasts are discussed in the survey. Synthesis of alpha-amylase majority is an inducible process which is stimulated in the presence of starch or products of its hydrolysis. It is possible to increase enzymes activity level by optimization of cultivation conditions of strains-producers. alpha-Amylases, isolated from different sources are distinguished in their physico-chemical properties, particularly in their molecular weights, pH- and thermooptimums, inhibitors and activators. The enzymes hydrolyse soluble starch, amylose, amylopectin, glycogen, maltodextrins, alpha- and beta3-cyclodextrins and other carbohydrate substrates. It is well known that alpha-amylases belong to GH-13 family of glycosyl-hydrolases, which contain the catalytic domain A as (beta/alpha)8-barrel. In addition to domain A, alpha-amylases contain two other domains: B and C, which are localized approximately on opposite sides of (beta/alpha)8-barrel. Most of the known alpha-amylases contain calcium ion, which is located on the surface between domains A and B and plays an important role in stability and activity of the enzyme.

  13. The role of SH and S-S groups in Bacillus cereus beta-amylase.

    Science.gov (United States)

    Nomura, K; Yoneda, I; Nanmori, T; Shinke, R; Morita, Y; Mikami, B

    1995-12-01

    The properties of sulfhydryl (SH) and disulfide (S-S) groups in Bacillus cereus BQ10-S1 Spo III beta-amylase have been investigated to clarify their roles in the enzyme action. Two out of three cysteine residues in B. cereus beta-amylase were found to form an S-S bond, which was found to be located between Cys91 and Cys99 by the analysis of an S-S containing peptide. The replacement of the soybean beta-amylase model around L3 loop 1 revealed that the S-S bond is located at the root of this flexible loop that moves between open and closed forms during catalysis. The analysis of fluorescence labeled peptides revealed that the remaining free SH group was Cys331. Modification of Cys331 with N-ethylmaleimide or p-chloromercuribenzoic acid (PCMB) caused inactivation of the enzyme. The rate constants for the reactions were consistent with those of Cys343 in soybean enzyme. The binding affinity of the PCMB-modified enzyme to maltose was also decreased. These results indicate that the modification of Cys331, which exists as a free SH group in B. cereus beta-amylase caused inactivation by a similar mechanism to that in the case of Cys343 in soybean beta-amylase as assumed from the sequence homology. This cysteine residue has a common role in beta-amylases irrespective their origin.

  14. Amylase activity of aquatic actinomycetes isolated from the sediments of mangrove forests in south of Iran

    Directory of Open Access Journals (Sweden)

    Farshid Kafilzadeh

    2015-01-01

    Full Text Available In this study amylase producing actinomycetes were isolated from the sediments of mangrove forests in the south of Iran and the rate of amylase activity was measured. The samples of sediments were collected from one hundred different places in mangrove forests of the south of Iran. Collected samples were diluted then they were purified on the starch (casein agar culture and Woodruff. After that they were examined in terms of amylase production on agar–starch culture. The activity of the produced amylase by the isolated aquatic actinomycetes was measured by dinitrosalicylic acid (DNS method. The results showed that aquatic actinomycetes were isolated from 86 per 100 places in spring (86% and from 61 per 100 places in summer (61%. The highest rates of producing enzyme were related to isolated samples in spring (62.97 U/ml. Biochemical and Bergey’s book tests showed that the most isolated aquatic actinomycetes belonged to Streptomyces genus. As regards this, it is economical and easy to isolate the aquatic actinomycetes which produce amylase that is used in different industries in Iran from the sediments of mangrove forests of the south of Iran. So the isolated strains in this study can be suitable candidates for amylase production after genetic manipulation.

  15. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    Directory of Open Access Journals (Sweden)

    Leandro Rodríguez-Viera

    Full Text Available Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  16. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    Science.gov (United States)

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  17. A Study on Effect of different culture media on amylase enzyme production by a native strain of Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    ziba Akbari

    2015-12-01

    Full Text Available Introduction: Amylases are among the most important enzymes and have great significance in present-day biotechnology. Amylase with commercial applications is mainly derived from the genus Bacillus. The main purpose of this study is identification and isolatation amylase enzyme producer Bacillus, determining the amylase enzyme activity and affecting a number of culture medium on amylase enzyme production. Materials and methods: Soil, water and wastewater samples were collected from agricultural area, choghakhor lake in chahar mahal e bakhtiari province and from food factory in Esfahan. Bacillus isolates were screened for amylolytic properties by starch hydrolysis test on starch agar plate. Amylase producing Bacillus were identified biochemical tests and molecular experiments. Amylase enzyme activity of isolates was measured using di-nitro salicylic acid (DNS method. Enzyme production was studied in variose medium culture TSB, NB, Yeast extract, molases and milk medium. Results: The enzyme amylase-producing strains, one sample showed was the highest amylase activity. The Bacillus has been detected as a member of Bacillus subtilis according to Bergey's Manual of Systematic Bacteriology and molecular recognition. The enzyme activity of Bacillus subtilis was measured 7/21 (U/ml in production media. Trough medium culture maximum amylase production for Bacillus subtilis was achieved in molases medium. Discussion and conclusion: In this study, Bacillus subtilis strains isolated from wastewater of a significant amount of enzyme producing 7/21 (U/ml as indicated. Among the medium-amylase from Bacillus subtilis highest enzyme activity was observed in beet molasses. According to this study, the use of Bacillus strains is an efficient way to achieve the amylase enzyme.

  18. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.L.; Carbonell, J.

    1984-09-01

    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  19. Glucose feedback inhibition of amylase activity in Aspergillus sp. and release of this inhibition when cocultured with Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, C.A.; Abouzied, M.M.

    1986-11-01

    The effect of starch and glucose concentration on amylase activity by Aspergillus niger, A. foetidus and A. awamori was determined. Up to 15 U/ml of amylase activity was observed in extracellular fluid of cultures grown with 1-2% starch for 7 days; however, no amylase activity was detectable in the extracellular fluid of otherwise identical cultures grown with 3-5% starch, even though these cultures contained substantial concentrations of glucose (16-20 mg/ml) which could only have been derived from starch hydrolysis. When extracellular fluid from the 5% starch cultures was dialysed to remove soluble sugar, high level of amylase activity was observed. Addition of increasing amounts of glucose to the dialysed extracellular fluid resulted in increasing levels of inhibition of amylase activity. Coculture of the Aspergillus species with Saccharomyces cerevisiae, an efficient sugar fermenting yeast, in 5% starch medium resulted in low sugar concentration and high amylase activity (greater than 18 U/ml) in the extracellular fluid. Amylase activity in cultures grown with glucose was comparable to that observed in cultures grown with glucose plus starch or starch only. These results lead us to conclude that amylase activity in the Aspergillus species studied is subject to feed back inhibition by glucose but is not subject to catabolite repression by glucose or starch as previously believed. Furthermore, the amylase activity in these organisms appears to be inducible by starch. 22 references.

  20. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System

    Science.gov (United States)

    Nater, Urs M.; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Background & Aim Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. Methods In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Conclusions Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals. PMID:26110636

  1. Relationship between post-ERCP pancreatitis and the change of serum amylase level after the procedure

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To clarify the relationship between the change of serum amylase level and post-ERCP pancreatitis.METHODS: Between January 1999 and December 2002, 1291 ERCP-related procedures were performed.Serum amylase concentrations were measured before the procedure and 3, 6, and 24 h afterward. The frequency and severity of post-ERCP pancreatitis and the relationship between these phenomena and the change in amylase level were estimated.RESULTS: Post-ERCP pancreatitis occurred in 47 patients (3.6%). Pancreatitis occurred in 1% of patients with normal amylase levels 3 h after ERCP, and in 1%,5%, 20%, 31% and 39% of patients with amylase levels elevated 1-2 times, 2-3 times, 3-5 times, 5-10 times and over 10 times the upper normal limit at 3 h after ERCP,respectively (level < 2 times vs ≥ 2 times, P < 0.001).Of the 143 patients with levels higher than the normal limit at 3 h after ERCP followed by elevation at 6 h,pancreatitis occurred in 26%. In contrast, pancreatitis occurred in 9% of 45 patients with a level higher than two times the normal limit at 3 h after ERCP followed by a decrease at 6 h (26% vs 9%, P < 0.05).CONCLUSION: Post-ERCP pancreatitis is frequently associated with an increase in serum amylase level greater than twice the normal limit at 3 h after ERCP with an elevation at 6 h. A decrease in amylase level at 6 h after ERCP suggests the unlikelihood of development of post-ERCP pancreatitis.

  2. Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase.

    Science.gov (United States)

    Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C; Santelia, Diana

    2013-11-22

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble substrates, with a strong preference for β-limit dextrin over amylopectin. Activity was shown to be dependent on a conserved aspartic acid residue (Asp(666)), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases, with a pH optimum of 7.5-8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between Cys(499) and Cys(587) is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast.

  3. Dynamics of the Streptococcus gordonii Transcriptome in Response to Medium, Salivary α-Amylase, and Starch.

    Science.gov (United States)

    Haase, Elaine M; Feng, Xianghui; Pan, Jiachuan; Miecznikowski, Jeffrey C; Scannapieco, Frank A

    2015-08-15

    Streptococcus gordonii, a primary colonizer of the tooth surface, interacts with salivary α-amylase via amylase-binding protein A (AbpA). This enzyme hydrolyzes starch to glucose, maltose, and maltodextrins that can be utilized by various oral bacteria for nutrition. Microarray studies demonstrated that AbpA modulates gene expression in response to amylase, suggesting that the amylase-streptococcal interaction may function in ways other than nutrition. The goal of this study was to explore the role of AbpA in gene regulation through comparative transcriptional profiling of wild-type KS1 and AbpA(-) mutant KS1ΩabpA under various environmental conditions. A portion of the total RNA isolated from mid-log-phase cells grown in 5% CO2 in (i) complex medium with or without amylase, (ii) defined medium (DM) containing 0.8% glucose with/without amylase, and (iii) DM containing 0.2% glucose and amylase with or without starch was reverse transcribed to cDNA and the rest used for RNA sequencing. Changes in the expression of selected genes were validated by quantitative reverse transcription-PCR. Maltodextrin-associated genes, fatty acid synthesis genes and competence genes were differentially expressed in a medium-dependent manner. Genes in another cluster containing a putative histidine kinase/response regulator, peptide methionine sulfoxide reductase, thioredoxin protein, lipoprotein, and cytochrome c-type protein were downregulated in KS1ΩabpA under all of the environmental conditions tested. Thus, AbpA appears to modulate genes associated with maltodextrin utilization/transport and fatty acid synthesis. Importantly, in all growth conditions AbpA was associated with increased expression of a potential two-component signaling system associated with genes involved in reducing oxidative stress, suggesting a role in signal transduction and stress tolerance.

  4. Structural elucidation and molecular characterization of Marinobacter sp. α-amylase.

    Science.gov (United States)

    Kumar, Sumit; Khan, Rizwan Hasan; Khare, S K

    2016-01-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Marinobacter sp. EMB8 α-amylase was found to be active and stable in salt and organic solvents. A study was carried out using circular dichroism (CD), fluorescence spectroscopy, and bioinformatics analysis of similar protein sequence to ascertain molecular basis of salt and solvent adaptability of α-amylase. Structural changes recorded in the presence of varying amounts of NaCl exhibited an increase in negative ellipticity as a function of salt, confirming that salt stabilizes the protein and increases the secondary structure, making it catalytically functional. The data of intrinsic and extrinsic fluorescence (using 1-anilinonaphthalene 8-sulfonate [ANS] as probe) further confirmed the role of salt. The α-amylase was active in the presence of nonpolar solvents, namely, hexane and decane, but inactivated by ethanol. The decrease in the activity was correlated with the loss of tertiary structure in the presence of ethanol. Guanidine hydrochloride and pH denaturation indicated the molten globule state at pH 4.0. Partial N-terminal amino acid sequence of the purified α-amylase revealed the relatedness to Pseudoalteromonas sp. α-amylase. "FVHLFEW" was found as the N-terminal signature sequence. Bioinformatics analysis was done using M. algicola α-amylase protein having the same N-terminal signature sequence. The three-dimensional structure of Marinobacter α-amylase was deduced using the I-TASSER server, which reflected the enrichment of acidic amino acids on the surface, imparting the stability in the presence of salt. Our study clearly indicate that salt is necessary for maintaining the secondary and tertiary structure of halophilic protein, which is a necessary prerequisite for catalysis.

  5. Inhibitory Effect of Capparis spinosa Extract on Pancreatic Alpha-Amylase Activity

    Directory of Open Access Journals (Sweden)

    Mostafa Selfayan

    2016-04-01

    Full Text Available Background Diabetes mellitus is a metabolic disorder characterized by high blood glucose level caused due to deficiency of insulin secretion or insulin function. The inhibition of carbohydrate hydrolyzing enzymes such as α-amylase can be an important strategy for decrease postprandial blood glucose level in patients with type II diabetes. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Objectives The aim of the present study is to investigate the effect of the ethanolic extract of Capparis spinosa on pancreatic α-amylase activities to find out the relevance of the plant in controlling blood sugar. Materials and Methods In this experimental study, root and leaves of C. spinosa were tested for α-amylase inhibition. Different concentrations (1.56, 3.12, 6.25, 12.5 and 25 mg/mL of extracts were incubated with enzyme substrate solution and the spectrometric method used for measure enzyme activity. Also acarbose was used as the standard inhibitor. Results Both root and leaves extracts showed inhibition of α-amylase (root = 97.31% and leaves = 98.92%. The root and leaves extracts of C. spinosa exhibited appreciable α-amylase inhibitory activity with an IC50 values 5.93 mg/mL and 3.89 mg/mL respectively, when compared with acarbose (IC50 value 0.038 mg/mL. Conclusions This study supports that root and leaves extracts of C. spinosa exhibit considerable α-amylase inhibitory activities. These results could be useful for developing functional foods by combination of plant-based foods for treatment of diabetes mellitus.

  6. One-step production of immobilized alpha-amylase in recombinant Escherichia coli.

    Science.gov (United States)

    Rasiah, Indira A; Rehm, Bernd H A

    2009-04-01

    Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

  7. Production, Purification, and Characterization of Thermostable α-Amylase Produced by Bacillus licheniformis Isolate AI20

    Directory of Open Access Journals (Sweden)

    Yasser R. Abdel-Fattah

    2013-01-01

    Full Text Available An optimization strategy, based on statistical experimental design, is employed to enhance the production of thermostable α-amylase by a thermotolerant B. licheniformis AI20 isolate. Using one variant at time (OVAT method, starch, yeast extract, and CaCl2 were observed to influence the enzyme production significantly. Thereafter, the response surface methodology (RSM was adopted to acquire the best process conditions among the selected variables, where a three-level Box-Behnken design was employed to create a polynomial quadratic model correlating the relationship between the three variables and α-amylase activity. The optimal combination of the major constituents of media for α-amylase production was 1.0% starch, 0.75% yeast extract, and 0.02% CaCl2. The predicted optimum α-amylase activity was 384 U/mL/min, which is two folds more than the basal medium conditions. The produced α-amylase was purified through various chromatographic techniques. The estimated enzyme molecular mass was 55 kDa and the α-amylase had an optimal temperature and pH of 60–80°C and 6–7.5, respectively. Values of Vmax and Km for the purified enzyme were 454 mU/mg and 0.709 mg/mL. The α-amylase enzyme showed great stability against different solvents. Additionally, the enzyme activity was slightly inhibited by detergents, sodium dodecyl sulphate (SDS, or chelating agents such as EDTA and EGTA. On the other hand, great enzyme stability against different divalent metal ions was observed at 0.1 mM concentration, but 10 mM of Cu2+ or Zn2+ reduced the enzyme activity by 25 and 55%, respectively.

  8. Interparental aggression and parent-adolescent salivary alpha amylase symmetry.

    Science.gov (United States)

    Gordis, Elana B; Margolin, Gayla; Spies, Lauren A; Susman, Elizabeth J; Granger, Douglas A

    2010-06-01

    The present study examined salivary alpha amylase (sAA), a putative marker of adrenergic activity, in family members engaging in family conflict discussions. We examined symmetry among family members' sAA levels at baseline and in response to a conflict discussion. The relation between a history of interparental aggression on parent-adolescent sAA symmetry also was examined. Participants were 62 families with a mother, father, and biological child age 13-18 (n=29 girls). After engaging in a relaxation procedure, families participated in a 15-minute triadic family conflict discussion. Participants provided saliva samples at post-relaxation/pre-discussion, immediately post-discussion, and at 10 and 20 min post-discussion. Participants also reported on interparental physical aggression during the previous year. Across the sample we found evidence of symmetry between mothers' and adolescents' sAA levels at baseline and around the discussion. Interparental aggression was associated with lower sAA levels among fathers. Interparental aggression also affected patterns of parent-child sAA response symmetry such that families reporting interparental aggression exhibited greater father-adolescent sAA symmetry than did those with no reports of interparental aggression. Among families with no interparental aggression history, we found consistent mother-adolescent symmetry. These differences suggest different patterns of parent-adolescent physiological attunement among families with interparental aggression.

  9. The amylase-creatinine clearance ratio following cardiopulmonary bypass.

    Science.gov (United States)

    Murray, W R; Mittra, S; Mittra, D; Roberts, L B; Taylor, K M

    1981-08-01

    The incidence of unexplained pancreatitis in patients dying after cardiac operations has been recorded as 16%, with evidence to implicate ischemia in the pathogenesis of the pancreatitis. Increased amylase--to--creatinine clearance ratios (ACCR), suggesting pancreatic dysfunction, have been reported in patients following nonpulsatile cardiopulmonary bypass (CPB). Pulsatile CPB is increasingly recognized to be a more physiological form of perfusion, particularly with respect to capillary blood flow. In this study the ACCR has been determined before, during, and after cardiac operations performed with both nonpulsatile and pulsatile CPB. Twenty patients undergoing elective cardiac operations were studied. Ten patients had nonpulsatile CPB (nonpulsatile group) and 10 had pulsatile CPB (pulsatile group). The two groups were comparable as regards perioperative variables and perfusion parameters. In both groups the ACCR was estimated preoperatively, on three occasions during the operation, and daily on the first 5 postoperative days. A significant elevation in ACCR was observed in nine of 10 patients in the nonpulsatile group but in only one of 10 patients in the pulsatile group (p less than 0.001). The significant improvement of ACCR stability following pulsatile CPB may indicate that this form of perfusion will reduce the risk of pancreatitis following cardiac operations performed with CPB.

  10. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    Science.gov (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations.

  11. Individual differences in AMY1 gene copy number, salivary α-amylase levels, and the perception of oral starch.

    Directory of Open Access Journals (Sweden)

    Abigail L Mandel

    Full Text Available BACKGROUND: The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. PRINCIPAL FINDINGS: Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. CONCLUSIONS: By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status.

  12. Purification and characterization of extracellular α-amylase from a thermophilic Anoxybacillus thermarum A4 strain

    Directory of Open Access Journals (Sweden)

    Nimet Baltas

    Full Text Available ABSTRACT α-Amylase from Anoxybacillus thermarum A4 was purified using ammonium sulphate precipitation and Sephadex G-100 gel filtration chromatography, with 29.8-fold purification and 74.6% yield. A4 amylase showed best performance for soluble potato starch hydrolysis at 70 °C and pH 5.5-10.5. A4 amylase was extremely stable at +4 °C, and the enzyme retained over 65% of its original α-amylase activity at 70 °C and 43% at 90 °C. The enzyme's Km values for soluble starch, amylopectin and amylose substrates were obtained as 0.9, 1.3 and 0.5 mg/mL, respectively. EDTA, Hg2+, B4O7 2-, OH-, CN- , and urea exhibited different inhibition effects; their IC50 values were identified as 8.0, 5.75, 16.5, 15.2, 8.2 and 10.9 mM, respectively. A4 amylase exhibited extreme stability toward some surfactants and perfect match for a wide variety of commercial solid and liquid detergents at 55 °C. So, it may be considered to be potential applications for detergent and other industrial uses.

  13. Rhizopus microsporus var. rhizopodiformis: a thermotolerant fungus with potential for production of thermostable amylases.

    Science.gov (United States)

    Peixoto, Simone C; Jorge, João A; Terenzi, Héctor F; Polizeli, Maria de Lourdes T M

    2003-12-01

    The effect of several nutritional and environmental parameters on growth and amylase production from Rhizopus microsporus var. rhizopodiformis was analysed. This fungus was isolated from soil of the Brazilian "cerrado" and produced high levels of amylolytic activity at 45 degrees C in liquid medium supplemented with starch, sugar cane bagasse, oat meal or cassava flour. Glucose in the culture medium drastically repressed the amylolytic activity. The products of hydrolysis were analysed by thin layer chromatography, and glucose was detected as the main component. The amylolytic activity hydrolysed several substrates, such as amylopectin, amylase, glycogen, pullulan, starch, and maltose. Glucose was always the main end product detected by high-pressure liquid chromatography analysis. These results indicated that the amylolytic activity studied is a glucoamylase, but there were also low levels of alpha-amylase. As compared to other fungi, R. microsporus var. rhizopodiformis can be considered an efficient producer of thermostable amylases, using raw residues of low cost as substrates. This information is of technological value, considering the importance of amylases for industrial hydrolysis.

  14. The Effect of an Intraperitoneal Injection of Melatonin on Serum Amylase Levels in Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    Cavit Çöl

    2009-05-01

    Full Text Available Context Several experimental studies have been carried out to explain the ph ysiopathological mechan isms and to introduce endocrinological, enzymatic, biochemical and histopathol ogical changes in organism s during acute pancreatitis. Objective To evaluate the effect of an intraperitoneal injection of melatonin on serum amylase levels. Design Experimental acut e pancreatitis was experimentally caused through panc reatic duct ligation in 20 Winstar Albino rats . The rats were then divided into two groups: control and melatonin groups. Intervention The serum amylase level was measured on the 7 th day after acute pancreatitis had developed. In the melatonin group, an intraperitoneal injecti on of melatonin (20 mg/kg/day was performed starting from the 2 nd day after pancreatic duct ligation. Main outcome measure The levels of serum amylase were measured with an auto analyzer. Results It was found that the mean (±SD level of serum amylase in th e control group was 947±182 IU/mL wh ile it was 358±177 IU/mL in the experimental group (P<0.001. Conclusions The 20 mg/kg/day intraperitoneal injection of melatonin which was carried out for one week attenuated the serum amylase levels to a statistically si gnificant degree. The researchers believe that intraperitoneal in jections of melatonin decrease the severity of acute pancreatitis.

  15. Existence of hydroxylated MWCNTs demotes the catalysis effect of amylases against starch degradation.

    Science.gov (United States)

    Sekar, Gajalakshmi; Sivakumar, Amaravathy; Mukherjee, Amitava; Chandrasekaran, Natarajan

    2016-05-01

    Possible interaction between amylase and Multi Walled Carbon Nanotubes (MWCNTs) has been elucidated with spectroscopic methods. Hyperchromism of the UV-visible spectra of amylase-CNT conjugates suggested ground state complex formation between them. On contrary, the decreasing fluorescence emission spectra revealed the fate of quenching mechanism to be static. Stoke shift observed from the synchronous and 3D spectra suggested the possibilities of disturbances to the aromatic micro-environment of amylases by OH-MWCNTS. FTIR and FT-Raman spectra showed alteration in the amide I band, that corresponds to their effect on alpha-helical structures. Loss of alpha-helical structures and alteration in the dichroic band again revealed possible conformational change and effect towards the stability of polypeptide backbone structures. In addition, the shift observed in the SPR band and FTIR peaks of CNTs-amylase conjugates suggested possible alteration in their optical and structural properties. On the functional aspect, amylase activity on starch degradation and hydrolysis were found to be decreased in the presence of CNTs.

  16. Thermal stability and starch degradation profile of α-amylase from Streptomyces avermitilis.

    Science.gov (United States)

    Hwang, Sang Youn; Nakashima, Kazunori; Okai, Naoko; Okazaki, Fumiyoshi; Miyake, Michiru; Harazono, Koichi; Ogino, Chiaki; Kondo, Akihiko

    2013-01-01

    Amylases from Streptomyces are useful in the production of maltooligosaccharides, but they have weak thermal stability at temperatures higher than 40 °C. In this study, α-amylase (SAV5981 gene of Streptomyces avermitilis) was expressed from Streptomyces lividans 1326 and purified by ammonium sulfate fractionation followed by anionic chromatography (Q-HP sepharose). The properties of the purified SAV5981 amylase were determined by the starch-iodine method. The effect of metal ions on amylase activity was investigated. The optimal temperature shifted from 25 to 50 °C with the addition of the Ca(2+) ion. The thermal stability of SAV5981 was also dramatically enhanced by the addition of 10 mM CaCl2. Improvement of the thermal stability of SAV5981 was examined by CD spectra in the presence and the absence of the Ca(2+) ion. Thin-layer chromatography (TLC) analysis and HPLC analysis of starch degradation revealed that SAV5981 mainly produced maltose and maltotriose, not glucose. The maltoorigosaccharide-producing amylase examined in this study has the potential in the industrial application of oligosaccharide production.

  17. Modulation by thyroid hormones of rat parotid amylase secretion stimulated by 5-hydroxytryptamine.

    Science.gov (United States)

    Ostuni, Mariano Aníbal; Houssay, Alberto Bernardo; Tumilasci, Omar René

    2003-12-01

    The effects of 5-hydroxytryptamine (5-HT) upon amylase secretion by rat parotid glands were studied in three groups of animals: (a) intact control rats (euthyroid rats); (b) hypothyroid rats obtained by surgical thyroidectomy 2 wk before the experiments; and (c) hyperthyroid rats obtained by the administration of sodium l-triiodothyronine for 2 wk before the experiments. Hyperthyroid rats showed significantly higher baseline amylase release than control rats. When the glands were stimulated with 5-HT (30 micro m), amylase release was significantly lower in the hypothyroid group and higher in the hyperthyroid rats than in control group. Addition of cholinergic, adrenergic or substance P antagonists did not modify 5-HT-stimulated amylase activity. The effects of 5-HT were partly but significantly blocked by the addition of 10 micro m methysergide (HT1/2/7 receptor blocker) in the three groups of rats. In contrast, 10 micro m ketanserine (HT2A receptor blocker) partly blocked the response to 5-HT only in the hyperthyroid animals. It was concluded that 5-HT induces amylase secretion by rat parotid glands through specific serotoninergic receptors, and that thyroid status modulates the 5-HT effect.

  18. PRODUCTION OF α-AMYLASE FROM ASPERGILLUS FLAVUS UNDER SOLID STATE FERMENTATION WITH OPTIMUM CONDITIONS

    Directory of Open Access Journals (Sweden)

    Mamatha J

    2012-08-01

    Full Text Available α-amylases are ubiquitous enzymes produced by plants, animals and microbes, where they play a dominant role in carbohydrate metabolism. In spite of the wide distribution of amylases, microbial sources, namely fungal and bacterial amylases, are used for the industrial production due to advantages such as cost effectiveness, consistency, less time and space required for production and ease of process modification and optimization. Filamentous fungi are known to be prolific producers of extracellular proteins; they are widely exploited for the production of different enzymes including a-amylase. SSF is generally defined as the growth of microorganisms on moist solid substrates with negligible free water, which is preferred than SmF because of simple technique, low capital investment, lower levels of catabolite repression, end- product inhibition, low waste water output, better product recovery and high quality production. Different substrates such as wheat bran, mollasses bran, rice bran, maize meal and sugarcane bagasse were used; out of which sugarcane bagasse has been reported to produce promising results. Different carbon and nitrogen supplements were given which increased the yield of the enzyme and optimized the pH as 6.0 and temperature 300C. Thus the maximum production of amylase was observed at optimized conditions, which can be employed in large scale.

  19. SALIVARY ALPHA-AMYLASE AS A BIOMARKER OF DENTAL FEAR AND ANXIETY IN CHILDREN

    Directory of Open Access Journals (Sweden)

    Réka GYERGYAY

    2015-03-01

    Full Text Available Dental treatment represents a stress factor for most children. The aim of the study was to analyse the variation of salivary alpha-amylase concentration in children after a video viewing on dental treatments. In this study, 7 to 10 year-old school children were evaluated (n=119. Unstimulated whole saliva was collected before and after viewing a 15 min video on dental treatments performed on children. Changes in salivary alpha-amylase levels have been assessed. Video viewing on dental procedures led to a significant increase of the alpha-amylase level in the whole sample group. This was noticeable in terms of gender as well as age groups. From the viewpoint of age and gender, girls displayed significantly higher levels of amylase in all age groups, while this could be observed only in younger boys. In conclusion, analysis of salivary alpha-amylase revealed that the sight of dental treatment represents a significant source of stress among children.

  20. Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.

    Science.gov (United States)

    Attia, M S; Al-Radadi, Najlaa S

    2016-12-15

    A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases.

  1. Antioxidant and α-amylase inhibition activities of phenolic compounds in the extracts of Indian honey

    Institute of Scientific and Technical Information of China (English)

    Subashini Devarajan; Subhashree Venugopal

    2012-01-01

    AIM:To evaluate the antioxidant and α-amylase inhibition potential of phenolic compounds in the extracts of Indian honey.METHODS:Phenolic compounds were extracted from Indian honey through column chromatography.The antioxidant potential of extracted phenolic compounds was measured by two different biochemical assays:ferric reducing antioxidant power (FRAP)assay and scavenging activity on 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals.Moreover,α-amylase inhibition assay of phenolic compounds of honey was also evaluated.RESULTS:The scavenging inhibition rate varied from 86.8% to 78.6% from the highest (6mg·mL-1) to the lowest (1.5 mg·mL-1) concentration,whereas,reducing power assay varied from 0.89 Abs to 0.19 Abs from the highest to the lowest concentration.Butylated hydroxytoluene (BHT) was used as reference compound for antioxidant assays.α-amylase inhibition assay is reported from the phenolic honey extracts for the first time.The inhibition rate for α-amylase varied from 88.8% to 30.5% from the highest (20 μg·mL-1) to the lowest concentration (4.μg·mL-1).CONCLUSION:Honey phenolic extract possessed antioxidant and α-amylase inhibition activity,thus increasing its potential therapeutic property.

  2. Inhibition of α-amylase activity by cellulose: Kinetic analysis and nutritional implications.

    Science.gov (United States)

    Dhital, Sushil; Gidley, Michael J; Warren, Frederick J

    2015-06-05

    We report on inhibition of α-amylase activity by cellulose based on in vitro experiments. The presence of cellulose in the hydrolysing medium reduced the initial velocity of starch hydrolysis in a concentration dependent manner. α-Amylase adsorption to cellulose was reversible, attaining equilibrium within 30min of incubation, and showed a higher affinity at 37°C compared to 20 and 0°C. The adsorption was almost unchanged in the presence of maltose (2.5-20mM) but was hindered in the presence of excess protein, suggesting non-specific adsorption of α-amylase to cellulose. Kinetic analyses of α-amylase hydrolysis of maize starch in the presence of cellulose showed that the inhibition is of a mixed type. The dissociation constant (Kic) of the EI complex was found to be ca. 3mg/mL. The observed inhibition of α-amylase activity suggests that cellulose in the diet can potentially attenuate starch hydrolysis.

  3. Effect of perioperative somatostatin administration of sphincteroplasty-induced increase of amylase.

    Science.gov (United States)

    Roncoroni, L; De Bernardinis, M; Violi, V; Montanari, M; Peracchia, A

    1986-06-01

    Twenty patients undergoing sphincteroplasty for cholelithiasis were randomly divided into two groups of 10. The former (T) were treated with a 4-h somatostatin intravenous drip (250 micrograms/h), started at the beginning of operation, while the latter (C) made up the control group. Serum and urine amylase, amylase creatinine clearance ratio, and liver function tests were assessed for 2 days before surgery, after the operation and for a period of 5 postoperative days. Homogeneity between the two series was verified in experimental conditions. Statistical differences occurred postoperatively in amylase creatinine clearance ratio, which proved higher in C group, and gamma-GT, which was higher in T group. Short-term somatostatin administration proved effective in reducing the postoperative amylase creatinine clearance ratio, although more evident results are reported after long-term administration. Cholestasis or any serious impairment in liver function did not occur, suggesting the suitability of somatostatin use even in patients with jaundice. Since a relationship between postoperative amylase levels and risk of pancreatitis has not yet been proved, the value of somatostatin in the prevention of postoperative pancreatitis after sphincteroplasty needs to be further verified.

