Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Population structure of Salmonella investigated by amplified fragment length polymorphism
DEFF Research Database (Denmark)
Torpdahl, M.; Ahrens, Peter
2004-01-01
Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...
ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping
DEFF Research Database (Denmark)
Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir
2008-01-01
A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...
DEFF Research Database (Denmark)
Kokotovic, Branko; On, Stephen L.W.
1999-01-01
A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...
DEFF Research Database (Denmark)
Kokotovic, Branko; Angen, Øystein
2007-01-01
Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...
K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale
1994-01-01
A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa
2010-01-01
Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.
Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
DEFF Research Database (Denmark)
On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.
2004-01-01
Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...
DEFF Research Database (Denmark)
Møller, Kristian; Jensen, Tim Kåre; Boye, Mette
1999-01-01
Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...
[Recent advances of amplified fragment length polymorphism and its applications in forensic botany].
Li, Cheng-Tao; Li, Li
2008-10-01
Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.
DEFF Research Database (Denmark)
Kokotovic, Branko; Bolske, G.; Ahrens, Peter
2000-01-01
The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...
Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.
1999-01-01
The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...
Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P
2008-07-22
Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.
DEFF Research Database (Denmark)
Fearnley, C.; On, S.L.W.; Kokotovic, Branko
2005-01-01
An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...
Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.
Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F
2003-07-01
ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.
DEFF Research Database (Denmark)
Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko
2006-01-01
In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Ahrens, Peter
2002-01-01
, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.
2002-01-01
Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...
Brouat, C; McKey, D; Douzery, E J P
2004-05-01
Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.
Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.
2006-01-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...
International Nuclear Information System (INIS)
Zhao, B.; Zheng, X.Z.
2015-01-01
Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)
Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.
2002-01-01
The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...
Johnsen, G; Kruse, H; Hofshagen, M
2006-12-01
We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional
International Nuclear Information System (INIS)
Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.
2012-12-01
Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number
Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C
2015-12-02
Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.
Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel
2011-01-01
A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014
Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul
2001-01-01
Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.
Elsheikha, H M; Schott, H C; Mansfield, L S
2006-06-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.
DEFF Research Database (Denmark)
Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe
2005-01-01
subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
DEFF Research Database (Denmark)
Fry, N K; Bangsborg, Jette Marie; Bernander, S
2000-01-01
The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...
Directory of Open Access Journals (Sweden)
Kotoka Masuyama
Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.
Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W
1999-09-01
Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.
Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru
2017-01-01
Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096
Qiu, T; Jiang, L L; Yang, Y F
2016-08-19
The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.
Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.
2005-01-01
An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073
Al-Khalifah, Nasser S; Shanavaskhan, A E
2017-01-01
Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.
Directory of Open Access Journals (Sweden)
Lieschen De Vos
Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.
DEFF Research Database (Denmark)
Fry, N K; Bangsborg, Jette Marie; Bergmans, A
2002-01-01
The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....
Nie, H-T; Li, Q; Kong, L-F
2014-06-01
Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun
2006-07-01
The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
Directory of Open Access Journals (Sweden)
Emma Suryati
2013-03-01
Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.
García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A
2012-05-01
Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.
Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms
Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.
1987-01-01
DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers
DEFF Research Database (Denmark)
Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B
2000-01-01
are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...
Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei
2013-01-01
A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Application of amplified fragment length polymorphism (AFLPs) for ...
African Journals Online (AJOL)
Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)
1999-09-01
Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)
Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S
2003-02-01
ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.
Directory of Open Access Journals (Sweden)
Karlovsky Petr
2006-02-01
Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres
DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...
African Journals Online (AJOL)
We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...
Qu, Xinshun; Christ, Barbara J
2006-10-01
ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.
Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K
2002-04-01
The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.
Efficiency of random amplified polymorphic DNA (RAPD) and inter ...
African Journals Online (AJOL)
Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.
Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B
2006-03-01
Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.
Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.
2006-01-01
Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921
Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui
2017-01-01
Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.
Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O
2012-05-01
MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Hasnain Seyed E
2006-01-01
Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1989-01-01
The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Lari, Nicoletta; Cavallini, Michela; Rindi, Laura; Iona, Elisabetta; Fattorini, Lanfranco; Garzelli, Carlo
1998-01-01
All but 2 of 63 Mycobacterium avium isolates from distinct geographic areas of Italy exhibited markedly polymorphic, multibanded IS1245 restriction fragment length polymorphism (RFLP) patterns; 2 isolates showed the low-number banding pattern typical of bird isolates. By computer analysis, 41 distinct IS1245 patterns and 10 clusters of essentially identical strains were detected; 40% of the 63 isolates showed genetic relatedness, suggesting the existence of a predominant AIDS-associated IS1245 RFLP pattern. PMID:9817900
International Nuclear Information System (INIS)
Ali, M. S.; Latif, Z.
2016-01-01
Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)
Restriction fragment length polymorphism of the major histocompatibility complex of the dog.
Sarmiento, U M; Storb, R F
1988-01-01
Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.
Directory of Open Access Journals (Sweden)
Daniel W. H. Robarts
2014-07-01
Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R
2000-01-01
Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain
Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn
2013-09-27
Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan
2016-01-01
Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Robarts, Daniel W. H.; Wolfe, Andrea D.
2014-01-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637
Robarts, Daniel W H; Wolfe, Andrea D
2014-07-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1991-01-01
The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...
J. E. Davis; Thomas L. Kubisiak; M. G. Milgroom
2005-01-01
Studies on the population biology of the chestnut blight fungus, Cryphonectria parasitica, have previously been carried out with dominant restriction fragment length polymorphism (RFLP) fingerprinting markers. In this study, we described the development of 11 condominant markers from randomly amplified polymorphic DNAs (RAPDs). RAPD fragments were...
International Nuclear Information System (INIS)
Conn, V.
1987-01-01
The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale
1994-01-01
A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
Boyko, Alex; Kovalchuk, Igor
2010-01-01
Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.
DEFF Research Database (Denmark)
Colding, H; Hartzen, S H; Mohammadi, M
2003-01-01
Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....
Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl
2012-01-01
The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method âterminal restriction fragment length polymorphismâ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...
ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R
Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1990-01-01
The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...
Guevara, María Ángeles; de María, Nuria; Sáez-Laguna, Enrique; Vélez, María Dolores; Cervera, María Teresa; Cabezas, José Antonio
2017-01-01
Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is the methylation-sensitive amplified polymorphism technique (MSAP) which is a modification of amplified fragment length polymorphism (AFLP). It has been used to study methylation of anonymous CCGG sequences in different fungi, plants, and animal species. The main variation of this technique resides on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent-cutter restriction enzyme. For each sample, MSAP analysis is performed using both EcoRI/HpaII- and EcoRI/MspI-digested samples. A comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) methylation-insensitive polymorphisms that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples and (2) methylation-sensitive polymorphisms which are associated with the amplified fragments that differ in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses the modifications that can be applied to adjust the technology to different species of interest.
Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
owner
2011-05-09
May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.
Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun
2015-12-14
Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the
Calpastatin ( CAST ) gene polymorphism in Kajli, Lohi and Thalli ...
African Journals Online (AJOL)
Restriction fragment length polymorphisms (RFLPs) in the amplified fragments were studied using Msp1 restriction enzyme. Frequencies of MM, MN and NN genotypes were found to be 77, 20 and 3% in Lohi breed and 68, 26 and 6% in Kajli breed respectively. In Thalli sheep, only the MM (80%) and MN (20%) genotypes ...
Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats
DEFF Research Database (Denmark)
Kastern, W.; Dyrberg, T.; Scholler, J.
1984-01-01
DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...
Coolen, MJL; Post, E; Davis, CC; Forney, LJ
2005-01-01
To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the
DEFF Research Database (Denmark)
Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.
2000-01-01
A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick
2013-01-01
In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a
Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van
2013-01-01
In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a
Search for methylation-sensitive amplification polymorphisms in mutant figs
Rodrigues, M. G F; Martins, A. B G [UNESP; Bertoni, B. W.; Figueira, A.; Giuliatti, S.
2013-01-01
Fig (Ficus carica) breeding programs that use conventional approaches to develop new cultivars are rare, owing to limited genetic variability and the difficulty in obtaining plants via gamete fusion. Cytosine methylation in plants leads to gene repression, thereby affecting transcription without changing the DNA sequence. Previous studies using random amplification of polymorphic DNA and amplified fragment length polymorphism markers revealed no polymorphisms among select fig mutants that ori...
International Nuclear Information System (INIS)
Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.
1987-01-01
The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens
Barbara, D J; Morton, A; Spence, N J; Miller, A
1995-09-01
Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.
International Nuclear Information System (INIS)
Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.
2017-01-01
The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)
Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R
1999-12-01
A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.
Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L
2012-11-01
Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.
Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J
2016-10-01
Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.
AFLP genetic polymorphism in wild barley (Hordeum spontaneum) populations in Israel
Turpeinen, T.; Vanhala, T.; Nevo, E.; Nissila, E.
2003-01-01
The genetic diversity produced by the amplified fragment length polymorphism (AFLP) method was studied in 94 genotypes of wild barley, Hordeum spontaneum (C. Koch) Thell., originating from ten ecologically and geographically different locations in Israel. Eight primer pairs produced 204 discernible
International Nuclear Information System (INIS)
Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.
1990-01-01
The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome
Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji
2015-05-01
DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.
Gilbert (nee Stoker), G.; Garton, S.; Karam, A.; Arnold, M.; Karp, A.; Edwards, J.; Cooke, T.; Barker, A.
2002-05-01
Genetic diversity in 38 genotypes, representing 28 individual genotypes from five landraces of Isatis tinctoria (three German: Tubingen, Potsdam and Erfurt, one Swiss and one English), five genotypes of Isatis indigotica (Chinese woad) and five genotypes of Isatis glauca, were investigated using AFLP analysis. Five primer combinations detected a total of 502 fragments of which 436 (86.9%) were polymorphic. The level of polymorphism recorded within each species was 29.8, 86.9 and 35.8% for I. indigotica, I. tinctoria and I. glauca, respectively. Clearly, genetic diversity within I. tinctoria was greater than that observed in I. indigotica or I. glauca. Cluster analyses of the AFLP data using UPGMA and PCO revealed the complete separation of the genotypes of each species into distinct groups. I. indigotica separated as an entirely independent group, whereas I. glauca formed a separate cluster within the I. tinctoria group. Indeed, I. tinctoria and I. glauca are more closely related to each other than either is to I. indigotica. In addition, the genotypes of each landrace, apart from one from the English group, were clearly discriminated. However, the anomalous genotype did associate with the rest of its group when it was linked with the Erfurt group. These results provide new and useful information about the make-up of the Isatis genome, which has not previously been evaluated. They will be useful in the selection of plant material for variety development and conservation of the gene-pool.
Wolfe, C J; Haygood, M G
1991-08-01
Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi
2012-01-01
Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.
Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.
2001-01-01
Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647
International Nuclear Information System (INIS)
Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.
1988-01-01
The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site
Amplified fragment length polymorphism (AFLP) and genealogy ...
African Journals Online (AJOL)
STORAGESEVER
2010-06-07
Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...
Directory of Open Access Journals (Sweden)
Arihiro Shiozaki
Full Text Available Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP, we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group (n = 20, those who had preterm labor but delivered term babies (PTL group (n = 11, and those who had preterm birth (PTB group (n = 10. Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.
Shiozaki, Arihiro; Yoneda, Satoshi; Yoneda, Noriko; Yonezawa, Rika; Matsubayashi, Takamichi; Seo, Genichiro; Saito, Shigeru
2014-01-01
Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP), we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group) (n = 20), those who had preterm labor but delivered term babies (PTL group) (n = 11), and those who had preterm birth (PTB group) (n = 10). Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.
Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).
Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F
2006-01-01
Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.
Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van
2013-01-01
BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard
Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin
2015-01-01
Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A
Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick
2013-01-01
In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of
Andeer, Peter; Strand, Stuart E; Stahl, David A
2012-01-01
Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.
Conversion of the random amplified polymorphic DNA (RAPD ...
African Journals Online (AJOL)
Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.
Methylation sensitive-sequence related amplified polymorphism (MS ...
African Journals Online (AJOL)
DR NJ TONUKARI
2011-04-25
Apr 25, 2011 ... Sequence-related amplified polymorphism (SRAP) is a simple but an efficient gene amplification marker system for both .... Each polymorphic band reflecting different methylation status at the ... After boiling for 5 min in the water, the .... CpG dinucleotides in the open reading frame of a testicular germ cell-.
Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang
2014-10-21
Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.
Energy Technology Data Exchange (ETDEWEB)
Williams, S.D.
1989-01-01
Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.
International Nuclear Information System (INIS)
Williams, S.D.
1989-01-01
Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population
Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi
Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.
1999-01-01
Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224
Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines
International Nuclear Information System (INIS)
Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran
2006-01-01
Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
Yan, Guiping; Smiley, Richard W
2010-03-01
The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.
Amplified fragment length polymorphism (AFLP) studies on Indian ...
African Journals Online (AJOL)
Jane
2011-07-11
Jul 11, 2011 ... 2University School of Environment Management, Guru Gobind Singh Indraprastha University, New Delhi-100 075, India. Accepted 15 April .... Technologies following principle developed by Zabeau and Vos. (1993). Genomic ...
Zhang, J; Zhang, L G
2014-02-14
Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.
Amplifier channel for a fission fragment semiconductor detector
International Nuclear Information System (INIS)
Tyurin, G.P.
1981-01-01
To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru
Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.
1991-01-01
Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600
induced by cadmium using random amplified polymorphic DNA
African Journals Online (AJOL)
darya
2013-04-17
Apr 17, 2013 ... metallurgy, painting, plastic production, etc., and is being released into the biosphere, and ...... aquatic macrophytes: Random amplified polymorphic DNA analysis and identification of ... ecotoxicology. Toxicol. Ecotoxicol.
Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J
1990-01-01
The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680
Methylation sensitive amplified polymorphism (MSAP) reveals that ...
African Journals Online (AJOL)
ajl yemi
2011-12-19
Dec 19, 2011 ... Key words: Salt stress, alkali stress, Gossypium hirsutum L., DNA methylation, methylation sensitive amplified polymorphism (MSAP). INTRODUCTION. DNA methylation is one of the key epigenetic mecha- nisms among eukaryotes that can modulate gene expression without the changes of DNA sequence.
Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.
1992-01-01
A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261
Random amplified polymorphic DNA based genetic characterization ...
African Journals Online (AJOL)
Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...
International Nuclear Information System (INIS)
Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.
1987-01-01
The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia
Wood, S; Starr, T V; Shukin, R J
1986-01-01
We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
Directory of Open Access Journals (Sweden)
Azzedine Bounamous
2014-07-01
Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2000-01-01
Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.
Amplified Fragment Length Polymorphism of Puccinia graminis f. sp ...
African Journals Online (AJOL)
Keywords: AFLP, wheat, stem rust, genetic diversity, population differentiation ... the method described by Vos et al (1995), with little modification, i.e., 1 µl genomic ..... Agriculture, Veterinary Science, Nutrition and Natural Resources, 1, 1- 13.
Amplified fragment length polymorphism of Puccinia graminis f. sp ...
African Journals Online (AJOL)
The developed AFLP fingerprints for the Ethiopian Pgt isolates reported herein could support the breeding program to develop strategies for the deployment of resistance genes in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, genetic diversity, population ...
Molecular research on the genetic diversity of Tunisian date palm ...
African Journals Online (AJOL)
Molecular research on the genetic diversity of Tunisian date palm ( Phoenix dactylifera L.) using the random amplified microsatellite polymorphism (RAMPO) and amplified fragment length polymorphism (AFLP) methods.
Random amplified polymorphic DNA (RAPD) markers reveal genetic ...
African Journals Online (AJOL)
The present study evaluated genetic variability of superior bael genotypes collected from different parts of Andaman Islands, India using fruit characters and random amplified polymorphic DNA (RAPD) markers. Genomic DNA extracted from leaf material using cetyl trimethyl ammonium bromide (CTAB) method was ...
Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations
Directory of Open Access Journals (Sweden)
DiaS Edelberto S.
1998-01-01
Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.
International Nuclear Information System (INIS)
Alexander, A.J.; Bailey, E.; Woodward, J.G.
1986-01-01
Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family
W.W.J. van de Sande (Wendy); R.F.J. Gorkink (Raymond); G. Simons (Guus); A. Ott (Alewijn); A. Ahmed (Asif); H.A. Verbrugh (Henri); A.F. van Belkum (Alex)
2005-01-01
textabstractOne of the causative organisms of mycetoma is the fungus Madurella mycetomatis. Previously, extensive molecular typing studies identified Sudanese isolates of this fungus as clonal, but polymorphic genetic markers have not yet been identified. Here, we report on the selective
Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele
2009-11-01
A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.
Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin
2015-10-01
Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.
Detection of somaclonal variation by random amplified polymorphic ...
African Journals Online (AJOL)
Detection of somaclonal variation by random amplified polymorphic DNA analysis during micropropagation of Phalaenopsis bellina (Rchb.f.) Christenson. ... Among the primers used, P 16 produced the highest number of bands (29), while primer OPU 10 produced the lowest number (15). The range of similarity coefficient ...
Application of random amplified polymorphic DNA (RAPD) markers ...
African Journals Online (AJOL)
The random amplified polymorphic DNA (RAPD) technique has been widely applied to identify different varieties of plants for molecular breeding. However, application of RAPD markers to identify parthenogenesis in plants has not been reported. In this investigation, we used pedigree and RAPD markers to differentiate ...
( Quercus spp. ) using random amplified polymorphic DNA (RAPD)
African Journals Online (AJOL)
Quercus is one of the most important woody genera of the Northern hemisphere and considered as one of the main forest tree species in Iran. In this study, genetic relationships in the genus Quercus, using random amplified polymorphic DNA (RAPD) was examined. Five species, including: Quercus robur, Quercus ...
[Detection of UGT1A1*28 Polymorphism Using Fragment Analysis].
Huang, Ying; Su, Jian; Huang, Xiaosui; Lu, Danxia; Xie, Zhi; Yang, Suqing; Guo, Weibang; Lv, Zhiyi; Wu, Hongsui; Zhang, Xuchao
2017-12-20
Uridine-diphosphoglucuronosyl transferase 1A1 (UGT1A1), UGT1A1*28 polymorphism can reduce UGT1A1 enzymatic activity, which may lead to severe toxicities in patients who receive irinotecan. This study tries to build a fragment analysis method to detect UGT1A1*28 polymorphism. A total of 286 blood specimens from the lung cancer patients who were hospitalized in Guangdong General Hospital between April 2014 to May 2015 were detected UGT1A1*28 polymorphism by fragment analysis method. Comparing with Sanger sequencing, precision and accuracy of the fragment analysis method were 100%. Of the 286 patients, 236 (82.5% harbored TA6/6 genotype, 48 (16.8%) TA 6/7 genotype and 2 (0.7%) TA7/7 genotype. Our data suggest hat the fragment analysis method is robust for detecting UGT1A1*28 polymorphism in clinical practice. It's simple, time-saving, and easy-to-carry.
Search for methylation-sensitive amplification polymorphisms in mutant figs.
Rodrigues, M G F; Martins, A B G; Bertoni, B W; Figueira, A; Giuliatti, S
2013-07-08
Fig (Ficus carica) breeding programs that use conventional approaches to develop new cultivars are rare, owing to limited genetic variability and the difficulty in obtaining plants via gamete fusion. Cytosine methylation in plants leads to gene repression, thereby affecting transcription without changing the DNA sequence. Previous studies using random amplification of polymorphic DNA and amplified fragment length polymorphism markers revealed no polymorphisms among select fig mutants that originated from gamma-irradiated buds. Therefore, we conducted methylation-sensitive amplified polymorphism analysis to verify the existence of variability due to epigenetic DNA methylation among these mutant selections compared to the main cultivar 'Roxo-de-Valinhos'. Samples of genomic DNA were double-digested with either HpaII (methylation sensitive) or MspI (methylation insensitive) and with EcoRI. Fourteen primer combinations were tested, and on an average, non-methylated CCGG, symmetrically methylated CmCGG, and hemimethylated hmCCGG sites accounted for 87.9, 10.1, and 2.0%, respectively. MSAP analysis was effective in detecting differentially methylated sites in the genomic DNA of fig mutants, and methylation may be responsible for the phenotypic variation between treatments. Further analyses such as polymorphic DNA sequencing are necessary to validate these differences, standardize the regions of methylation, and analyze reads using bioinformatic tools.
Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah
2016-07-29
A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.
Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H
1998-02-01
A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.
Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying
2016-01-01
Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.
Directory of Open Access Journals (Sweden)
Xiaomei Xu
Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.
Tan, Ming-pu
2010-01-01
Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Diaz R
2001-01-01
Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.
DEFF Research Database (Denmark)
Priemé, Anders; Wolsing, Martin
2004-01-01
Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...
Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M
2006-05-01
The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic
Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S
2007-08-01
Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.