  4. Renal handling of beta-2-microglobulin, amylase and albumin in acute pancreatitis.

    Science.gov (United States)

    Karlsson, F A; Jacobson, G

    1979-01-01

    The renal handling of beta-2-microglobulin, amylase and albumin was studied in patients with acute pancreatitis. The data were compared with results obtained from patients with glomerular proteinuria and from patients with tubular proteinuria. Initially during acute pancreatitis, the clearance ratio (clearance protein/clearance creatinine) for beta-2-microglobulin was increased dramatically (77-fold) compared to normals. After four to seven days this ratio had fallen and was elevated only 7-fold. The corresponding figures for amylase were 3.3 and 1.8 times and for albumin 9 and 5 times respectively. In glomerular disease, the clearance ratios for beta-2-microglobulin, amylase and albumin were increased 6, 1.1, and 154 times and in tubular disease 448, 1.1, and 28 times, respectively. The electrophoretic pattern of the urinary proteins during pancreatitis was mostly normal. In a few cases, slight tubular proteinuria was noticed. Amylase activity in serum and urine from patients with pancreatitis was found to sediment, (S20,W = 4.6) in a sucrose gradient, identical to amylase from normal serum and urine. The marked increase in the excretion of beta-2-microglobulin probably reflects interference of the kidney function at the proximal tubular level. Determinations of this protein in urine may be of value in studies of kidney dysfunction that can accompany pancreatitis.

  5. Purification and properties of apoplastic amylase from oat (Avena sativa) seedlings.

    Science.gov (United States)

    Uno-Okamura, Kuniko; Soga, Kouichi; Wakabayashi, Kazuyuki; Kamisaka, Seiichiro; Hoson, Takayuki

    2004-05-01

    The protein fraction extracted with a high ionic strength buffer from the cell wall preparation of oat (Avena sativa L.) coleoptiles and first leaves contained starch-degrading (amylase) activity. The activity of apoplastic amylase in the coleoptiles and first leaves continued to increase in parallel with organ growth. One of the apoplastic amylases recovered from shoot cell wall preparations was purified by sequential ion exchange and gel filtration chromatography, and the catalytic properties of the enzyme were analysed. The purified enzyme gave a single 25 kDa protein band on SDS-PAGE. The enzyme exhibited maximum activity at pH 5.0 against maltooligosaccharides. The purified enzyme hydrolysed soluble starch and maltooligosaccharides larger than tetraose at maltose unit, but did not hydrolyse beta-limit dextrin or p-nitrophenyl-alpha-d-glucopyranoside. These results as well as the findings that the molecular size and the catalytic properties of the purified enzyme are different from those of known amylases obtained from Gramineae caryopses suggest that this enzyme is a novel type of beta-amylase present in cell walls of vigorously elongating Gramineae shoot organs.

  6. Carboxylic ester hydrolase and amylase in ischemic pancreatitis in the guinea pig.

    Science.gov (United States)

    Blind, P J; Bläckberg, L; Lundström, E B; Emdin, S O; Hernell, O

    1996-05-01

    The observation that an elevated level of pancreatic carboxylic ester hydrolase (CEH) in serum is a more sensitive and specific marker of acute pancreatitis than is elevated serum amylase activity prompted us to explore whether these findings could be confirmed in an experimental model and, if so, to find the explanation behind this difference. We therefore developed a model for ischemic pancreatitis in the guinea pig and a sandwich enzyme-linked immunosorbent assay for determination of CEH in this species. There was a strong correlation between duration of ischemia and severity of pancreatic inflammation and between severity of inflammation and serum CEH level. In contrast, serum amylase was elevated only in animals with the most severe grade of inflammation. Amylase was, however, increased in urine in animals with mild inflammation, but the level did not increase with severity of inflammation. Only one of 31 animals had detectable CEH in urine. In animals with intermediate serum CEH levels the serum and biliary concentrations correlated, indicating that CEH may be cleared by the liver. Amylase was detectable in bile only in animals with high serum levels. The results confirm our observations made in previous clinical studies. A likely explanation for differences in serum levels of CEH and amylase is clearance from the circulation at different rates and, at least partly, via different routes, e.g., the liver and kidney, respectively.

  7. Effects of dopamine on adenylyl cyclase activity and amylase secretion in rat parotid tissue.

    Science.gov (United States)

    Hatta, S; Amemiya, N; Takemura, H; Ohshika, H

    1995-06-01

    Several previous studies have shown that dopamine causes amylase secretion from rat parotid tissue. However, the mechanism of this dopamine action is still unclear. The present study was designed to characterize dopamine action in rat parotid gland tissue by examining the effects of dopamine on cyclic AMP accumulation, adenylyl cyclase activity, and amylase release. Dopamine significantly enhanced accumulation of cyclic AMP in parotid slices and stimulated adenylyl cyclase activity in parotid membrane preparations. It also significantly stimulated amylase release from parotid slices. The stimulatory effects of dopamine on cyclic AMP accumulation, adenylyl cyclase activity, and amylase release were effectively blocked with propranolol, a beta-adrenergic antagonist, but not by either SCH 23390, a preferential D1 antagonist, or butaclamol, a preferential D2 antagonist. No substantial specific binding sites for D1 receptors were detectable by [3H]SCH 23390 binding in parotid membranes. These results suggest that the stimulatory effect of dopamine on amylase secretion in rat parotid tissue is not mediated through specific D1 dopamine receptors but rather through beta-adrenergic receptors.

  8. Acute Pancreatitis with Normal Serum Lipase and Amylase: A Rare Presentation

    Directory of Open Access Journals (Sweden)

    Arvind K Mathur

    2016-08-01

    Full Text Available Acute pancreatitis presenting with normal serum amylase and lipase levels is a rare phenomenon. It is thought that typically, acute inflammation and auto-digestion of the pancreas leads to the release of both amylase and lipase, leading to elevated levels in the blood. For this reason, normal serum amylase and lipase levels in a patient with acute abdominal pain would typically rule out acute pancreatitis in favor of another diagnosis. Here we present two cases of acutely ill patients that were confirmed to have acute pancreatitis radiologically but with serum amylase and lipase levels that remained within the normal range throughout their illnesses for both patients. These cases suggest that while an important diagnostic tool, serum amylase and lipase should not be used as the sole factor to either diagnose or rule out acute pancreatitis. Instead, these laboratory markers should be viewed in the context of the patient’s overall presentation, weighted equally with the presenting signs, symptoms, and imaging studies to help guide toward a diagnosis.

  9. Hydroxyproline and proline inhibit α-amylase from isolated barley aleurone layers

    Directory of Open Access Journals (Sweden)

    Craig C. Freudenrich

    2014-02-01

    Full Text Available Previously, we reported that 1 mM hydroxyproline appeared to inhibit the gibberellic acid-induced release of α-amylase from isolated Hordeum vulgare L. cv. Himalaya aleurone layers into an incubation medium. Here, we report our attempts to determine the mechanism(s for this inhibition and whether this inhibition can be caused by other proline analogues. Both 1 mM hydroxyproline and proline inhibited extracellular a-amylase activity without affecting its intracellular activity. This suggested that neither hydroxyproline nor proline impaired the release of a-amylase. Lineweaver-Burk plots revealed that both hydroxyproline and proline uncompetitively inhibited α-amy-lase. Thus, the inhibition is probably an assay artifact resulting from the formation of an enzyme-substrate-hydroxyproline or -proline complex. Because azetidine-2-carboxylic acid, glutamic acid and pipecolic acid did not inhibit extracellular α-amylase activity, the uncompetitive inhibition of a-amylase must be unique to imino aicids as well as their precursors and derivatives which possess a five membered ring.

  10. beta-Amylase production by some Bacillus cereus, Bacillus megaterium and Bacillus polymyxa [correction of polymaxa] strains.

    Science.gov (United States)

    Niziołek, S

    1997-01-01

    The production of extracellular beta-amylase by some Bacillus cereus, Bacillus megaterium and Bacillus polymyxa [corrected] strains was investigated, and the maximal yields of the enzyme were 3.6; 9.3 and 20.4 U/mL of the culture fluid, respectively (U, 1 mumol of maltose equivalent per min at 30 degrees C). Several cultivation media were used for beta-amylase production. Bacillus cereus and some strains of Bacillus megaterium gave good yields of beta-amylase only in medium with the addition of nutrient broth. However, beta-amylase produced during growth in protein rich medium (nutrient broth) was highly unstable, probably due to inactivation by proteolytic enzymes co-existing in the culture fluid. Bacillus polymyxa [corrected] strains can produce good yields of beta-amylase on a semi-synthetic medium consisting of inorganic salts, potato starch and inexpensive soybean extract instead of costly peptone and meat extract. The most potential beta-amylase producer was the strain Bacillus polymyxa [corrected] NCIB 8524. The tested Bacillus megaterium and Bacillus polymyxa [corrected] strains were apparently differentiated by temperature cultivation (30 and 37 degrees C) suitable for beta-amylase amylase yield.

  11. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    Science.gov (United States)

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylase that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization,...

  12. A Kinetic Model to Explain the Maximum in alpha-Amylase Activity Measurements in the Presence of Small Carbohydrates

    NARCIS (Netherlands)

    Baks, T.; Janssen, A.E.M.; Boom, R.M.

    2006-01-01

    The effect of the presence of several small carbohydrates on the measurement of the -amylase activity was determined over a broad concentration range. At low carbohydrate concentrations, a distinct maximum in the -amylase activity versus concentration curves was observed in several cases. At higher

  13. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222

    Directory of Open Access Journals (Sweden)

    Shalini Singh

    2015-06-01

    Full Text Available Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best of production conditions. This study evaluates the influence of varying concentration of Ferrous sulphate (Fe2+ on microbial growth and amylase production for Aspergillus, Aspergillus fumigatus NTCC1222. Ferrous sulphate enhanced growth (concentration of 100mg/L by 1.83%, compared to the control. In contrast, it decreased amylase activity at all concentrations tested. As the concentration of ferrous sulphate increased, the amylase activity decreased. Amylases are metalloenzymes and the inhibition in amylase activity observed in the presence of ferrous ions may be due to competition between the exogenous cation and the protein associated cation, resulting in reduced metalloenzyme activity. Further studies will aim to evaluate the effect of different ferrous salts and different forms of iron on amylase production by Aspergillus fumigatus NTCC1222.

  14. Selective sweep on human amylase genes postdates the split with Neanderthals

    Science.gov (United States)

    Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas

    2016-01-01

    Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181

  15. A kinetic model of starch hydrolysis by alpha- and beta-amylase during mashing.

    Science.gov (United States)

    Marc, A; Engasser, J M; Moll, M; Flayeux, R

    1983-02-01

    Kinetics of malt starch hydrolysis by endogeneous alpha- and beta-amylases has been experimentally investigated in laboratory-, pilot- and industrial-scale reactors. The production rates of glucose, maltose, maltotriose and total extract, and the separate alpha- and beta-amylases deactivation rates are measured at varying mashing temperature and different initial starch concentrations and qualities. Based on the experimental results, a model is proposed that takes into account the initial carbohydrates and enzymes dissolution, the starch gelatinization, the separate hydrolytic action of alpha-and beta-amylases on insoluble and soluble starch and dextrins, and the influence of temperature both on enzyme activities and thermal denaturation rate. The model can predict, at the three scales, the final sugars concentrations in the wort for given initial malt concentrations and enzymatic contents, and for a fixed temperature profile during the mashing process.

  16. Implications of alpha-amylase production and beta-glucuronidase expression in Escherichia coli strains.

    Science.gov (United States)

    Caldini, G; Strappini, C; Trotta, F; Cenci, G

    1999-01-01

    Two Escherichia coli strains in which alpha-amylase production differed were used to study in depth some characteristics related to beta-glucuronidase induction by starch. The beta-glucuronidase background activity in Luria broth medium was comparable for the two isolates, but only amylase positive S1 was able to grow on starch molecules supplied as the sole carbon source. In this case growth resulted at higher beta-glucuronidase levels (p beta-glucuronidase activity of amylase negative M94 remained unchanged during starvation on starch medium, but an induced response was observed with methylumbelliferyl-glucuronide. These results further support the hypothesis that starch metabolism is involved in the complex beta-glucuronidase regulation of E. coli strains. This is relevant not only for basic research but also to investigating gut microbial enzymology.

  17. Agrobacterium-mediated transformation of chickpea with -amylase inhibitor gene for insect resistance

    Indian Academy of Sciences (India)

    S Ignacimuthu; S Prakash

    2006-09-01

    Chickpea is the world’s third most important pulse crop and India produces 75% of the world’s supply. Chickpea seeds are attacked by Callosobruchus maculatus and C. chinensis which cause extensive damage. The -amylase inhibitor gene isolated from Phaseolus vulgaris seeds was introduced into chickpea cultivar K850 through Agrobacterium-mediated transformation. A total of 288 kanamycin resistant plants were regenerated. Only 0.3% of these were true transformants. Polymerase chain reaction (PCR) analysis and Southern hybridization confirmed the presence of 4.9 kb -amylase inhibitor gene in the transformed plants. Western blot confirmed the presence of -amylase inhibitor protein. The results of bioassay study revealed a significant reduction in the survival rate of bruchid weevil C. maculatus reared on transgenic chickpea seeds. All the transgenic plants exhibited a segregation ratio of 3:1.

  18. A highly efficient and thermostable α-amylase from soya bean seeds.

    Science.gov (United States)

    Prakash, Om; Jaiswal, Nivedita

    2010-12-01

    The α-amylase from soya bean seeds was purified by affinity precipitation, resulting in approx. 20-fold purification with approx. 84% recovery. The purified α-amylase had an optimum pH of 5.5, optimum temperature of 75 °C, Arrhenius energy of activation of 6.03 kcal/mol (1 kcal≈4.184 kJ) and a Km of 2.427 mg/ml (starch substrate). The enzyme had maximum substrate specificity for starch. Among the various metal ions tested, Co2+ and Mn2+ were found to be strong activators. The effect of thiol group modifying agents showed that the thiols of soya bean α-amylase are not directly involved in catalysis. The thermostability of the enzyme makes it suitable for starch liquefaction and the detergent industry respectively.

  19. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications.

    Science.gov (United States)

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications.

  20. Thermophilic amylase from Thermus sp. isolation and its potential application for bioethanol production

    Directory of Open Access Journals (Sweden)

    Amin Fatoni

    2012-11-01

    Full Text Available Limited reserves of fossil energy stimulate researchers to explore for a new alternative energy, such as bioethanol.A thermophilic amylase producing bacterium was isolated from local hot-springs and its characteristic and potential applicationfor bioethanol production was determined. The obtained amylase was studied to determine its optimum temperature, pH,enzymatic reaction time, and substrate concentration. Tapioca waste was used as the substrate to find the potential of theamylase for degrading starch into glucose, and then the process was continued by fermentation to produce bioethanol. Theamylase producer bacterium was proposed as genus Thermus sp. The crude amylase that was obtained has the optimumtemperature of 60°C and optimum pH of 8.0, optimum substrate concentration at 10% (w/w and optimum enzymatic reactiontime of 45 minutes. These enzymes convert the starches of waste tapioca at optimum conditions, with the result of 2.9%ethanol produced from raw materials.

  1. Interactions between Barley a-Amylases, Substrates, Inhibitors and Regulatory Proteins

    DEFF Research Database (Denmark)

    Hachem, Maher Abou; Bozonnet, Sophie; Willemoës, Martin

    2006-01-01

    Barley a-amylase binds sugars at two sites on the enzyme surface in addition to the active site. Crystallography and site-directed mutagenesis highlight the importance of aromatic residues at these surface sites as demonstrated by Kd values determined for ß-cyclodextrin by surface plasmon resonance......, a fully hydrated calcium ion at the protein interface mediates contact between inhibitor residues and the enzyme catalytic groups in a manner that depends on calcium and which can be suppressed by site-directed mutagenesis of Glu168 in BASI. Finally certain inhibitors and enzymes are targets...... of the disulphide reductase thioredoxin h that attacks a specific disulphide bond in BASI and, remarkably, reduces two different disulphide bonds in the barley monomeric and dimeric amylase inhibitors that both belong to the CM-proteins and inhibit animal a-amylase....

  2. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide.

    Science.gov (United States)

    Tysoe, Christina; Williams, Leslie K; Keyzers, Robert; Nguyen, Nham T; Tarling, Chris; Wicki, Jacqueline; Goddard-Borger, Ethan D; Aguda, Adeleke H; Perry, Suzanne; Foster, Leonard J; Andersen, Raymond J; Brayer, Gary D; Withers, Stephen G

    2016-03-23

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.

  3. SOME PROPERTIES OF ENDOGENOUS α-AMYLASE INHIBITOR FROM WHEAT GRAIN

    Directory of Open Access Journals (Sweden)

    Aidar Atymtaevich Khakimzhanov

    2014-02-01

    Full Text Available The protein with endogenous α-amylase inhibitor activity was extracted and purified from wheat (Triticum aestivum grains through 70% ammonium sulphate fractionation, ion-exchange chromatography on DEAE-Sephacel and gel-chromatography on Toyapearl HW-50. The molecular weight and isoelectric point of protein were estimated about 21 kD and 7.0 respectively. The inhibitor repressed of high pI wheat α-amylase isozymes, but had no effect on amylases of microbial and animal origin. The inhibitor also exhibited activity towards serine protease subtilisin. The inhibitor was the most active at pH 7.8 to pH 8.0 and was stable up to 90° C for 10 minutes. The protein is localized in the peripheral parts of the seed, and in the starchy endosperm.

  4. ANTICARIES AND α-AMYLASE INHIBITORY ACTIVITY OF JASMINUM ARBORESCENS ROXB. (OLEACEAE LEAVES EXTRACT

    Directory of Open Access Journals (Sweden)

    Bhagath K

    2013-12-01

    Full Text Available The aim of the present study was to determine anti caries and α-amylase inhibitory activity of leaf extract of Jasminum arborescens Roxb. (Oleaceae. Anti caries activity was determined by Agar well diffusion assay against seven clinical isolates of Streptococcus mutans (Sm-01 to Sm-07 recovered from dental caries subjects. Enzyme inhibitory activity was tested against α-amylase by spectrophometric method using starch as substrate. The extract exhibited dose dependent inhibition against cariogenic isolates. Among seven isolates, isolate Sm-04 and Sm-06 were inhibited to higher and least extent respectively. The extract was found to cause inhibition of α-amylase activity in a dose dependent manner and its IC50 value was found to be 17.45 mg/ml. The inhibitory activity could be attributed to the presence of secondary metabolites. The plant may be a potential source for development of agents which are active against dental caries pathogens and for diabetes mellitus.

  5. Study on Salivary Glands α-amylase In Wheat Bug Eurygaster maura (Hemiptera: Scutelleridae

    Directory of Open Access Journals (Sweden)

    Mohammad Mehrabadi

    2009-01-01

    Full Text Available α-amylase activity in the salivary glands of Eurygaster maura was determined by biochemical experiments. Some of adult insect was collected and their salivary glands isolated and characterized. Enzyme samples from salivary glands of adults were prepared by the method of Cohen with slight modifications. α-Amylase activity was assayed based on Bernfeld method by the dinitrosalicylic acid (DNS procedure. The activity of α-amylase in salivary glands was 0.050 U/insect. The optimum pH and temperature for the enzyme activity was determined to be 6.5-7 and 30-35°C, respectively. The enzyme activity was inhibited by addition of EDTA (Ethylenediamine tetraacetic acid urea, CaCl2, MgCl2 and SDS but Mg2+, NaCl and KCl enhanced enzyme activity.

  6. Spatio-temporal appearance of α-amylase and limit dextrinase in barley aleurone layer in response to gibberellic acid, abscisic acid and salicylic acid

    DEFF Research Database (Denmark)

    Shahpiri, Azar; Talaei, Nasim; Finnie, Christine

    2015-01-01

    Release of LD was found to differ from that of amylase and was suggested to depend on programmed cell death (PCD). Despite detection of intracellular amylase in untreated aleurone layers or aleurone layers treated with ABA or SA, α-amylase was not released from these samples. Nevertheless, the re...

  7. Heterologous expression, biochemical characterization, and overproduction of alkaline α-amylase from Bacillus alcalophilus in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Li Jianghua

    2011-10-01

    Full Text Available Abstract Background Alkaline α-amylases have potential applications for hydrolyzing starch under high pH conditions in the starch and textile industries and as ingredients in detergents for automatic dishwashers and laundries. While the alkaline α-amylase gains increased industrial interest, the yield of alkaline α-amylases from wild-type microbes is low, and the combination of genetic engineering and process optimization is necessary to achieve the overproduction of alkaline α-amylase. Results The alkaline α-amylase gene from Bacillus alcalophilus JN21 (CCTCC NO. M 2011229 was cloned and expressed in Bacillus subtilis strain WB600 with vector pMA5. The recombinant alkaline α-amylase was stable at pH from 7.0 to 11.0 and temperature below 40°C. The optimum pH and temperature of alkaline α-amylase was 9.0 and 50°C, respectively. Using soluble starch as the substrate, the Km and Vmax of alkaline α-amylase were 9.64 g/L and 0.80 g/(L·min, respectively. The effects of medium compositions (starch, peptone, and soybean meal and temperature on the recombinant production of alkaline α-amylase in B. subtilis were investigated. Under the optimal conditions (starch concentration 0.6% (w/v, peptone concentration 1.45% (w/v, soybean meal concentration 1.3% (w/v, and temperature 37°C, the highest yield of alkaline α-amylase reached 415 U/mL. The yield of alkaline α-amylase in a 3-L fermentor reached 441 U/mL, which was 79 times that of native alkaline α-amylase from B. alcalophilus JN21. Conclusions This is the first report concerning the heterologous expression of alkaline α-amylase in B. subtilis, and the obtained results make it feasible to achieve the industrial production of alkaline α-amylase with the recombinant B. subtilis.

  8. a-淀粉酶的应用研究进展%Research Progress of the a-amylase Application

    Institute of Scientific and Technical Information of China (English)

    丁皓; 王冠; 徐丽; 程瑛

    2012-01-01

    Amylase is the general term for a class of catalytic decomposition of starch, glycogen, dextrin, the glycosidic bond enzymes. Amylase included a-amylase, β-amylase and glucoamylase enzymes. This article focused on the research progress application, detection methods, and enzymatic properties of the a-amylase.%淀粉酶是指一类能催化分解淀粉(糖原、糊精)的糖苷键的酶总称,包括a-淀粉酶、β-淀粉酶、葡萄糖淀粉酶等。文章综述了a-淀粉酶的研究进展、应用、检测方法以及酶争陛质。

  9. Two-step purification and partial characterization of an extra cellular α-amylase from Bacillus licheniformis

    Directory of Open Access Journals (Sweden)

    Zare Mirakabadi, A.

    2012-11-01

    Full Text Available The aim of this study was production and partial purification of α-amylase enzyme by Bacillus licheniformis. B. Licheniformis was allowed to grow in broth culture for purpose of inducing α-amylase enzyme. Optimal conditions for amylase production by B. Licheniformis are incubation period of 120 h, temperature of 37 °C and pH 7.0. The α-amylase enzyme was purified by ion exchange chromatography on DEAE-sepharose CL-6B and sephadex G-100 gel filtration with a 19.1-fold increase in specific activity as compared to the concentrated supernatant and with a specific activity of 926.47 U/mg. The α-amylase had the highest activity at pH 7.0 and 65 °C. According to the data on native polyacrylamide gel electrophoresis, the molecular weight of the purified enzyme was 72 kDa.

  10. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch.

    Science.gov (United States)

    Say, R; Şenay, R Hilal; Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz; Akgöl, Sinan; Denizli, Adil

    2013-05-01

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. Km values were 0.26 and 0.87 mM and Vmax values were 0.36 IU mg(-1) and 22.32 IU mg(-1) for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70-80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst.

  11. [Alpha-amylase as an occupational allergen in baking industry employees].

    Science.gov (United States)

    De Zotti, R; Larese, F; Molinari, S

    1994-01-01

    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Partial Purification and Characterization of a Thermostable Actinomycete beta-Amylase.

    Science.gov (United States)

    Obi, S K; Odibo, F J

    1984-03-01

    A thermostable amylase, possibly a beta-amylase from Thermoactinomyces sp. no. 2 isolated from soil, is reported. The enzyme was purified 36-fold by acetone precipitation, ion-exchange chromatography, and Sephadex G-200 gel filtration, and the molecular weight was estimated at 31,600. The enzyme was characterized by demonstration of optimum activity at 60 degrees C and pH 7 and by retention of 70% activity at 70 degrees C (30 min). It was stimulated by Mn and Fe but strongly inhibited by Hg. Maltose was the only detectable product of hydrolysis of starches and was quantitatively highest in plantain starch hydrolysate.

  13. Expression of α-Amylase Gene of Bacillus licheniformis in Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    罗进贤; 黎杨; 李文清; 张添元; 何鸣

    1994-01-01

    The secretive expression vector has been constructed using the promoter and signal se-quence of yeast MF-α1 factor,and the Bacillus licheniformis α-amylase gene without promoter and signal se-quence has been inserted into the downstream of the signal sequence on the vector.After the readjustment ofthe reading frame,the amylase gene was expressed in Saccharomyces cerevisiae and the product was secretedfrom it.The properties of enzymes secreted from yeast and B.subtilis are compared,and the mechanism ofthe gene expression and product secretion are discussed.

  14. Componential profile and amylase inhibiting activity of phenolic compounds from Calendula officinalis L. leaves.

    Science.gov (United States)

    Olennikov, Daniil N; Kashchenko, Nina I

    2014-01-01

    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6'-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6''-acetyl)-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase.

  15. Amylase-Binding Protein B of Streptococcus gordonii Is an Extracellular Dipeptidyl-Peptidase▿

    OpenAIRE

    Chaudhuri, Biswendu; Paju, Susanna; Haase, Elaine M.; Vickerman, M. Margaret; Tanzer, Jason M.; Frank A Scannapieco

    2008-01-01

    The oral commensal bacterium Streptococcus gordonii interacts with salivary amylase via two amylase-binding proteins, AbpA and AbpB. Based on sequence analysis, the 20-kDa AbpA protein is unique to S. gordonii, whereas the 82-kDa AbpB protein appears to share sequence homology with other bacterial dipeptidases. The aim of this study was to verify the peptidase activity of AbpB and further explore its potential functions. The abpB gene was cloned, and histidine-tagged AbpB (His-AbpB) was expre...

  16. Binding of Tris to Bacillus licheniformis alpha-amylase can affect its starch hydrolysis activity.

    Science.gov (United States)

    Ghalanbor, Zahra; Ghaemi, Nasser; Marashi, Sayed-Amir; Amanlou, Massoud; Habibi-Rezaei, Mehran; Khajeh, Khosro; Ranjbar, Bijan

    2008-01-01

    Bacillus licheniformis alpha-amylase (BLA) is routinely used as a model thermostable amylase in biochemical studies. Its starch hydrolysis activity has recently been studied in Tris buffer. Here, we address the question that whether the application of Tris buffer may influence the results of BLA activity analyses. Based on the inhibition studies and docking simulations, we suggest that Tris molecule is a competitive inhibitor of starch-hydrolyzing activity of BLA, and it has a high tendency to bind the enzyme active site. Hence, it is critically important to consider such effect when interpreting the results of activity studies of this enzyme in Tris buffer.

  17. [Ratio of amylase clearance and creatinine clearance in the diagnosis of acute pancreatitis].

    Science.gov (United States)

    Haffter, D; Reichlin, B; Gyr, K

    1981-05-30

    In 21 healthy volunteers the ratio of amylase clearance and creatinine clearance (Cam/Ccr) was determined in urine collected at admission, after a 1-hour collection period and after a 2-hour collection period. The normal values were 1.8 +/- 1.6%, 1.9 +/- 2% and 2.0 +/- 1.7% respectively. They were comparable with those published by others. The reproducibility of the method was acceptable (r = 0.62). When compared with serum amylase determinations, Cam/Ccr showed neither better sensitivity in 19 patients suffering an acute episode of proven pancreatitis, nor better specificity in 19 patients with acute abdomen but no evidence of pancreatitis.

  18. Pigment and amylase production in Penicillium sp NIOM-02 and its radical scavenging activity

    Digital Repository Service at National Institute of Oceanography (India)

    Dhale, M.A.; VijayRaj, A.S.

    and Singh 1995). During solid-state fermentation P. restrictum produced amylase, lipase and protease on basal medium of industrial waste of babassu oil (Palma et al., 2006). A high maltose producing amylase was secreted from P. expansum (Doyle et al..., 17, 770-778. Ogihara, J. & Oishi, K. (2002). Effect of ammonium nitrate on the production of PP-V and monascorubrin homologues by Penicillium sp. AZ. Journal of Bioscience and Bioengineering, 93, 54-59. Palma, M.B., Pinto, A.L., Gombert, A...

  19. Cloning and characterization of a novel α-amylase from a fecal microbial metagenome.

    Science.gov (United States)

    Xu, Bo; Yang, Fuya; Xiong, Caiyun; Li, Junjun; Tang, Xianghua; Zhou, Junpei; Xie, Zhenrong; Ding, Junmei; Yang, Yunjuan; Huang, Zunxi

    2014-04-01

    To isolate novel and useful microbial enzymes from uncultured gastrointestinal microorganisms, a fecal microbial metagenomic library of the pygmy loris was constructed. The library was screened for amylolytic activity, and 8 of 50,000 recombinant clones showed amylolytic activity. Subcloning and sequence analysis of a positive clone led to the identification a novel gene (amyPL) coding for α-amylase. AmyPL was expressed in Escherichia coli BL21 (DE3) and the purified AmyPL was enzymatically characterized. This study is the first to report the molecular and biochemical characterization of a novel α-amylase from a gastrointestinal metagenomic library.

  20. alpha-Amylase and programmed cell death in aleurone of ripening wheat grains.

    Science.gov (United States)

    Mrva, Kolumbina; Wallwork, Meredith; Mares, Daryl J

    2006-01-01

    Late maturity alpha-amylase (LMA) in wheat is a genetic defect that may result in the accumulation of unacceptable levels of high pI alpha-amylase in grain in the absence of germination or weather damage. During germination, gibberellin produced in the embryo triggers expression of alpha-Amy genes, the synthesis of alpha-amylase and, subsequently, cell death in the aleurone. LMA also involves the aleurone and whilst LMA appears to be independent of the embryo there is nevertheless some evidence that gibberellin is involved. The aim of this investigation was to determine whether the increase in alpha-amylase activity in LMA-prone genotypes, like alpha-amylase synthesis by aleurone cells in germinating or GA-challenged grains, is followed by aleurone cell death. Programmed cell death was seen in aleurone layers from developing, ripe and germinated grains using confocal microscopy and fluorescent probes specific for dead or living cells. Small pockets of dying cells were observed distributed at random throughout the aleurone of ripening LMA-affected grains and by harvest-ripeness these cells were clearly dead. The first appearance of dying cells, 35 d post-anthesis, coincided with the later part of the 'window of sensitivity' in grain development in LMA-prone wheat cultivars. No dead or dying cells were present in ripening or fully ripe grains of control cultivars. In germinating grains, dying cells were observed in the aleurone adjacent to the scutellum and, as germination progressed, the number of dead cells increased and the affected area extended further towards the distal end of the grain. Aside from the obvious differences in spatial distribution, dying cells in 20-24 h germinated grains were similar to dying cells in developing LMA-affected grains, consistent with previous measurements of alpha-amylase activity. The increase in high pI alpha-amylase activity in developing grains of LMA-prone cultivars, like alpha-amylase synthesis in germinating grains, is

  1. Evaluation of amylase and lipase levels in blunt trauma abdomen patients

    Directory of Open Access Journals (Sweden)

    Subodh Kumar

    2012-01-01

    Full Text Available Background: There are studies to prove the role of amylase and lipase estimation as a screening diagnostic tool to detect diseases apart from acute pancreatitis. However, there is sparse literature on the role of serum and urine amylase, lipase levels, etc to help predict the specific intra-abdominal injury after blunt trauma abdomen (BTA. Aim: To elucidate the significance of elevation in the levels of amylase and lipase in serum and urine samples as reliable parameters for accurate diagnosis and management of blunt trauma to the abdomen. Materials and Methods: A prospective analysis was done on the trauma patients admitted in Jai Prakash Narayan Apex Trauma Center, AIIMS, with blunt abdomen trauma injuries over a period of six months. Blood and urine samples were collected on days 1, 3, and 5 of admission for the estimation of amylase and lipase, liver function tests, serum bicarbonates, urine routine microscopy for red blood cells, and complete hemogram. Clinical details such as time elapsed from injury to admission, type of injury, trauma score, and hypotension were noted. Patients were divided into groups according to the single or multiple organs injured and according to their hospital outcome (dead/discharged. Wilcoxon′s Rank sum or Kruskal-Wallis tests were used to compare median values in two/three groups. Data analysis was performed using STATA 11.0 statistical software. Results: A total of 55 patients with median age 26 (range, 6-80 years, were enrolled in the study. Of these, 80% were males. Surgery was required for 20% of the patients. Out of 55 patients, 42 had isolated single organ injury [liver or spleen or gastrointestinal tract (GIT or kidney]. Patients with pancreatic injury were excluded. In patients who suffered liver injuries, urine lipase levels on day 1, urine lipase/amylase ratio along with aspartate aminotransferase (AST, alanine aminotransferase (ALT, and alkaline phosphatase (ALP on days 1, 3, and 5, were found to

  2. Advantages of soybeanβ-amylase in maltose production%大豆β-淀粉酶在生产麦芽糖浆上的优势

    Institute of Scientific and Technical Information of China (English)

    许永苗; 李惠安; 伍伯良; 黄玉新; 黄智钧

    2014-01-01

    介绍了β-淀粉酶和α-淀粉酶的酶种来源及其在生产麦芽糖浆中的作用机理,并对大豆β-淀粉酶、大麦β-淀粉酶、小麦β-淀粉酶、真菌α-淀粉酶、普鲁兰酶的适用条件、失活条件进行了比较,得出大豆β-淀粉酶在生产麦芽糖浆上的优势。%This paper summarized the resources and mechanisms ofβ-amylase and α-amylase. Optimum condi-tions and inactivated conditions of the soybeanβ-amylase, barleyβ-amylase, wheatβ-amylase, fungalα-amylase, and pullulanase were compared. Advantage of soybeanβ-amylase in maltose production was pointed out.