Riek, de J.; Everaert, I.; Esselink, D.; Calsyn, E.; Smulders, M.J.M.; Vosman, B.
2007-01-01
High genetic variation within sugar beet (Beta vulgaris L.) varieties hampers reliable classification procedures independent of the type of marker technique applied. Datasets on amplified fragment length polymorphisms, sequence tagged microsatellite sites, and cleaved amplified polymorphic sites
Jiao, J; Wu, J; Lv, Z; Sun, C; Gao, L; Yan, X; Cui, L; Tang, Z; Yan, B; Jia, Y
2015-11-26
This study aimed to investigate cytosine methylation profiles in different tobacco (Nicotiana tabacum) cultivars grown in China. Methylation-sensitive amplified polymorphism was used to analyze genome-wide global methylation profiles in four tobacco cultivars (Yunyan 85, NC89, K326, and Yunyan 87). Amplicons with methylated C motifs were cloned by reamplified polymerase chain reaction, sequenced, and analyzed. The results show that geographical location had a greater effect on methylation patterns in the tobacco genome than did sampling time. Analysis of the CG dinucleotide distribution in methylation-sensitive polymorphic restriction fragments suggested that a CpG dinucleotide cluster-enriched area is a possible site of cytosine methylation in the tobacco genome. The sequence alignments of the Nia1 gene (that encodes nitrate reductase) in Yunyan 87 in different regions indicate that a C-T transition might be responsible for the tobacco phenotype. T-C nucleotide replacement might also be responsible for the tobacco phenotype and may be influenced by geographical location.
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
International Nuclear Information System (INIS)
Wang Tiegu; Huang Qunce; Feng Weisen
2007-01-01
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
Wang, Tiegu; Huang, Qunce; Feng, Weisen
2007-10-01
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
Energy Technology Data Exchange (ETDEWEB)
Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)
2007-10-15
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.
Zhu, Yufeng; Yin, Yanfei; Yang, Keqiang; Li, Jihong; Sang, Yalin; Huang, Long; Fan, Shu
2015-08-18
Walnut (Juglans regia, 2n = 32, approximately 606 Mb per 1C genome) is an economically important tree crop. Resistance to anthracnose, caused by Colletotrichum gloeosporioides, is a major objective of walnut genetic improvement in China. The recently developed specific length amplified fragment sequencing (SLAF-seq) is an efficient strategy that can obtain large numbers of markers with sufficient sequence information to construct high-density genetic maps and permits detection of quantitative trait loci (QTLs) for molecular breeding. SLAF-seq generated 161.64 M paired-end reads. 153,820 SLAF markers were obtained, of which 49,174 were polymorphic. 13,635 polymorphic markers were sorted into five segregation types and 2,577 markers of them were used to construct genetic linkage maps: 2,395 of these fell into 16 linkage groups (LGs) for the female map, 448 markers for the male map, and 2,577 markers for the integrated map. Taking into account the size of all LGs, the marker coverage was 2,664.36 cM for the female map, 1,305.58 cM for the male map, and 2,457.82 cM for the integrated map. The average intervals between two adjacent mapped markers were 1.11 cM, 2.91 cM and 0.95 cM for three maps, respectively. 'SNP_only' markers accounted for 89.25% of the markers on the integrated map. Mapping markers contained 5,043 single nucleotide polymorphisms (SNPs) loci, which corresponded to two SNP loci per SLAF marker. According to the integrated map, we used interval mapping (Logarithm of odds, LOD > 3.0) to detect our quantitative trait. One QTL was detected for anthracnose resistance. The interval of this QTL ranged from 165.51 cM to 176.33 cM on LG14, and ten markers in this interval that were above the threshold value were considered to be linked markers to the anthracnose resistance trait. The phenotypic variance explained by each marker ranged from 16.2 to 19.9%, and their LOD scores varied from 3.22 to 4.04. High-density genetic maps for walnut containing 16
Essentials of Conservation Biotechnology: A mini review
Merlyn Keziah, S.; Subathra Devi, C.
2017-11-01
Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.
Directory of Open Access Journals (Sweden)
A.C. Panunto
2003-10-01
Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.
Directory of Open Access Journals (Sweden)
Sucik Maylinda
2015-04-01
Full Text Available Research with aim to estimate genetic polymorphism at ACACA (Acetyl-coenzyme A carboxylase locus in Ettawa Crossbred goat wan its relationship with production traits was done at goat population in Batu, Lawang and Ampel Gading. 46 female goats were taken it’s blood sample to isolate the DNA and continue with PCR (Polymerase Chain Reaction and RFLP (Restricted Fragment Length Polymorphism. PCR was used to amplify ACACA gene fragment in intron 3’ about 200 bp with primer F : 5’ – AGT GTA GAA GGG ACA GCC CAG C – 3’ and R : 5’ – GTG GAA TGA CAC ATG GAG AGG G – 3’; RFLP was used to test mutation of that fragment in particular place (point using restriction enzyme RSA1. Variables were alelles and genotypes composition in population, milk and fat content, and birth weight of kid. Result showed that (a genetic polymorphism at locus ACACA in three location was high that is 44,22 %, with allele frequency of G (p = 33 % and allele T (q = 67 %; (b no relationship between the high polymorphism with productive performance of goat in fat and protein content, and birth weight of kid. It was concluded that in goat population there was a high polymorphism at ACACA gene, and that polymorphism was not related to production.
Directory of Open Access Journals (Sweden)
Yan Liu
2011-09-01
Full Text Available We report the characterization of 16 polymorphic microsatellite markers in the golden apple snail, Pomacea canaliculata, a pest registered in the list of “100 of the world’s worst invasive alien species”. The fast isolation by AFLP (Amplified Fragment Length Polymorphism of sequences containing repeats (FIASCO method was used to isolate microsatellite loci, and polymorphism was explored with 29 individuals collected in an invasive region from China. These primers showed a number of alleles per locus ranging from three to 13. The ranges of observed and expected heterozygosity were 0.310–0.966 and 0.523–0.898, respectively. These microsatellite markers described here will be useful for population genetic studies of P. canaliculata.
Assessment of genetic diversity for some Iraqi date palms ( Phoenix ...
African Journals Online (AJOL)
Amplified fragment length polymorphisms (AFLP) were used to evaluate the genetic diversity between 18 date palm (Phoenix dactylifera L.) varieties (11 females and 7 males) collected from the center of Iraq. Six primer pairs were applied to detect polymorphism between varieties. A total of 83 polymorphic AFLP fragments ...
Lott, M J; Hose, G C; Power, M L
2014-09-01
Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Gusti Ngurah Permana
2016-11-01
The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Directory of Open Access Journals (Sweden)
Haiying Liu
2012-11-01
Full Text Available Insulin-like growth factor binding protein-3 (IGFBP-3 gene is important for regulation of growth and development in mammals. The present investigation was carried out to study DNA polymorphism by PCR-RFLP of IGFBP-3 gene and its effect on fibre traits of Chinese Inner Mongolian cashmere goats. The fibre traits data investigated were cashmere fibre diameter, combed cashmere weight, cashmere fibre length and guard hair length. Four hundred and forty-four animals were used to detect polymorphisms in the hircine IGFBP-3 gene. A 316-bp fragment of the IGFBP-3 gene in exon 2 was amplified and digested with HaeIII restriction enzyme. Three patterns of restriction fragments were observed in the populations. The frequency of AA, AB and BB genotypes was 0.58, 0.33 and 0.09 respectively. The allelic frequency of the A and B allele was 0.75 and 0.25 respectively. Nucleotide sequencing revealed a C>G transition in the exon 2 region of the IGFBP-3 gene resulting in R158G change which caused the polymorphism. Least squares analysis revealed a significant effect of genotypes on cashmere weight (p0.05. The animals of AB and BB genotypes showed higher cashmere weight, cashmere fibre length and hair length than the animals possessing AA genotype. These results suggested that polymorphisms in the hircine IGFBP-3 gene might be a potential molecular marker for cashmere weight in cashmere goats.
Directory of Open Access Journals (Sweden)
Muylaert An
2002-07-01
Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.
Directory of Open Access Journals (Sweden)
Roberto A. Caffaro-Filho
2007-12-01
Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.
Screening and characterization a RAPD marker of tobacco brown ...
African Journals Online (AJOL)
STORAGESEVER
2008-08-04
Aug 4, 2008 ... Random amplified DNA polymorphism of Nicotiana tabacum L. cultivars. Biologia Plantarum. 49: 605-607. Zhang HY, Liu XZ, Li TS, Yang YM (2006). Genetic diversity among flue- cured tobacco (Nicotiana tabacum L.) revealed by amplified fragment length polymorphism. Botanical Studies. 47: 223-229.
Growth Hormone Gene Polymorphism in Two Iranian Native Fowls (Short Communication
Directory of Open Access Journals (Sweden)
Jafari A
1999-11-01
Full Text Available Biochemical polymorphism study is a method of determination of genetic variation. This variability could be a basis for selection and subsequent genetic improvement in farm animals. The polymorphism in the intron 1 of chicken growth hormone (cGH gene was investigated in the Iranian native fowls by using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP method. The genomic DNA was extracted from 217 samples (129 samples from the native fowls of Isfahan province and 88 samples from the native fowls of Mazandaran province by using modified salting out technique. The DNA fragment of the growth hormone gene with 776 bp was amplified by PCR using specific primers. Then the PCR products were digested with MspI restriction enzyme and analyzed on 2.5% agarose gel. The allelic frequency of intron 1 locus for A1, A2 and A3 alleles in Isfahan native fowls were 0.60, 0.21 and 0.19 and those in Mazandaran native fowls were 0.28, 0.05 and 0.67, respectively. The results of current study indicated that the intron 1 of cGH is polymorphic in Iranian native fowls and could be exploited as a candidate gene for marker-assisted selection for growth-related traits.
How to interpret Methylation Sensitive Amplified Polymorphism (MSAP) profiles?
Fulneček, Jaroslav; Kovařík, Aleš
2014-01-01
Background DNA methylation plays a key role in development, contributes to genome stability, and may also respond to external factors supporting adaptation and evolution. To connect different types of stimuli with particular biological processes, identifying genome regions with altered 5-methylcytosine distribution at a genome-wide scale is important. Many researchers are using the simple, reliable, and relatively inexpensive Methylation Sensitive Amplified Polymorphism (MSAP) method that is ...
Jernberg, Cecilia; Sullivan, Asa; Edlund, Charlotta; Jansson, Janet K
2005-01-01
Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic.