  3. Kinetic Analysis of Amylase Using Quantitative Benedict's and Iodine Starch Reagents

    Science.gov (United States)

    Cochran, Beverly; Lunday, Deborah; Miskevich, Frank

    2008-01-01

    Quantitative analysis of carbohydrates is a fundamental analytical tool used in many aspects of biology and chemistry. We have adapted a technique developed by Mathews et al. using an inexpensive scanner and open-source image analysis software to quantify amylase activity using both the breakdown of starch and the appearance of glucose. Breakdown…

  4. Amylase,. beta. -glucanase and protease activities from a mutant of Bacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Yin, X.S.; Li, Y.X. (Wuxi Inst. of Light Industry, JS (China). Dept. of Fermentation Technology); Stark, J.R. (International Centre for Brewing and Distilling, Edinburgh (UK))

    1991-10-01

    Enzymes in the shake culture of a mutant of Bacillus subtilis developed mainly during the stationary phase of growth. Extracellular {alpha}-amylase and protease activities increased and then declined to relatively low levels after 48 h of incubation while the {beta}-glucanase activity remained high. The production of extracellular proteolytic activity commenced only when the low molecular weight nitrogen source in the medium was completely consumed. Enzymes were fractionated by ion-exchange chromatography and the molecular weights of {beta}-glucanase, {alpha}-amylase, protease I and protease II were estimated by gel filtration to be 1.3x10{sup 4}, 3.2x10{sup 4}, 6.3x10{sup 3} and 2.0x10{sup 4}, respectively. The {beta}-glucanase and {alpha}-amylase showed maximum activities at around pH 7, but the two proteases had different pH optima (pH 6-7 and 8.5, respectivelty). The presence of proteolytic activity in the enzyme preparation had a significant effect on the stability of the {beta}-glucanase and the {alpha}-amylase at 65deg C. (orig.).

  5. Alpha-amylase inhibitory activities of ascidians in the treatment of diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Antonyraj Selva Prabhu

    2014-12-01

    Full Text Available Extracts of ten selected ascidians with a reputation of usefulness in treating diabetes were examined for alpha-amylase inhibition using an in vitro model. The extract with the highest activity was selected for further characterization. From the results ethyl acetate showed predominant amylase inhibition activity for all species and the maximum level of inhibition was recorded in Phallusia mammillata (68% at 300 µg/mL and the lowest activity was noted in Microcosmus squamiger (12% at 200 µg/mL. After preliminary results, the methanolic extract of P. mammallita were further assayed for confirmation of enzyme inhibition and the maximum results (82% were obtained at 250 µg/mL and the IC50 value of P. mammillata were evidenced at 145.0 ± 0.4 µg/g. In the present study, P. mammillata indicated the maximum α-amylase activity without toxic effects. Similarly, α-glucosidase and α-amylase inhibitor bromophenol, C6H5BrO was produced by P. mammillata.

  6. How Do Detergents Work? A Qualitative Assay to Measure Amylase Activity

    Science.gov (United States)

    Novo, M. Teresa; Casanoves, Marina; Garcia-Vallvé, Santi; Pujadas, Gerard; Mulero, Miquel; Valls, Cristina

    2016-01-01

    We present a practical activity focusing on two main goals: to give learners the opportunity to experience how the scientific method works and to increase their knowledge about enzymes in everyday situations. The exercise consists of determining the amylase activity of commercial detergents. The methodology is based on a qualitative assay using a…

  7. Improvement of starch digestion using α-amylase entrapped in pectin-polyvinyl alcohol blend.

    Science.gov (United States)

    Cruz, Maurício; Fernandes, Kátia; Cysneiros, Cristine; Nassar, Reginaldo; Caramori, Samantha

    2015-01-01

    Polyvinyl alcohol (PVA) and pectin blends were used to entrap α-amylase (Termamyl) using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25%) on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM), tensile strength (TS), elongation, and rate of dissolution in water (pH 5.7), ruminal buffering solution (pH 7.0), and reactor containing 0.1 mol L(-1) sodium phosphate buffer (pH 6.5), were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E) decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h), in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications.

  8. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion.

    Science.gov (United States)

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng

    2015-11-01

    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits.

  9. Identification a Novel Raw-Starch-Degrading-α-Amylase from a Tropical Marine Bacterium

    Directory of Open Access Journals (Sweden)

    Zeily Nurachman

    2010-01-01

    Full Text Available Problem statement: Bacteria from the surface of the tropical marine hard coral Acropora sp. were screened for producing raw-starch-degrading-á-amylase. Approach: Based on its 16s rDNA sequence, a bacterium that produced the highest amylolitic activity was identified as Bacillus amyloliquifaciens ABBD. The bacterial isolate secreted a á-amylase extracellularly and then the enzyme was partially purified by ammonium sulfate precipitation followed by anion exchange chromatography. Results: Electrophoresis results both SDS-PAGE and native PAGE suggested that the enzyme was a heterodimeric protein (97 kDa consisting of 45 and 55 kDa subunits. The á-amylase had an optimum pH of 7.0 and temperature of 60°C. More than 80% activity of the enzyme was retained under high salt conditions (up to 20% NaCl. The enzyme remained stable at 50°C for 1 h. Starch hydrolysis by the enzyme at 70°C yielded oligosaccharides (G2-G4 and at room temperature yielded glucose/maltose (G1 and G2. Conclusion: The B. amyloliquifaciens ABBD á-amylase was capable of degrading various raw starch granules from corn, rice, cassava and sago at room temperature.

  10. Structure of Waxy Maize Starch Hydrolyzed by Maltogenic α-Amylase in Relation to Its Retrogradation.

    Science.gov (United States)

    Grewal, Navneet; Faubion, Jon; Feng, Guohua; Kaufman, Rhett C; Wilson, Jeff D; Shi, Yong-Cheng

    2015-04-29

    Maltogenic α-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different degrees by a maltogenic amylase. High-performance anion-exchange chromatography and size exclusion chromatography were used to determine saccharides formed and the molecular weight (Mw) distributions of the residual starch structure, respectively. Chain length (CL) distributions of debranched starch samples were further related to amylopectin (AP) retrogradation. Differential scanning calorimetry (DSC) results showed the complete inhibition of retrogradation when starches were hydrolyzed to >20% DH. Mw and CL distributions of residual AP structure indicated that with an increase in %DH, a higher proportion of unit chains with degree of polymerization (DP) ≤9 and a lower proportion of unit chains with DP ≥17 were formed. A higher proportion of short outer AP chains that cannot participate in the formation of double helices supports the decrease in and eventual inhibition of retrogradation observed with the increase in %DH. These results suggest that the maltogenic amylase could play a powerful role in inhibiting the staling of baked products even at limited starch hydrolysis.

  11. Determinants of salivary evening alpha-amylase in a large sample free of psychopathology

    NARCIS (Netherlands)

    Veen, Gerthe; Giltay, Erik J.; Vreeburg, Sophie A.; Licht, Carmilla M. M.; Cobbaert, Christa M.; Zitman, Frans G.; Penninx, Brenda W. J. H.

    2012-01-01

    Objective: Recently, salivary alpha-amylase (sAA) has been proposed as a suitable index for sympathetic activity and dysregulation of the autonomic nervous system (ANS). Although determinants of sAA have been described, they have not been studied within the same study with a large sample size withou

  12. Amy63, a novel type of marine bacterial multifunctional enzyme possessing amylase, agarase and carrageenase activities.

    Science.gov (United States)

    Liu, Ge; Wu, Shimei; Jin, Weihua; Sun, Chaomin

    2016-01-04

    A multifunctional enzyme is one that performs multiple physiological functions, thus benefiting the organism. Characterization of multifunctional enzymes is important for researchers to understand how organisms adapt to different environmental challenges. In the present study, we report the discovery of a novel multifunctional enzyme Amy63 produced by marine bacterium Vibrio alginolyticus 63. Remarkably, Amy63 possesses amylase, agarase and carrageenase activities. Amy63 is a substrate promiscuous α-amylase, with the substrate priority order of starch, carrageenan and agar. Amy63 maintains considerable amylase, carrageenase and agarase activities and stabilities at wide temperature and pH ranges, and optimum activities are detected at temperature of 60 °C and pH of 6.0, respectively. Moreover, the heteroexpression of Amy63 dramatically enhances the ability of E. coli to degrade starch, carrageenan and agar. Motif searching shows three continuous glycosyl hydrolase 70 (GH70) family homologs existed in Amy63 encoding sequence. Combining serial deletions and phylogenetic analysis of Amy63, the GH70 homologs are proposed as the determinants of enzyme promiscuity. Notably, such enzymes exist in all kingdoms of life, thus providing an expanded perspective on studies of multifunctional enzymes. To our knowledge, this is the first report of an amylase having additional agarase and carrageenase activities.

  13. Improvement of Starch Digestion Using α-Amylase Entrapped in Pectin-Polyvinyl Alcohol Blend

    Directory of Open Access Journals (Sweden)

    Maurício Cruz

    2015-01-01

    Full Text Available Polyvinyl alcohol (PVA and pectin blends were used to entrap α-amylase (Termamyl using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25% on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM, tensile strength (TS, elongation, and rate of dissolution in water (pH 5.7, ruminal buffering solution (pH 7.0, and reactor containing 0.1 mol L−1 sodium phosphate buffer (pH 6.5, were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h, in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications.

  14. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva

    Science.gov (United States)

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka

    2016-01-01

    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  15. Partial characterization of cold active amylases and proteases of Streptomyces sp. from Antarctica

    Directory of Open Access Journals (Sweden)

    Mihaela Cotârleţ

    2011-09-01

    Full Text Available The aim of this study was to isolate novel enzyme-producing bacteria from vegetation samples from East Antarctica and also to characterize them genetically and biochemically in order to establish their phylogeny. The ability to grow at low temperature and to produce amylases and proteases cold-active was also tested. The results of the 16S rRNA gene sequence analysis showed that the 4 Alga rRNA was 100% identical to the sequences of Streptomyces sp. rRNA from Norway and from the Solomon Islands. The Streptomyces grew well in submerged system at 20ºC, cells multiplication up to stationary phase being drastically increased after 120 h of submerged cultivation. The beta-amylase production reached a maximum peak after seven days, while alpha-amylase and proteases were performing biosynthesis after nine days of submerged cultivation at 20ºC. Newly Streptomyces were able to produce amylase and proteases in a cold environment. The ability to adapt to low temperature of these enzymes could make them valuable ingredients for detergents, the food industry and bioremediation processes which require low temperatures.

  16. Structural and biochemical features of acidic α-amylase of Bacillus acidicola.

    Science.gov (United States)

    Sharma, Archana; Satyanarayana, T

    2013-10-01

    The investigation is aimed at understanding structure-function aspect of α-amylase of an acidophilic bacterium Bacillus acidicola (BAamy), which is Ca(2+)-independent and active at acidic pH of native starch, and thus, suits better in starch saccharification process. The CD spectroscopic data analysis revealed that the enzyme has 30% α-helices, 14.2% β-sheets, and 55.8% random coils at 60 °C and pH 4.0. Using Bacillus stearothermophilus α-amylase (BStA) as the template, 3-D structure of rBAamy has been proposed. A complete loss in α-amylase activity was recorded when the amino acid residues (D231, E261 and D328) were substituted that confirmed their role in catalysis. The CD studies indicated a decrease in the α-helices content below and beyond the optimum pH and temperature that suggests a critical role of α-helix in maintaining the structural conformation of the enzyme. Fluorescence-quenching by N-bromosuccinimide (NBS) suggested the role of tryptophan in maintaining structural integrity of α-amylase and that by acrylamide indicated interaction by simple collision process.

  17. Inhibitory effect of hexane fraction from Myagropsis myagroides on pancreatic α-amylase in vitro.

    Science.gov (United States)

    Pak, Won-Min; Kim, Koth-Bong-Woo Ri; Kim, Min-Ji; Cho, Ji-Young; Ahn, Dong-Hyun

    2015-03-01

    A Myagropsis myagroides (Mm) methanol extract showed α-amylase inhibitory activity of 13% at a concentration of 5 mg/ml. Results showed that the hexane fraction from the Mm methanol extract exhibited α-amylase inhibitory activity with an IC50 value of 4.24 mg/ml. The hexane fraction was separated using silica-gel column chromatography, and six subfractions were obtained. The fraction eluted with CHCl3:MeOH = 50:1 showed the highest α-amylase inhibitory activity with an IC50 value of 0.72 mg/ml. This fraction was purified using Sephadex LH-20 column chromatography and an octadecyl silica (ODS) Sepak cartridge, obtaining seven subfractions. Fraction (Fr.) 4 also showed a strong α-amylase inhibitory activity with an IC50 value of 0.75 mg/ml. Fr. 4 was purified by Sephadex LH-20 column chromatography and ODS Sepak cartridge, obtaining six subfractions. Fr. 4-2 was identified as sargachromanol I with an IC50 value of 0.40 mg/ml, and the inhibition pattern analyzed from Lineweaver-Burk plots revealed it to be an uncompetitive inhibitor. These results suggest that Mm has potential as a natural antidiabetes agent.

  18. Production of Amylases and Proteases by Bacillus caldolyticus from Food Industry Wastes

    Directory of Open Access Journals (Sweden)

    Thorsten Jamrath

    2012-01-01

    Full Text Available Amylases and proteases are utilized in industrial processes such as starch liquefaction or as supplements for washing agents. For these applications it is desirable to have enzymes active at high temperatures (>70 °C. In this work, thermostable α-amylase and neutral proteases were produced using the thermophilic strain Bacillus caldolyticus DSM 405. The goal of this work is to reduce the cost of production media by substituting expensive medium components such as prehydrolyzed starch and peptone, used in control fermentations, by inexpensive food industry wastes such as potato fruit water, potato pulp, cheese whey, draff, pea pulp, pea fruit water, bread residues, and pork blood. Comparative studies were conducted in shake flasks. With the use of such wastes, significant improvements in the activities of the enzyme α-amylase were obtained along with concomitant reductions in medium costs. With the use of pea pulp, 160 % increase in the activity of α-amylase was observed with 97 % reduction in medium costs compared to control medium. The cost of medium for the production of proteases also decreased by more than 50 %.

  19. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase

    Science.gov (United States)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  20. Allotides: Proline-Rich Cystine Knot α-Amylase Inhibitors from Allamanda cathartica.

    Science.gov (United States)

    Nguyen, Phuong Q T; Luu, Thuy T; Bai, Yang; Nguyen, Giang K T; Pervushin, Konstantin; Tam, James P

    2015-04-24

    Cystine knot α-amylase inhibitors belong to a knottin family of peptidyl inhibitors of 30-32 residues and contain two to four prolines. Thus far, only four members of the group of cystine knot α-amylase inhibitors have been characterized. Herein, the discovery and characterization of five cystine knot α-amylase inhibitors, allotides C1-C5 (Ac1-Ac5) (1-5), from the medicinal plant Allamanda cathartica are reported using both proteomic and genomic methods. Proteomic analysis showed that 1-5 are 30 amino acids in length with three or four proline residues. NMR determination of 4 revealed that it has two cis- and one trans-proline residues and adopts two equally populated conformations in solution. Determination of disulfide connectivity of 2 by differential S-reduction and S-alkylation provided clues of its unfolding process. Genomic analysis showed that allotide precursors contain a three-domain arrangement commonly found in plant cystine knot peptides with conserved residues flanking the processing sites of the mature allotide domain. This work expands the number of known cystine knot α-amylase inhibitors and furthers the understanding of both the structural and biological diversity of this type of knottin family.

  1. Attenuation of Porphyromonas gingivalis oral infection by α-amylase and pentamidine.

    Science.gov (United States)

    Li, Ying; Miao, Yu-Song; Fu, Yun; Li, Xi-Ting; Yu, Shao-Jie

    2015-08-01

    The Porphyromonas gingivalis bacterium is one of the most influential pathogens in oral infections. In the current study, the antimicrobial activity of α-amylase and pentamidine against Porphyromonas gingivalis was evaluated. Their in vitro inhibitory activity was investigated with the agar overlay technique, and the minimal inhibitory and bactericidal concentrations were determined. Using the bactericidal concentration, the antimicrobial actions of the inhibitors were investigated. In the present study, multiple techniques were utilized, including scanning electron microscopy (SEM), general structural analysis and differential gene expression analysis. The results obtained from SEM and bactericidal analysis indicated a notable observation; the pentamidine and α-amylase treatment destroyed the structure of the bacterial cell membranes, which led to cell death. These results were used to further explore these inhibitors and the mechanisms by which they act. Downregulated expression levels were observed for a number of genes coding for hemagglutinins and gingipains, and various genes involved in hemin uptake, chromosome replication and energy production. However, the expression levels of genes associated with iron storage and oxidative stress were upregulated by α-amylase and pentamidine. A greater effect was noted in response to pentamidine treatment. The results of the present study demonstrate promising therapeutic potential for α-amylases and pentamidine. These molecules have the potential to be used to develop novel drugs and broaden the availability of pharmacological tools for the attenuation of oral infections caused by Porphyromonas gingivalis.

  2. Shear induced inactivation of a-amylase in a plain shear field

    NARCIS (Netherlands)

    Veen, van der M.E.; Iersel, van D.G.; Goot, van der A.J.; Boom, R.M.

    2004-01-01

    A newly developed shearing device was used to study shear-induced inactivation of thermostable alpha-amylase in a plain shear field, under conditions comparable to extrusion. The results show that the inactivation can be described well with a first-order process, in which the inactivation energy lar

  3. Coupled reactions of immobilized enzymes and immobilized substrates: clinical application as exemplified by amylase assay.

    Science.gov (United States)

    Barabino, R C; Gray, D N; Keyes, M H

    1978-08-01

    We described a partitioned enzyme-sensor system, which incorporates an immoblized substrate and three or more discrete immobilized enzymes. This instrument measures alpha-amylase activity by passing the solution containing alpha-amylase over a column packed with immobilized starch. The resulting oligosaccharides are successively exposed to a column or columns containing immobolized glucose oxidase, catalase, glucoamylase or maltase, and glucose oxidase. The resulting hydrogen peroxide is detected by a three-electrode amperometric cell. All immobilized reagents were immobilized on a particulate, porous alumina to allow rapid and constant flow rate. With use of less than optimum immobilized reagents, alpha-amylase activity has been measured from about 5 to 200 kU/liter with a 50 microliter sample size. Lack of sensitivity is predominantly attributable to the low activity and low stability of immobilized maltase and glucoamylase. We believe that a clinical test using this system is feasible and desirable because the immobilized reagent system should allow for testing of alpha-amylase with excellent precision, convenience to the operator, and low cost.

  4. Production of Active Bacillus licheniformis Alpha-Amylase in Tobacco and its Application in Starch Liquefaction

    NARCIS (Netherlands)

    Pen, J; MOLENDIJK, L; Quax, Wim J.; SIJMONS, PC; VANOOYEN, AJJ; VANDENELZEN, PJM; RIETVELD, K; HOEKEMA, A

    1992-01-01

    As a first example of the feasibility of producing industrial bulk enzymes in plants, we have expressed Bacillus licheniformis alpha-amylase in transgenic tobacco, and applied the seeds directly in starch liquification. The enzyme was properly secreted into the intercellular space, and maximum expre

  5. ALPHA-AMYLASE ACTIVITY IN VARIOUS CONCENTRATIONS OF THE IONIC LIQUID, 1-BUTYL-3-METHYLIMIDAZOLIUM CHLORIDE

    Science.gov (United States)

    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  6. In-vitro α amylase and glycosidase inhibitory effect of ethanolic extract of antiasthmatic drug - Shirishadi

    Directory of Open Access Journals (Sweden)

    Divya Kajaria

    2013-01-01

    Full Text Available Asthma and diabetes have strong relationship; both are cause and effect of each other. Oxidative stress due to bronchial asthma may cause insulin resistance whereas lack of proper insulin can cause defective smooth muscle relaxant. There is no single medicine available that can manage both diseases, rather the mainstay treatment of bronchial asthma causes hyperglycemia. Keeping this problem in focus, in this study the hypoglycemic effect of an indigenous antiasthmatic Ayurvedic drug Shirishadi was evaluated. Pancreatic alpha amylase and glucosidase inhibitors offer an effective strategy to lower the level of post prandial hyperglycemia via control of starch breakdown. For evaluation of hypoglycemic activity of drug, in-vitro alpha amylase and alpha glucosidase enzyme inhibition was calculated. Ethanolic extract of compound showed 76.40% + 0.88% reduction in alpha amylase activity and 63.85% + 0.36% in alpha glucosidase activity with IC 50 0.68 mg/ml and 2.89 mg/ml, respectively. This study suggests that the ethanolic extract of Shirishadi polyherbal compound effectively acts as alpha amylase and glucosidase inhibitor leading to a reduction in starch hydrolysis and hence acts as antiasthmatic as well as hypoglycemic drug.

  7. Carboxymethyl cellulose-gelatin-silica nanohybrid: an efficient carrier matrix for alpha amylase.

    Science.gov (United States)

    Singh, Vandana; Ahmad, Shakeel

    2014-06-01

    Carboxymethyl cellulose (CMC)-gelatin (G) dual templated polymerization of tetramethoxysilane (TMOS) furnished an efficient hybrid carrier support for alpha amylase. The material has been characterized using FTIR, XRD SEM, TGA and BET studies. The amylase was immobilized at the presynthesized hybrid support by adsorption and the immobilized enzyme was used to optimize the conditions for soluble starch hydrolysis. The immobilization did not change the optimum working pH (pH 5) and temperature (40°C) of the enzymatic reaction. The kinetic parameters of the immobilized (Km=9.970mgmL(-1); Vmax=66.23mgmL(-1)min(-1)) and free amylase (KM=4.0509mgmL(-1), Vmax=4.2909mgmL(-1)min(-1)) indicated that the immobilization has enhanced the catalytic function of diastase alpha amylase. The immobilized enzyme showed higher shelf life as compared to the free enzyme in solution and it could be reused for seven consecutive cycles where 85% of the initial activity was exhibited even in the last cycle. The present material is as efficient as our previously reported material CMC-AgNps-Si.

  8. Specificity of increased amylase to creatinine clearance ratio in acute pancreatitis.

    Science.gov (United States)

    Lankisch, P G; Koop, H; Otto, J; Oberdieck, U; Winckler, K; Wolfrum, D I

    1977-01-01

    The amylase to creatinine clearance ratio was found to be normal in 11 of 33 patients with acute pancreatitis. The ratio was elevated in 10 of 19 patients with renal insufficiency. Thus, it does not seem to be a specific index in the diagnosis of acute pancreatitis.

  9. Mechanism of increased renal clearnace of amylase/creatinine in acute pancreatitis.

    Science.gov (United States)

    Johnson, S G; Ellis, C J; Levitt, M D

    1976-11-25

    We investigated three possible causes of the increased ratio of amylase/creatinine clearance observed in acute pancreatitis. The presence of rapidly cleared isoamylase was excluded by studies of serum and urine, which demonstrated no anomalous isoamylases. In pancreatitis, the ratios (+/-1 S.E.M.) of both pancreatic isoamylase (9.2+/-0.6 per cent) and salivary isoamylase (8.6+/-1.6 per cent) were significantly (P less than 0.01) elevated over respective control values (2.4+/-0.2 and 1.8+/-0.2 per cent). Increased glomerular permeability to amylase was excluded by the demonstration of normal renal clearance of dextrans. We tested tubular reabsorption of protein by measuring the renal clearance of beta2-microglobulin, which is relatively freely filtered at the glomerulus and then avidly reabsorbed by the normal tubule. During acute pancreatitis the ratio of the renal clearance of beta2-microglobulin to that of creatinine was 1.22+/-0.52 per cent, an 80-fold increase over normal (0.015+/-0.002 per cent), with a rapid return toward normal during convalescence. Presumably, this reversible renal tubular defect also reduces amylase reabsorption and accounts for the elevated renal clearance of amylase/creatinine observed in acute pancreatitis.

  10. Salivary alpha-amylase : a measure associated with satiety and subsequent food intake in humans

    NARCIS (Netherlands)

    Harthoorn, L.F.

    2008-01-01

    Food intake regulation in humans involves various central and peripheral mechanisms. In this study salivary -amylase was examined for functioning as a measure of satiety and food intake. In a 1.25-h session, 32 fasted subjects were given a preload of starch-based custard (849 kJ) followed by ad libi

  11. A calorimetric study of solute effects on the kinetic stability of a-amylase

    DEFF Research Database (Denmark)

    Olsen, Søren Nymand; Andersen, Kim Bruno; Øgendal, Lars Holm;

    2009-01-01

    In this study we evaluated the applications of isothermal titration calorimetry (ITC) to Study solute effects on the kinetics of irreversible protein denaturation. More specifically, denaturation of Bacillus Halmapalus alpha-amylase (BHA) was initiated by addition of EDTA to the calorimetric cell...

  12. Enhancing Maritime Education and Training: Measuring a Ship Navigator's Stress Based on Salivary Amylase Activity

    Science.gov (United States)

    Murai, Koji; Wakida, Shin-Ichi; Miyado, Takashi; Fukushi, Keiichi; Hayashi, Yuji; Stone, Laurie C.

    2009-01-01

    Purpose: The purpose of this paper is to propose that the measurement of salivary amylase activity is an effective index to evaluate the stress of a ship navigator for safe navigation training and education. Design/methodology/approach: Evaluation comes from the simulator and actual on-board experiments. The subjects are real captains who have…

  13. Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations

    DEFF Research Database (Denmark)

    Møller, Kasper; Sharif, M.Z.; Olsson, Lisbeth

    2004-01-01

    amounts of ethanol. A fed-batch cultivation was carried out with S. kluyveri where the biomass concentration reached 85 g l(-1) and the alpha-amylase concentration reached 320 mg l(-1). Even though S. kluyveri could be grown to high cell density, it was also observed that it has a high maintenance...... and S. cerevisiae were transformed with the same plasmid, which led to secretion of active alpha-amylase in both cases. The S. cerevisiae 2 mu plasmid was found to be stable in S. kluyveri as evaluated by a constant alpha-amylase productivity in a continuous cultivation for more than 40 generations. S....... kluyveri and S. cerevisiae secreted alpha-amylase with similar yields during continuous cultivations at dilution rates of 0.1 and 0.2 h(-1) (4.8-5.7 mg (g dry weight)(-1)). At a dilution rate of 0.3 h(-1) the metabolism of S. kluyveri was fully respiratory, whereas S. cerevisiae produced significant...

  14. Assessing the susceptibility of amylose-lysophosphatidylcholine complexes to amylase by the use of iodine

    NARCIS (Netherlands)

    Ahmadiabhari, Salomeh; Woortman, Albert J. J.; Hamer, Rob J.; Loos, Katja

    2014-01-01

    The formation of amylose-lysophosphatidylcholine (LPC) inclusion complexes renders amylose less susceptible to amylase digestion. In order to better understand this phenomenon on a structural level, the complexation of 9% wheat starch suspensions with 0, 2, 3, and 5% exogenous LPC was developed in R

  15. Homogeneity and heterogeneity in amylase production by Bacillus subtilis under different growth conditions

    NARCIS (Netherlands)

    Ploss, Tina N.; Reilman, Ewoud; Monteferrante, Carmine G.; Denham, Emma L.; Piersma, Sjouke; Lingner, Anja; Vehmaanpera, Jari; Lorenz, Patrick; van Dijl, Jan Maarten

    2016-01-01

    Background: Bacillus subtilis is an important cell factory for the biotechnological industry due to its ability to secrete commercially relevant proteins in large amounts directly into the growth medium. However, hyper-secretion of proteins, such as alpha-amylases, leads to induction of the secretio

  16. Adaptation of class-13 alpha-amylases to diverse living conditions.

    Science.gov (United States)

    Linden, Anni; Wilmanns, Matthias

    2004-02-06

    There are currently 35 available nonredundant molecular structures of class-13 alpha-amylases (EC 3.2.1.1), mostly from microbial organisms living under a wide range of environmental conditions. One of the most recent additions has been the first alpha-amylase structure of a hyperthermophilic archaeon [Linden et al., J. Biol. Chem. 2003, 278, 9875-9884]. The structure has been used for comparative analyses with a representative set of three alpha-amylases from thermophilic, mesophilic and psychrophilic sources to identify molecular parameters for environmental adaptation. Our analysis supports generally observed trends such as an increase in structural compactness as well as an increase in salt bridges in order to cope with high-temperature conditions. The two representative thermophilic structures used in this comparative study have independently evolved di-metal centres--not present in the mesophilic and psychrophilic structures--in the vicinity of the active site. These observations may provide impetus for the design of alpha-amylases with improved molecular properties to enhance their utility in biotechnological processes.

  17. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    Directory of Open Access Journals (Sweden)

    Gaurav Sapra

    2013-01-01

    Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations.

  18. Fucoidan - An α-amylase inhibitor from Sargassum wightii with relevance to NIDDM.

    Science.gov (United States)

    Lakshmana Senthil, S; Vinoth Kumar, T; Geetharamani, D; Suja, G; Yesudas, Rincy; Chacko, Amrutha

    2015-11-01

    The present experiment was conducted to screen the α-amylase inhibitory activity of fucoidan extracted from Sargassum wightii collected at the coastal area of Mandapam, Tamil Nadu, India. Fucoidan was extracted from the sporophyll of S. Wightii by ethanol and CaCl2 precipitation method. The average yield was 1.8±0.16% and the extracted fucoidan was found to contain 53±0.52% of fucose and 36±0.60% of sulphate. Structural elucidation (FT-IR and NMR) and in vitro α-amylase activity of purified fucoidon were performed. Fucoidan at the concentration of 62.5, 125 and 250μg exhibited 24.81, 62.50 and 99.24% inhibition against α-amylase, respectively, in a dose dependent manner. Fucoidan from S. wightii also inhibits α-glucosidase which clearly indicates dual inhibitory activity of the compound. The IC50 value against α-amylase of fucoidan is found to be 103.83μg which is more effective than that of acarbose (16mg).

  19. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.

    Science.gov (United States)

    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra

    2016-11-01

    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  20. Production of a raw starch saccharifying amylase byBacillus alvei grown on different agricultural substrates.

    Science.gov (United States)

    Achi, O K; Nijoku-Obi, A N

    1992-03-01

    Maximum activity of the amylase ofBacillus alvei was attained after growth of the organism on sorghum starch. Rice, corn, yam, cassava and potato starch gave high enzyme activities as did soluble starch. Glucose, maltose and glycerol were less effective. Optimum conditions for both growth and enzyme production were pH 6.8 at 40°C.

  1. New insight into structure/function relationships in plant alpha-amylase family GH13 members

    DEFF Research Database (Denmark)

    Seo, Eun-Seong; Andersen, Joakim Mark; Nielsen, Morten Munch;

    2010-01-01

    Two carbohydrate binding surface sites (SBSs) on barley α-amylase 1 (AMY1) of glycoside hydrolase family 13 (GH13) displayed synergy in interactions with starch granules, thus being pivotal for hydrolysis of supramolecular substrates. Mutational analysis showed that SBS1 is more critical for the ...

  2. Production of α-Amylase by Aspergillus terreus NCFT 4269.10 Using Pearl Millet and Its Structural Characterization

    Science.gov (United States)

    Sethi, Bijay K.; Jana, Arijit; Nanda, Prativa K.; DasMohapatra, Pradeep K.; Sahoo, Santi L.; Patra, Jayanta Kumar

    2016-01-01

    In this investigation, Aspergillus terreus NCFT4269.10 was employed in liquid static surface (LSSF) and solid state (SSF) fermentation to assess the optimal conditions for α-amylase biosynthesis. One-variable-at-a-time approach (quasi-optimum protocol) was primarily used to investigate the effect of each parameter on production of amylase. The maximum amylase production was achieved using pearl millet (PM) as substrate by SSF (19.19 ± 0.9 Ug−1) and also in presence of 1 mM magnesium sulfate, 0.025% (w/v) gibberellic acid, and 30 mg/100 ml (w/v) of vitamin E (~60-fold higher production of amylase) with the initial medium pH of 7.0 and incubation at 30 °C for 96 h. In addition, maltose, gelatin and isoleucine also influenced the α-amylase production. Amylase was purified to homogeneity with molecular mass around 15.3 kDa. The enzyme comprised of a typical secondary structure containing α-helix (12.2%), β-pleated sheet (23.6%), and β-turn (27.4%). Exploitation of PM for α-amylase production with better downstream makes it the unique enzyme for various biotechnological applications. PMID:27242841

  3. Production and Partial Characterization of α-Amylase Enzyme from Bacillus sp. BCC 01-50 and Potential Applications.

    Science.gov (United States)

    Simair, Altaf Ahmed; Qureshi, Abdul Sattar; Khushk, Imrana; Ali, Chaudhry Haider; Lashari, Safia; Bhutto, Muhammad Aqeel; Mangrio, Ghulam Sughra; Lu, Changrui

    2017-01-01

    Amylase is an industrially important enzyme and applied in many industrial processes such as saccharification of starchy materials, food, pharmaceutical, detergent, and textile industries. This research work deals with the optimization of fermentation conditions for α-amylase production from thermophilic bacterial strain Bacillus sp. BCC 01-50 and characterization of crude amylase. The time profile of bacterial growth and amylase production was investigated in synthetic medium and maximum enzyme titer was observed after 60 h. In addition, effects of different carbon sources were tested as a substrate for amylase production and molasses was found to be the best. Various organic and inorganic compounds, potassium nitrate, ammonium chloride, sodium nitrate, urea, yeast extract, tryptone, beef extract, and peptone, were used and beef extract was found to be the best among the nitrogen sources used. Temperature, pH, agitation speed, and size of inoculum were also optimized. Highest enzyme activity was obtained when the strain was cultured in molasses medium for 60 h in shaking incubator (150 rpm) at 50°C and pH 8. Crude amylase showed maximal activity at pH 9 and 65°C. Enzyme remained stable in alkaline pH range 9-10 and 60-70°C. Crude amylase showed great potential for its application in detergent industry and saccharification of starchy materials.

  4. Gellan gum microspheres containing a novel α-amylase from marine Nocardiopsis sp. strain B2 for immobilization.

    Science.gov (United States)

    Chakraborty, Samrat; Jana, Sougata; Gandhi, Arijit; Sen, Kalyan Kumar; Zhiang, Wang; Kokare, Chandrakant

    2014-09-01

    A Nocardiopsis sp. stain B2 with an ability to produce stable α-amylase was isolated from marine sediments. The characterization of microorganism was done by biochemical tests and 16S rDNA sequencing. The α-amylase was purified by gel filtration chromatography by using sephadex G-75. The molecular mass of the amylase was found to be 45 kDa by SDS-PAGE and gel filtration chromatography. The isolated α-amylase was immobilized by ionotropic gelation technique using gellan gum (GG). These microspheres were spherical with average particle size of 375.62±21.76 to 492.54±32.18 μm. The entrapment efficiency of these α-amylase loaded GG microspheres was found 74.76±1.32 to 87.64±1.52%. Characterization of α-amylase-gellan gum microspheres was confirmed using FTIR and SEM analysis. The in vitro amylase release kinetic have been studied by various mathematical models that follow the Korsmeyer-Peppas model (R2=0.9804-0.9831) with anomalous (non-Fickian) diffusion release mechanism.

  5. High-throughput hydrolysis of starch during permeation across α-amylase-immobilized porous hollow-fiber membranes

    Science.gov (United States)

    Miura, Suguru; Kubota, Noboru; Kawakita, Hidetaka; Saito, Kyoichi; Sugita, Kazuyuki; Watanabe, Kohei; Sugo, Takanobu

    2002-02-01

    Two kinds of supporting porous membranes, ethanolamine (EA) and phenol (Ph) fibers, for immobilization of α-amylase were prepared by radiation-induced graft polymerization of an epoxy-group-containing monomer, glycidyl methacrylate, onto a porous hollow-fiber membrane, and subsequent ring-opening with EA and Ph, respectively. An α-amylase solution was forced to permeate radially outward through the pores of the EA and Ph fibers. α-Amylase was captured at a density of 0.15 and 6.6 g/L of the membrane by the graft chain containing 2-hydroxyethylamino and phenyl groups, respectively. A permeation pressure of 0.10 MPa provided a space velocity of 780 and 1500 h -1 for the α-amylase-immobilized EA and Ph fibers, respectively. Quantitative hydrolysis of starch during permeation of a 20 g/L starch solution in the buffer across the α-amylase-immobilized Ph fiber was attained up to a space velocity of about 2000 h -1; this was achieved because of negligible diffusional mass-transfer resistance of the starch to the α-amylase due to convective flow, whereas an enzyme reaction-controlled system was observed for the α-amylase-immobilized EA fiber.

  6. Purification, sequencing, and biochemical characterization of a novel calcium-independent α-amylase AmyTVE from Thermoactinomyces vulgaris.

    Science.gov (United States)

    El-Sayed, Ahmed K A; Abou Dobara, Mohamed I; El-Fallal, Amira A; Omar, Noha F

    2013-06-01

    α-Amylase from Thermoactinomyces vulgaris was highly purified 48.9-fold by ammonium sulfate precipitation, gel filtration on Sephadex G-50 column, and ion exchange chromatography column of DEAE-cellulose. The molecular weight of the enzyme was estimated to be 135 and 145 kDa by SDS-PAGE. Its high molecular weight is due to high glycosylation. The purified amylase exhibited maximal activity at pH 6.0 to 7.0 and was stable in the range of pH 4.0 to 9.0. The optimum temperature for its activity was 50 °C. The enzyme half-life time was 120 min at 50 °C, suggesting intermediate temperature stable α-amylase. The enzyme was sensitive to different metal ions, including NaCl, CoCl(2), and CaCl(2), and to different concentrations of EDTA. The enzyme activity was inhibited in the presence of 1 mM CaCl(2), suggesting that it is a calcium-independent α-amylase. The TLC showed that the amylase hydrolyzed starch to produce large maltooligosaccharides as the main products. A 1.1-kb DNA fragment of the putative α-amylase gene (amy TVE) from T. vulgaris was amplified by using two specific newly designed primers. Sequencing analysis showed 56.2 % similarity to other Thermoactinomyces α-amylases with two conserved active sites confirming its function.

  7. In Vivo Synthesis and Turnover of α-Amylase in Attached and Detached Cotyledons of Vigna mungo Seeds 1

    Science.gov (United States)

    Koshiba, Tomokazu; Minamikawa, Takao

    1983-01-01

    α-Amylase activity increased in attached cotyledons of germinated Vigna mungo seeds until the 5th day after imbibition and decreased thereafter, whereas in detached and incubated cotyledons the activity continuously increased and, at the 6th day, reached the value more than three times that of the maximum activity of attached cotyledons. Zymograms of the activities and Ouchterlony double immunodiffusion test on the activities of attached and detached cotyledons showed that the increase of activity in detached cotyledons was due to the identical enzyme as in attached tissues. α-Amylase contents, determined by single radial immunodiffusion method, changed in parallel with enzyme activity in both attached and detached cotyledons, which also suggested the de novo synthesis of α-amylase in V. mungo cotyledons. The rate of incorporation of the label from [3H]leucine into α-amylase and the ratios of dpm in α-amylase/dpm in trichloroacetic acid-insoluble fraction did not show significant difference between attached and detached cotyledons. The results indicated that in attached cotyledons fluctuation of α-amylase activity was regulated by both synthesis and degradation of the enzyme, whereas in detached cotyledons α-amylase was synthesized and accumulated, because of low degrading activity during incubation. Images Fig. 1 Fig. 2 Fig. 4 PMID:16662780

  8. In Vivo Synthesis and Turnover of alpha-Amylase in Attached and Detached Cotyledons of Vigna mungo Seeds.

    Science.gov (United States)

    Koshiba, T; Minamikawa, T

    1983-01-01

    alpha-Amylase activity increased in attached cotyledons of germinated Vigna mungo seeds until the 5th day after imbibition and decreased thereafter, whereas in detached and incubated cotyledons the activity continuously increased and, at the 6th day, reached the value more than three times that of the maximum activity of attached cotyledons. Zymograms of the activities and Ouchterlony double immunodiffusion test on the activities of attached and detached cotyledons showed that the increase of activity in detached cotyledons was due to the identical enzyme as in attached tissues. alpha-Amylase contents, determined by single radial immunodiffusion method, changed in parallel with enzyme activity in both attached and detached cotyledons, which also suggested the de novo synthesis of alpha-amylase in V. mungo cotyledons.The rate of incorporation of the label from [(3)H]leucine into alpha-amylase and the ratios of dpm in alpha-amylase/dpm in trichloroacetic acid-insoluble fraction did not show significant difference between attached and detached cotyledons. The results indicated that in attached cotyledons fluctuation of alpha-amylase activity was regulated by both synthesis and degradation of the enzyme, whereas in detached cotyledons alpha-amylase was synthesized and accumulated, because of low degrading activity during incubation.

  9. Polyaniline-graphene based α-amylase biosensor with a linear dynamic range in excess of 6 orders of magnitude.

    Science.gov (United States)

    Teixeira, Sofia Rodrigues; Lloyd, Catherine; Yao, Seydou; Andrea Salvatore Gazze; Whitaker, Iain S; Francis, Lewis; Conlan, R Steven; Azzopardi, Ernest

    2016-11-15

    α-amylase is an established marker for diagnosis of pancreatic and salivary disease, and recent research has seen a substantial expansion of its use in therapeutic and diagnostic applications for infection, cancer and wound healing. The lack of bedside monitoring devices for α-amylase detection has hitherto restricted the clinical progress of such applications. We have developed a highly sensitive α-amylase immunosensor platform, produced via in situ electropolymerization of aniline onto a screen-printed graphene support (SPE). Covalently binding an α-amylase specific antibody to a polyaniline (PANI) layer and controlling device assembly using electrochemical impedance spectroscopy (EIS), we have achieved a highly linear response against α-amylase concentration. Each stage of the assembly was characterized using a suite of high-resolution topographical, chemical and mechanical techniques. Quantitative, highly sensitive detection was demonstrated using an artificially spiked human blood plasma samples. The device has a remarkably wide limit of quantification (0.025-1000IU/L) compared to α-amylase assays in current clinical use. With potential for simple scale up to volume manufacturing though standard semiconductor production techniques and subsequently clinical application, this biosensor will enable clinical benefit through early disease detection, and better informed administration of correct therapeutic dose of drugs used to treat α-amylase related diseases.

  10. Production and Partial Characterization of α-Amylase Enzyme from Bacillus sp. BCC 01-50 and Potential Applications

    Directory of Open Access Journals (Sweden)

    Altaf Ahmed Simair

    2017-01-01

    Full Text Available Amylase is an industrially important enzyme and applied in many industrial processes such as saccharification of starchy materials, food, pharmaceutical, detergent, and textile industries. This research work deals with the optimization of fermentation conditions for α-amylase production from thermophilic bacterial strain Bacillus sp. BCC 01-50 and characterization of crude amylase. The time profile of bacterial growth and amylase production was investigated in synthetic medium and maximum enzyme titer was observed after 60 h. In addition, effects of different carbon sources were tested as a substrate for amylase production and molasses was found to be the best. Various organic and inorganic compounds, potassium nitrate, ammonium chloride, sodium nitrate, urea, yeast extract, tryptone, beef extract, and peptone, were used and beef extract was found to be the best among the nitrogen sources used. Temperature, pH, agitation speed, and size of inoculum were also optimized. Highest enzyme activity was obtained when the strain was cultured in molasses medium for 60 h in shaking incubator (150 rpm at 50°C and pH 8. Crude amylase showed maximal activity at pH 9 and 65°C. Enzyme remained stable in alkaline pH range 9-10 and 60–70°C. Crude amylase showed great potential for its application in detergent industry and saccharification of starchy materials.

  11. Amylase activity is associated with AMY2B copy numbers in dog: implications for dog domestication, diet and diabetes.

    Science.gov (United States)

    Arendt, Maja; Fall, Tove; Lindblad-Toh, Kerstin; Axelsson, Erik

    2014-10-01

    High amylase activity in dogs is associated with a drastic increase in copy numbers of the gene coding for pancreatic amylase, AMY2B, that likely allowed dogs to thrive on a relatively starch-rich diet during early dog domestication. Although most dogs thus probably digest starch more efficiently than do wolves, AMY2B copy numbers vary widely within the dog population, and it is not clear how this variation affects the individual ability to handle starch nor how it affects dog health. In humans, copy numbers of the gene coding for salivary amylase, AMY1, correlate with both salivary amylase levels and enzyme activity, and high amylase activity is related to improved glycemic homeostasis and lower frequencies of metabolic syndrome. Here, we investigate the relationship between AMY2B copy numbers and serum amylase activity in dogs and show that amylase activity correlates with AMY2B copy numbers. We then describe how AMY2B copy numbers vary in individuals from 20 dog breeds and find strong breed-dependent patterns, indicating that the ability to digest starch varies both at the breed and individual level. Finally, to test whether AMY2B copy number is strongly associated with the risk of developing diabetes mellitus, we compare copy numbers in cases and controls as well as in breeds with varying diabetes susceptibility. Although we see no such association here, future studies using larger cohorts are needed before excluding a possible link between AMY2B and diabetes mellitus.

  12. Concurrent attenuated reactivity of alpha-amylase and cortisol is related to disruptive behavior in male adolescents.

    Science.gov (United States)

    de Vries-Bouw, Marjan; Jansen, Lucres; Vermeiren, Robert; Doreleijers, Theo; van de Ven, Peter; Popma, Arne

    2012-06-01

    Attenuated reactivity of salivary alpha-amylase has been proposed as a specific sympathetic marker of disruptive behavior in juveniles and may have additional value to studying other autonomic parameters and hypothalamic-pituitary-adrenal axis activity. Investigating the interrelationships between neurobiological parameters in relation to juvenile disruptive behavior may enhance insight into the complex mechanisms at play. We investigated salivary alpha-amylase, cortisol, heart rate (HR), and heart rate variability (HRV) in response to a standardized public speaking task, and examined interactions between these parameters in relation to disruptive behavior. Participants were 48 delinquent male adolescents (mean age 18.4 years, SD 0.9), with and without a disruptive behavior disorder (resp. DP+, DP-) and 16 matched normal controls (NC). A structured psychiatric interview as well as the Youth Self Report and Child Behavior Checklist were administered to assess disruptive behavior. Alpha-amylase and cortisol reactivity, but not HR or HRV, showed significant inverse associations with dimensional measures of disruptive behavior. Moreover, both cortisol and alpha-amylase reactivity were significantly lower in the DP+ group as compared to the NC group. The mentioned relationships remained present when nicotine use was entered as a covariate. Combining alpha-amylase and cortisol in one model explained a larger part of the variance of disruptive behavior than either single parameter. There were no interactions between alpha-amylase and cortisol or HRV in relation to disruptive behavior. Attenuated alpha-amylase responsivity to stress is a correlate of disruptive behavior in late-adolescent males. Although nicotine use explains a considerable part of the variance of disruptive behavior, both alpha-amylase and cortisol are related to disruptive behavior, over and above the effect of nicotine use. Combining alpha-amylase and cortisol improved insight into neurobiological

  13. A simple one pot purification of bacterial amylase from fermented broth based on affinity toward starch-functionalized magnetic nanoparticle.

    Science.gov (United States)

    Paul, Tanima; Chatterjee, Saptarshi; Bandyopadhyay, Arghya; Chattopadhyay, Dwiptirtha; Basu, Semanti; Sarkar, Keka

    2015-08-18

    Surface-functionalized adsorbant particles in combination with magnetic separation techniques have received considerable attention in recent years. Selective manipulation on such magnetic nanoparticles permits separation with high affinity in the presence of other suspended solids. Amylase is used extensively in food and allied industries. Purification of amylase from bacterial sources is a matter of concern because most of the industrial need for amylase is met by microbial sources. Here we report a simple, cost-effective, one-pot purification technique for bacterial amylase directly from fermented broth of Bacillus megaterium utilizing starch-coated superparamagnetic iron oxide nanoparticles (SPION). SPION was prepared by co-precipitation method and then functionalized by starch coating. The synthesized nanoparticles were characterized by transmission electron microscopy (TEM), a superconducting quantum interference device (SQUID, zeta potential, and ultraviolet-visible (UV-vis) and Fourier-transform infrared (FTIR) spectroscopy. The starch-coated nanoparticles efficiently purified amylase from bacterial fermented broth with 93.22% recovery and 12.57-fold purification. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) revealed that the molecular mass of the purified amylase was 67 kD, and native gel showed the retention of amylase activity even after purification. Optimum pH and temperature of the purified amylase were 7 and 50°C, respectively, and it was stable over a range of 20°C to 50°C. Hence, an improved one-pot bacterial amylase purification method was developed using starch-coated SPION.

  14. β-amylase 1 (BAM1) degrades transitory starch to sustain proline biosynthesis during drought stress.

    Science.gov (United States)

    Zanella, Martina; Borghi, Gian Luca; Pirone, Claudia; Thalmann, Matthias; Pazmino, Diana; Costa, Alex; Santelia, Diana; Trost, Paolo; Sparla, Francesca

    2016-03-01

    During photosynthesis of higher plants, absorbed light energy is converted into chemical energy that, in part, is accumulated in the form of transitory starch within chloroplasts. In the following night, transitory starch is mobilized to sustain the heterotrophic metabolism of the plant. β-amylases are glucan hydrolases that cleave α-1,4-glycosidic bonds of starch and release maltose units from the non-reducing end of the polysaccharide chain. In Arabidopsis, nocturnal degradation of transitory starch involves mainly β-amylase-3 (BAM3). A second β-amylase isoform, β-amylase-1 (BAM1), is involved in diurnal starch degradation in guard cells, a process that sustains stomata opening. However, BAM1 also contributes to diurnal starch turnover in mesophyll cells under osmotic stress. With the aim of dissecting the role of β-amylases in osmotic stress responses in Arabidopsis, mutant plants lacking either BAM1 or BAM3 were subject to a mild (150mM mannitol) and prolonged (up to one week) osmotic stress. We show here that leaves of osmotically-stressed bam1 plants accumulated more starch and fewer soluble sugars than both wild-type and bam3 plants during the day. Moreover, bam1 mutants were impaired in proline accumulation and suffered from stronger lipid peroxidation, compared with both wild-type and bam3 plants. Taken together, these data strongly suggest that carbon skeletons deriving from BAM1 diurnal degradation of transitory starch support the biosynthesis of proline required to face the osmotic stress. We propose the transitory-starch/proline interplay as an interesting trait to be tackled by breeding technologies aimingto improve drought tolerance in relevant crops.

  15. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    Science.gov (United States)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  16. The predominantly nonhydrolytic action of alpha amylases on alpha-maltosyl fluoride.

    Science.gov (United States)

    Okada, G; Genghof, D S; Hehre, E J

    1979-06-01

    Crystalline alpha amylases from a number of sources utilized alpha-maltosyl fluoride as a glycosyl donor and acceptor at high rates (approximately 10 to approximately 1550 mumol/min/mg of protein, for 30 mM substrate). All enzymes catalyzed conversion of this compound into maltooligosaccharides in preference to causing its hydrolysis. Maltotetraosyl flouride and maltooligosaccharides of d.p. 3 to 6+ accounted for 75--93% (by weight) of early reaction-products. At a late stage, the yield of maltooligosaccharides was 2--5 times that of maltose, with chains as long as 12 D-glucosyl residues formed by one amylase (from Asp. oryzae), which utilized alpha-maltosyl fluoride as a donor and as an acceptor at extremely high rates. These results indicate that alpha amylases have a substantial capacity for binding two molecules of this small substrate in a distinctive way, with the C--F glycosylic bond of one and the free C-4 hydroxyl group of the other located in the region of the enzyme's catalytic groups, therby favoring glycosylation of the suitably positioned acceptor over solvent water. Hydrolysis is assumed to prevail when only a single substrate molecule or segment binds to alpha amylase with a (1 linked to 4)-alpha-D-glucosidic linkage of glycosylic C--F bond positioned at the catalytic center. The present demonstration that glycosyl-transfer reactions can be dominantly expressed by alpha amylases, given an appropriate substrate, illustrates the inadequacy of the usual characterization of these enzymes as hydrolases that produce overwhelming hydrolysis of all substrates.

  17. Remarkable evolutionary relatedness among the enzymes and proteins from the α-amylase family.

    Science.gov (United States)

    Janeček, Štefan; Gabriško, Marek

    2016-07-01

    The α-amylase is a ubiquitous starch hydrolase catalyzing the cleavage of the α-1,4-glucosidic bonds in an endo-fashion. Various α-amylases originating from different taxonomic sources may differ from each other significantly in their exact substrate preference and product profile. Moreover, it also seems to be clear that at least two different amino acid sequences utilizing two different catalytic machineries have evolved to execute the same α-amylolytic specificity. The two have been classified in the Cabohydrate-Active enZyme database, the CAZy, in the glycoside hydrolase (GH) families GH13 and GH57. While the former and the larger α-amylase family GH13 evidently forms the clan GH-H with the families GH70 and GH77, the latter and the smaller α-amylase family GH57 has only been predicted to maybe define a future clan with the family GH119. Sequences and several tens of enzyme specificities found throughout all three kingdoms in many taxa provide an interesting material for evolutionarily oriented studies that have demonstrated remarkable observations. This review emphasizes just the three of them: (1) a close relatedness between the plant and archaeal α-amylases from the family GH13; (2) a common ancestry in the family GH13 of animal heavy chains of heteromeric amino acid transporter rBAT and 4F2 with the microbial α-glucosidases; and (3) the unique sequence features in the primary structures of amylomaltases from the genus Borrelia from the family GH77. Although the three examples cannot represent an exhaustive list of exceptional topics worth to be interested in, they may demonstrate the importance these enzymes possess in the overall scientific context.

  18. Kinetic model for the co-action of beta-amylase and debranching enzymes in the production of maltose.

    Science.gov (United States)

    Jiahua, Z

    1999-03-05

    The kinetics of the hydrolysis of starch with beta-amylase and debranching enzymes was studied. The hydrolysis of the alpha-1, 6-glycoside bonds of the substrate by debranching enzymes does not create any new nonreducing ends, so debranching enzyme promotes the action of beta-amylase not by increasing the concentration of the substrate of beta-amylase but by increasing the linear linkage portion of the substrate. The introduction of an effective chain length function was used to formulate a kinetic model.

  19. Molecular cloning and expression of two alpha-amylase genes from Streptococcus bovis 148 in Escherichia coli.

    OpenAIRE

    Satoh, E; Niimura, Y; UCHIMURA, T; Kozaki, M; Komagata, K

    1993-01-01

    The alpha-amylase genes of Streptococcus bovis 148 were cloned in Escherichia coli MC1061, using pBR322. The recombinant plasmids were classified into two groups on the basis of their restriction maps. Southern blot analysis did not show homology between the two types of alpha-amylase genes, and the two alpha-amylase genes existed on the chromosomal DNA of S. bovis 148. The enzymatic properties and N-terminal amino acid sequences of the two purified enzymes produced by the cloned E. coli stra...

  20. Enhanced Production and Characterization of a Solvent Stable Amylase from Solvent Tolerant Bacillus tequilensis RG-01: Thermostable and Surfactant Resistant

    OpenAIRE

    Soni Tiwari; Neha Shukla; Pooja Mishra; Rajeeva Gaur

    2014-01-01

    Ten bacterial strains isolated from the soil samples in the presence of cyclohexane were screened for amylase production. Among them, culture RG-01 was adjudged as the best amylase producer and was identified as Bacillus tequilensis from MTCC, Chandigarh. The isolate showed maximum amylase production (8100 U/mL) in the presence of starch, peptone, and Ca2+ ions at 55°C pH 7.0 within 24 h of incubation. The enzyme was stable in the presence of n-dodecane, isooctane, n-decane, xylene, toluene, ...

  1. [The amylase-creatinine clearance ratio in the differential diagnosis of pancreatitis and gastroduodenal ulcer with hyperamylasemia].

    Science.gov (United States)

    Pezzangora, V; Della Dora, R; Pagliarini, A; Dell'Olivo, I

    1978-04-01

    The Authors followed 29 patients, hospitaled with a diagnosis of pancreatitis. They all presented the same sympotomatology and a considerable increase of the serum amylase ad urinary amylase. The examination of the ratio between the clearance of amylasis and creatinine permitted to make a differential diagnosis for 8 cases (4rd group) that were nothing but peptic ulcera. Such a diagnosis was confirmed by the radiological contrastographic examination or by the intraoperative report. So if the ratio between the clearance of amylase and creatinine is normal we must think about a pathological situation were the iperamylasemia has a pathogenetic cause different from pancreatitis.

  2. Downregulation of chloroplast-targeted beta-amylase leads to a starch-excess phenotype in leaves

    DEFF Research Database (Denmark)

    Scheidig, A.; Fröhlich, A.; Schulze, S.;

    2002-01-01

    A functional screen in Escherichia coli was established to identify potato genes coding for proteins involved in transitory starch degradation. One clone isolated had a sequence very similar to a recently described chloroplast-targeted 5-amylase of Arabidopsis. Expression of the gene in E. coli...... showed that the protein product was a functional beta-amylase that could degrade both starch granules and solubilized amylopectin, while import experiments demonstrated that the beta-amylase was imported and processed into pea chloroplasts. To study the function of the protein in transitory starch...

  3. Mixed-mode resins: taking shortcut in downstream processing of raw-starch digesting α-amylases.

    Science.gov (United States)

    Lončar, Nikola; Šokarda Slavić, Marinela; Vujčić, Zoran; Božić, Nataša

    2015-10-23

    Bacillus licheniformis 9945a α-amylase is known as a potent enzyme for raw starch hydrolysis. In this paper, a mixed mode Nuvia cPrime™ resin is examined with the aim to improve the downstream processing of raw starch digesting amylases and exploit the hydrophobic patches on their surface. This resin combines hydrophobic interactions with cation exchange groups and as such the presence of salt facilitates hydrophobic interactions while the ion-exchange groups enable proper selectivity. α-Amylase was produced using an optimized fed-batch approach in a defined media and significant overexpression of 1.2 g L(-1) was achieved. This single step procedure enables simultaneous concentration, pigment removal as well as purification of amylase with yields of 96% directly from the fermentation broth.

  4. Physiological characterisation of recombinant Aspergillus nidulans strains with different creA genotypes expressing A-oryzae alpha-amylase

    DEFF Research Database (Denmark)

    Agger, Teit; Petersen, J.B.; O'Connor, S.M.;

    2002-01-01

    sources on the alpha-amylase production in the creA deletion strain was investigated and it was found that starch was the best inducer. The degree of induction by starch increased almost linearly with the concentration of starch in starch/glucose mixtures. High-density batch cultivation was performed......The physiology of three strains of Aspergillus nidulans was examined-a creA deletion strain, a wild type creA genotype and a strain containing extra copies of the creA gene, all producing Aspergillus oryzae alpha-amylase. The strains were cultured in batch and continuous cultivations...... and the biomass formation and alpha-amylase production was characterised. Overexpression of the creA gene resulted in a lower maximum specific growth rate and a slightly higher repression of the alpha-amylase production during conditions with high glucose concentration. No expression of creA also resulted...

  5. Evolutionary conservation of the chromosomal configuration and regulation of amylase genes among eight species of the Drosophila melanogaster species subgroup.

    Science.gov (United States)

    Payant, V; Abukashawa, S; Sasseville, M; Benkel, B F; Hickey, D A; David, J

    1988-09-01

    Nuclear DNA was extracted from each of the eight species comprising the Drosophila melanogaster species subgroup. Southern hybridization of this DNA by using a molecular probe specific for the alpha-amylase coding region showed that the duplicated structure of the amylase locus, first found in D. melanogaster, is conserved among all species of the melanogaster subgroup. Evidence is also presented for the concerted evolution of the duplicated genes within each species. In addition, it is shown that the glucose repression of amylase gene expression, which has been extensively studied in D. melanogaster, is not confined to this species but occurs in all eight members of the species subgroup. Thus, both the duplicated gene structure and the glucose repression of Drosophila amylase gene activity are stable over extended periods of evolutionary time.

  6. Pancreatic amylase is an environmental signal for regulation of biofilm formation and host interaction in Campylobacter jejuni.

    Science.gov (United States)

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A; Nair, Sean P; Sadiq, Sohaib; Williams, Lisa K; Trantham, Emma K; Stephenson, Holly; Wren, Brendan W; Bajaj-Elliott, Mona; Cogan, Tristan A; Laws, Andrew P; Wade, Jim; Dorrell, Nick; Allan, Elaine

    2015-12-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism.

  7. [Effect of triterpenoid glycosides on alpha- and beta-amylase activity and total protein content in wheat seedlings].

    Science.gov (United States)

    Davidiants, E S

    2011-01-01

    Influence of the aleanolic acid glycosides from Silphium perfoliatum L. (silphioside B, C, E and G) and their progenins on the amylase activity and total protein content in wheat seedlings was studied. Treatment of the Triticum aestivum L. seeds with 1-10 microM water solutions of mono- and diglycosides (mono- and bisdesmosines) elevated the alpha-amylase and total amylase activities in seedlings. Silphioside E containing three glucose moieties in its molecule did not change alpha-amylase activity, but it did if bis-triglycoside acetylated carbohydrate (as in silphioside C). Effects of 5-10 microM solutions of the active glycosides was comparable with that of exogenous gibberellin A3 and 6-benzylaminopurine.

  8. Fermentation Kinetics of Media Optimization for the Production of Alpha Amylase by a New Isolate of Aspergillus Oryzae

    Institute of Scientific and Technical Information of China (English)

    Ikram-ul-Haq; Roheena Abdullah; Hamid Mukhtar; Muhammad Nauman Aftab

    2007-01-01

    The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested,Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35. Kinetic analysis revealed that the values of product yield coefficient (Yp/x) and specific product yield coefficient( qp ) were found highly significant (p ≤ 0.05 ) when medium M1 was used for the enzyme production.

  9. Improving Bread Quality with the Application of a Newly Purified Thermostable α-Amylase from Rhizopus oryzae FSIS4

    Science.gov (United States)

    Ait Kaki El-Hadef El-Okki, Amel; Gagaoua, Mohammed; Bourekoua, Hayat; Hafid, Kahina; Bennamoun, Leila; Djekrif-Dakhmouche, Shahrazed; El-Hadef El-Okki, Mohamed; Meraihi, Zahia

    2017-01-01

    A new thermostable α-amylase from Rhizopus oryzae FSIS4 was purified for first time and recovered in a single step using a three-phase partitioning (TPP) system. The fungal α-amylase, at a concentration of 1.936 U per kg of flour, was used in bread-making and compared to the commercial enzyme. The results showed a significant effect of the recovered α-amylase in the prepared bread and allowed us to improve the quality of the bread. The study indicated clearly that the recovered α-amylase is a potential candidate for future applications in the bread-making industry and in other food biotechnology applications. PMID:28231081

  10. 大豆β-淀粉酶和大麦β-淀粉酶糖化特性的比较%Comparison of Enzymatic Properties of the Soybean β-amylase and Barley β-amylase

    Institute of Scientific and Technical Information of China (English)

    周春海

    2011-01-01

    In this paper, the activity of the soybean β-amylase and barley β-amylase were compared under the conditions of the existing saccharification for producing maltose. The impact of low pH and high temperature on the activity of the two enzymes were studied The results showed that 1.2 dosage of soybeanβ-amylase and 1 dosage of the barley β-amylase has the same maltose throughput, and the soybean β-amylase is more suitable for low pH and high temperature condition compared to soybean β-amylase.%本实验参照淀粉糖车间现有糖化工艺条件,对大豆β-淀粉酶和正在使用的大麦β-淀粉酶糖化能力及两种酶的低pH和高温的耐受性进行了对比研究.结果显示大豆β-淀粉酶添加量为大麦淀粉酶的1.2倍时与其有等效的麦芽糖生产能力,且大豆β-淀粉酶比大麦β-淀粉酶对低pH和高温有更好的耐受性.