1988-01-01
A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402
Directory of Open Access Journals (Sweden)
Seifu Gizaw Feyisa
2016-04-01
Full Text Available Abstract: INTRODUCTION Characterization of Mycobacterium tuberculosis (MTB isolates by DNA fingerprinting has contributed to tuberculosis (TB control. The aim of this study was to determine the genetic diversity of MTB isolates from Tehran province in Iran. METHODS MTB isolates from 60 Iranian and 10 Afghan TB patients were fingerprinted by standard IS6110-restriction fragment length polymorphism (RFLP analysis and spoligotyping. RESULTS The copy number of IS6110 ranged from 10-24 per isolate. The isolates were classified into 22 clusters showing ≥ 80% similarity by RFLP analysis. Fourteen multidrug-resistant (MDR isolates were grouped into 4 IS6110-RFLP clusters, with 10 isolates [71% (95% CI: 45-89%] in 1 cluster, suggesting a possible epidemiological linkage. Eighteen Iranian isolates showed ≥ 80% similarity with Afghan isolates. There were no strains with identical fingerprints. Spoligotyping of 70 isolates produced 23 distinct patterns. Sixty (85.7% isolates were grouped into 13 clusters, while the remaining 10 isolates (14.2% were not clustered. Ural (formerly Haarlem4 (n = 22, 31.4% was the most common family followed by Central Asian strain (CAS (n = 18, 25.7% and T (n = 9, 12.8% families. Only 1strain was characterized as having the Beijing genotype. Among 60 Iranian and 10 Afghan MTB isolates, 25% (95% CI: 16-37 and 70% (95% CI: 39-89 were categorized as Ural lineage, respectively. CONCLUSIONS A higher prevalence of Ural family MTB isolates among Afghan patients than among Iranian patients suggests the possible transmission of this lineage following the immigration of Afghans to Iran.
msap: a tool for the statistical analysis of methylation-sensitive amplified polymorphism data.
Pérez-Figueroa, A
2013-05-01
In this study msap, an R package which analyses methylation-sensitive amplified polymorphism (MSAP or MS-AFLP) data is presented. The program provides a deep analysis of epigenetic variation starting from a binary data matrix indicating the banding pattern between the isoesquizomeric endonucleases HpaII and MspI, with differential sensitivity to cytosine methylation. After comparing the restriction fragments, the program determines if each fragment is susceptible to methylation (representative of epigenetic variation) or if there is no evidence of methylation (representative of genetic variation). The package provides, in a user-friendly command line interface, a pipeline of different analyses of the variation (genetic and epigenetic) among user-defined groups of samples, as well as the classification of the methylation occurrences in those groups. Statistical testing provides support to the analyses. A comprehensive report of the analyses and several useful plots could help researchers to assess the epigenetic and genetic variation in their MSAP experiments. msap is downloadable from CRAN (http://cran.r-project.org/) and its own webpage (http://msap.r-forge.R-project.org/). The package is intended to be easy to use even for those people unfamiliar with the R command line environment. Advanced users may take advantage of the available source code to adapt msap to more complex analyses. © 2013 Blackwell Publishing Ltd.
An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments
Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.
2015-01-01
The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.
Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun
2009-03-01
Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.
Directory of Open Access Journals (Sweden)
Good Michael F
2005-10-01
Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.
Analysis of genetic diversity in pigeon pea germplasm using ...
Indian Academy of Sciences (India)
MANEESHA
2017-08-16
Aug 16, 2017 ... fied polymorphic DNA (RAPD), simple sequence repeats. (SSR), amplified fragment length polymorphism (AFLP), single-nucleotide polymorphisms (SNPs), diversity array technology (DArT), genic-simple sequence repeats (genic-. SSR) etc. (see review by Varshney et al. 2013). Since retrotransposons are ...
Directory of Open Access Journals (Sweden)
Zeyan Wu
Full Text Available Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF, coniferous forest (CF, subalpine dwarf forest (SDF and alpine meadow (AM were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC, total nitrogen (TN, total phosphorus (TP and total potassium (TK were positively correlated with the diversity of bacterial communities.
Association of transforming growth factor-ß3 gene polymorphism ...
African Journals Online (AJOL)
Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...
Directory of Open Access Journals (Sweden)
Zhao Jianjun
2011-02-01
Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.
Genetic variability of cultivated cowpea in Benin assessed by random amplified polymorphic DNA
Zannou, A.; Kossou, D.K.; Ahanchédé, A.; Zoundjihékpon, J.; Agbicodo, E.; Struik, P.C.; Sanni, A.
2008-01-01
Characterization of genetic diversity among cultivated cowpea [Vigna unguiculata (L.) Walp.] varieties is important to optimize the use of available genetic resources by farmers, local communities, researchers and breeders. Random amplified polymorphic DNA (RAPD) markers were used to evaluate the
Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng
2015-03-01
DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.
He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin
2003-06-01
Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.
Directory of Open Access Journals (Sweden)
Segurado Aluisio AC
2002-01-01
Full Text Available Although human T-lymphotropic virus type I (HTLV-I exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV, genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, using restricted fragment length polymorphism (RFLP analysis of long terminal repeat (LTR HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%, cosmopolitan C (7.1% and cosmopolitan E (3.6% subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.
DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...
African Journals Online (AJOL)
The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...
Directory of Open Access Journals (Sweden)
V. N. Muhasin Asaf
2014-10-01
Full Text Available Aim: The present study was undertaken to identify whether single nucleotide polymorphism (SNP rs109231409 located on mannose-binding lectins 1 (MBL1 gene was associated with mastitis tolerance/susceptibility. Materials and Methods: After grouping 100 Vrindavani crossbred cattle as mastitis positive and negative animals, they were genotyped using polymerase chain reaction (PCR-restriction fragment length polymorphisms method. Gene and genotype frequencies of different patterns were estimated by standard procedure (POPGENE version 1.32, (University of Alberta, Canada and statistical analysis was carried out by logistic regression methods using STATA 12 software (StataCorp LP, USA. Results: The 588 bp fragment of MBL1 gene was amplified using PCR. PCR product was digested with ApaI restriction enzyme showed two distinct genotypes viz., GG (311 bp and 272 bp fragments and GA (588 bp, 311 bp and 277 bp fragments. The gene, genotype frequencies, average heterozygosity, polymorphic information content and χ2 values for the locus rs109231409 was ascertained. Conclusions: No significant association between SNP “rs109231409” with mastitis tolerance was found. Although there is a lack of association, further studies have to be undertaken in a large population in order to validate the impact of rs109231409 (g.855G >A on mastitis tolerance.
Directory of Open Access Journals (Sweden)
KUSUMADEWI SRI YULITA
2011-07-01
Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.
Xiong, L Z; Xu, C G; Saghai Maroof, M A; Zhang, Q
1999-04-01
DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. In this study, we assessed the extent and pattern of cytosine methylation in the rice genome, using the technique of methylation-sensitive amplified polymorphism (MSAP), which is a modification of the amplified fragment length polymorphism (AFLP) method that makes use of the differential sensitivity of a pair of isoschizomers to cytosine methylation. The tissues assayed included seedlings and flag leaves of an elite rice hybrid, Shanyou 63, and the parental lines Zhenshan 97 and Minghui 63. In all, 1076 fragments, each representing a recognition site cleaved by either or both of the isoschizomers, were amplified using 16 pairs of selective primers. A total of 195 sites were found to be methylated at cytosines in one or both parents, and the two parents showed approximately the same overall degree of methylation (16.3%), as revealed by the incidence of differential digestion by the isoschizomers. Four classes of patterns were identified in a comparative assay of cytosine methylation in the parents and hybrid; increased methylation was detected in the hybrid compared to the parents at some of the recognition sites, while decreased methylation in the hybrid was detected at other sites. A small proportion of the sites was found to be differentially methylated in seedlings and flag leaves; DNA from young seedlings was methylated to a greater extent than that from flag leaves. Almost all of the methylation patterns detected by MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrate that the MSAP technique is highly efficient for large-scale detection of cytosine methylation in the rice genome. We believe that the technique can be adapted for use in other plant species.
Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.
Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P
2003-08-01
The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.
Genetic structure in cultivated and wild carrots (¤Daucus carota¤ L.) revealed by AFLP analysis
DEFF Research Database (Denmark)
Shim, S.I.; Bagger Jørgensen, Rikke
2000-01-01
Genetic variation within and among five Danish populations of wild carrot and five cultivated varieties was investigated using amplified fragment length polymorphism (AFLP). Ten AFLP primer combinations produced 116 polymorphic bands. Based on the marker data an UPGMA-cluster analysis and principal...
DEFF Research Database (Denmark)
Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.
2004-01-01
. Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...
Ginibun, F.C.; Bhassu, S.; Khalid, N.; Arens, P.; Vosman, B.; Othman, R.Y.
2015-01-01
Spathoglottis is a native terrestrial orchid that attracting horticultural interest as a landscaping plant. Distinguishing orchid at species level based on morphological characteristics is unconvincing as some characteristic may sensitive to environmental. Therefore, molecular characterization
Kanchanaketu, T; Sangduen, N; Toojinda, T; Hongtrakul, V
2012-04-13
Genetic analysis of 56 samples of Jatropha curcas L. collected from Thailand and other countries was performed using the methylation-sensitive amplification polymorphism (MSAP) technique. Nine primer combinations were used to generate MSAP fingerprints. When the data were interpreted as amplified fragment length polymorphism (AFLP) markers, 471 markers were scored. All 56 samples were classified into three major groups: γ-irradiated, non-toxic and toxic accessions. Genetic similarity among the samples was extremely high, ranging from 0.95 to 1.00, which indicated very low genetic diversity in this species. The MSAP fingerprint was further analyzed for DNA methylation polymorphisms. The results revealed differences in the DNA methylation level among the samples. However, the samples collected from saline areas and some species hybrids showed specific DNA methylation patterns. AFLP data were used, together with methylation-sensitive AFLP (MS-AFLP) data, to construct a phylogenetic tree, resulting in higher efficiency to distinguish the samples. This combined analysis separated samples previously grouped in the AFLP analysis. This analysis also distinguished some hybrids. Principal component analysis was also performed; the results confirmed the separation in the phylogenetic tree. Some polymorphic bands, involving both nucleotide and DNA methylation polymorphism, that differed between toxic and non-toxic samples were identified, cloned and sequenced. BLAST analysis of these fragments revealed differences in DNA methylation in some known genes and nucleotide polymorphism in chloroplast DNA. We conclude that MSAP is a powerful technique for the study of genetic diversity for organisms that have a narrow genetic base.
Genetic characterization of three varieties of Astragalus lentiginosus (Fabaceae).