  11. Phospholipase A2 as a point of care alternative to serum amylase and pancreatic lipase

    Science.gov (United States)

    Liu, Nathan J.; Chapman, Robert; Lin, Yiyang; Bentham, Andrew; Tyreman, Matthew; Philips, Natalie; Khan, Shahid A.; Stevens, Molly M.

    2016-06-01

    Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to serve as high lipase (n = 20), CA19-9 positive (n = 15), and healthy (n = 20) controls. sPLA2-IB concentration correlated well with the serum activity of both amylase and lipase, and performed at least as well as either markers in the differentiation of pancreatitis from controls.Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to

  12. Isolation, purification and characterization of β-amylase from Dioscorea hispida Dennst

    Science.gov (United States)

    Oktiarni, Dwita; Lusiana, Simamora, Febri Yanti; Gaol, Jusni M. Lumban

    2015-09-01

    β-amylase (E.C 3.2.1.2) is an enzyme commonly found in plants and bacteria. The enzyme is an exo-acting carbohydrolase which hydrolyzes α-1.4-glucosidic linkages of starch, removing maltose units from the non-reducing end of the polysaccharide chain, producing β-maltose and β-limit dextrin as the final product. β-amylase is widely distributed in the higher plants such as sweet potato. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-stalling agents in baking. This enzyme was extracted from Dioscorea hispida Dennst in 0.05 M acetate buffer pH 4.8 and followed by ammonium sulfate fractionation at cold temperature (10°C). Ammonium sulfate fractionation was shared into fraction of 0-60%, 60-70%, 70-80% and 80-100%. The fraction containing high of specific activity (determined by Somogyi-Nelson and Lowry methods) was futher purified by dialysis. Fraction with high enzyme activity of β-amylase were fraction 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst were 1.32 and 1.55 mg sugar.mg protein-1.minute-1, whereas specific activity of crude extract enzyme was 0.21 mg sugar.mg protein-1.minute-1. After purified with dialysis, fraction with high enzyme activity of β-amylase were fraction of 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst was 2.72 and 4.24 mg sugar.mg protein-1.minute-1. The purified Dioscorea hispida Dennst β-amylase from dialysis showed increasing in spesific activity the crude enzyme as much as 24 folds. The characterization of enzyme showed that Dioscorea hispida Dennst derived enzyme had optimum pH of 5.5 and temperature of 70°C. The kinetic parameters of purified Dioscorea hispida Dennst β-amylase showed that the KMapp, Vmaxapp value and Hill constant were 0.0211 mg/ml, 9.63 mg sugar.minute-1 and 1.34, respectively.

  13. α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest

    Directory of Open Access Journals (Sweden)

    Oliveira-Neto Osmundo B

    2010-06-01

    Full Text Available Abstract Background Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei, is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an α-amylase inhibitor gene (α-AI1, which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. Results We transformed C. arabica with the α-amylase inhibitor-1 gene (α-AI1 from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L. The presence of the α-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against α-AI1 inhibitor showed a maximum α-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the α-AI1 protein against H. hampei α-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. Conclusions This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee.

  14. Optimization of physico-chemical condition for improved production of hyperthermostable β amylase from Bacillus subtilis DJ5

    OpenAIRE

    Abhijit Poddar; Ratan Gachhui; Subhas Chandra Jana

    2012-01-01

    Bacillus subtilis DJ5 was found to produce hyperthermostable beta amylase in a complex medium during submerged fermentation. The media was optimized for improved production of hyperthermostable β amylase following one variable at a time (OVAT) method. Initial medium pH of 7 and cultivation temperature of 37 °C were optimal for enzyme production. Among different nitrogen and carbon sources tested, 0.05% tryptone and 5% starch were most effective for enzyme yield. Little supplementatio...

  15. The Construction of the Probe for Amylase Ⅱ Gene Cloning from Bacillus halodurans Strain 38C1-1

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Thermus sp. IM6501, B. stearothermophilus ET-1, and B. acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.

  16. Effects of alpha-amylase and its inhibitors on acid production from cooked starch by oral streptococci.

    Science.gov (United States)

    Aizawa, S; Miyasawa-Hori, H; Nakajo, K; Washio, J; Mayanagi, H; Fukumoto, S; Takahashi, N

    2009-01-01

    This study evaluated acid production from cooked starch by Streptococcus mutans, Streptococcus sobrinus, Streptococcus sanguinis and Streptococcus mitis, and the effects of alpha-amylase inhibitors (maltotriitol and acarbose) and xylitol on acid production. Streptococcal cell suspensions were anaerobically incubated with various carbohydrates that included cooked potato starch in the presence or absence of alpha-amylase. Subsequently, the fall in pH and the acid production rate at pH 7.0 were measured. In addition, the effects of adding alpha-amylase inhibitors and xylitol to the reaction mixture were evaluated. In the absence of alpha-amylase, both the fall in pH and the acid production rate from cooked starch were small. On the other hand, in the presence of alpha-amylase, the pH fell to 3.9-4.4 and the acid production rate was 0.61-0.92 micromol per optical density unit per min. These values were comparable to those for maltose. When using cooked starch, the fall in pH by S. sanguinis and S. mitis was similar to that by S. mutans and S. sobrinus. For all streptococci, alpha-amylase inhibitors caused a decrease in acid production from cooked starch, although xylitol only decreased acid production by S. mutans and S. sobrinus. These results suggest that cooked starch is potentially acidogenic in the presence of alpha-amylase, which occurs in the oral cavity. In terms of the acidogenic potential of cooked starch, S. sanguinis and S. mitis were comparable to S. mutans and S. sobrinus. Alpha-amylase inhibitors and xylitol might moderate this activity.

  17. Dopamine-induced amylase secretion from rat parotid salivary gland in vitro: an effect mediated via noradrenergic and cholinergic nerves.

    OpenAIRE

    Hata, F.; Ishida, H.; Kondo, E

    1986-01-01

    The effect of dopamine on amylase secretion by rat parotid tissue was examined in vitro. Dopamine induced marked amylase secretion from the tissue in a dose-dependent manner. Its EC50 value was about 4 microM and the maximal response was obtained at a concentration of 100 microM. The dopamine-induced secretion was inhibited by the dopamine-antagonists haloperidol, (+)-butaclamol and spiroperidol. Atropine reduced the dopamine-induced secretion significantly, and physostigmine enhanced the sec...

  18. Development and validation of a monoclonal based immunoassay for the measurement of fungal alpha-amylase: focus on peak exposures.

    Science.gov (United States)

    Elms, J; Denniss, S; Smith, M; Evans, P G; Wiley, K; Griffin, P; Curran, A D

    2001-03-01

    The inhalation of flour dust has been implicated in the induction of sensitisation and elicitation of respiratory symptoms, such as asthma in bakers. In addition to the cereal allergens present in wheat flour, enzymes in flour improvers, in particular fungal alpha-amylase, are now known to be a significant cause of respiratory allergy in the baking industry.A monoclonal antibody based enzyme-linked immunoassay (ELISA) was developed using two monoclonal antibodies that recognised two distinct epitopes of the fungal alpha-amylase enzyme. The ELISA had an inter-assay variation of 12.0% at 1360 pg/ml and 12.8% at 564 pg/ml and intra-assay variation of 4.9% at 1340 pg/ml and 6.1% at 504 pg/ml. The assay had a sensitivity of 200 pg/ml. Competitive inhibition assays confirmed that the monoclonal antibodies had no cross reactivity with other enzymes used in the baking industry and could distinguish added fungal alpha-amylase from cereal amylase. We assessed the levels of exposure to dust, total protein and fungal alpha-amylase in four UK bakeries ranging in size and technical capabilities. Within the bakeries we surveyed, workers were exposed to variable levels of inhalable dust (0.8-39.8 mg/m3), total protein (0-5.7 mg/m3) and fungal alpha-amylase (0-29.8 ng/m3). Consecutive 15 min personal samples taken over a 1 h period demonstrated that the ELISA could measure fungal alpha-amylase exposure in such a 15 min period. Short term peak exposures to fungal alpha-amylase could be identified which may contribute to the sensitisation in individuals who appear to have low exposure levels if measured over a full shift period.

  19. Natural plant enzyme inhibitors. Characterization of an unusual alpha-amylase/trypsin inhibitor from ragi (Eleusine coracana Geartn.).

    Science.gov (United States)

    Shivaraj, B; Pattabiraman, T N

    1981-01-01

    An inhibitor I-1, capable of acting on both alpha-amylase and trypsin, was purified to homogeneity from ragi (finger-millet) grains. The factor was found to be stable to heat treatment at 100 degrees C for 1 h in the presence of NaCl and also was stable over the wide pH range 1-10. Pepsin and Pronase treatment of inhibitor I-1 resulted in gradual loss of both the inhibitory activities. Formation of trypsin-inhibitor I-1 complex, amylase-inhibitor I-1 complex and trypsin-inhibitor I-1-amylase trimer complex was demonstrated by chromatography on a Bio-Gel P-200 column. This indicated that the inhibitor is 'double-headed' in nature. The inhibitor was retained on a trypsin-Sepharose 4B column at pH 7.0. Elution at acidic pH resulted in almost complete recovery of amylase-inhibitory and trypsin-inhibitory activities. alpha-Amylase was retained on a trypsin-Sepharose column to which inhibitor I-1 was bound, but not on trypsin-Sepharose alone. Modification of amino groups of the inhibitor with 2,4,6-trinitrobenzenesulphonic acid resulted in complete loss of amylase-inhibitory activity but only 40% loss in antitryptic activity. Modification of arginine residues by cyclohexane-1,2-dione led to 85% loss of antitryptic activity after 5 h, but no effect on amylase-inhibitory activity. The results show that a single bifunctional protein factor is responsible for both amylase-inhibitory and trypsin-inhibitory activities with two different reactive sites.

  20. A barley flour inhibitor of insect alpha-amylase is a major allergen associated with baker's asthma disease.

    Science.gov (United States)

    Barber, D; Sánchez-Monge, R; Gómez, L; Carpizo, J; Armentia, A; López-Otín, C; Juan, F; Salcedo, G

    1989-05-08

    A barley salt-soluble protein of 14.5 kDa, which inhibits the alpha-amylase from the insect Tenebrio molitor, has been identified as a major IgE-binding component of sera from baker's asthma patients. The N-terminal amino acid sequence of this protein indicates that it is a member of a previously described family of alpha-amylase/trypsin inhibitors.

  1. Amylase level in extrahepatic bile duct in adult patients with choledochal cyst plus anomalous pancreatico-biliary ductal union

    Institute of Scientific and Technical Information of China (English)

    In-Ho Jeong; Jin-Hong Kim; Jae-Ho Han; Wook-Hwan Kim; Yong-Sik Jung; Hong Kim; Bong-Wan Kim; Jung-Woon Kim; Jeong Hong; Hee-Jung Wang; Myung-Wook Kim; Byung-Moo Yoo

    2005-01-01

    AIM: To investigate the relationship between pancreatic amylase in bile duct and the clinico-pathological features in adult patients with choledochal cyst and anomalous pancreatico-biliary ductal union (APBDU).METHODS: From 39 patients who underwent surgery for choledochal cyst between March 1995 and March 2003,we selected 15 adult patients who had some symptoms and were radiologically diagnosed as APBDU, and their clinico-pathological features were subsequently evaluated retrospectively. However, we could not obtain biliary amylase in all the patients because of the surgeon's slip.Therefore, we measured the amylase level in gall bladder of 10 patients and in common bile duct of 11 patients.RESULTS: Levels of amylase in common bile duct and gall bladder ranged from 11 500 to 212 000 IU/L, and the younger the patients, the higher the biliary amylase level (r= -0.982, P<0.01). Pathologically, significant correlation was found between the size of choledochal cyst and the grade of inflammation (r= 0.798,P<0.01). And, significant correlation was found between the level of amylase in gall bladder and the grade of hyperplasia. On the other hand, there was no correlation to the age of symptomatic onset or inflammatory grade (r = 0.743, P<0.05). Level of lipase was elevated from 6 000 to 159 000 IU/L in bile duct and from 14 400 to 117 000 IU/L in the gall bladder;however, there was no significant correlation with age or clinico-pathological features.CONCLUSION: The results support the notion that amylase has a particular role in the onset of symptoms, and suggest that a large amount of biliary amylase induces early onset of symptom, thereby making early diagnosis possible.

  2. Biophysical and biochemical characterization of a hyperthermostable and Ca2+ -independent alpha-Amylase of an extreme thermophile Geobacillus thermoleovorans.

    Science.gov (United States)

    Uma Maheswar Rao, J L; Satyanarayana, T

    2008-08-01

    alpha-Amylases reported from various microbial sources have been shown to be moderately thermostable and Ca2+ dependent. The bacterial strain used in this investigation is an extremely thermophilic bacterium Geobacillus thermoleovorans that produces a novel alpha-amylase (26 kDa; alpha-amylase gt), which is hyperthermostable (Topt 100 degrees C) and does not require Ca2+ for its activity/stability. These special features of alpha-amylase gt make it applicable in starch saccharification process. The structural aspects of alpha-amylase gt are, therefore, of significant interest to understand its structure-function relationship. The circular dichroism spectroscopic data revealed the native alpha-amylase gt to contain 25% alpha-helix, 21% beta-sheet, and 54% random coils. The addition of urea, at high concentration (8 M), appeared to expose the buried Trp residues of the native alpha-amylase gt to the aqueous environment and thus showed low fluorophore. Fluorescence-quenching experiments using KI, CsCl, N-bromosuccinimide, and acrylamide revealed interesting features of the tryptophan microenvironment. Analysis of Ksv and fa values of KI, CsCl, and acrylamide suggested the overall Trp microenvironment in alpha-amylase to be slightly electropositive. Fluorescence-quenching studies with acrylamide revealed the occurrence of both collisional as well as static quenching processes. There was no change in the alpha-helix content or the enzyme activity with an increase in temperature (60-100 degrees C) that suggested a critical role of the alpha-helix content in maintaining the catalytic activity.

  3. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222

    OpenAIRE

    2015-01-01

    Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best o...

  4. Cloning and sequencing analysis of three amylase cDNAs in the shrimp Penaeus vannamei (Crustacea decapoda): evolutionary aspects.

    Science.gov (United States)

    Van Wormhoudt, A; Sellos, D

    1996-05-01

    In Penaeus vannamei, alpha-amylase is the most important glucosidase and is present as at least two major isoenzymes which have been purified. In order to obtain information on their structure, a hepatopancreas cDNA library constructed in phage lambda-Zap II (Strategene) was screened using a synthetic oligonucleotide based on the amino acid sequence of a V8 staphylococcal protease peptide of P. vannamei alpha-amylase. Three clones were selected: AMY SK 37 (EMBL sequence accession number: X 77318) is the most complete of the analyzed clones and was completely sequenced. It contains the complete cDNA sequence coding for one of the major isoenzymes of shrimp amylase. The deduced amino acid sequence shows the existence of a 511-residue-long pre-enzyme containing a highly hydrophobic signal peptide of 16 amino acids. Northern hybridization of total RNA with the amylase cDNA confirms the size of the messenger at around 1,600 bases. AMY SK 28, which contains the complete mature sequence of amylase, belonged to the same family characterized by a common 3' terminus and presented four amino acid changes. Some other variants of this family were also partially sequenced. AMY SK 20 was found to encode a minor variant of the protein with a different 3' terminus and 57 amino acid changes. Phylogenetic analysis established with the conserved amino acid regions of the (beta/alpha) eight-barrel domain and with the total sequence of P. vannamei showed close evolutionary relationships with mammals (59-63% identity) and with insect alpha-amylase (52-62% identity). The use of conserved sequences increased the level of similarity but it did not alter the ordering of the groupings. Location of the secondary structure elements confirmed the high level of sequence similarity of shrimp alpha-amylase with pig alpha-amylase.

  5. The production of a new fungal alpha-amylase degraded the raw starch by means of solid-state fermentation.

    Science.gov (United States)

    Balkan, Bilal; Ertan, Figen

    2010-01-01

    In this study, it was intended to produce a new fungal amylase by solid-state fermentation and purification and also to determine some of its biochemical properties. It was found that Penicillium brevicompactum had the best enzyme activity according to screening methods with amylase degrading raw starch, and P. brevicompactum was selected as the amylase source. Wheat bran, rice husks, and sunflower oil meal were tested to determine the best solid substrate. Wheat bran was determined as the best of these. The fermentation conditions were optimized for the production of amylase. The optimum fermentation conditions were found to be an initial moisture level for the solid substrate of 55%, moistening agent of 0.1 M sodium phosphate buffer (pH 5.0), incubation period of 7 d, inoculum concentration of 2.5 mL, and incubation temperature at 30 degrees C. Penicillium brevicompactum alpha-amylase was purified 45.98 times by the starch affinity method. The K(m) and V(max) values of alpha-amylase for soluble starch were 5.71 mg/mL and 666.6 U/mL, respectively. This amylase showed maximum activity at between 30 and 50 degrees C and at pH 5.0. Initial enzyme activity was kept at 100% after incubation at 30 degrees C for 45 min. Enzyme was stable in the pH range of 4.0-5.0. This enzyme was activated by Mn(2+), Cu(2+), and Na(+) ions, and was inhibited by Mg(2+), K(+), Fe(3+), and ethylenediamine tetraacetic acid (EDTA). The molecular mass of P. brevicompactum alpha-amylase was found to be 32.5 kD by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis.

  6. A Thermostable α-Amylase Producing Natural Variant of Bacillus spp. Isolated From Soil in Iran

    Directory of Open Access Journals (Sweden)

    Iraj Rasooli

    2008-01-01

    Full Text Available Thermophilic processes appear more stable, rapid and less expensive and facilitate reactant activity and product recovery. Amylases have a quarter of the world enzyme market and thermostable α-amylases possess extensive commercial applications. Since little work has been done on strain isolation, growth and enzyme yield optimization, the level of thermophilic enzyme production remains relatively low. Therefore, large scale exploitation of thermophiles requires further intensive and integrated work. The present study describes isolation of an α-amylase producing bacillus from soil. The isolated bacillus was identified and named as Bacillus licheniformis Shahed-07. The strain was cultured in liquid media to produce α-amylase. The enzyme production conditions of the newly isolated bacillus revealed that the maximum enzyme production after 26 h of cultivation at pH 7.0 and 50°C. 0.5% tryptophan in production medium enhanced the enzyme productivity to two fold whereas peptone and lysin at 0.5% level showed a strong repression. Crude α-amylase characterization revealed that optimum activity was at pH 7.5 and 70°C. The crude enzyme was stable for 24 h at pH range of 6-7 at 70°C. Enzyme activity increased with temperature within the range of 40-70°C. The Bacillus licheniformis Shahed-07 strain produced thermostable α-amylase with characteristics suitable for application in starch processing and food industries.

  7. Supplementation of Carbohydrate to Enhance the α-amylase Production by Bacillus licheniformis ATCC 6346 in Presence of Seed Cakes

    Directory of Open Access Journals (Sweden)

    Vengadaramana, A.

    2012-01-01

    Full Text Available Aims: The effect of carbohydrate and amino acids on the production of a-amylase by Bacillus licheniformis ATCC 6346 was investigated. Methodology and results: To find out the influence of carbohydrate the total carbohydrate content of the medium containing different concentration (2-18 g/L of defatted seed cake powder of sesamum and mustard containing medium was kept constant by the addition of soluble starch separately. The highest a-amylase activity obtained in the medium containing 18g/L mustard (59.11+b1.48 U/mL and sesamum seed cake powder (55.23+b1.55 U/mL. The results indicated that under these conditions the carbohydrate content had no effect on the production of a-amylase. Effect of amino acids (0.2g/L of glycine, methionine, proline, lysine, leucine, threonine, serine, arginine, alanine, glutamic acid, tryptophan, glutamine, asparagine, histidine, valine, phenylalanine, isoleucine and mixture of amino acids on the production of a-amylase in fermentation medium was investigated. Among the different amino acids supplemented, eight amino acids improved the a-amylase production but casaminoacids slightly inhibited the enzyme production. In presence of tryptophan highest enzyme activity was obtained than control. Conclusion, significance and impact of study: In these study amino acids especially tryptophan takes part in a particular role rather than carbohydrate in the production of a-amylase from B. licheniformis ATCC 6346.

  8. Growth temperature of different local isolates of Bacillus sp. in the solid state affects production of raw starch digesting amylases

    Directory of Open Access Journals (Sweden)

    Šokarda-Slavić Marinela

    2014-01-01

    Full Text Available Natural amylase producers, wild type strains of Bacillus sp., were isolated from different regions of Serbia. Strains with the highest amylase activity based on the starch-agar plate test were grown on solid-state fermentation (SSF on triticale. The influence of the substrate and different cultivation temperature (28 and 37°C on the production of amylase was examined. The tested strains produced α-amylases when grown on triticale grains both at 28 and at 37°C, but the activity of amylases and the number and intensity of the produced isoforms were different. Significant hydrolysis of raw cornstarch was obtained with the Bacillus sp. strains 2B, 5B, 18 and 24B. The produced α-amylases hydrolyzed raw cornstarch at a temperature below the temperature of gelatinization, but the ability for hydrolysis was not directly related to the total enzyme activity, suggesting that only certain isoforms are involved in the hydrolysis. [Projekat Ministarstva nauke Republike Srbije, br. 172048

  9. Utilization of a maltotetraose-producing amylase as a whole wheat bread improver: dough rheology and baking performance.

    Science.gov (United States)

    Bae, Woosung; Lee, Sung Ho; Yoo, Sang-Ho; Lee, Suyong

    2014-08-01

    A maltotetraose-producing enzyme (G4-amylase) was utilized to improve the baking performance of whole-grain wheat flour. Whole-grain bread dough prepared with G4-amylase showed reduced water absorption and increased development time, while the dough stability was not affected. Also, the G4-amylase-treated samples exhibited lower Mixolab torque values than the control upon heating and cooling. Rheological measurements showed the decreased ratio of Rmax /E and increased tan δ, clearly demonstrating that the viscous characteristics of whole-grain bread dough became dominant with increasing levels of G4-amylase. The use of G4-amylase produced whole-grain wheat breads with a variety of maltooligosaccharides, primarily maltotetraose that positively contributed to the bread volume (1.2-fold higher than the control). Moreover, G4-amylase delayed the crumb firming of whole-grain wheat bread during a 7-d storage period, showing that it can function as an antiretrogradation agent to enhance the quality attributes of whole-grain wheat bread.

  10. Chloride Activated Halophilic α-Amylase from Marinobacter sp. EMB8: Production Optimization and Nanoimmobilization for Efficient Starch Hydrolysis.

    Science.gov (United States)

    Kumar, Sumit; Khare, S K

    2015-01-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Present work encompasses production optimization and nanoimmobilization of an α-amylase from moderately halophilic Marinobacter sp. EMB8. Media ingredients and culture conditions were optimized by "one-at-a-time approach." Starch was found to be the best carbon source at 5% (w/v) concentration. Glucose acted as catabolic repressor for amylase production. Salt proved critical for amylase production and maximum production was attained at 5% (w/v) NaCl. Optimization of various culture parameters resulted in 48.0 IU/mL amylase production, a 12-fold increase over that of unoptimized condition (4.0 IU/mL). α-Amylase was immobilized on 3-aminopropyl functionalized silica nanoparticles using glutaraldehyde as cross-linking agent. Optimization of various parameters resulted in 96% immobilization efficiency. Starch hydrolyzing efficiency of immobilized enzyme was comparatively better. Immobilized α-amylase retained 75% of its activity after 5th cycle of repeated use.

  11. Production and properties of a raw-starch-degrading amylase from the thermophilic and alkaliphilic Bacillus sp. TS-23.

    Science.gov (United States)

    Lin, L L; Chyau, C C; Hsu, W H

    1998-08-01

    The optimum temperature and initial medium pH for amylase production by Bacillus sp. TS-23 were 55 degrees C and 8.5 respectively. Maximum amylase activity was obtained in a medium containing peptone and soluble starch as nitrogen and carbon sources. Activity staining revealed that two amylases with molecular masses of 150 and 42 kDa were produced when maltose, soluble starch or amylose was used as carbon source for growth, whereas only the 150 kDa protein was detected in the medium containing water-insoluble carbon sources. A raw-starch-degrading amylase was purified from culture supernatant of Bacillus sp. TS-23. The molecular mass of the purified amylase was estimated at 42 kDa by electrophoresis. The enzyme had a pI of 4. 2. The optimal pH and temperature for activity were 9.0 and 70 degrees C respectively. The thermoactivity of the purified enzyme was enhanced in the presence of 5 mM Ca2+; under this condition, enzyme activity could be measured at a temperature of 90 degrees C. The enzyme was strongly inhibited by Hg2+, Pb2+, Zn2+, Cu2+ and EDTA, but less affected by Ni2+ and Cd2+. The enzyme preferentially hydrolysed high-molecular-mass substrates with an alpha-1, 4-glucosidic bond except glycogen. The raw starches were partly degraded by the purified amylase to yield predominantly oligosaccharides with degrees of polymerization 3, 4 and 5.

  12. Chloride Activated Halophilic α-Amylase from Marinobacter sp. EMB8: Production Optimization and Nanoimmobilization for Efficient Starch Hydrolysis

    Directory of Open Access Journals (Sweden)

    Sumit Kumar

    2015-01-01

    Full Text Available Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Present work encompasses production optimization and nanoimmobilization of an α-amylase from moderately halophilic Marinobacter sp. EMB8. Media ingredients and culture conditions were optimized by “one-at-a-time approach.” Starch was found to be the best carbon source at 5% (w/v concentration. Glucose acted as catabolic repressor for amylase production. Salt proved critical for amylase production and maximum production was attained at 5% (w/v NaCl. Optimization of various culture parameters resulted in 48.0 IU/mL amylase production, a 12-fold increase over that of unoptimized condition (4.0 IU/mL. α-Amylase was immobilized on 3-aminopropyl functionalized silica nanoparticles using glutaraldehyde as cross-linking agent. Optimization of various parameters resulted in 96% immobilization efficiency. Starch hydrolyzing efficiency of immobilized enzyme was comparatively better. Immobilized α-amylase retained 75% of its activity after 5th cycle of repeated use.

  13. Purification, biochemical characterisation and partial primary structure of a new alpha-amylase inhibitor from Secale cereale (rye).

    Science.gov (United States)

    Iulek, J; Franco, O L; Silva, M; Slivinski, C T; Bloch, C; Rigden, D J; Grossi de Sá, M F

    2000-01-01

    Plant alpha-amylase inhibitors show great potential as tools to engineer resistance of crop plants against pests. Their possible use is, however, complicated by the observed variations in specificity of enzyme inhibition, even within closely related families of inhibitors. Better understanding of this specificity depends on modelling studies based on ample structural and biochemical information. A new member of the alpha-amylase inhibitor family of cereal endosperm has been purified from rye using two ionic exchange chromatography steps. It has been characterised by mass spectrometry, inhibition assays and N-terminal protein sequencing. The results show that the inhibitor has a monomer molecular mass of 13,756 Da, is capable of dimerisation and is probably glycosylated. The inhibitor has high homology with the bifunctional alpha-amylase/trypsin inhibitors from barley and wheat, but much poorer homology with other known inhibitors from rye. Despite the homology with bifunctional inhibitors, this inhibitor does not show activity against mammalian or insect trypsin, although activity against porcine pancreatic, human salivary, Acanthoscelides obtectus and Zabrotes subfasciatus alpha-amylases was observed. The inhibitor is more effective against insect alpha-amylases than against mammalian enzymes. It is concluded that rye contains a homologue of the bifunctional alpha-amylase/trypsin inhibitor family without activity against trypsins. The necessity of exercising caution in assigning function based on sequence comparison is emphasised.

  14. Structural stability of soybean (Glycine max) α-amylase: properties of the unfolding transition studied with fluorescence and CD spectroscopy.

    Science.gov (United States)

    Kumari, Arpana; Rosenkranz, Tobias; Fitter, Jörg; Kayastha, Arvind M

    2011-03-01

    Stability and unfolding of mammalian and microbial α-amylases have been intensively investigated. However, there is only limited information available on the structural stability of plant α-amylases, namely of the two isoenzymes from barley AMY1 and AMY2, of the α-amylase from mung bean (Vigna radiata), and of the α-amylase from malted sorghum (Sorghum bicolor). We report here the stability of soyabean α-amylase (GMA), against elevated temperatures and chemical denaturants (GndHCl) by employing circular dichroism and fluorescence spectroscopy. Since it is well-known that calcium ions play a crucial role for enzymatic activity and stability of a-amylases, we performed our studies with calcium bound and calcium free GMA. The thermal unfolding transition temperature decreased from 72°C for calcium saturated samples to 57°C for the case of calcium depleted GMA. Similarly, the GndHCl transition concentration was lowered from 0.70 M for calcium bound GMA to 0.41 M in the absence of calcium. Thermal unfolding of GMA irreversible due to aggregation of the unfolded state. GMA unfolded in 6 M GndHCl shows high degree of reversibility after diluting the unfolded enzyme in native buffer containing 7 M glycerol. Furthermore, the refolded enzyme showed 93% of activity.

  15. Deletion analysis of the C-terminal region of the alpha-amylase of Bacillus sp. strain TS-23.

    Science.gov (United States)

    Lo, Huei-Fen; Lin, Long-Liu; Chiang, Wen-Ying; Chie, Meng-Chun; Hsu, Wen-Hwei; Chang, Chen-Tien

    2002-08-01

    The alpha-amylase from Bacillus sp. strain TS-23 is a secreted starch hydrolase with a domain organization similar to that of other microbial alpha-amylases and an additional functionally unknown domain (amino acids 517-613) in the C-terminal region. By sequence comparison, we found that this latter domain contained a sequence motif typical for raw-starch binding. To investigate the functional role of the C-terminal region of the alpha-amylase of Bacillus sp. strain TS-23, four His(6)-tagged mutants with extensive deletions in this region were constructed and expressed in Escherichia coli. SDS-PAGE and activity staining analyses showed that the N- and C-terminally truncated alpha-amylases had molecular masses of approximately 65, 58, 54, and 49 kDa. Progressive loss of raw-starch-binding activity occurred upon removal of C-terminal amino acid residues, indicating the requirement for the entire region in formation of a functional starch-binding domain. Up to 98 amino acids from the C-terminal end of the alpha-amylase could be deleted without significant effect on the raw-starch hydrolytic activity or thermal stability. Furthermore, the active mutants hydrolyzed raw corn starch to produce maltopentaose as the main product, suggesting that the raw-starch hydrolytic activity of the Bacillus sp. strain TS-23 alpha-amylase is functional and independent from the starch-binding domain.

  16. A role for arabinogalactan proteins in gibberellin-induced alpha-amylase production in barley aleurone cells.

    Science.gov (United States)

    Suzuki, Yoshihito; Kitagawa, Mamiko; Knox, J Paul; Yamaguchi, Isomaro

    2002-03-01

    Arabinogalactan proteins (AGPs) are plant proteoglycans that have been implicated in plant growth and development. The possible involvement of AGPs in the action of gibberellin (GA), a class of plant hormones, was examined by applying beta-glucosyl Yariv reagent (beta-Glc)3Y, a synthetic phenyl glycoside that interacts selectively with AGPs, to barley aleurone protoplasts. Gibberellin induces transcription and secretion of alpha-amylases in the protoplasts. Induction of alpha-amylase was clearly inhibited by (beta-Glc)3Y but not by (alpha-Gal)3Y, a negative control of the Yariv reagent that does not interact with AGPs. Transfection analysis, using an alpha-amylase promoter-GUS fusion gene in the protoplasts, indicated that the transcriptional activation of the alpha-amylase promoter was inhibited specifically by (beta-Glc)3Y. These observations are the first indication of an involvement of AGPs in a plant hormone function. The inhibitory effect of (beta-Glc)3Y was not observed when aleurone layers or half-seed grains were used. This result, together with the fact that protoplasts do not have cell walls, suggests that the AGPs that function in alpha-amylase induction reside at the plasma membrane. An aleurone-specific AGP was detected by reversed-phase HPLC, and supported the idea that an AGP may play an important role in aleurone-specific events. The possible mechanism of AGP function in gibberellin-induced alpha-amylase production is discussed.

  17. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum.