Brian J. Knaus; Rich C. Cronn; Aaron. Liston
2005-01-01
Astragalus lentiginosus is a polymorphic species that occurs in geologically young habitats and whose varietal circumscription implies active morphological and genetic differentiation. In this preliminary study, we evaluate the potential of amplified fragment length polymorphism (AFLP) markers to resolve infraspecific taxa in three varieties of...
Directory of Open Access Journals (Sweden)
M. Jorjandi
2014-08-01
Full Text Available As an aim in sustainable agriculture, biological control of plant diseases has received intensive attention mainly as a response to public concern about the use of chemical fungicides in the environment. Soil Actinomycetes particularly Streptomyces spp. enhance soil fertility and have antagonistic activity against wide range of plant pathogens. To investigate for biocontrol means against the pathogen, 30 isolates of Actinomycetes have been isolated from agricultural soils of Kerman province of Iran and assayed for antagonistic activity against Botrytis allii, the agent of onion gray mold. RAPD DNA analysis has been used to determine the relatedness of active and non-active isolates based on their RAPD-PCR fingerprints. PCR amplifiable DNA samples have been isolated using the CTAB method and amplified fragments have been obtained from 5 random 10-mer primers. Different DNA fingerprinting patterns have been obtained for all of the isolates. Electrophoretic and cluster analysis of the amplification products has revealed incidence of polymorphism among the isolates. A total of 138 bands, ranging in size from 150-2800 bp, have been amplified from primers which 63.7% of the observed bands have been polymorphic. Genetic distances among different varieties have been analyzed with a UPGMA (Unweighted pair-group method, arithmetic average-derived dendrogram. Resulting dendrogram has showed from 0.65 to 0.91 similarities among varieties and divided the isolates into five major groups. Isolates which haven’t had any antagonistic activity against B. allii have been separated into a group and other isolates classified into four groups. The results indicate that RAPD is an efficient method for discriminating and studying genetic diversity of Streptomyces isolates.
Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy
2007-01-01
PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939
Wang, G.; van Dam, A. P.; Spanjaard, L.; Dankert, J.
1998-01-01
To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA
Analysis of DNA methylation variation in sibling tobacco ( Nicotiana ...
African Journals Online (AJOL)
Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) analysis were used to investigate the genome of two sibling tobacco cultivars, Yunyan85 and Yunyan87, their parent K326 and the other tobacco cultivar NC89. AFLP analysis indicated that, the genome primary ...
Testing independence of fragment lengths within VNTR loci
Energy Technology Data Exchange (ETDEWEB)
Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))
1993-11-01
Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.
DiBartolomeis, Susan M.
2011-01-01
Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104
International Nuclear Information System (INIS)
BIBI, S.; Khan, I.A.; Naqvi, M.H.; Siddiqui, M.A.; Yasmeen, S.; Seema, M.
2012-01-01
Twenty four wheat varieties/lines were assessed through RAPD for genetic diversity. Of forty primers, thirteen were able to amplify the genomic DNA and yielded 269 polymorphic bands. The percentage of the polymorphic loci was 86.22%. Nei's genetic diversity (h) ranged from 0.248 to 0.393, with an average of 0.330. Shanon's index ranged from 0.382 to 0.567, with an average of 0.487. The proportion of genetic variation among the populations ( Ds) accounted for 28.58 % of the whole genetic diversity. The level of gene flow (Nm) was 1.25. Some specific RAPD bands were also identified, variety C-591, and QM-4531 contain a specific segment of 4.9 kbp. Whereas SARC-1 and PKV-1600 amplified a specific DNA segment with primer A-09. Marvi-2000 contains two specific segments of 3.2 kb and 200 bp amplified with primer B-07. Genetically most similar genotypes were C-591 and Pasban-90 (76%) and most dissimilar genotypes were Rawal-87 and Khirman (36.1%). On the basis of results, 24 wheat varieties under study could be divided into 'two' groups and five clusters 'A' to 'E. (author)
International Nuclear Information System (INIS)
Kumar, S.V.; Tan, S.G.; Quah, S.C.
2000-01-01
A newly developed technique, Direct Amplification of Length Polymorphisms (DALP), developed by Desmarais and co-workers in 1998 was successfully used to identify and characterise new genetic markers in mungbean (Vigyia radiata). DALP uses an arbitrarily primed PCR (AP-PCR) to produce genomic fingerprints and is specifically designed to enable direct sequencing of polymorphic bands. In this study, an oligonucleotide pair DALP235 and DAPLR were tested on four varieties of mungbean (V3476, P4281, V5973 and V5784) and produced, through PCR, specific multibanded fingerprints which showed polymorphisms. These polymorphic bands are the result of length polymorphisms as well as absence and presence of bands. Some of the polymorphic zones may be codominantly inherited and may be potential microsatellites. The success of DALP in characterising new polymorphic loci and its ability to discover microsatellites without the use of priori knowledge of the mungbean genome is revolutionary. This would greatly facilitate the breeding and improvement of the crop. (author)
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
DEFF Research Database (Denmark)
Ellegaard-Jensen, Lea; Selck, Henriette; Priemé, Anders
2010-01-01
/without Capitella teleta (formerly Capitella sp. I)). Furthermore effects of AC on microbial respiration in the system were determined by examining CO(2) flux. T-RFLP (terminal restriction fragment length polymorphism) was used to analyze PCR (polymerase chain reaction) amplified 16S DNA gene fragments from...
Use of DNA markers in forest tree improvement research
D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall
1992-01-01
DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...
A comparative genetic diversity analysis in mungbean ( Vigna ...
African Journals Online (AJOL)
Amplified fragment length polymorphism (AFLP) and inter-simple sequence repeat (ISSR) markers were used to study the DNA polymorphism in elite mungbean genotypes. A total of nine AFLP primer combination and 22 ISSR primers were used. Amplification of genomic DNA of the 30 genotypes, using AFLP analysis, ...
Directory of Open Access Journals (Sweden)
Luciane Tieko Shinya
2006-09-01
Full Text Available Clostridium perfringens is an important pathogen in human and veterinary medicine. In swine, the agent is responsible for necrotic enteritis and enterotoxemia characterized by diarrhea, weight loss, delayed development and, in some cases, death. In the present study amplified fragment length polymorphism analyses (AFLP was used to characterize 54 C. perfringens strains isolated from swine presenting diarrhea. Analysis of the results showed 29 distinct profiles with discriminatory index equal to 0.97. Partial correlation between the origin of the isolates and groups was drawn, and correlation was possible in only 18.5% of the samples. Characterization of the strains in biotypes (A, B, C, D and E, production of beta-2 toxin and enterotoxin were performed by means of the polymerase chain reaction (PCR. Biotypes A, C and D were observed among the strains analyzed. All samples were positive for presence of the gene encoding beta-2 toxin and negative for the gene encoding enterotoxin. AFLP have shown to be a simple, fast, low cost method with high discriminative power and good reproducibility, presenting a great potential in epidemiological studies involving C. perfringens strains of animal origin.Clostridium perfringens é um importante agente infeccioso em medicina veterinária e humana. Em suínos, o agente é responsável pela enterite necrótica e enterotoxemia, caracterizadas por diarréia, perda de peso, atraso no desenvolvimento e morte. No presente estudo foi utilizado o polimorfismo do comprimento de fragmentos amplificados (AFLP, para caracterizar 54 isolados de C. perfringens obtidos de suínos com diarréia. A análise dos resultados do AFLP demonstrou 29 perfis distintos com índice discriminatório igual a 0,97. A correlação entre a origem dos isolados e os agrupamentos obtidos foi parcial, sendo apenas possível a correlação total de 18,5% das amostras estudadas. A caracterização das cepas em biotipos (A, B, C, D e E, produ
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
Association of genetic polymorphism in GH gene with milk ...
Indian Academy of Sciences (India)
Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...
Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study
Directory of Open Access Journals (Sweden)
Dalia Mohamed Ali
2016-06-01
Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji
1999-09-01
In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)
Bansal, N S; McDonell, F
1997-01-01
The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...
Directory of Open Access Journals (Sweden)
Aytül Sofu
2017-01-01
Full Text Available Lactic acid bacteria (LAB with different ecological niches are widely seen in fermented meat, vegetables, dairy products and cereals as well as in fermented beverages. Lactic acid bacteria are the most important group of bacteria in dairy industry due to their probiotic characteristics and fermentation agents as starter culture. In the taxonomy of the lactic acid bacteria; by means of rep-PCR, which is the analysis of repetitive sequences that are based on 16S ribosomal RNA (rRNA gene sequence, it is possible to conduct structural microbial community analyses such as Restriction Fragment Length Polymorphism (RFLP analysis of DNA fragments of different sizes cut with enzymes, Random Amplified Polymorphic DNA (RAPD polymorphic DNA amplified randomly at low temperatures and Amplified Fragment-Length Polymorphism (AFLP-PCR of cut genomic DNA. Besides, in the recent years, non-culture-based molecular methods such as Pulse Field Gel Electrophoresis (PFGE, Denaturing Gradient Gel Electrophoresis (DGGE, Thermal Gradient Gel Electrophoresis (TGGE, and Fluorescence In-situ Hybridization (FISH have replaced classical methods once used for the identification of LAB. Identification of lactic acid bacteria culture independent regardless of the method will be one of the most important methods used in the future pyrosequencing as a Next Generation Sequencing (NGS techniques. This paper reviews molecular-method based studies conducted on the identification of LAB species in dairy products.
Evaluation of insulin-like growth factor-I gene polymorphism in ...
African Journals Online (AJOL)
This study aimed to detect the genetic polymorphism of IGF-1 in different Egyptian sheep and goat breeds. The amplified fragments at 320-bp were digested with HaeIII endonuclease and the results show the presence of three different genotypes: CC (15.71%), CG (29.29%) and GG (55.0%). The nucleotide sequence ...
Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.
Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A
2009-07-01
Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.
Directory of Open Access Journals (Sweden)
Zhao Lingbo
2017-01-01
Full Text Available Novel fluorescent sequence-related amplified polymorphism (FSRAP markers were developed based on the SRAP molecular marker. Then, the FSRAP markers were used to construct the genetic map of a wheat (Triticum aestivumL. recombinant inbred line population derived from a Chuanmai 42×Chuannong 16 cross. Reproducibility and polymorphism tests indicated that the FSRAP markers have repeatability and better reflect the polymorphism of wheat varieties compared with SRAP markers. A total of 430 polymorphic loci between Chuanmai 42 and Chuannong 16 were detected with 189 FSRAP primer combinations. A total of 281 FSARP markers and 39 SSR markers re classified into 20 linkage groups. The maps spanned a total length of 2499.3cM with an average distance of 7.81cM between markers. A total of 201 markers were mapped on the B genome and covered a distance of 1013cM. On the A genome, 84 markers were mapped and covered a distance of 849.6cM. On the D genome, however, only 35 markers were mapped and covered a distance of 636.7cM. No FSRAP markers were distributed on the 7D chromosome. The results of the present study revealed that the novel FSRAP markers can be used to generate dense, uniform genetic maps of wheat.
Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu
2016-03-01
Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon.
Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco
2008-01-01
A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.
Sakcali, M Serdal; Kekec, Guzin; Uzonur, Irem; Alpsoy, Lokman; Tombuloglu, Huseyin
2015-08-01
This study was carried out to investigate the genotoxic effect of boron (B) on maize using randomly amplified polymorphic DNA (RAPD) method. Experimental design was conducted under 0, 5, 10, 25, 50, 100, 125, and 150 ppm B exposures, and physiological changes have revealed a sharp decrease in root growth rates from 28% to 85%, starting from 25 ppm to 150 ppm, respectively. RAPD-polymerase chain reaction (PCR) analysis shows that DNA alterations are clearly observed from beginning to 100 ppm. B-induced inhibition in root growth had a positive correlation with DNA alterations. Total soluble protein, root and stem lengths, and B content analysis in root and leaves encourage these results as a consequence. These preliminary findings reveal that B causes chromosomal aberration and genotoxic effects on maize. Meanwhile, usage of RAPD-PCR technique is a suitable biomarker to detect genotoxic effect of B on maize and other crops for the future. © The Author(s) 2013.
International Nuclear Information System (INIS)
Ammouneh, H.; Arabi, M.; Shoaib, A.
2011-01-01
Thirty Erwinia amylovora strains, collected from the main rosaceous crop-growing regions in Syria, were chosen as representatives of all major pathogenicity groups and were genetically studied by AFLP. Eight primer combinations were utilized and approximately 300 scorable bands in total were generated. Based on similarity coefficient, E. amylovora strains were placed into a main cluster containing two sub clusters, indicating very low genetic variations among the studied pathogen. The existence of two plasmids, pEA29 (present in nearly all E. amylovora isolates) and pEL60 (present mainly in Lebanese strains), was confirmed using multiplex PCR in all tested Syrian E. amylovora strains, indicating that Lebanese and Syrian isolates may share a common origin.(author)
Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael
We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To
Madode, Y.E.E.; Linnemann, A.R.; Nout, M.J.R.; Vosman, B.J.; Hounhouigan, D.J.; Boekel, van T.
2012-01-01
The genetic relationships among twenty phenotypically different cowpea landraces were unravelled regarding their suitability for preparing West African dishes. Amplified fragment length polymorphism classified unpigmented landraces (UPs) as highly similar (65%, one cluster), contrary to pigmented
Molecular diversity and genetic relationships in Secale
Indian Academy of Sciences (India)
2001); and molecular methods such as amplified fragment length polymorphism ... to the maintenance and rational use of germplasm resources in the improvement of ... study of diversity of ScMATE1 gene in different species of. Secale genus.
Molecular and genetic study of wheat rusts
African Journals Online (AJOL)
Nicholas Le Maitre
Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.
Czech Academy of Sciences Publication Activity Database
Mikulíček, Peter; Jandzik, D.; Fritz, U.; Schneider, C.; Široký, P.
2013-01-01
Roč. 108, č. 1 (2013), s. 151-160 ISSN 0024-4066 Institutional support: RVO:68081766 Keywords : Amplified fragment length polymorphism * morphological plasticity * reptiles * stabilizing selection * Testudines Subject RIV: EG - Zoology Impact factor: 2.535, year: 2013
Amplification of deoxyribonucleic acid (DNA) fragment using two ...
African Journals Online (AJOL)
user
2011-04-11
Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...
Directory of Open Access Journals (Sweden)
Phoebe A Chapman
Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to
Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A
2014-03-01
Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition
International Nuclear Information System (INIS)
Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.
1986-01-01
ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels
Czech Academy of Sciences Publication Activity Database
Boestfleisch, Ch.; Drotleff, A.M.; Ternes, W.; Nehring, S.; Pažoutová, Sylvie; Papenbrock, J.
2015-01-01
Roč. 141, č. 3 (2015), s. 445-461 ISSN 0929-1873 Institutional support: RVO:61388971 Keywords : Amplified fragment length polymorphism (AFLP) * Claviceps purpurea var. spartinae * Epimers Subject RIV: EE - Microbiology, Virology Impact factor: 1.494, year: 2015
Host- and tissue-specific pathogenic traits of Staphylococcus aureus.
W.B. van Leeuwen (Willem); D.C. Melles (Damian); A. Alaidan (Alwaleed); M. Al-Ahdal (Mohammed); H.A.M. Boelens (Hélène); S.V. Snijders (Susan); H.F.L. Wertheim (Heiman); E. van Duijkeren (Engeline); J.K. Peeters (Justine); P.J. van der Spek (Peter); R.F.J. Gorkink (Raymond); G. Simons (Guus); H.A. Verbrugh (Henri); A.F. van Belkum (Alex)
2005-01-01
textabstractComparative genomics were used to assess genetic differences between Staphylococcus aureus strains derived from infected animals versus colonized or infected humans. A total of 77 veterinary isolates were genetically characterized by high-throughput amplified fragment length polymorphism
Genetic relationships among Arachis species based on AFLP
Directory of Open Access Journals (Sweden)
Gimenes Marcos A.
2002-01-01
Full Text Available Amplified Fragment Length Polymorphism (AFLP was used to establish the genetic relationships among 20 species from seven of the nine sections of genus Arachis. The level of polymorphism among nine accessions of the cultivated peanut, A. hypogaea L., was also evaluated. Three combinations of primers were used to amplify the AFLPs. The fragments were separated in 6% denaturing acrylamide gels. A total of 408 fragments were analyzed. An average of 135.3 fragments per primer combination were scored, and the largest number of fragments was 169 using primer combination Eco RI - ACC / Mse I - CTG, while the lowest was 108, with Eco RI - ACT / Mse I - CTT. In general, the genetic relationships established using AFLPs agreed with the classification established using morphology and crossability data. The results indicated that AFLPs are good markers for establishing the relationships among Arachis species. The polymorphism detected in A. hypogaea by this method was higher than the one found with other markers, like RAPDs and RFLPs. However, our data suggest that the polymorphism detected be using AFLP with only three primer combinations is still too low to be used for any kind of genetic study in this species.
Directory of Open Access Journals (Sweden)
Akeela Fatima
2017-01-01
Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.
DEFF Research Database (Denmark)
Kusiluka, L.J.M.; Ojeniyi, B.; Friis, N.F.
2001-01-01
A molecular analysis of strains of Mycoplasma capricolum subsp, capripneumoniae (M. capripneumoniae) and Mycoplasma mycoides subsp. mycoides, small colony type (M. mycoides SQ isolated from goats was performed using the amplified fragment length polymorphism (AFLP) and pulsed-field gel...
CSIR Research Space (South Africa)
Barros, E
2009-05-01
Full Text Available of Eucalyptus grandis planting stock that exhibit preferred wood qualities is thus a priority of the South African forestry industry. The researchers used microarray-based DNA-amplified fragment length polymorphism (AFLP) analysis in combination with expression...
DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis
DEFF Research Database (Denmark)
Morling, N; Friis, J; Fugger, L
1991-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...
Association of Gln27Glu polymorphism of the β-2- adrenergic ...
African Journals Online (AJOL)
A group of 66 patients with preeclampsia and 72 control subjects were analyzed for the Arg16Gly and Gln27Glu polymorphisms of the ADRB2 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Comparisons of the ADRB2 genotypes or alleles between different groups were performed ...
Use of AFLP marker system on sugarcane somaclones to study their resistance to rust
María Ileana Oloriz; Luis Rojas; Víctor Gil; Milady Mendoza; Ariel Arencibia; Elva Rosa Carmona; Elio Jiménez
2002-01-01
AFLPs (amplified fragment length polymorphism) was carried out from genomic DNA of five rust resistant sugar cane somaclons and their susceptible donor, Saccharum officinarum var B 4362, using three combinations of primers (EcoRI/aca: MseI/acc; EcoRI/aca: MseI/atg and EcoRI/aca: MseI/agg). Six polymorphic bands were obtained, two of these only appeared in the resistant genotypes, which are probably DNA sequences, related to rust resistance locus. These fragments have been cloned to study thei...
Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction
International Nuclear Information System (INIS)
Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang
2002-01-01
The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor
Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction
Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang
2002-12-01
The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.
Molecular variation of Trypanosoma brucei subspecies as revealed by AFLP fingerprinting
Agbo, E.E.C.; Majiwa, P.A.O.; Claassen, H.J.H.M.; Pas, te M.F.W.
2002-01-01
Genetic analysis of Trypanosoma spp. depends on the detection of variation between strains. We have used the amplified fragment length polymorphism (AFLP) technique to develop a convenient and reliable method for genetic characterization of Trypanosome (sub)species. AFLP accesses multiple
Genetic diversity and relationships among cabbage ( Brassica ...
African Journals Online (AJOL)
The integration of our data with historical documents confirmed that traditional cabbage landraces cultivated in North of China were first introduced from Russia. Key words: Amplified fragment length polymorphism (AFLP), genetic diversity, cabbage (Brassica oleracea var. capitata), landraces, population structure.
Class 1 integrons in ciprofloxacin-resistant Escherichia coli strains from two Dutch hospitals
Mooij, M. J.; Schouten, I.; Vos, G.; van Belkum, A.; Vandenbroucke-Grauls, C. M. J. E.; Savelkoul, P. H. M.; Schultsz, C.
2005-01-01
A significant increase in the isolation frequency of ciprofloxacin-resistant Escherichia coli was observed in the haematology departments of two university hospitals in The Netherlands. Amplified fragment length polymorphism analysis revealed that this increase was not caused by the emergence of
Energy Technology Data Exchange (ETDEWEB)
Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L. (Stanford Univ., CA (USA)); Sherritt, M.; Bernard, C.C. (LaTrobe Univ., Victoria (Australia)); Begovich, A.B.; Erlich, H.A. (Cetus Corporation, Emeryville, CA (USA))
1989-02-01
Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of the polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.
T-cell receptor Vα and Cα alleles associated with multiple sclerosis and myasthenia gravis
International Nuclear Information System (INIS)
Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L.; Sherritt, M.; Bernard, C.C.; Begovich, A.B.; Erlich, H.A.