    Science.gov (United States)

    Kim, Kyung-Tae; Rioux, Laurie-Eve; Turgeon, Sylvie L

    2014-02-01

    Fucoidan is a water-soluble, negatively charged, biologically active polysaccharide found in great abundance in brown marine algae. However, the inhibition of α-amylase and α-glucosidase by fucoidan derived from two algal species (Ascophyllum nodosum and Fucus vesiculosus) harvested at different periods (accounting for seasonal and yearly variations) has never been investigated. It was found that fucoidans inhibited α-glucosidase differently, depending on the algal species from which it was extracted and the algae's season of harvest. Fucoidan extracted from A. nodosum was a more potent inhibitor of α-glucosidase, with an IC50 ranging from 0.013 to 0.047 mg/mL, than the inhibition by fucoidan extracted from F. vesiculosus (IC50=0.049 mg/mL). In contrast, fucoidan extracted from F. vesiculosus did not inhibit α-amylase activity, while fucoidan from A. nodosum decreased α-amylase activity by 7-100% at 5 mg/mL depending upon the algae harvest period. An IC50 of 0.12-4.64 mg/mL for fucoidan from A. nodosum was found for the α-amylase inhibition. The ability of fucoidan to inhibit α-amylase and α-glucosidase thus varies according to the algae species and harvest period. A. nodosum is more suitable than F. vesiculosus as a source of fucoidan to inhibit α-amylase and α-glucosidase activities. Their potential benefits towards Type 2 diabetes management should be further investigated.

  18. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    Energy Technology Data Exchange (ETDEWEB)

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  19. Primer extension studies on alpha-amylase mRNAs in barley aleurone. II. Hormonal regulation of expression.

    Science.gov (United States)

    Chandler, P M; Jacobsen, J V

    1991-04-01

    Relative levels of different alpha-amylase mRNAs were assessed by primer extension experiments using RNA prepared from aleurone of barley (Hordeum vulgare L. cv. Himalaya). Three different aleurone systems were studied: protoplasts prepared from aleurone layers, isolated aleurone layers, and aleurone from germinated grain. Oligonucleotide primers specific for the low-pI and high-pI alpha-amylase groups allowed the levels of different alpha-amylase mRNAs to be assessed both within and between the two groups. In all aleurone systems the same set of alpha-amylase mRNAs was produced in response to either applied gibberellic acid (aleurone protoplasts, isolated aleurone layers) or, presumably, native gibberellin(s) (germinated grain). This result indicates that the same set of genes is being expressed in each case. Differences were observed between the different aleurone systems in regulation of levels of alpha-amylase mRNAs. In particular, the regulation of alpha-amylase mRNA levels in aleurone of germinated grain has unique features which are not adequately explained by the response of isolated aleurone layers to gibberellic acid.

  20. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey

    2016-06-01

    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  1. Purification and characterisation of α-amylase produced by mutant strain of Aspergillus oryzae EMS-18.

    Science.gov (United States)

    Abdullah, Roheena; Ikram-ul-Haq

    2015-01-01

    α-Amylase produced by a mutant strain of Aspergillus oryzae EMS-18 has been purified to homogeneity as judged by sodium dodecyle sulphate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was purified by using 70% ammonium sulphate precipitation followed by anion exchange chromatography on DEAE-Sephadex column and gel filtration on Sephadex G-100. An enzyme purification factor of 9.5-fold was achieved with a final specific activity of 1987.7 U/mg protein and overall yield of 23.8%. The molecular weight of purified α-amylase was estimated to be 48 kDa by SDS-PAGE. The purified enzyme revealed an optimum assay temperature and pH 40°C and 5.0, respectively. Except Ca(++) all other metal ions such as Mg, Mn, Na, Zn, Ni, Fe, Cu, Co and Ba were found to be inhibitory to enzyme activity.

  2. α-GLUCOSIDASE AND α -AMYLASE INHIBITORY ACTIVITIES OF RAPHANUS SATIVUS LINN.

    Directory of Open Access Journals (Sweden)

    R. Vadivelan et al

    2012-09-01

    Full Text Available Herbal medicine has been used for many years by different cultures around the world for the treatment of diabetes. There has been an enormous interest in the development of alternative medicines for type 2 diabetes, specifically screening for phytochemicals with the ability to delay or prevent glucose absorption. The goal of the present study is to evaluate the invitro antidiabetic activity of Raphanus sativus ethanolic extract and fractions by α-glucosidase and α -amylase inhibitory activity. Raphanus sativus ethanolic extract and fractions showed dose dependent inhibition of α-glucosidase and α -amylase enzyme and exhibited lower inhibitory activity than acarbose. The study revealed the antidiabetic potential and could be helpful to develop medicinal preparations and nutraceuticals and function foods for diabetes.

  3. Interactions of barley alpha-amylase isozymes with Ca2+, substrates and proteinaceous inhibitors

    DEFF Research Database (Denmark)

    Abou Hachem, Maher; Bozonnet, Sophie; Willemoes, Martin

    2006-01-01

    , and proteinaceous inhibitors for alpha-amylases. Isozyme specific effects of Ca2+ on the 80% sequence identical barley alpha-amylases AMY1 and AMY2 are not obvious from the two crystal structures, containing three superimposable Ca2+ with identical ligands. A fully hydrated fourth Ca2+ at the interface of the AMY2...... has revealed that AMY1 has ten functional subsites which can be modified by means protein engineering to modulate the substrate specificity. Other mutational analyses show that surface carbohydrate binding sites are critical for interaction with polysaccharides. The conserved Tyr380 in the newly...... discovered 'sugar tongs' site in domain C of AMY1 is thus critical for binding to starch granules. Furthermore, mutations of binding sites mostly reduced the degree of multiple attack in amylose hydrolysis. AMY1 has higher substrate affinity than AMY2, but isozyme chimeras with AMY2 domain C and other...

  4. Characterization and Application of BiLA, a Psychrophilic α-Amylase from Bifidobacterium longum.

    Science.gov (United States)

    Lee, Hye-Won; Jeon, Hye-Yeon; Choi, Hye-Jeong; Kim, Na-Ri; Choung, Woo-Jae; Koo, Ye-Seul; Ko, Dam-Seul; You, SangGuan; Shim, Jae-Hoon

    2016-04-06

    In this study, a novel α-amylase was cloned from Bifidobacterium longum and named BiLA. The enzyme exhibited optimal activity at 20 °C and a pH value of 5.0. Kinetic analysis using various carbohydrate substrates revealed that BiLA had the highest k(cat/)K(m) value for amylose. Interestingly, analysis of the enzymatic reaction products demonstrated that BiLA specifically catalyzed the hydrolysis of oligosaccharides and starches up to G5 from the nonreducing ends. To determine whether BiLA can be used to generate slowly digestible starch (SDS), starch was treated with BiLA, and the kinetic parameters were analyzed using porcine pancreatic α-amylase (PPA) and amyloglucosidase (AMG). Compared to normal starch, BiLA-treated starch showed lower k(cat)/K(m) values with PPA and AMG, suggesting that BiLA is a potential candidate for the production of SDS.

  5. Influence of carbon source on alpha-amylase production by Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens

    2001-01-01

    The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol and acet......The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol...... and acetate. A. oryzae did not grow on galactose as the sole carbon source, but galactose was co-metabolized together with glucose. Relative to that on low glucose concentration (below 10 mg/l), productivity was found to be higher during growth on maltose and maltodextrins, whereas it was lower during growth...

  6. Componential Profile and Amylase Inhibiting Activity of Phenolic Compounds from Calendula officinalis L. Leaves

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-01-01

    Full Text Available An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6′-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6′′-acetyl-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase.

  7. Kinetic model of Bacillus stearothermophilus. cap alpha. -amylase under process conditions

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, W.E.; Teague, W.M.

    1988-11-01

    A model is presented describing starch hydrolysis by Bacillus stearothermophilus ..cap alpha..-amylase at temperatures of 90 to 115/sup 0/C and substrate concentrations of 24 to 36% solids. First order kinetics adequately describe both the enzyme decay and starch hydrolysis reactions. Quantitation of temperature, pH, added calcium and substrate concentration interactive effects on the first order rate constants is aided by applying standard statistical techniques of experimental design and data analysis. A method for determining residual ..cap alpha..-amylase activity in liquefact based on the Phadebas dye release assay, and an osmometry method for determining degree of liquefact hydrolysis are described. Computer implementation of the model allows rapid graphical visualization as well as screening of ideas for improved starch hydrolysis processes.

  8. Amylase production by solid-state fermentation of agro-industrial wastes using Bacillus sp.

    Directory of Open Access Journals (Sweden)

    Rajshree Saxena

    2011-12-01

    Full Text Available Solid state fermentation was carried out using various agro- industrial wastes with the best amylase producing strain isolated from soil. Different physicochemical conditions were varied for maximum enzyme production. The strain produced about 5400 units/g of amylase at 1:3 moisture content, 20% inoculum, after 72 h of incubation with Mustard Oil seed cake as the substrate. The optimum temperature and pH of the enzyme activity were found to be 50ºC and 6 respectively. The enzyme was found to be thermostable at 70ºC for about 2 h without any salt. It showed stability at pH range 5-7. The metal ions as Na+, Ca++, Mg++ and Co++ enhanced the enzyme activity.

  9. Studies on alpha-amylase induced degradation of binary polymeric blends of crosslinked starch and pectin.

    Science.gov (United States)

    Bajpai, A K; Shrivastava, Jyoti

    2007-05-01

    A blend matrix of crosslinked starch and pectin was prepared and characterized by infra-red (IR) spectroscopy, differential scanning calorimetry (DSC), and scanning electron microscopy (SEM). The prepared blends were investigated kinetically for water sorption studies and alpha-amylase induced degradation adopting a gravimetric procedure. Based on the experimental findings, a plausible mechanism including both diffusion and surface enhanced degradation was suggested and degradation profiles were interpreted. The influence of various factors such as chemical architecture of the blend, pH and temperature of alpha-amylase solution were examined for the swelling and degradation kinetics of crosslinked starch-pectin blends. The effect of concentration of enzyme solution was also studied on the degradation profile of the blends. A correlation was established between the extent of degradation and water imbibing capacity of the degrading blends.

  10. Comparison of Antibodies with Amylase Activity from Cerebrospinal Fluid and Serum of Patients with Multiple Sclerosis.

    Directory of Open Access Journals (Sweden)

    Vasilii B Doronin

    Full Text Available We have recently shown that IgGs from serum and cerebrospinal fluid (CSF of MS patients are active in hydrolysis of DNA and myelin basic protein. According to literature data, anti-DNA and anti-MBP abzymes may promote important neuropathologic mechanisms in this chronic inflammatory disorder and in MS pathogenesis development. At the same time, the involvement of antibodies with amylase activity in the pathogenesis of any autoimmune disease has not yet been identified. Electrophoretically and immunologically homogeneous IgGs were obtained by a sequential affinity chromatography of the CSF proteins on protein G-Sepharose and FPLC gel filtration. We are able to present the first unpredictable evidence showing that IgGs from CSF possess amylase activity and efficiently hydrolyze maltoheptaose; their average specific Ab activity is ~30-fold higher than that of antibodies from sera of the same MS patients. Specific average RA (SAA for IgGs from healthy volunteers was approximately ~1000 lower than that for MS patients. In addition, it was shown that a relative SAA of total proteins of CSF (including Abs ~15-fold lower than that for purified IgGs, while the relative SAA of the total sera protein is higher than that of sera IgGs by a factor of 1033. This result speaks in favor of the fact that amylolytic activity of CSF proteins is mainly caused by the activity of amylase abzymes. One cannot exclude, that amylase abzymes of CSF can play a, as yet unknown, role in the pathogenesis of MS. Some possible reasons of these findings are discussed.

  11. Control of postprandial hyperglycaemia by galactosyl maltobionolactone and its novel anti-amylase effect in mice.

    Science.gov (United States)

    Murai, Atsushi; Iwamura, Koji; Takada, Masayasu; Ogawa, Koichi; Usui, Taichi; Okumura, Jun-ichi

    2002-08-09

    The ability to control carbohydrate digestion is useful in the treatment of diabetes mellitus and obesity. In the present study, we examined whether recently developed 4(2)-O-beta-D-galactosyl maltobionolactone (LG2O) having anti-amylase activity is able to control postprandial blood glucose concentration in mice. In addition, we tried to determine how LG2O regulates carbohydrate delivery in the gut lumen by conducting in vivo and in vitro studies. Male non-diabetic ddY mice and KK-A(y) mice, a spontaneously diabetic strain, had free access to a carbohydrate rich diet supplemented with LG2O (3 or 10 g/kg) for 0.5 hr, and blood glucose concentration was measured. LG2O suppressed any steep increase in postprandial blood glucose concentration in both ddY and KK-A(y) mice. Corresponding to the blood glucose response, LG2O also markedly suppressed any increase in postprandial plasma insulin concentration. After ingestion of the diet, LG2O produced a 1.5-3.5 fold increase in the gut contents and reducible sugar content in the small intestine but not in the stomach. Although alpha-amylase activity in the stomach was much lower compared with the activity in the small intestine, LG2O still strongly inhibited alpha-amylase activity in the stomach. In contrast, LG2O had little or no influence on alpha-amylase activity in the proximal intestine. From the in vitro carbohydrate digestion stimulation, LG2O at 7.5 mM decreased glucose production by 75% for dextrin, 25% for alpha-starch and 60% for raw starch. In conclusion, administration of LG2O inhibits carbohydrate digestion in the gut, and produces significant improvements in both blood glucose and insulin response following ingestion as part of the diet, and this evidence provides support for its therapeutic potential in treating diabetes mellitus and obesity.

  12. High-level expression of the native barley alpha-amylase/subtilisin inhibitor in Pichia pastoris

    DEFF Research Database (Denmark)

    Micheelsen, Pernille Ollendorff; Ostergaard, Peter Rahbek; Lange, Lene;

    2008-01-01

    An expression system for high-level expression of the native Hordeum vulgare alpha-amylase/subtilisin inhibitor (BASI) has been developed in Pichia pastoris, using the methanol inducible alcohol oxidase 1 (AOX1) promoter. To optimize expression, two codon-optimized coding regions have been designed...... and characterized by Edman degradation, liquid chromatography mass spectrometry and insoluble blue starch assay, and was shown to possess the same characteristics as wild-type protein purified from barley grains....

  13. Differences in salivary α-amylase levels among women with different taste sensitivities

    OpenAIRE

    Sequeira, Márcia; Rodrigues, Lénia; Costa, Ana R; Pinheiro, C.; Antunes, Célia M.; Lamy, Elsa

    2013-01-01

    Saliva is the main component of taste receptor cells external environment, and consequently it may have a decisive role in taste perception. Taste sensitivity varies among different individuals. Sensitivity to the compound n-6-propylthiouracil (PROP) has been considerably studied and besides the known influence of genetic background, the contribution of perireceptor environment is not completely clear yet. Salivary α-amylase (one of the main proteins of saliva) is involved in carbohydrate dig...

  14. Differences in salivary α-amylase levels among women ith different taste sensitivities.

    OpenAIRE

    Sequeira, Márcia; Rodrigues, Lénia; R Costa, Ana; Antunes, Célia; Pinheiro, Cristina; Lamy, Elsa

    2012-01-01

    Saliva is the main component of taste receptor cells external environment, and consequently it may have a decisive role in taste perception. Taste sensitivity varies among different individuals. Sensitivity to the compound n-6-propylthiouracil (PROP) has been considerably studied and besides the known influence of genetic background, the contribution of perireceptor environment is not completely clear yet. Salivary α-amylase (one of the main proteins of saliva) is involved in carbohydrate dig...

  15. Optimization of Thermostable Alpha-Amylase Production Via Mix Agricultural-Residues and Bacillus amyloliquefaciens

    Directory of Open Access Journals (Sweden)

    Shalini RAI

    2014-03-01

    Full Text Available This study reports utilization of mixture of wheat and barley bran (1:1 for the production of thermostable alpha-amylase enzyme through a spore former, heat tolerant strain of Bacillus amyloliquefaciens in solid state fermentation. Maximum yield of alpha-amylase (252.77 U mL-1 was obtained in following optimized conditions, inoculums size 2 mL (2 × 106 CFU/mL, moisture 80%, pH 7±0.02, NaCl (3%, temperature 38±1°C, incubation for 72 h, maltose (1% and tryptone (1%. After SSF crude enzyme was purified via ammonium sulfate precipitation, ion exchange and column chromatography by DEAE Cellulose. Purified protein showed a molecular weight of 42 kDa by SDS-PAGE electrophoresis. After purification, purified enzyme was characterized against several enzymes inhibitors such as temperature, NaCl, pH, metal and surfactants. Pure enzyme was highly active over broad temperature (50-70°C, NaCl concentration (0.5-4 M, and pH (6-10 ranges, indicating it’s a thermoactive and alkali-stable nature. Moreover, CaCl2, MnCl2, =-mercaptoethanol were found to stimulate the amylase activity, whereas FeCl3, sodium dodecyl sulfate (SDS, CuCl3 and ethylenediaminetetraacetic acid (EDTA strongly inhibited the enzyme. Moreover, enzyme specificity and thermal stability conformed by degradation of different soluble starch up to 55°C. Therefore, the present study proved that the extracellular alpha-amylase extracted through wheat flour residues by organism B. amyloliquefaciens MCCB0075, both have considerable potential for industrial application owing to its properties.

  16. Direct screening of libraries of yeast clones for alpha-amylase activity on raw starch hydrolysis.

    Science.gov (United States)

    Wong, Dominic W S; Batt, Sarah B; Lee, Charles C; Robertson, George H

    2003-10-01

    High-throughput screening for high-activity barley alpha-amylase mutants expressed in Saccharomyces cerevisiae is hampered by the interference of reducing agents, particularly the glucose used in yeast growth media. The present investigation employed colorimetric and chemiluminescent detection systems that enable direct and rapid screening of activities on raw starch substrate. Active clones could be separated into two groups, based on high total activity or high specific activity.

  17. Evaluation of Traditional Indian Antidiabetic Medicinal Plants for Human Pancreatic Amylase Inhibitory Effect In Vitro

    Directory of Open Access Journals (Sweden)

    Sudha Ponnusamy

    2011-01-01

    Full Text Available Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post prandial hyperglycemia via control of starch breakdown. Eleven Ayurvedic Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evaluate their inhibitory potential on pancreatic α-amylase. Analysis of 91 extracts, showed that 10 exhibited strong Human Pancreatic Amylase (HPA inhibitory potential. Of these, 6 extracts showed concentration dependent inhibition with IC50 values, namely, cold and hot water extracts from Ficus bengalensis bark (4.4 and 125 μgmL-1, Syzygium cumini seeds (42.1 and 4.1 μgmL-1, isopropanol extracts of Cinnamomum verum leaves (1.0 μgmL-1 and Curcuma longa rhizome (0.16 μgmL-1. The other 4 extracts exhibited concentration independent inhibition, namely, methanol extract of Bixa orellana leaves (49 μgmL-1, isopropanol extract from Murraya koenigii leaves (127 μgmL-1, acetone extracts from C. longa rhizome (7.4 μgmL-1 and Tribulus terrestris seeds (511 μgmL-1. Thus, the probable mechanism of action of the above fractions is due to their inhibitory action on HPA, thereby reducing the rate of starch hydrolysis leading to lowered glucose levels. Phytochemical analysis revealed the presence of alkaloids, proteins, tannins, cardiac glycosides, flavonoids, saponins and steroids as probable inhibitory compounds.

  18. Structural and regulatory differences in amylase isoenzymes in germinating Brazilian barley cultivars

    Directory of Open Access Journals (Sweden)

    Georg-Kraemer J.E.

    2003-01-01

    Full Text Available The amylase electrophoretic patterns of 10 Brazilian brewing-barley varieties with different malting grades and diastatic power were analyzed during the 7-day germination which occurs during the malting process. Intra and inter-variety genetic variability was observed at both the structural and regulatory level. In the first few days after germination all varieties showed a few active loci, all of them with low activity. In subsequent days, new loci became active and those already detected since early germination showed increased activity. All varieties showed a continuous increase in amylase synthesis until the 3rd and/or 4th day after germination. Some varieties maintained high amylase activity until the last day of germination, while others showed a decrease in activity on the 5th or 6th day. No specific band increased or decreased its intensity independently of the others. A total of 14 loci were detected, out of which only one locus was polymorphic, indicating very low structural genetic variability, with only 2.8% polymorphic loci, an average of 1.04 alleles per loci, and an average expected heterozygosity of only 0.7%. The mean intra-variety Jaccard similarity coefficient complement (1 - S J was 0.009. The mean intra-variety difference based on regulatory differences was higher (1 - S J = 0.17 than that obtained based on structural differences, suggesting differential gene activation. Inter-variety differentiation also showed low structural variability, with 1 - S J = 0.026 and a Nei genetic distance (D value of 0.0076, and a remarkable increase in divergence caused by differential gene activation (1 - S J = 0.34. These results indicate that regulatory polymorphism is the principal agent responsible for amylase variability in the barley varieties analyzed.

  19. Modification of the activity of an a-amylase from Bacillus licheniformis by several surfactants

    OpenAIRE

    2006-01-01

    The influence of different commercial surfactants on the enzymatic activity of a commercial ??-amylase from Bacillus licheniformis (Termamyl 300 L) has been studied. As non-ionic surfactants, alkyl polyglycosides (Glucopon?? 215, Glucopon?? 600 and Glucopon?? 650) were studied, as were fatty alcohol ethoxylates (Findet 1214N/23 and Findet 10/15), and nonyl phenol ethoxylate (Findet 9Q/21.5NF). Also, an anionic surfactant, linear alkyl benzene sulfonate (LAS) was assayed. In general, none of t...

  20. [Influence of amaranth on the production of alpha-amylase using Aspergillus niger NRRL 3112].

    Science.gov (United States)

    Mariani, D D; Lorda, G; Balatti, A P

    2000-01-01

    In this paper the influence of the amaranth seed meal and the aeration conditions on the alpha-amylase production by Aspergillus niger NRRL 3112 were studied. The assays of selection of culture medium were carried out in a rotary shaker at 250 rpm and 2.5 cm stroke. The aeration conditions were studied in a mechanically stirred fermentor New Brunswick type. A concentration of alpha-amylase of 2750 U.Dun/ml was achieved at 120 h with a dry weight of 8.0 g/l, using a base medium with 5.0 g/l Amaranthus cruentus seed meal. In the experiment performed in a New Brunswick fermentor, the highest value was 2806 U.Dun/ml. This result was obtained after 120 h, operating at 300 rpm and an airflow of 1 l/l. min. in a limited dissolved oxygen concentration. It was determined that the increase in the agitation rate was not favorable to the enzyme production, despite that an increase was verified in the dissolved oxygen. The morphology of the microorganism, in long and ramified hyphae, was the critical factor to obtain higher levels of alpha-amylase.

  1. Rice proteins, extracted by alkali and α-amylase, differently affect in vitro antioxidant activity.

    Science.gov (United States)

    Wang, Zhengxuan; Liu, Ye; Li, Hui; Yang, Lin

    2016-09-01

    Alkali treatment and α-amylase degradation are different processes for rice protein (RP) isolation. The major aim of this study was to determine the influence of two different extraction methods on the antioxidant capacities of RPA, extracted by alkaline (0.2% NaOH), and RPE, extracted by α-amylase, during in vitro digestion for 2h with pepsin and for 3h with pancreatin. Upon pepsin-pancreatin digestion, the protein hydrolysates (RPA-S, RPE-S), which were the supernatants in the absence of undigested residue, and the whole protein digests (RPA, RPE), in which undigested residue remained, were measured. RPE exhibited the stronger antioxidant responses to free radical scavenging activity, metal chelating activity, and reducing power, whereas the weakest antioxidant capacities were produced by RPE-S. In contrast, no significant differences in antioxidant activity were observed between RPA and RPA-S. The present study demonstrated that the in vitro antioxidant responses induced by the hydrolysates and the protein digests of RPs could be affected differently by alkali treatment and α-amylase degradation, suggesting that the extraction is a vital processing step to modify the antioxidant capacities of RPs. The results of the current study indicated that the protein digests, in which undigested residues remained, could exhibit more efficacious antioxidant activity compared to the hydrolysates.

  2. Effect of ultrasound on the activity and conformation of α-amylase, papain and pepsin.

    Science.gov (United States)

    Yu, Zhi-Long; Zeng, Wei-Cai; Zhang, Wen-Hua; Liao, Xue-Pin; Shi, Bi

    2014-05-01

    The effect of ultrasound on the activity of α-amylase, papain and pepsin was investigated and the mechanism of the effect was explored by determining their conformational changes. With the irradiation of power ultrasound, the activity of α-amylase and papain was inhibited, while the activity of pepsin was activated. According to the analysis of circular dichroism, Fourier transform infrared and fluorescence spectroscopy, the πo → π(∗) amide transitions and secondary structural components, especially β-sheet, of these three enzymes were significantly influenced by ultrasound. The tryptophan fluorescence intensity of the three enzymes was also observed to be affected by sonication. Furthermore, it was found that the pepsin molecule might gradually be resistant to prolonged ultrasonic treatment and recover from the ultrasound-induced damage to its original structure. The results suggested that the activity of α-amylase, papain and pepsin could be modified by ultrasonic treatment mainly due to the variation of their secondary and tertiary structures.

  3. Production and properties of alpha-amylase from Penicillium chrysogenum and its application in starch hydrolysis.

    Science.gov (United States)

    Balkan, Bilal; Ertan, Figen

    2005-01-01

    Fungi were screened for their ability to produce alpha-amylase by a plate culture method. Penicillium chrysogenum showed high enzymatic activity. Alpha-amylase production by P. chrysogenum cultivated in liquid media containing maltose (2%) reached its maximum at 6-8 days, at 30 degrees C, with a level of 155 U ml(-1). Some general properties of the enzyme were investigated. The optimum reaction pH and temperature were 5.0 and 30-40 degrees C, respectively. The enzyme was stable at a pH range from 5.0-6.0 and at 30 degrees C for 20 min and the enzyme's 92.1% activity's was retained at 40 degrees C for 20 min without substrate. Hydrolysis products of the enzyme were maltose, unidefined oligosaccharides, and a trace amount of glucose. Alpha-amylase of P. chrysogenum hydrolysed starches from different sources. The best hydrolysis was determined (98.69%) in soluble starch for 15 minute at 30 degrees C.

  4. Pea starch (Pisum sativum L.) with slow digestion property produced using β-amylase and transglucosidase.

    Science.gov (United States)

    Shi, Miaomiao; Zhang, Zhiheng; Yu, Shujuan; Wang, Kai; Gilbert, Robert G; Gao, Qunyu

    2014-12-01

    Starches extracted from wrinkled (WP) and smooth (SP) peas were treated using β-amylase (B) alone and also with a combination of β-amylase and transglucosidase (BT). After enzymatic treatment, the proportions of slowly digested starch in WP-B, WP-BT, SP-B and SP-BT samples were increased by 6%, 9%, 9% and 12%, respectively. Starches treated by a combination of β-amylase and transglucosidase exhibited a smaller amount of longer amylopectin chains, a larger amount of short amylopectin chains, and higher branching fraction. The branching fraction was significantly increased, with an increase of 8%, 10%, 13% and 14% for WP-B, WP-BT, SP-B and SP-BT, respectively. The maximum absorbance and iodine binding of enzyme-treated starches were reduced compared with their native starch parents. The C-type crystalline structure completely disappeared after enzymatic treatment. The results support previous findings that increases in the amount of shorter amylopectin chains and branch fraction are likely to contribute to the slow digestion of starch.

  5. High endogenous salivary amylase activity is associated with improved glycemic homeostasis following starch ingestion in adults.

    Science.gov (United States)

    Mandel, Abigail L; Breslin, Paul A S

    2012-05-01

    In the current study, we determined whether increased digestion of starch by high salivary amylase concentrations predicted postprandial blood glucose following starch ingestion. Healthy, nonobese individuals were prescreened for salivary amylase activity and classified as high (HA) or low amylase (LA) if their activity levels per minute fell 1 SD higher or lower than the group mean, respectively. Fasting HA (n = 7) and LA (n = 7) individuals participated in 2 sessions during which they ingested either a starch (experimental) or glucose solution (control) on separate days. Blood samples were collected before, during, and after the participants drank each solution. The samples were analyzed for plasma glucose and insulin concentrations as well as diploid AMY1 gene copy number. HA individuals had significantly more AMY1 gene copies within their genomes than did the LA individuals. We found that following starch ingestion, HA individuals had significantly lower postprandial blood glucose concentrations at 45, 60, and 75 min, as well as significantly lower AUC and peak blood glucose concentrations than the LA individuals. Plasma insulin concentrations in the HA group were significantly higher than baseline early in the testing session, whereas insulin concentrations in the LA group did not increase at this time. Following ingestion of the glucose solution, however, blood glucose and insulin concentrations did not differ between the groups. These observations are interpreted to suggest that HA individuals may be better adapted to ingest starches, whereas LA individuals may be at greater risk for insulin resistance and diabetes if chronically ingesting starch-rich diets.

  6. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    Science.gov (United States)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  7. Thermostable α-amylase immobilization: Enhanced stability and performance for starch biocatalysis.

    Science.gov (United States)

    Kumar, Gudi Satheesh; Rather, Gulam Mohmad; Gurramkonda, Chandrasekhar; Reddy, Bontha Rajasekhar

    2016-01-01

    The uses of thermostable starch hydrolytic biocatalysts are steadily increasing for the industrial application because of their obvious need for biocatalytic performance at elevated temperatures. The starch liquefaction and saccharification can be carried out simultaneously by the use of thermostable starch hydrolytic biocatalysts, thus minimizing the unit operations, time, and efforts. The cost factor hampers the industrialization of expensive soluble (free) enzymes for biocatalytic applications and the immobilization of enzymes offers promising alternative to the hurdle. The present investigation was aimed for immobilization of thermostable α-amylase using calcium alginate, and statistical optimization studies were carried out for enhanced biocatalytic performance. Initially, one-parameter at a time optimization studies were carried out for identification of significant factors influencing the immobilization. Furthermore, a statistical approach, response surface methodology, was applied for immobilization of α-amylase. The immobilized α-amylase in alginate microbeads showed enhanced stability to temperature and reusable property for up to seven cycles (with the retention of 50% initial activity). Finally, the kinetic behavior of free and immobilized enzyme showed the Km value of 1.2% and 2.6% (w/v) and Vmax of 1,020 and 1,030 U, respectively. Fifty percent reduction in affinity of the immobilized enzyme toward substrate was compensated by its longer stability.

  8. β-amylase-like proteins function as transcription factors in Arabidopsis, controlling shoot growth and development.

    Science.gov (United States)

    Reinhold, Heike; Soyk, Sebastian; Simková, Klára; Hostettler, Carmen; Marafino, John; Mainiero, Samantha; Vaughan, Cara K; Monroe, Jonathan D; Zeeman, Samuel C

    2011-04-01

    Plants contain β-amylase-like proteins (BAMs; enzymes usually associated with starch breakdown) present in the nucleus rather than targeted to the chloroplast. They possess BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains--also found in transcription factors mediating brassinosteroid (BR) responses. The two Arabidopsis thaliana BZR1-BAM proteins (BAM7 and BAM8) bind a cis-regulatory element that both contains a G box and resembles a BR-responsive element. In protoplast transactivation assays, these BZR1-BAMs activate gene expression. Structural modeling suggests that the BAM domain's glucan binding cleft is intact, but the recombinant proteins are at least 1000 times less active than chloroplastic β-amylases. Deregulation of BZR1-BAMs (the bam7bam8 double mutant and BAM8-overexpressing plants) causes altered leaf growth and development. Of the genes upregulated in plants overexpressing BAM8 and downregulated in bam7bam8 plants, many carry the cis-regulatory element in their promoters. Many genes that respond to BRs are inversely regulated by BZR1-BAMs. We propose a role for BZR1-BAMs in controlling plant growth and development through crosstalk with BR signaling. Furthermore, we speculate that BZR1-BAMs may transmit metabolic signals by binding a ligand in their BAM domain, although diurnal changes in the concentration of maltose, a candidate ligand produced by chloroplastic β-amylases, do not influence their transcription factor function.

  9. Overexpression of salivary-type amylase reduces the sensitivity to bortezomib in multiple myeloma cells.

    Science.gov (United States)

    Mizuno, Shohei; Hanamura, Ichiro; Ota, Akinobu; Karnan, Sivasundaram; Narita, Tomoko; Ri, Masaki; Mizutani, Motonori; Goto, Mineaki; Gotou, Mayuko; Tsunekawa, Norikazu; Shikami, Masato; Iida, Shinsuke; Hosokawa, Yoshitaka; Miwa, Hiroshi; Ueda, Ryuzo; Nitta, Masakazu; Takami, Akiyoshi

    2015-11-01

    Amylase-producing myeloma exhibits refractoriness to chemotherapy and a dismal prognosis. In this study, we established a human myeloma cell line, 8226/AMY1, in which a lentivirally transfected AMY1 gene was stably expressed and explored its biological characteristics. 8226/AMY1 showed a survival advantage over mock control when treated with dexamethasone, bortezomib, and lenalidomide in vitro partly through inhibition of apoptosis induced by these reagents. In a xenograft murine model, 8226/AMY1 showed rapid tumor growth and reduced sensitivity to bortezomib compared with mock. A microarray gene expression analysis identified TCL1A, which functions as a coactivator of the cell survival kinase Akt, differentially up-regulated in 8226/AMY1. The expression of phosphorylated Akt was increased in the 8226/AMY1 cells following bortezomib treatment, but not in the mock cells. In addition, treatment with perifosine, an inhibitor of Akt phosphorylation, enhanced the anti-myeloma effect of bortezomib in the 8226/AMY1 cells. Our data suggest that amylase-producing myeloma reduced the sensitivity to bortezomib in vitro and in vivo, and the up-regulation of TCL1A may influence the drug susceptibility of 8226/AMY1 via the phosphorylation of Akt. These findings provide clues for developing treatment approaches for not only amylase-producing myeloma, but also relapsed and refractory myelomas.

  10. Optimizing of the formation of active BMW-amylase after in vitro refolding.

    Science.gov (United States)

    Nasrollahi, Parisa; Khajeh, Khosro; Akbari, Neda

    2012-09-01

    This study was carried out to determine the optimal folding condition of α-amylase from Bacillus megaterium WHO using response surface methodology (RSM). A first-order model showed that three factors namely glycerol, Ca(2+) and protein concentration had the most significant effect on refolding. Analysis of the results showed that glycerol was better than the other polyols due to its effect on protein stability. Since α-amylases are known to contain calcium ions in their structure, the presence of calcium in the refolding buffer was compulsory. The concentration of protein had the most significant quadratic effect on the response studied. A second-order polynomial model was developed to quantify the relationships between variables. It was shown that the combination of 20%(v/v) glycerol, 25 mM Ca(2+) and 0.3 (mg/ml) protein was the most efficient condition for in vitro refolding of α-amylase. Under the optimal condition the yield of refolding was enhanced up to 7-fold. In order to analysis the size distribution in optimized and basic medium, dynamic light scattering (DLS) was fulfilled. The information gathered in this study showed that the use of solvent engineering and optimization procedure can be a general method for protein refolding.

  11. Heterologous Expression of Amylase Gene from Saccharomycopsis fibuligera in an Industrial Strain of Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    LIU Zeng-ran; ZHANG Guang-yi; LONG Zhang-fu; LIU Shi-gui

    2005-01-01

    An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligera and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 promoter and α-factor signal gene. The recombinant expression plasmid pLA8α was transformed into an industrial strain of Saccharomyces cerevisiae Sc-11. The activity of the α-amylase produced by the transformant Sc-11-pLA8α was 6.3 U/mL and the starch utilization rate in YPS medium was 42 %. The purified amylase was analyzed by SDS-PAGE,showing a molecular weight of 55×103 protein band. Furthermore, the residual sugar, ethanol and some volatile compounds in the fermented worts under simulating brewing conditions were determined by chromatographic analyses. The fermentation characteristics of Sc-11-pLA8α were similar to that of Sc-11 and only minor changes in the concentration of flavor compounds could be observed.

  12. Amylase clearance in differentiating acute pancreatitis from peptic ulcer with hyperamylasemia.

    Science.gov (United States)

    Warshaw, A L; Lesser, P B

    1975-03-01

    Thirty-four patients with abdominal pain, tenderness, and hyperamylasemia suggesting acute pancreatitis were studied prospectively to elucidate the relationship between peptic ulcer disease and pancreatitis. Confirming evidence of pancreatitis and/or ulcer was obtained either at laparotomy of by upper gastrointestinal roentgenograms. The presence or absence of pancreatitis was substantiated by measurement of the amylase/creatinine clearance ratio, which is significantly higher (p less than 0.001) in patients with acute pancreatitis (9.3 plus or minus 0.9), than in patients without pancreatitis (3.1 plus or minus 0.2). Nine of the 34 patients were found to have gastric or duodenal ulcers. However, seven of the nine, despite an elevated serum amylase, had no sign of pancreatitis at surgery, on radiological examination, or by elevation of the amylase/creatinine clearance ratio (3.1 plus or minus 0.4). It is suggested that hyperamylasemia associated with peptic ulcer disease is most often not indicative of acute pancreatitis and that treatment is most appropriately directed at the ulcer.

  13. Preparation of glucosamine by hydrolysis of chitosan with commercial α-amylase and glucoamylase

    Institute of Scientific and Technical Information of China (English)

    Sai-kun PAN; Sheng-jun WU; Jin-moon KIM

    2011-01-01

    Objective: In order to overcome the defects of chemical hydrolysis approach to prepare glucosamine,an enzymatic hydrolysis method was developed.Methods: Glucosamine was prepared by hydrolyzing chitosan,employing α-amylase initially,and subsequently,glucoamylase.Results: The optimal hydrolyzing conditions were as follows: reaction time,4 h; pH,5.0; temperature,50 ℃; and,α-amylase,80 U/g for the initial reaction.Subsequently,glucoamylase was added in the presence of a-amylase.The optimal reaction conditions were found to be: reaction time,8 h; pH,4.5; temperature,55 ℃; and,glucoamylase,4000 U/g.The hydrolysates were subject to filtrating,concentrating to about 20% (w/w),precipitating with five volumes of ethanol,and drying at 60 ℃ for 2 h.The content and the yield of glucosamine in the dried precipitate were 91.3% (w/w) and 86.2% (w/w),respectively.Conclusions:The method developed in this study is a promising option in the preparation of glucosamine.

  14. Purification and characterisation of a novel amylase enzyme from red pitaya (Hylocereus polyrhizus) peel.

    Science.gov (United States)

    Amid, Mehrnoush; Abd Manap, Mohd Yazid

    2014-12-15

    An amylase enzyme from pitaya peel was purified 234.2-folds with 72.1% recovery using ammonium sulphate precipitation, gel filtration and ion exchange chromatography. Gel filtration chromatography and SDS-PAGE revealed that the enzyme is monomeric with a molecular weight of 42.1kDa. The apparent Km and Vmax of the amylase were 2.7 mg/ml and 34.30 u/min/mg of protein, respectively. The enzyme was highly active and stable over a wide pH range from pH 3 to pH 11.0, with optimum activity being observed at pH 5.0. The enzyme was highly selective for soluble starch, amylopectin, glycogen and pulullan. The purified amylase did not require calcium and displayed extreme stability with regard to surfactants and oxidising agents. EDTA, a powerful chelating agent, did not have any significant effect on the stability of the enzyme. Such characteristics have not been previously reported for this type of enzyme from fruit peel. This enzyme, which possesses unique properties, could be widely used in different types of industries, especially in food and biotechnological applications.

  15. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    Science.gov (United States)

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  16. Amylase Crystalloids on Fine-Needle Aspiration of the Salivary Gland

    Directory of Open Access Journals (Sweden)

    İrem PAKER

    2010-05-01

    Full Text Available Amylase crystalloids is one of the several types of crystalline structures that can be seen in non-neoplastic and neoplastic salivary gland lesions. Here, a 60-year-old woman with an infraauricular mass existing for two years is presented.On ultrasound a cystic mass, 1 cm in diameter was detected in the tail of right parotid gland. Clear and mucoid fluid was obtained from the mass by fine-needle aspiration. Smears showed numerous rhomboid, rectangular or rod-shaped, non-birefringent crystalloid structures and a few acinar cell groups in a mucoid background rich in polymorphonuclear leucocytes and lymphoctes. It was reported as cystic sialadenitis with amylase crystalloids. In the four-month follow-up, there was no recurrence of the mass.Since encountered only in benign salivary gland lesions in the literature as in our case, observation of amylase crystalloids on fine-needle aspiration smears indicates a benign lesion and avoids unnecessary surgery.

  17. Kinetic and structural analysis of enzyme sliding on a substrate: multiple attack in beta-amylase.

    Science.gov (United States)

    Ishikawa, Kazuhiko; Nakatani, Hiroshi; Katsuya, Yoshio; Fukazawa, Chikafusa

    2007-01-23

    Beta-amylase (EC 3.2.1.2) is starch-hydrolyzing exo-type enzyme that can catalyze the successive liberation of beta-maltose from the nonreducing ends of alpha-1,4-linked glucopyranosyl polymers. There is a well-known phenomenon called multiple or repetitive attack where the enzyme releases several maltose molecules in a single enzyme-substrate complex. In order to understand it further, we examined the beta-amylase-catalyzed reaction using maltooligosaccharides. The Monte Carlo method was applied for simulation of the beta-amylase-catalyzed reaction including the multiple attack mechanism. Through site-directed mutagenesis, we have successfully prepared a mutant enzyme which may be simulated as a multiple attack action reduced one with retaining significant hydrolytic activity. From the results of X-ray structure analysis of the mutant enzyme, it was clarified that one carboxyl residue plays a very important role in the multiple attack. The multiple attack action needs the force of enzyme sliding on the substrate. In addition, it is important for the multiple attack that the enzyme and substrate have the characteristics of a stable productive substrate-enzyme complex through a hydrogen bond between the nonreducing end of the substrate and the carboxyl residue of the enzyme.

  18. Application of decolourized and partially purified polygalacturonase and α-amylase in apple juice clarification

    Science.gov (United States)

    Dey, Tapati Bhanja; Banerjee, Rintu

    2014-01-01

    Polygalacturonase and α-amylase play vital role in fruit juice industry. In the present study, polygalacturonase was produced by Aspergillus awamori Nakazawa MTCC 6652 utilizing apple pomace and mosambi orange (Citrus sinensis var mosambi) peels as solid substrate whereas, α-amylase was produced from A. oryzae (IFO-30103) using wheat bran by solid state fermentation (SSF) process. These carbohydrases were decolourized and purified 8.6-fold, 34.8-fold and 3.5-fold, respectively by activated charcoal powder in a single step with 65.1%, 69.8% and 60% recoveries, respectively. Apple juice was clarified by these decolourized and partially purified enzymes. In presence of 1% polygalacturonase from mosambi peels (9.87 U/mL) and 0.4% α-amylase (899 U/mL), maximum clarity (%T660nm = 97.0%) of juice was attained after 2 h of incubation at 50 °C in presence of 10 mM CaCl2. Total phenolic content of juice was reduced by 19.8% after clarification, yet with slightly higher %DPPH radical scavenging property. PMID:24948919

  19. Influence of gallic acid on α-amylase and α-glucosidase inhibitory properties of acarbose

    Directory of Open Access Journals (Sweden)

    Ganiyu Oboh

    2016-07-01

    Full Text Available Acarbose is an antidiabetic drug which acts by inhibiting α-amylase and α-glucosidase activities but with deleterious side effects. Gallic acid (GA is a phenolic acid that is widespread in plant foods. We therefore investigated the influence of GA on α-amylase and α-glucosidase inhibitory properties of acarbose (in vitro. Aqueous solutions of acarbose and GA were prepared to a final concentration of 25μM each. Thereafter, mixtures of the samples (50% acarbose + 50% GA; 75% acarbose+25% GA; and 25% acarbose+75% GA were prepared. The results revealed that the combination of 50% acarbose and 50% GA showed the highest α-glucosidase inhibitory effect, while 75% acarbose+25% GA showed the highest α-amylase inhibitory effect. Furthermore, all the samples caused the inhibition of Fe2+-induced lipid peroxidation (in vitro in rat pancreatic tissue homogenate, with the combination of 50% acarbose and 50% GA causing the highest inhibition. All the samples also showed antioxidant properties (reducing property, 2,2'-azino-bis (-3-ethylbenzthiazoline-6-sulphonate [ABTS*] and 1,1-diphenyl-2-picrylhydrazyl [DPPH] free radicals scavenging abilities, and Fe2+ chelating ability. Therefore, combinations of GA with acarbose could be employed as antidiabetic therapy, with a possible reduction of side effects of acarbose; nevertheless, the combination of 50% acarbose and 50% GA seems the best.

  20. Occurrence of an Affinity Site apart from the Active Site on the Raw-Starch-Digesting but Non-Raw-Starch-Adsorbable Bacillus subtilis 65 α-Amylase

    OpenAIRE

    Hayashida, Shinsaku; Teramoto, Yuji; Inoue, Takehiro; MITSUIKI, Shinji

    1990-01-01

    α-Cyclodextrin specifically inhibited raw starch digestion by Bacillus subtilis 65 α-amylase. The raw starch digestibility and α-cyclodextrin-Sepharose 6B adsorbability of this α-amylase were simultaneously lost when the specific domain corresponding to the affinity site essential for raw starch digestion was deleted by proteolysis. Occurrence of the affinity site on raw-starch-digesting enzymes was proven also with bacterial amylase.

  1. Significantly enhancing recombinant alkaline amylase production in Bacillus subtilis by integration of a novel mutagenesis-screening strategy with systems-level fermentation optimization

    OpenAIRE

    2016-01-01

    Background Alkaline amylase has significant potential for applications in the textile, paper and detergent industries, however, low yield of which cannot meet the requirement of industrial application. In this work, a novel ARTP mutagenesis-screening method and fermentation optimization strategies were used to significantly improve the expression level of recombinant alkaline amylase in B. subtilis 168. Results The activity of alkaline amylase in mutant B. subtilis 168 mut-16# strain was 1.34...

  2. Comparison of starch hydrolysis activity and thermal stability of two Bacillus licheniformis alpha-amylases and insights into engineering alpha-amylase variants active under acidic conditions.

    Science.gov (United States)

    Lee, Seunjae; Oneda, Hiroshi; Minoda, Masashi; Tanaka, Akiyoshi; Inouye, Kuniyo

    2006-06-01

    Bacillus licheniformis alpha-amylase (BLA) is widely used in various procedures of starch degradation in the food industry, and a BLA species with improved activity at higher temperature and under acidic conditions is desirable. Two BLA species, designated as PA and MA, have been isolated from the wild-type B. licheniformis strain and a mutant strain, respectively. In this study, their starch-hydrolysis activity and thermal stability were examined. MA showed higher activity than PA, especially at acidic pH (pH 5.0-5.5), and even after 1 h of treatment at 90 degrees C. MA was active in the range of pH 4.0-8.0, which is much wider than that (pH 4.5-7.5) of PA. It was shown that the proton dissociation constants on the acidic and alkaline sides (pKa1 and pKa2) were shifted to more acidic and basic values, respectively, by the mutation of PA to MA. The activation energy and thermodynamic parameters for their thermal inactivation indicate that MA is more thermally stable and catalytically active than PA, suggesting that MA could be useful for glucose-production process coupled with reactions catalyzed by beta-amylase.

  3. Influence of media composition on the production of alkaline α-amylase from Bacillus subtilis CB-18

    Directory of Open Access Journals (Sweden)

    Anthonia Odiase

    2012-09-01

    Full Text Available   Background. Starch, a homopolysaccharide is an important and an abundant food reserve and energy source. Starches are processed to yield different products which find many industrial applications. Alpha-amylases hydrolyze starch by cleaving α-1,4-glucosidic bonds and have been used in food, textile and pharmaceutical industries [Sun et al. 2010]. Enzymatic conversion of starch with amylase presents an economically superior alternative to the conventional method of starch gelatinization. Alkaline α-amylase has an important position in the global enzyme market as a constituent of detergent. In this paper, we screened soil bacteria and an isolate, alkalophilic Bacillus subtilis CB-18 was found to produce an alkaline α-amylase in different media. Material and methods. Screening of the isolates for amylolytic activity was carried out by growing bacteria isolated from the soil in starch agar plates and subsequently staining the plates with iodine solution to reveal zones of hydrolysis of starch. The selected isolate, Bacillus subtlis CB-18 was grown in different media at alkaline pH to evaluate the influence of media composition on alkaline α-amylase production. Enzyme assay was carried out by growing the culture in a broth medium and obtaining cell – free culture supernatant after centrifugation at 2515 × g for 15 minutes Amylase activity was determined by incubating 0.5 ml of crude enzyme solution in 0.1M Tris/HCl buffer (pH 8.5 with 0.5 ml of 1% soluble starch solution. The reaction was terminated by the addition of DNS reagent and reducing sugar produced from the amylolytic reaction was determined. Results. Bacillus subtilis CB-18 used for this work was selected because it produced 7 mm zone diameter on starch agar plate. This organism was cultured in different alkaline broth media containing 2% soluble starch as inducer carbohydrate for α-amylase production. Among the carbon sources used for enzyme production, sorbitol was the best to

  4. Solution structure of the main alpha-amylase inhibitor from amaranth seeds.

    Science.gov (United States)

    Martins, J C; Enassar, M; Willem, R; Wieruzeski, J M; Lippens, G; Wodak, S J

    2001-04-01

    The most abundant alpha-amylase inhibitor (AAI) present in the seeds of Amaranthus hypochondriacus, a variety of the Mexican crop plant amaranth, is the smallest polypeptide (32 residues) known to inhibit alpha-amylase activity of insect larvae while leaving that of mammals unaffected. In solution, 1H NMR reveals that AAI isolated from amaranth seeds adopts a major trans (70%) and minor cis (30%) conformation, resulting from slow cis-trans isomerization of the Val15-Pro16 peptide bond. Both solution structures have been determined using 2D 1H-NMR spectroscopy and XPLOR followed by restrained energy refinement in the consistent-valence force field. For the major isomer, a total of 563 distance restraints, including 55 medium-range and 173 long-range ones, were available from the NOESY spectra. This rather large number of constraints from a protein of such a small size results from a compact fold, imposed through three disulfide bridges arranged in a cysteine-knot motif. The structure of the minor cis isomer has also been determined using a smaller constraint set. It reveals a different backbone conformation in the Pro10-Pro20 segment, while preserving the overall global fold. The energy-refined ensemble of the major isomer, consisting of 20 low-energy conformers with an average backbone rmsd of 0.29 +/- 0.19 A and no violations larger than 0.4 A, represents a considerable improvement in precision over a previously reported and independently performed calculation on AAI obtained through solid-phase synthesis, which was determined with only half the number of medium-range and long-range restraints reported here, and featured the trans isomer only. The resulting differences in ensemble precision have been quantified locally and globally, indicating that, for regions of the backbone and a good fraction of the side chains, the conformation is better defined in the new solution structure. Structural comparison of the solution structure with the X-ray structure of the

  5. Effects of indomethacin suppositories on serum amylase, inflammatory factors and immune function after endoscopic retrograde cholangiopancreatography

    Institute of Scientific and Technical Information of China (English)

    Xiao-Bin Peng; Xiao-Yun Wang; Gao-Jue Wu; Zhen Hu; Shuang Tang; Lei Gong

    2016-01-01

    Objective:To explore the effects of indomethacin suppositories on serum amylase, inflammatory factors and immune function after endoscopic retrograde cholangiopancreatography (ERCP).Methods:A total of 85 patients with common bile duct stones or obstructive jaundice were divided into the observation group (n=45) and the control group (n=40) according to the different treatment methods, both two groups patients were treated with ERCP, patients in the observation group was given indomethacin suppositories 50 mg preoperative 30 min. Serum amylase, inflammatory factors and T cell subsets were detected preoperative, postoperative 6h and postoperative 24h. Inflammatory factors including interleukin -10 (IL-10), interleukin -6 (IL-6), tumor necrosis factor alpha (TNF-α) and interleukin-4 (IL-4). T cell subsets including CD3+, CD4+, CD8+ and calculated CD4+/CD8+.Results:In both two groups, postoperative 6h, 24h serum amylase were significantly higher than before surgery; in the observation group, the postoperative 6h, 24h serum amylase were significantly lower than in the control group at the same time point and the differences were statistically significant (P<0.05). Both two groups’ postoperative 6h, 24h serum pro-inflammatory factor IL-6 and TNF-α increased first and then decreased, both were significantly higher than before surgery; both two groups’ postoperative 6h, 24h serum anti-inflammatory factor IL-10 and IL-4 gradually increased, both were significantly higher than before surgery, and the differences were statistically significant (P<0.05); In the observation group, anti-inflammatory factor IL-10 and IL-4 significantly increased while pro-inflammatory factor IL-6 and TNF-α significantly decreased compared with the control group at the same time point 6h and 24h after surgery, the difference between the two groups was statistically significant (P<0.05). Both two groups’ postoperative 6h, 24h T cell subsets CD3+, CD4+, CD4+/CD8+first decreased and then

  6. Partial purification and characterization of {alpha}-amylases from one insecticide-resistant population of Sitophilus zeamais

    Energy Technology Data Exchange (ETDEWEB)

    Lopes, K.V.; Oliveira, M.G.A.; Paixao, G.P.; Visotto, L.E. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Bioquimica e Biologia Molecular; Veloso, R.V.S.; Marinho, J.S.; Guedes, R.N.C. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Quimica

    2008-07-01

    Full text: {alpha}-Amylases (EC 3.2.1.1) constitute a family of endo-amylases that catalyze the hydrolysis of a-D- (1,4)-glucan linkages in st ach components and various other related carbohydrates. They play a central role in carbohydrate metabolism of animals, plants and microorganisms. Many insects, especially those that feed on grain products during larval and/or adult life, depend on their amylases for survival. This is particularly true for the Sitophilus zeamais Motschulsky, a cosmopolitan pest of stored products. It is mainly controlled by insecticides. Amylases from adults of S.zeamais insecticide-resistant were purified by using a sequential procedure of glycogen-complex precipitation and ion exchange chromatography. Specific activity increased from 58,0454 AU/dL/mg protein in the crude homogenate to 2558,8720 AU/dL/mg protein in the final purified sample. Amylase unit (AU/dL) refers to the amount of amylase that hydrolysis 10 mg starch in 30 min at 37 deg C. The purified amylase ran as a single protein band on SDS-PAGE. From a plot of log molecular weight against relative mobility in 10% acrylamide gel, molecular weight was estimated to be 56 kDa. The enzyme had a K{sub m} of 0,2243 g/L for soluble starch and was most active at ph 5,0. The temperature of major activity was 40 deg C. The activity of enzyme was unaffected by presence or absence of Cl{sup -} and Ca{sup 2+}.

  7. Amylase addition increases starch ruminal digestion in first-lactation cows fed high and low starch diets.

    Science.gov (United States)

    Nozière, P; Steinberg, W; Silberberg, M; Morgavi, D P

    2014-01-01

    The objective of this study was to evaluate the effect of an exogenous amylase preparation on digestion of low- and high-starch diets in dairy cattle. Rumen and total-tract nutrient digestibility were measured in a 4×4 Latin square design with 28-d periods using 4 first-lactation cows cannulated at the rumen and duodenum. Corn silage-based diets had 20 or 30% starch, attained by changing the composition of concentrate, with or without addition of an exogenous amylase preparation. Effects of the enzyme additive were observed on ruminal digestibility but not at the total-tract level. Ruminal digestibility of starch increased from 75% in control to 81% with amylase supplementation. This difference in ruminal starch digestion was compensated postruminally, so that the total-tract digestibility of starch was almost complete and did not differ between treatments. The amylase supplement also increased the true ruminal digestibility of organic matter but did not affect microbial N flow to the duodenum. Amylase supplement reduced the proportion of acetate and butyrate and increased that of propionate, particularly in the high-starch diet, where it tended to increase the concentration of total volatile fatty acids in the rumen. Other effects were a higher amylase activity in the solid-associated microbial community and a tendency for lower numbers of protozoa. In contrast, we observed no changes in intake, production, dry matter and fiber (neutral detergent fiber and acid detergent fiber) digestibility, or ruminal digestion, and no or small changes on selected fibrolytic and amylolytic bacteria and on the microbial community in general. We conclude that the exogenous amylase improved starch digestion in the rumen in first-lactation cows with moderate intake and production levels.

  8. Studies on Amylase and Degradation of Starch and Pigment of Tobacco Leaf During Process of Flue-Curing

    Institute of Scientific and Technical Information of China (English)

    GONG Chang-rong; YUAN Hong-tao; CHEN Jiang-hua; SONG Zhao-peng

    2004-01-01

    The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric heated flue-curing barn designed and made by the Henan Agricultural University. The temperature and humidity of the barn were controlled automatically. The results indicated that starch in tobacco leaf decreased rapidly and leveled off after 48h of curring, in the meantime, the content of soluble sugar increased accordingly and reached a peak at the stage of color-fixing. Both of them had a rapid-changing stage in the first 36 hours of yellowing. The changes of starch and soluble sugar contents had highly significantnegative-correlation at 1% level (rNCc89=-0.8962**, RYY85=-0.9704**). The activity of amylase increased with the proceeding of curing and reached a peak after 36 hours of curing, then decreased. But the activity of amylase kept at a high level when the humidity of curing-environment was very iow, even if the tobacco leaf had been dried. The rapid degradation of starch showed a significantly negative correlation with the increase of activity of amylase at 5% level (rNC89=-0.8495*, RYY85=-0.7839*). The degradation of starch and pigment had the same regulation and had highly significant correlation at 1%level (rNC89=0.9649**, rYY85=0.9428**). There were mainly three amylase-isoenzyme bands -A, B, C respectively, in tobacco leaf during flue curing. They were identified as α -AMY, β -AMY, R-AMY, and the activity of β -AMY was the highest. The changes in amylase activity and contents of starch and pigment were affected by the tobacco leaf moisture and environmental humidity during curing.

  9. No effect of 5-fluorouracil on the properties of purified. cap alpha. -amylase from barley half-seeds

    Energy Technology Data Exchange (ETDEWEB)

    Rodaway, S.J.; Kende, H.

    1978-01-01

    Amylase has been purified from de-embryonated seeds of barley (Horedeum vulgare L. cv. Betzes) which have been incubated on 10/sup 6/M gibberellic acid (GA/sub 3/) following 3 days of imbibition in buffer. Incubation of the half-seeds in up to 10/sup -2/ M 5-fluorouracil (5-FU) during the entire incubation period, including imbibition, had no effect on any of the following characteristics of purified ..cap alpha..-amylase: thermal stability in the absence of calcium, molecular weight of the enzyme, isozyme composition, specific activity, or the amount of ..cap alpha..-amylase synthesized by the aleurone tissue. The synthesis of rRNA and tRNA was strongly inhibited by 5-FU, indicating that the analog had entered the aleurone cells. These results are not in agreement with those of Carlson (Nature New Biology 237: 39-41 (1972)) who found that treatment of barley aleurone with 10/sup -4/ M 5-FU to the addition of GA/sub 3/ resulted in decreased thermal stability of GA/sub 3/-induced ..cap alpha..-amylase and who interpreted this as evidence that the mRNA for ..cap alpha..-amylase was synthesized during the imbibition of the aleurone tissue and independently of gibberellin action. Results of the present experiments indicate that the thermal stability of highly purified ..cap alpha..-amylase is not altered by treatment of barley half-seeds with 5-FU, and that 5-FU cannot be used as a probe to examine the timing of ..cap alpha..-amylase mRNA synthesis.

  10. 利用α-淀粉酶和β-淀粉酶制备缓慢消化淀粉%Preparation of slowly digestible starch by α-amylase andβ-amylase

    Institute of Scientific and Technical Information of China (English)

    于国萍; 连莲

    2011-01-01

    Making normal corn starch as original material, SDS was prepared by α-amylase and β-amylase respectively. The orthogonal test optimal conditions were given as follows, α-amylase: pH 6.5, enzyme reaction time of 50 min, temperature 50 ℃, α-amylase 240 U; β-amylase: pH 7.0, enzyme reaction time of 60 min, temperature 40 ℃, β-amylase 500 U. Based on these conditions, starch products prepared using a-amylase and β-amylase showed yield of SDS by 7.11% and 10.12%. Although the optimum conditions of the two methods are similar, the products prepared using β-amylase with higher yield.%以普通玉米淀粉为原料,分别利用α-淀粉酶和β-淀粉酶制备缓慢消化淀粉(SDS),并通过正交试验优化了制备SDS的最佳工艺条件.通过正交试验确定α-淀粉酶法制备SDS的最佳条件为:pH 6.5,酶反应时间50min,温度50℃,α-淀粉酶用量240 U,在此条件下SDS最高产率为7.11%;通过正交试验确定β-淀粉酶法制备SDS的最佳务件为:pH 7.0,酶反应时间60 min,温度40℃,β-淀粉酶用量500 U,在此条件下SDS最高产率为10.12%.由于两种制备方法的最佳工艺条件差别不大,而β-淀粉酶法制备的产品产率较高.

  11. Secretion, purification, and characterisation of barley alpha-amylase produced by heterologous gene expression in Aspergillus niger.

    Science.gov (United States)

    Juge, N; Svensson, B; Williamson, G

    1998-04-01

    Efficient production of recombinant barley alpha-amylase has been achieved in Aspergillus niger. The cDNA encoding alpha-amylase isozyme 1 (AMY1) and its signal peptide was placed under the control of the Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter and the A. nidulans trpC gene terminator. Secretion yields up to 60 mg/l were obtained in media optimised for alpha-amylase activity and low protease activity. The recombinant AMY1 (reAMY1) was purified to homogeneity and found to be identical to native barley AMY1 with respect to size, pI, and immunoreactivity. N-terminal sequence analysis of the recombinant protein indicated that the endogenous plant signal peptide is correctly processed in A. niger. Electrospray ionisation/mass spectrometry gave a molecular mass for the dominant form of 44,960 Da, in accordance with the loss of the LQRS C-terminal residues; glycosylation apparently did not occur. The activities of recombinant and native barley alpha-amylases are very similar towards insoluble and soluble starch as well as 2-chloro-4-nitrophenol beta-D-maltoheptaoside and amylose (degree of polymerisation = 17). Barley alpha-amylase is the first plant protein efficiently secreted and correctly processed by A. niger using its own signal sequence.

  12. Microencapsulation of Purified Amylase Enzyme from Pitaya (Hylocereus polyrhizus Peel in Arabic Gum-Chitosan using Freeze Drying

    Directory of Open Access Journals (Sweden)

    Mehrnoush Amid

    2014-03-01

    Full Text Available Amylase is one of the most important enzymes in the world due to its wide application in various industries and biotechnological processes. In this study, amylase enzyme from Hylocereus polyrhizus was encapsulated for the first time in an Arabic gum-chitosan matrix using freeze drying. The encapsulated amylase retained complete biocatalytic activity and exhibited a shift in the optimum temperature and considerable increase in the pH and temperature stabilities compared to the free enzyme. Encapsulation of the enzyme protected the activity in the presence of ionic and non-ionic surfactants and oxidizing agents (H2O2 and enhanced the shelf life. The storage stability of amylase is found to markedly increase after immobilization and the freeze dried amylase exhibited maximum encapsulation efficiency value (96.2% after the encapsulation process. Therefore, the present study demonstrated that the encapsulation of the enzyme in a coating agent using freeze drying is an efficient method to keep the enzyme active and stable until required in industry.

  13. Evaluation of α-amylase inhibitory potential of three medicinally important traditional wild food plants of India

    Directory of Open Access Journals (Sweden)

    K.S.N Jyothi

    2011-01-01

    Full Text Available Naturally available α-amylase inhibitors from medicinally important plants are shown to be effective in managing postprandial hyperglycemia (PPHG which is of major concern in Type -2 diabetes. Three wild food plants namely Oxalis corniculata, Basella rubra , and Cocculus hirsutus with known traditional medicinal values were tested for α-amylase inhibition in order to evaluate their inhibitory potential on porcine pancreatic α-amylase. A total of 15 extracts obtained from three plants by aqueous and solvent extraction have been tested for their inhibitory potential against porcine pancreatic α-amylase. Of the fifteen extracts, five extracts showed concentration-dependent potent inhibition of >75% with IC50 (half maximal inhibitory concentration values much less than that of standard anti-diabetic drug acarbose namely aqueous extract of Oxalis corniculata 89.87% (100 μg/ml, IC 50 -68.08 0.06, chloroform, acetone and methanol extracts of Cocculus hirsutus exhibited 83.33% (60 μg/ml, IC 50 -70.48 18.39, 79.10% (100 μg/ml, IC 50 -80.77 0.63, 77.2% (100 μg/ml, IC 50 -80.11 2.23 respectively. The other extracts of the plants showed inhibition, but not statistically significant. Thus, these extracts showing potent inhibition might prove to be efficient sources for the extraction of natural α-amylase inhibitors.