1989-01-01
Polymorphic markers in genes encoding the α chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR α cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of the polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V α and C α markers were identified between patients and healthy individuals
High-current relativistic klystron amplifier development for microsecond pulse lengths
International Nuclear Information System (INIS)
Fazio, M.V.; Carlsten, B.E.; Faehl, R.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.
1991-01-01
Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To data the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modeling are presented
High-current relativistic klystron amplifier development for microsecond pulse lengths
International Nuclear Information System (INIS)
Fazio, M.V.; Carlsten, B.E.; Faehl, R.J.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.
1991-01-01
Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To date the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modelling are presented. 5 refs., 5 figs
DEFF Research Database (Denmark)
Bagger Jørgensen, Rikke; Chen, B.Y.; Cheng, B.F.
1996-01-01
The alien C-genome chromosome in a Brassica campestris-alboglabra monosomic addition line was characterized by random amplified polymorphic DNA (RAPD) analysis. The alien chromosome carried three loci, E(c), W-c and Lap-1C, controlling synthesis of erucic acid, white flower colour and a fast...
Ludovic J. A. Capo-chichi; Wilson H. Faircloth; A. G. Williamson; Michael G. Patterson; James H. Miller; Edzard van Santen
2008-01-01
Nine sites of cogongrass were included in a study of genotypic dimity and spread dynamics at the point of introduction and its adjacent areas in the southern United States. Clones evaluated with two primer pairs yielded a total of 137 amplified fragment length polymorphism (AFLP) hi of which 102 (74.4%) were polymorphic. Genetic diversity was measured as the percentage...
Peng, Chong; Sui, Zhenghong; Zhou, Wei; Hu, Yiyi; Mi, Ping; Jiang, Minjie; Li, Xiaodong; Ruan, Xudong
2018-06-01
Gracilariopsis lemaneiformis is an economically important agarophyte, which contains high quality gel and shows a high growth rate. Wild population of G. lemaneiformis displayed resident divergence, though with a low genetic diversity as was revealed by amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR) analyses. In addition, different strains of G. lemaneiformis are diverse in morphology. The highly inconsistence between genetic background and physiological characteristics recommends strongly to the regulation at epigenetic level. In this study, the DNA methylation change in G. lemaneiformis among different generation branches and under different temperature stresses was assessed using methylation sensitive amplified polymorphism (MSAP) technique. It was shown that DNA methylation level among different generation branches was diverse. The full and total methylated DNA level was the lowest in the second generation branch and the highest in the third generation. The total methylation level was 61.11%, 60.88% and 64.12% at 15°C, 22°C and 26°C, respectively. Compared with the control group (22°C), the fully methylated and totally methylated ratios were increased in both experiment groups (15°C and 26°C). All of the cytosine methylation/demethylation transform (CMDT) was further analyzed. High temperature treatment could induce more CMDT than low temperature treatment did.
Albertini, Emidio; Marconi, Gianpiero
2014-01-01
Methylation-sensitive amplified polymorphism (MSAP) is a technique developed for assessing the extent and pattern of cytosine methylation and has been applied to genomes of several species (Arabidopsis, grape, maize, tomato, and pepper). The technique relies on the use of isoschizomers that differ in their sensitivity to methylation.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Werge, Thomas
2005-01-01
The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...
Genetic diversity, classification and comparative study on the larval ...
African Journals Online (AJOL)
use
2011-12-14
Dec 14, 2011 ... Lanka, Philippines, Bangladesh, Nepal, Myanmar, Turkey,. Papua New Guinea, Mexico, Uzbekistan and some of the. *Corresponding author. E-mail: ...... Characterization of Iranian Native Bombyx mori Strains Using. Amplified Fragment Length Polymorphism Markers. J. Econ. Entomol. 100(3): 939-945.
Escudero, M.; Vargas, P.; Arens, P.; Ouborg, N.J.; Luceno, M.
2010-01-01
Coastal plants are ideal models for studying the colonization routes of species because of the simple linear distributions of these species. Carex extensa occurs mainly in salt marshes along the Mediterranean and European coasts. Variation in cpDNA sequences, amplified fragment length polymorphisms
DEFF Research Database (Denmark)
Masneuf, I; Hansen, J.; Groth, C
1998-01-01
Two yeast isolates, a wine-making yeast first identified as a Mel(+) strain (ex. S. uvarum) and a cider-making yeast, were characterized for their nuclear and mitochondrial genomes, Electrophoretic karyotyping analyses, restriction fragment length polymorphism maps of PCR-amplified MET2 gene...
Genetic linkage maps of Japanese and European pears aligned to the apple consensus map
Yamamoto, T.; Kimura, T.; Saito, T.; Kotobuki, K.; Matsuta, N.; Liebhard, R.; Gessler, C.; Weg, van de W.E.; Hayashi, T.
2004-01-01
Genetic linkage maps of the Japanese pear (Pyrus pyrifolia Nakai) cultivar `Housui¿ and the European pear (Pyrus communis L.) cultivar `Bartlett¿ were constructed based on Amplified Fragment Length Polymorphism markers (AFLPs), Simple Sequence Repeat markers (SSRs) (from pear, apple and Prunus),
Genetic and Environmental Impact on Iron, Zinc, and Phytate in Food Sorghum Grown in Benin
Kayodé, A.P.P.; Linnemann, A.R.; Hounhouigan, J.D.; Nout, M.J.R.; Boekel, van M.A.J.S.
2006-01-01
Seventy-six farmers' varieties of sorghum from Benin were distinguished by amplified fragment length polymorphism (AFLP) and clustered into 45 distinct genotypes. The genotype clusters were evaluated for their Fe, Zn, and phytate concentrations to assess the impact of genetic and environmental
Genetic diversity of Actinobacillus lignieresii isolates from different hosts
DEFF Research Database (Denmark)
Kokotovic, Branko; Angen, Øystein; Bisgaard, Magne
2011-01-01
Genetic diversity detected by analysis of amplified fragment length polymorphisms (AFLPs) of 54 Actinobacilus lignieresii isolates from different hosts and geographic localities is described. On the basis of variances in AFLP profiles, the strains were grouped in two major clusters; one comprisin...
Identification of bacteria in drinking water with Raman spectroscopy
van de Vossenberg, J.; Tervahauta, H.; Maquelin, K.; Blokker-Koopmans, C.H.W.; Uytewaal-Aaarts, M.; Kooij, D.; van Wezel, A.P.; van der Gaag, B.
2013-01-01
Raman spectroscopy was used to discriminate between Legionella strains and between E. coli and coliform strains. The relationship between triplicate Raman spectra derived from Legionella bacteria was compared with that derived from a blind set of samples and amplified fragment length polymorphism
Khayhan, Kantarawee; Hagen, Ferry; Norkaew, Treepradab; Puengchan, Tanpalang; Boekhout, Teun; Sriburee, Pojana
2017-01-01
The pathogenic yeast Cryptococcus gattii was isolated from a tree hollow of a Castanopsis argyrophylla King ex Hook.f. (Fagaceae) in Chiang Mai, Thailand. Molecular characterization with amplified fragment length polymorphism analysis and multi-locus sequence typing showed that this isolate belonged
Molecular marker analysis to differentiate a clonal selection of ...
African Journals Online (AJOL)
Lalit Kumar
2013-04-03
Apr 3, 2013 ... Microsatellite and amplified fragment length polymorphism (AFLP) markers were used to differentiate. Manjari Naveen, a clonal selection of Centennial Seedless variety of grape. Twenty one (21) microsatellite primers could not detect variation between parent variety and its clone. AFLP analysis.
Genetic diversity of Pogonatherum paniceum (Lam.) Hack. in ...
African Journals Online (AJOL)
Amplified fragment length polymorphism (AFLP) markers were used to estimate the genetic diversity of Pogonatherum paniceum (Lam.) Hack. from Sichuan Province, Yunnan Province, Chongqing City and. Guangxi Zhuang autonomous Region in China. 10 primer combinations were carried out on 180 different individuals ...
Reshetnikov, Evgeny A; Akulova, Ludmila Y; Dobrodomova, Irina S; Dvornyk, Volodymyr Y; Polonikov, Alexey V; Churnosov, Mikhail I
2015-09-01
Malfunctioning of the cardiovascular system during pregnancy may be responsible for adverse effects on the 'mother-fetus' system. The cardiovascular system of a pregnant woman develops adaptation to the increased load. Angiotensin-converting enzyme (ACE) is known to play an important role in the adaptation. The present study was designed to investigate whether the insertion-deletion (I/D) polymorphism of the ACE gene is associated with the level of arterial blood pressure in women before and during pregnancy. The level of blood pressure was measured in 591 Russian women (Central Russia) before and during (37-40 weeks term) pregnancy. The women were divided into three groups which were hypertensive, hypotensive, and normotensive according to blood pressure level. Genotyping of the ACE I/D polymorphism was performed using polymerase chain reaction (PCR) and amplified fragment length polymorphism assay. Women with genotype DD showed the highest blood pressure level both during and at the end of pregnancy (pACE gene is associated with high blood pressure level at the end of pregnancy. © The Author(s) 2013.