  14. Enhanced production of α-amylase by Penicillium chrysogenum in liquid culture by modifying the process parameters.

    Science.gov (United States)

    Dar, Gowhar H; Kamili, Azra N; Nazir, Ruqeya; Bandh, Suhaib A; Jan, Tariq R; Chishti, Mohammad Z

    2015-11-01

    In this paper, we have assessed the role of changing physicochemical parameters and substrate types on the production of α-amylase enzyme from Penicillium chrysogenum, with a view to determining the optimal conditions required for its maximum production. The findings of this research revealed that, at pH 6 using linseed oil cake as substratum, α-amylase enzyme production was maximum (550.0 U/mL), when the fungi was incubated for 6 days at 30 °C in 0.1 M acetate buffer. Further, reasonably good production of the α-amylase enzyme was also observed at pH 9 with all the experimented carbon sources as substrates. Moreover, statistical analysis, using analysis of variance (ANOVA) carried out to study the impact of different studied parameters on the α-amylase enzyme production revealed that incubation period of 6-18 days is highly significant (p = 0.01) factor in amylotic activity of the P. chrysogenum. Under the researched out optimal conditions, P. chrysogenum is an economically viable option for the industrial and biotechnological production of α-amylase enzyme.

  15. Analysis of a preferential action of α-amylase from B. licheniformis towards amorphous regions of waxy maize starch.

    Science.gov (United States)

    Foresti, María Laura; Williams, María del Pilar; Martínez-García, Ricardo; Vázquez, Analía

    2014-02-15

    Waxy maize starch was subjected to α-amylase (Bacillus licheniformis) hydrolysis in buffered medium to determine the evolution of reaction in quantitative terms and also in terms of the morphology and crystallinity of the partially hydrolyzed starch granules. Gathered data allowed studying the pattern of action of this α-amylase over waxy maize starch granules, with particular focus on a preferential hydrolysis of the amorphous regions of starch. Results showed that waxy maize starch hydrolysis followed a two-stage kinetic profile with an initial stage characterized by high reaction rate, followed by a slower second stage. The change of hydrolysis rate occurred at approximately 6h of reaction, a time for which X-ray diffraction data quantitatively analyzed by three different techniques showed a maximum of crystallinity in partially hydrolyzed granules. Scanning electron microscopy images illustrated the action of α-amylases which implied the exoerosion of the granules surface, the entry of α-amylases into the granules through radial channels, their endoerosion towards the granule exterior, and their fragmentation. Fragmentation of waxy maize starch granules revealed internal layered structures of starch which were interpreted as hydrolyzed/non-hydrolyzed growth rings. Under the conditions chosen, kinetic, electron microscopy and X-ray data all gave evidence of a preferential action of α-amylase from Bacillus licheniformis towards the less ordered regions of waxy maize starch. Results showed that, provided the proper hydrolysis time is chosen, starch granules with increased crystallinity can be obtained by a pure enzymatic treatment.

  16. Characterization of a thermostable raw-starch hydrolyzing α-amylase from deep-sea thermophile Geobacillus sp.

    Science.gov (United States)

    Jiang, Tao; Cai, Menghao; Huang, Mengmeng; He, Hao; Lu, Jian; Zhou, Xiangshan; Zhang, Yuanxing

    2015-10-01

    A deep-sea thermophile, Geobacillus sp. 4j, was identified to grow on starch and produce thermostable amylase. N-terminally truncated form of Geobacillus sp. 4j α-amylase (Gs4j-amyA) was fused at its N-terminal end with the signal peptide of outer membrane protein A (OmpA) of Escherichia coli. The enzyme was over-expressed in E. coli BL21 with a maximum extracellular production of 130U/ml in shake flask. The yield of the transformant increased 22-fold as compared with that of the wild strain. The recombinant enzyme purified to apparent homogeneity by metal-affinity chromatography, exhibited a molecular mass of 62kDa. It displayed the maximal activity at 60-65°C and pH 5.5. Its half-life (t1/2) at 80°C was 4.25h with a temperature deactivation energy of 166.3kJ/mol. Compared to three commonly used commercial α-amylases, the Gs4j-amyA exhibited similar thermostable performance to BLA but better than BAA and BSA. It also showed a universally efficient raw starch hydrolysis performance superior to commercial α-amylases at an acidic pH approaching nature of starch slurry. As a new acidic-resistant thermostable α-amylase, it has the potential to bypass the industrial gelatinization step in raw starch hydrolysis.

  17. Amylase production by Saccharomycopsis fibuligera A11 in solid-state fermentation for hydrolysis of Cassava starch.

    Science.gov (United States)

    Chen, Lei; Chi, Zhen-Ming; Chi, Zhe; Li, Mei

    2010-09-01

    The optimization of process parameters for high amylase production by Saccharomycopsis fibuligera A11 in solid-state fermentation was carried out using central composite design. Finally, the optimal parameters obtained with the response surface methodology (RSM) were moisture 610.0 ml/kg, inoculum 30.0 ml (OD(600 nm) = 20.0)/kg, the amount ratio of wheat bran to rice husk 0.42, cassava starch concentration 20.0 g/kg, temperature 28 degrees C, and natural pH. Under the optimized conditions, 4,296 U/g of dry substrate of amylase activity was reached in the solid-state fermentation culture of the yeast strain A11 within 160 h, whereas the predicted maximum amylase activity of 4,222 U/g of dry substrate of amylase activity was derived from the RSM regression. It was found that cassava starch can be actively converted into monosaccharides and oligosaccharides by the crude amylase.

  18. An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment

    DEFF Research Database (Denmark)

    Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

    2015-01-01

    A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold......-adapted enzymes, as did comparison of the kinetic parameters Km and kcat to a mesophilic α-amylase. AmyI3C6 was shown to be heat-labile. Temperature optimum was at 10-15 °C, and more than 70 % of the relative activity was retained at 1 °C. The pH optimum of AmyI3C6 was at pH 8-9, and the enzyme displayed activity...... in two commercial detergents tested, suggesting that the AmyI3C6 α-amylase may be useful as a detergent enzyme in environmentally friendly, low-temperature laundry processes. © 2014 Springer-Verlag Berlin Heidelberg....

  19. Optimization of the production of extracellular α-amylase by Kluyveromyces marxianus IF0 0288 by response surface methodology

    Directory of Open Access Journals (Sweden)

    Panagiota-Yiolanda Stergiou

    2014-06-01

    Full Text Available The aim of this work was to study the production of extracellular α-amylase by Kluyveromyces marxianus IF0 0288 using optimized nutritional and cultural conditions in a complex yeast medium under aerobic batch fermentation. By applying the conventional "one-variable-at-a-time" approach and the response surface methodology, the effect of four fermentation parameters (type of carbon source, initial culture pH, temperature, and incubation time on the growth and α-amylase production was evaluated. The production of α-amylase during 60 h of fermentation increased 13-fold under optimized conditions (1% starch, pH 6.0, 30ºC in comparison to the conventional optimization method. The initial pH value of 6.13 and temperature of 30.3ºC were optimal conditions by the response surface methodology, leading to further improvement (up to 13-fold in the production of extracellular α-amylase. These results constituted first evidence that K. marxianus could be potentially used as an effective source of extracellular α-amylase.

  20. Enhanced production and characterization of a solvent stable amylase from solvent tolerant Bacillus tequilensis RG-01: thermostable and surfactant resistant.

    Science.gov (United States)

    Tiwari, Soni; Shukla, Neha; Mishra, Pooja; Gaur, Rajeeva

    2014-01-01

    Ten bacterial strains isolated from the soil samples in the presence of cyclohexane were screened for amylase production. Among them, culture RG-01 was adjudged as the best amylase producer and was identified as Bacillus tequilensis from MTCC, Chandigarh. The isolate showed maximum amylase production (8100 U/mL) in the presence of starch, peptone, and Ca(2+) ions at 55°C pH 7.0 within 24 h of incubation. The enzyme was stable in the presence of n-dodecane, isooctane, n-decane, xylene, toluene, n-hexane, n-butanol, and cyclohexane, respectively. The presence of benzene, methanol, and ethanol marginally reduced the amylase stability, respectively. The enzyme was showed it 100% activity at 55°C and pH 7.0 with 119% and 127% stability at 55°C and pH 7.0, respectively. The enzyme was also stable in the presence of SDS, Tween-40, Tween-60, and Tween-80 (1%) and was found stimulatory effect, respectively. Only Triton-X-100 showed a moderate inhibitory effect (5%) on amylase activity. This isolate (Bacillus tequilensis RG-01) may be useful in several industrial applications owing to its thermotolerant and organic solvents and surfactants resistance characteristics.

  1. Antibiofilm activity of α-amylase from Bacillus subtilis S8-18 against biofilm forming human bacterial pathogens.

    Science.gov (United States)

    Kalpana, Balu Jancy; Aarthy, Subramonian; Pandian, Shunmugiah Karutha

    2012-07-01

    The extracellular α-amylase enzyme from Bacillus subtilis S8-18 of marine origin was proved as an antibiofilm agent against methicillin-resistant Staphylococcus aureus (MRSA), a clinical strain isolated from pharyngitis patient, Vibrio cholerae also a clinical isolate from cholera patient and Pseudomonas aeruginosa ATCC10145. The spectrophotometric and microscopic investigations revealed the potential of α-amylase to inhibit biofilm formation in these pathogens. At its BIC level, the crude enzyme caused 51.81-73.07% of biofilm inhibition. Beyond the inhibition, the enzyme was also effective in degradation of preformed mature biofilm by disrupting the exopolysaccharide (EPS), an essential component in biofilm architecture. Furthermore, the enzyme purified to its homogeneity by chromatographic techniques was also effective in biofilm inhibition (43.83-61.68%) as well as in degradation of EPS. A commercial α-amylase enzyme from B. subtilis was also used for comparative purpose. Besides, the effect of various enzymes and temperature on the antibiofilm activity of amylase enzymes was also investigated. This study, for the first time, proved that α-amylase enzyme alone can be used to inhibit/disrupt the biofilms of V. cholerae and MRSA strains and beholds much promise in clinical applications.

  2. Acid diffusion into rice boluses is influenced by rice type, variety, and presence of α-amylase.

    Science.gov (United States)

    Mennah-Govela, Yamile A; Bornhorst, Gail M; Singh, R Paul

    2015-02-01

    Breakdown of rice during gastric digestion may be influenced by rice structure, presence of salivary α-amylase, and hydrolysis by gastric acid. During mastication, saliva is mixed with rice, allowing α-amylase to begin starch hydrolysis. This hydrolysis may continue in the gastric environment depending on the rate at which gastric acid penetrates into the rice bolus. The objective of this study was to determine the acid uptake into rice boluses with and without α-amylase in saliva. Two types each of brown and white rice (medium and long grain), were formed into a cylindrical-shaped bolus. Each bolus was sealed on all sides except one to allow one-dimensional mass transfer, and incubated by immersion in simulated gastric juice at 37 °C under static conditions. Acidity of the boluses was measured by titration after 1 to 96 h of incubation. Effective diffusivity of the gastric juice through the bolus was estimated using MATLAB. Average acidity values ranged from 0.04 mg HCl/g dry matter (medium grain white rice, no incubation) to 10.01 mg HCl/g dry matter (long-grain brown rice, 72 h incubation). The rice type, presence of α-amylase, and incubation time all significantly influenced rice bolus acidity (P starch hydrolysis by α-amylase may continue in the stomach before the gastric acid penetrates the rice bolus, and the rate of acid uptake will depend on the type of rice consumed.

  3. Microencapsulation of purified amylase enzyme from pitaya (Hylocereus polyrhizus) peel in Arabic gum-chitosan using freeze drying.

    Science.gov (United States)

    Amid, Mehrnoush; Manap, Yazid; Zohdi, Nor Khanani

    2014-03-24

    Amylase is one of the most important enzymes in the world due to its wide application in various industries and biotechnological processes. In this study, amylase enzyme from Hylocereus polyrhizus was encapsulated for the first time in an Arabic gum-chitosan matrix using freeze drying. The encapsulated amylase retained complete biocatalytic activity and exhibited a shift in the optimum temperature and considerable increase in the pH and temperature stabilities compared to the free enzyme. Encapsulation of the enzyme protected the activity in the presence of ionic and non-ionic surfactants and oxidizing agents (H₂O₂) and enhanced the shelf life. The storage stability of amylase is found to markedly increase after immobilization and the freeze dried amylase exhibited maximum encapsulation efficiency value (96.2%) after the encapsulation process. Therefore, the present study demonstrated that the encapsulation of the enzyme in a coating agent using freeze drying is an efficient method to keep the enzyme active and stable until required in industry.

  4. Β-amylase from starchless seeds of Trigonella foenum-graecum and its localization in germinating seeds.

    Directory of Open Access Journals (Sweden)

    Garima Srivastava

    Full Text Available Fenugreek (Trigonella foenum-graecum seeds do not contain starch as carbohydrate reserve. Synthesis of starch is initiated after germination. A β-amylase from ungerminated fenugreek seeds was purified to apparent electrophoretic homogeneity. The enzyme was purified 210 fold with specific activity of 732.59 units/mg. Mr of the denatured enzyme as determined from SDS-PAGE was 58 kD while that of native enzyme calculated from size exclusion chromatography was 56 kD. Furthermore, its identity was confirmed to be β-amylase from MALDI-TOF analysis. The optimum pH and temperature was found to be 5.0 and 50°C, respectively. Starch was hydrolyzed at highest rate and enzyme showed a Km of 1.58 mg/mL with it. Antibodies against purified Fenugreek β-amylase were generated in rabbits. These antibodies were used for localization of enzyme in the cotyledon during different stages of germination using fluorescence and confocal microscopy. Fenugreek β-amylase was found to be the major starch degrading enzyme depending on the high amount of enzyme present as compared to α-amylase and also its localization at the periphery of amyloplasts. A new finding in terms of its association with protophloem was observed. Thus, this enzyme appears to be important for germination of seeds.

  5. Β-amylase from starchless seeds of Trigonella foenum-graecum and its localization in germinating seeds.

    Science.gov (United States)

    Srivastava, Garima; Kayastha, Arvind M

    2014-01-01

    Fenugreek (Trigonella foenum-graecum) seeds do not contain starch as carbohydrate reserve. Synthesis of starch is initiated after germination. A β-amylase from ungerminated fenugreek seeds was purified to apparent electrophoretic homogeneity. The enzyme was purified 210 fold with specific activity of 732.59 units/mg. Mr of the denatured enzyme as determined from SDS-PAGE was 58 kD while that of native enzyme calculated from size exclusion chromatography was 56 kD. Furthermore, its identity was confirmed to be β-amylase from MALDI-TOF analysis. The optimum pH and temperature was found to be 5.0 and 50°C, respectively. Starch was hydrolyzed at highest rate and enzyme showed a Km of 1.58 mg/mL with it. Antibodies against purified Fenugreek β-amylase were generated in rabbits. These antibodies were used for localization of enzyme in the cotyledon during different stages of germination using fluorescence and confocal microscopy. Fenugreek β-amylase was found to be the major starch degrading enzyme depending on the high amount of enzyme present as compared to α-amylase and also its localization at the periphery of amyloplasts. A new finding in terms of its association with protophloem was observed. Thus, this enzyme appears to be important for germination of seeds.

  6. Structure of the bifunctional inhibitor of trypsin and alpha-amylase from ragi seeds at 2.2 A resolution.

    Science.gov (United States)

    Gourinath, S; Alam, N; Srinivasan, A; Betzel, C; Singh, T P

    2000-03-01

    The crystal structure of a bifunctional inhibitor of alpha-amylase and trypsin (RATI) from ragi seeds (Indian finger millet, Eleusine coracana Gaertneri) has been determined by X-ray diffraction at 2.2 A resolution. The inhibitor consists of 122 amino acids, with five disulfide bridges, and belongs to the plant alpha-amylase/trypsin inhibitor family. The crystals were grown by the microdialysis method using ammonium sulfate as a precipitating agent. The structure was determined by the molecular-replacement method using as models the structures of Corn Hageman factor inhibitor (CHFI) and of RATI at 2.9 A resolution determined previously. It has been refined to an R factor of 21.9%. The structure shows an r.m.s. deviation for C(alpha) atoms of 2.0 A compared with its own NMR structure, whereas the corresponding value compared with CHFI is found to be 1.4 A. The r.m.s. difference for C(alpha) atoms when compared with the same protein in the structure of the complex with alpha-amylase is 0.7 A. The conformations of trypsin-binding loop and the alpha-amylase-binding N-terminal region were also found to be similar in the crystal structures of native RATI and its complex with alpha-amylase. These regions differed considerably in the NMR structure.

  7. Enhanced Production and Characterization of a Solvent Stable Amylase from Solvent Tolerant Bacillus tequilensis RG-01: Thermostable and Surfactant Resistant

    Directory of Open Access Journals (Sweden)

    Soni Tiwari

    2014-01-01

    Full Text Available Ten bacterial strains isolated from the soil samples in the presence of cyclohexane were screened for amylase production. Among them, culture RG-01 was adjudged as the best amylase producer and was identified as Bacillus tequilensis from MTCC, Chandigarh. The isolate showed maximum amylase production (8100 U/mL in the presence of starch, peptone, and Ca2+ ions at 55°C pH 7.0 within 24 h of incubation. The enzyme was stable in the presence of n-dodecane, isooctane, n-decane, xylene, toluene, n-hexane, n-butanol, and cyclohexane, respectively. The presence of benzene, methanol, and ethanol marginally reduced the amylase stability, respectively. The enzyme was showed it 100% activity at 55°C and pH 7.0 with 119% and 127% stability at 55°C and pH 7.0, respectively. The enzyme was also stable in the presence of SDS, Tween-40, Tween-60, and Tween-80 (1% and was found stimulatory effect, respectively. Only Triton-X-100 showed a moderate inhibitory effect (5% on amylase activity. This isolate (Bacillus tequilensis RG-01 may be useful in several industrial applications owing to its thermotolerant and organic solvents and surfactants resistance characteristics.

  8. Heavy metal resistance of some thermophiles: potential use of alpha-amylase from Anoxybacillus amylolyticus as a microbial enzymatic bioassay.

    Science.gov (United States)

    Poli, Annarita; Salerno, Anna; Laezza, Giusi; di Donato, Paola; Dumontet, Stefano; Nicolaus, Barbara

    2009-03-01

    Six thermophilic extremophiles, Anoxybacillus amylolyticus, Geobacillus thermoleovorans, Geobacillus thermoleovorans subspecies stromboliensis, Geobacillus toebii subspecies decanicus, Bacillus thermantarcticus and Thermus oshimai, isolated from different environmental sites, were studied for their heavy metal resistance. The effects of heavy metals on microorganism growth were studied here in a pilot fermenter tank spiked with various trace metals, (Ni(2+), Zn(2+), Co(2+), Hg(2+), Mn(2+), Cr(6+), Cu(2+), Fe(3+) and Cd(2+)) at concentrations spanning from 0.01 to 20 mM. Trace metal toxicity varied depending on the species and metal considered. Among the tested microorganisms, attention was focused on alpha-amylase producing-A. amylolyticus, an acidothermophilic bacterium recently isolated from geothermal soil samples from Mount Rittmann in Antarctica. The effect of heavy metals on the biosynthesis and activity of alpha-amylase of A. amylolyticus was investigated. When bacteria were grown in the presence of heavy metals, a decrease in alpha-amylase activity, correlated with a decrease in alpha-amylase production, was observed, suggesting an effect on the biosynthesis of the enzyme. A decrease in enzyme activity was also noted when the assay was performed in the presence of heavy metals. Thus, alpha-amylase could represent a potential sensitive bioassay for detecting trace heavy metals.

  9. Inhibitory effect of leaf extract of Newbouldia laevis on the metabolic activities of alpha-glucosidase and alpha-amylase

    Directory of Open Access Journals (Sweden)

    Oyetunji T. Kolawole

    2013-12-01

    Full Text Available In this study, the effect of ethanol extract of the leaves of Newbouldia laevis on the activity of α-amylase and α-glucosidase was investigated. Inhibitory effect of N. laevis extract on α-glucosidase was tested in vitro using baker’s yeast α-glucosidase and rat intestinal α-glucosidase while α-amylase inhibitory effect was assayed using rat pancreatic α-amylase. α-Glucosidase inhibitory effect of the extract was also tested in vivo in diabetic and non-diabetic rats. N. laevis extract exhibited good α-glucosidase inhibitory activity in vitro with IC50 values of 2.2 µg/mL and 43.5 µg/mL for baker’s yeast and rat intestinal α-glucosidase respectively. The extract also inhibited rat pancreatic α-amylase activity with IC50 value of 58.7 µg/mL. In both diabetic and non-diabetic rats, N. laevis extract caused a significant reduction in postprandial blood glucose level after oral sucrose load. The results of this study indicate that N. laevis extract exerts its glucose-lowering effect through inhibition of α-glucosidase and α-amylase.

  10. In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

    Directory of Open Access Journals (Sweden)

    ERTUĞRUL FILIZ

    2014-04-01

    Full Text Available Beta-amylase (β-amylase, EC 3.2.1.2 is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

  11. Characterization of a Novel Maltose-Forming α-Amylase from Lactobacillus plantarum subsp. plantarum ST-III.

    Science.gov (United States)

    Jeon, Hye-Yeon; Kim, Na-Ri; Lee, Hye-Won; Choi, Hye-Jeong; Choung, Woo-Jae; Koo, Ye-Seul; Ko, Dam-Seul; Shim, Jae-Hoon

    2016-03-23

    A novel maltose (G2)-forming α-amylase from Lactobacillus plantarum subsp. plantarum ST-III was expressed in Escherichia coli and characterized. Analysis of conserved amino acid sequence alignments showed that L. plantarum maltose-producing α-amylase (LpMA) belongs to glycoside hydrolase family 13. The recombinant enzyme (LpMA) was a novel G2-producing α-amylase. The properties of purified LpMA were investigated following enzyme purification. LpMA exhibited optimal activity at 30 °C and pH 3.0. It produced only G2 from the hydrolysis of various substrates, including maltotriose (G3), maltopentaose (G5), maltosyl β-cyclodextrin (G2-β-CD), amylose, amylopectin, and starch. However, LpMA was unable to hydrolyze cyclodextrins. Reaction pattern analysis using 4-nitrophenyl-α-d-maltopentaoside (pNPG5) demonstrated that LpMA hydrolyzed pNPG5 from the nonreducing end, indicating that LpMA is an exotype α-amylase. Kinetic analysis revealed that LpMA had the highest catalytic efficiency (kcat/Km ratio) toward G2-β-CD. Compared with β-amylase, a well-known G2-producing enzyme, LpMA produced G2 more efficiently from liquefied corn starch due to its ability to hydrolyze G3.

  12. Raw starch-degrading alpha-amylase from Bacillus aquimaris MKSC 6.2 : isolation and expression of the gene, bioinformatics and biochemical characterization of the recombinant enzyme

    NARCIS (Netherlands)

    Puspasari, F.; Radjasa, O. K.; Noer, A. S.; Nurachman, Z.; Syah, Y. M.; van der Maarel, M.; Dijkhuizen, L.; Janecek, S.; Natalia, D.; Janeček, Š.

    2013-01-01

    Aims The aims were to isolate a raw starchdegrading a-amylase gene baqA from Bacillus aquimaris MKSC 6.2, and to characterize the gene product through in silico study and its expression in Escherichia coli. Methods and Results A 1539 complete open reading frame of a starchdegrading a-amylase gene ba

  13. Production of raw-starch-digesting α-amylase isoform from Bacillus sp. under solid-state fermentation and biochemical characterization.

    Science.gov (United States)

    Božić, Nataša; Slavić, Marinela Šokarda; Gavrilović, Anja; Vujčić, Zoran

    2014-07-01

    α-Amylase production by solid-state fermentation of different Bacillus sp. was studied previously on different fermentation media. However, no study has been reported on the influence of selected media on expression of desired amylase isoforms such as raw-starch-digesting amylase (RSDA). In this paper, the influence of different inexpensive and available agro-resources as solid media (corn, wheat and triticale) on α-amylase isoform induction from three wild-type Bacillus sp., selected among one hundred strains tested, namely 9B, 12B and 24A was investigated. For all three strains, tested amylases were detected in the multiple forms; however, number and intensity of each form differed depending on the solid media used for growth. To determine which isoform from Bacillus sp. 12B was RSDA, the suspected isoform was purified. The optimum pH for the purified α-amylase isoform was 6.0-8.0, while the optimum temperature was 60-90 °C. Isoform was considerably thermostable and Ca(2+)-independent, and actually the only α-amylase active towards raw starch. Purification and characterization of RSDA showed that not all of the solid media tested induced RSDA. From an economic point of view, it might be significant to obtain pure isoenzyme for potential use in the raw-starch hydrolysis, since it was 5 times more efficient in raw corn starch hydrolysis than the crude amylase preparation.

  14. Lactase persistence and augmented salivary alpha-amylase gene copy numbers might have been selected by the combined toxic effects of gluten and (food born) pathogens

    NARCIS (Netherlands)

    Pruimboom, Leo; Fox, Tom; Muskiet, Frits A. J.

    2014-01-01

    Various positively selected adaptations to new nutrients have been identified. Lactase persistence is among the best known, conferring the ability for drinking milk at post weaning age. An augmented number of amylase gene (AMY1) copies, giving rise to higher salivary amylase activity, has been impli

  15. In vitro investigations of α-amylase mediated hydrolysis of cyclodextrins in the presence of ibuprofen, flurbiprofen, or benzo[a]pyrene

    DEFF Research Database (Denmark)

    Riisager, Ludmilla Lumholdt; Holm, R.; Jørgensen, E. B.;

    2012-01-01

    In vitro studies of α-amylase degradation of α-, β- and γ-cyclodextrins and 2-hydroxypropyl-β- and -γ-cyclodextrins were investigated spectrophotometrically by measuring the formation of reducing sugars, the reaction products of α-amylase degradation. This was done to evaluate potential degradation...

  16. Alpha-amylase from germinating soybean (Glycine max) seeds--purification, characterization and sequential similarity of conserved and catalytic amino acid residues.

    Science.gov (United States)

    Kumari, Arpana; Singh, Vinay Kumar; Fitter, Jörg; Polen, Tino; Kayastha, Arvind M

    2010-10-01

    Starch hydrolyzing amylase from germinated soybeans seeds (Glycine max) has been purified 400-fold to electrophoretic homogeneity with a final specific activity of 384 units/mg. SDS-PAGE of the final preparation revealed a single protein band of 100 kDa, whereas molecular mass was determined to be 84 kDa by MALDI-TOF and gel filtration on Superdex-200 (FPLC). The enzyme exhibited maximum activity at pH 5.5 and a pI value of 4.85. The energy of activation was determined to be 6.09 kcal/mol in the temperature range 25-85 degrees C. Apparent Michaelis constant (K(m)((app))) for starch was 0.71 mg/mL and turnover number (k(cat)) was 280 s(-1) in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 85 degrees C showed first-order kinetics with rate constant (k) equal to 0.0063 min(-1). Soybean alpha-amylase showed high specificity for its primary substrate starch. High similarity of soybean alpha-amylase with known amylases suggests that this alpha-amylase belongs to glycosyl hydrolase family 13. Cereal alpha-amylases have gained importance due to their compatibility for biotechnological applications. Wide availability and easy purification protocol make soybean as an attractive alternative for plant alpha-amylase. Soybean can be used as commercially viable source of alpha-amylase for various industrial applications.

  17. Effect of introducing a disulphide bond between the A and C domains on the activity and stability of Saccharomycopsis fibuligera R64 α-amylase

    NARCIS (Netherlands)

    Natalia, Dessy; Vidilaseris, Keni; Ismaya, Wangsa T.; Puspasari, Fernita; Prawira, Iman; Hasan, Khomaini; Fibriansah, Guntur; Permentier, Hjalmar P; Nurachman, Zeily; Subroto, Toto; Dijkstra, Bauke W.; Soemitro, Soetijoso

    2014-01-01

    Native enzyme and a mutant containing an extra disulphide bridge of recombinant Saccharomycopsis fibuligera R64 α-amylase, designated as Sfamy01 and Sfamy02, respectively, have successfully been overexpressed in the yeast Pichia pastoris KM71H. The purified α-amylase variants demonstrated starch hyd

  18. Expression of the promoter for the maltogenic amylase gene in Bacillus subtilis 168.

    Science.gov (United States)

    Kim, Do-Yeon; Cha, Choon-Hwan; Oh, Wan-Seok; Yoon, Young-Jun; Kim, Jung-Wan

    2004-12-01

    An additional amylase, besides the typical alpha-amylase, was detected for the first time in the cytoplasm of B. subtilis SUH4-2, an isolate from Korean soil. The corresponding gene (bbmA) encoded a maltogenic amylase (MAase) and its sequence was almost identical to the yvdF gene of B. subtilis 168, whose function was unknown. Southern blot analysis using bbmA as the probe indicated that this gene was ubiquitous among various B. subtilis strains. In an effort to understand the physiological function of the bbmA gene in B. subtilis, the expression pattern of the gene was monitored by measuring the beta-galactosidase activity produced from the bbmA promoter fused to the amino terminus of the lacZ structural gene, which was then integrated into the amyE locus on the B. subtilis 168 chromosome. The promoter was induced during the mid-log phase and fully expressed at the early stationary phase in defined media containing beta-cyclodextrin (beta-CD), maltose, or starch. On the other hand, it was kept repressed in the presence of glucose, fructose, sucrose, or glycerol, suggesting that catabolite repression might be involved in the expression of the gene. Production of the beta-CD hydrolyzing activity was impaired by the spo0A mutation in B. subtilis 168, indicating the involvement of an additional regulatory system exerting control on the promoter. Inactivation of yvdF resulted in a significant decrease of the beta-CD hydrolyzing activity, if not all. This result implied the presence of an additional enzyme(s) that is capable of hydrolyzing beta-CD in B. subtilis 168. Based on the results, MAase encoded by bbmA is likely to be involved in maltose and beta-CD utilization when other sugars, which are readily usable as an energy source, are not available during the stationary phase.

  19. Properties and applications of starch-converting enzymes of the alpha-amylase family.

    Science.gov (United States)

    van der Maarel, Marc J E C; van der Veen, Bart; Uitdehaag, Joost C M; Leemhuis, Hans; Dijkhuizen, L

    2002-03-28

    Starch is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. A large-scale starch processing industry has emerged in the last century. In the past decades, we have seen a shift from the acid hydrolysis of starch to the use of starch-converting enzymes in the production of maltodextrin, modified starches, or glucose and fructose syrups. Currently, these enzymes comprise about 30% of the world's enzyme production. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-staling agents in baking. A number of these starch-converting enzymes belong to a single family: the alpha-amylase family or family13 glycosyl hydrolases. This group of enzymes share a number of common characteristics such as a (beta/alpha)(8) barrel structure, the hydrolysis or formation of glycosidic bonds in the alpha conformation, and a number of conserved amino acid residues in the active site. As many as 21 different reaction and product specificities are found in this family. Currently, 25 three-dimensional (3D) structures of a few members of the alpha-amylase family have been determined using protein crystallization and X-ray crystallography. These data in combination with site-directed mutagenesis studies have helped to better understand the interactions between the substrate or product molecule and the different amino acids found in and around the active site. This review illustrates the reaction and product diversity found within the alpha-amylase family, the mechanistic principles deduced from structure-function relationship structures, and the use of the enzymes of this family in industrial applications.

  20. Structural elements of thermostability in the maltogenic amylase of Geobacillus thermoleovorans.

    Science.gov (United States)

    Mehta, Deepika; Satyanarayana, T

    2015-08-01

    Maltogenic amylase of Geobacillus thermoleovorans (Gt-MamyIII), which has the highest thermostability among bacterial maltogenic amylases, has been used as a model enzyme to understand the role of networked salt bridges in thermoadaptation. The role of intra-chain cross-domain salt bridge networks in the thermostabilization of maltogenic amylase of G. thermoleovorans was confirmed by site-directed mutagenesis and CD analysis. The amino acid pairs in seven salt bridges have been mutated singly and pair-wise, and their free energy of thermal inactivation has been calculated. Among seven, single and double mutations in the amino acids corresponding to four salt bridges (lys306.glu336, arg403.asp65, arg497.glu523 and lys524.glu523) decrease T1/2 and Tm of Gt-MamyIII significantly. Moreover, glu523 forms networked salt bridges with arg497 and lys524. OE1 of glu523 forms electrostatic interactions with NH1 of arg497, NH2 of arg497 and NZ of lys524 at a distance of 2.33, 2.02 and 0.33Å, respectively. The mutations in three buried amino acids led to a decline in T1/2 and Tm. The buried as well as networked cross-domain salt bridges thus appear to play a significant role in the thermostabilization of Gt-MamyIII. The salt bridges lys306.glu336 and arg403.asp65, which are isolated and partially accessible, play a minor role in its thermostabilization.