Lee, Hsien-Chung; Yang, Man-Miao; Yeh, Wen-Bin
2008-08-01
The occurrence of pear decline, a disease found in some pear (Pyrus spp.) orchards of Taiwan in recent years, is accompanied by an outbreak of Cacopsylla chinensis (Yang & Li). Two major morphological forms (summer and winter forms) with a variety of intermediate body color and two phylogenetic lineages of this psyllid have been described. The work herein used sequences of mitochondrial cytochrome oxidase I (COI) and 16S rDNA regions to delineate the genetic differentiation of this color-variable insect and to elucidate their relationship. Sequence divergence and phylogenetic analysis have shown that C. chinensis individuals could be divided into two lineages with 3.3 and 2.3% divergence of COI and 16S rDNA, respectively. All specimens from China were found to belong to lineage I. Restriction fragment length polymorphism analysis of COI with restriction enzymes AcuI, AseI, BccI, and FokI on 263 specimens of six populations from Taiwan produced two digestion patterns, which are in agreement with the two lineages described above. Both patterns could be found in each population, with most individuals belonging to lineage I and 5-21% of the individuals belonging to lineage II. Because these two lineages included summer as well as winter morphological forms, the lineage differentiation is apparently not related to morphological characters of this psyllid. Because the invasive records are not in favor of a sympatric differentiation, this psyllid is more likely introduced as different populations from countries in temperate regions.
de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip
2013-01-01
In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841
Identification of polymorphisms of XRCC1 gene in patients with cancer in a city of northern Brazil
Directory of Open Access Journals (Sweden)
Artemis Socorro N. Rodrigues
2015-06-01
Full Text Available ABSTRACT Introduction: Cancer is considered a genetic disease. For this reason, identification and characterization of the genes involved in its origin and progression are of fundamental importance in understanding its molecular basis. Objective: Our objective was to determine whether people from Macapá with a diagnosis of cancer have genetic polymorphisms related to the XRCC1 gene. Materials and methods: We analyzed 30 samples of deoxyribonucleic acid (DNA of cases with cancer and 30 control samples. All samples were amplified and analyzed by the polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP method, with the use of restriction enzyme MspI. Results: Regarding the 194T polymorphism, we found that all samples of the cases presented the polymorphic allele Trp (Arg/Trp. In control samples, 96.6% also identify the polymorphic allele Trp and, among these, one was homozygous for the same allele (Trp/Trp. Regarding the 399A polymorphism, 83.3% of the cases and 23.3% of the controls had the Arg/ Gln genotype, respectively. We found that 73.3% of controls and 16.6% of cases had the Arg/Arg genotype. Among the controls, we found only a sample that was homozygous for the polymorphic allele Trp/Trp. Conclusion: Our results demonstrated the allele frequency of 194Trp polymorphism in both sample groups analyzed. We also found a significant number of polymorphic allele 399A in people with cancer. Thus, we can highlight 399Gln polymorphism as a genetic marker of cancer risk in this population.
Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda
2006-01-01
Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.
Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene
Energy Technology Data Exchange (ETDEWEB)
Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)
1991-09-11
The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.
Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.
2016-01-01
We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371
Phylogenic analysis in Acacia senegal using AFLP molecular ...
African Journals Online (AJOL)
Amplified fragment length polymorphism (AFLP) DNA markers were used to characterize the genetic diversity and relationships in gum Arabic tree (Acacia senegal). Twenty eight samples of Acacia senegal collected from populations distributed throughout the Gum Arabic belt were tested in comparison with samples of ...
DEFF Research Database (Denmark)
Coote, J.G.; Stewart-Tull, D.E.S.; Owen, R.J.
2007-01-01
mammalian cells. The results were correlated with source of isolation and genetic makeup by amplified fragment length polymorphism (AFLP) typing. The isolates had variable degrees of haemolytic activity against rabbit erythrocytes and cytotoxicity towards CaCo-2, HeLa and Vero cells. The data indicated...
Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency
Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.
2009-01-01
Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on
library of genic multiple-allele inherited male-steri
African Journals Online (AJOL)
Administrator
2011-06-15
Jun 15, 2011 ... male sterility; AFLP, amplified fragment length polymorphism;. DDRT-PCR, differential ... production of hybrid seed (Bino, 1985). ... percentage of male-sterile plants in an ideal male-sterile .... and presence or absence of pollen, the flower buds were ..... Diurnal changes of photosynthetic and physiological.
Molecular Epidemiology of Fonsecaea Species
Najafzadeh, M.J.; Sun, J.; Vicente, V.A.; Klaassen, C.H.W.; Bonifaz, A.; Gerrits van den Ende, A.H.G.; Menken, S.B.J.; de Hoog, G.S.
2011-01-01
To assess population diversities among 81 strains of fungi in the genus Fonsecaea that had been identified down to species level, we applied amplified fragment-length polymorphism (AFLP) technology and sequenced the internal transcribed spacer regions and the partial cell division cycle, β-tubulin,
Molecular responses and expression analysis of genes in a ...
African Journals Online (AJOL)
Haloxylon ammodendron (C.A Mey.) Bunge is a xero-halophytic desert shrub with excellent drought resistance and salt tolerance. To decipher the molecular responses involved in its drought resistance, the cDNA-AFLP (amplified fragment length polymorphism) technique was employed to identify genes expressed ...
Stable MSAP markers for the distinction of Vitis vinifera cv Pinot noir clones.
Ocaña, Juan; Walter, Bernard; Schellenbaum, Paul
2013-11-01
Grapevine is one of the most economically important fruit crops. Molecular markers have been used to study grapevine diversity. For instance, simple sequence repeats are a powerful tool for identification of grapevine cultivars, while amplified fragment length polymorphisms have shown their usefulness in intra-varietal diversity studies. Other techniques such as sequence-specific amplified polymorphism are based on the presence of mobile elements in the genome, but their detection lies upon their activity. Relevant attention has been drawn toward epigenetic sources of variation. In this study, a set of Vitis vinifera cv Pinot noir clones were analyzed using the methylation-sensitive amplified polymorphism technique with isoschizomers MspI and HpaII. Nine out of fourteen selective primer combinations were informative and generated two types of polymorphic fragments which were categorized as "stable" and "unstable." In total, 23 stable fragments were detected and they discriminated 92.5 % of the studied clones. Detected stable polymorphisms were either common to several clones, restricted to a few clones or unique to a single clone. The identification of these stable epigenetic markers will be useful in clonal diversity studies. We highlight the relevance of stable epigenetic variation in V. vinifera clones and analyze at which level these markers could be applicable for the development of forthright techniques for clonal distinction.
Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi
2011-07-15
presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.
Bednarek, Piotr T.; Or?owska, Renata; Niedziela, Agnieszka
2017-01-01
Background We present a new methylation-sensitive amplified polymorphism (MSAP) approach for the evaluation of relative quantitative characteristics such as demethylation, de novo methylation, and preservation of methylation status of CCGG sequences, which are recognized by the isoschizomers HpaII and MspI. We applied the technique to analyze aluminum (Al)-tolerant and non-tolerant control and Al-stressed inbred triticale lines. The approach is based on detailed analysis of events affecting H...
Molecular characterization of olive cultivars grown in Iraq using ...
African Journals Online (AJOL)
The results of this research confirmed AFLP and SSR to be useful tools in genetic relationships among olive cultivars, in creating a molecular database for Iraqi olive cultivars, in breeding strategies and in correct cultivar identification. Keywords: Olea europaea, genetic diversity, amplified fragment length polymorphism ...
Molecular fingerprinting of the Egyptian medicinal plant Cocculus ...
African Journals Online (AJOL)
Since no information about the genome of C. pendulus is available, the current study deals with molecular investigation of C. pendulus expressed by DNA fingerprinting of the young leaves of this plant using amplified fragment length polymorphism (AFLP) technique with four primer combinations. The obtained results ...
Genetic differentiation in Japanese flounder in the Yellow Sea and ...
African Journals Online (AJOL)
The population structure of Japanese flounder (Paralichthys olivaceus) in the Yellow and East China Seas were analyzed using amplified fragment length polymorphism (AFLP) and cytochrome c oxidase subunit I (COI) gene sequencing. A total of 390 reproducible bands were generated by 10 AFLP primer combinations in ...
Molecular and genetic study of wheat rusts | Le Maitre | African ...
African Journals Online (AJOL)
Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...
Swanson, Colby A; Sliwinski, Marek K
2013-09-01
DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.
Andoh, Akira; Kobayashi, Toshio; Kuzuoka, Hiroyuki; Tsujikawa, Tomoyuki; Suzuki, Yasuo; Hirai, Fumihito; Matsui, Toshiyuki; Nakamura, Shiro; Matsumoto, Takayuki; Fujiyama, Yoshihide
2014-05-01
The gut microbiota plays a significant role in the pathogenesis of Crohn's disease (CD). In this study, we analyzed the disease activity and associated fecal microbiota profiles in 160 CD patients and 121 healthy individuals. Fecal samples from the CD patients were collected during three different clinical phases, the active (n=66), remission-achieved (n=51) and remission-maintained (n=43) phases. Terminal restriction fragment length polymorphism (T-RFLP) and data mining analysis using the Classification and Regression Tree (C&RT) approach were performed. Data mining provided a decision tree that clearly identified the various subject groups (nodes). The majority of the healthy individuals were divided into Node-5 and Node-8. Healthy subjects comprised 99% of Node-5 (91 of 92) and 84% of Node-8 (21 of 25 subjects). Node-3 was characterized by CD (136 of 160 CD subjects) and was divided into Node-6 and Node-7. Node-6 (n=103) was characterized by subjects in the active phase (n=48; 46%) and remission-achieved phase (n=39; 38%) and Node-7 was characterized by the remission-maintained phase (21 of 37 subjects; 57%). Finally, Node-6 was divided into Node-9 and Node-10. Node-9 (n=78) was characterized by subjects in the active phase (n=43; 55%) and Node-10 (n=25) was characterized by subjects in the remission-maintained phase (n=16; 64%). Differences in the gut microbiota associated with disease activity of CD patients were identified. Thus, data mining analysis appears to be an ideal tool for the characterization of the gut microbiota in inflammatory bowel disease.
Perrone, T M; Gonzatti, M I; Villamizar, G; Escalante, A; Aso, P M
2009-05-12
Nine Trypanosoma sp. Venezuelan isolates, initially presumed to be T. evansi, were collected from three different hosts, capybara (Apure state), horse (Apure state) and donkey (Guarico state) and compared by the random amplification polymorphic DNA technique (RAPD). Thirty-one to 46 reproducible fragments were obtained with 12 of the 40 primers that were used. Most of the primers detected molecular profiles with few polymorphisms between the seven horse, capybara and donkey isolates. Quantitative analyses of the RAPD profiles of these isolates revealed a high degree of genetic conservation with similarity coefficients between 85.7% and 98.5%. Ten of the primers generated polymorphic RAPD profiles with two of the three Trypanosoma sp. horse isolates, namely TeAp-N/D1 and TeGu-N/D1. The similarity coefficient between these two isolates and the rest, ranged from 57.9% to 68.4% and the corresponding dendrogram clustered TeAp-N/D1 and Te Gu-N/D1 in a genetically distinct group.
International Nuclear Information System (INIS)
Theodorakis, C.W.; Shugart, L.R.
1993-01-01
In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Molecular phylogeny of Fusarium species by AFLP fingerprint ...
African Journals Online (AJOL)
The high-resolution genotyping method of amplified fragment length polymorphism (AFLP) analysis was used to study the genetic relationships within and between natural populations of five Fusarium spp. AFLP templates were prepared by the digestion of Fusarium DNA with EcoRI and MseI restriction endonucleases and ...
Linkage mapping of a dominant male sterility gene Ms-cd1 in Brassica oleracea
Wang, X.; Lou, P.; Bonnema, A.B.; Yang, Boujun; He, H.; Zhang, Y.; Fang, Z.
2005-01-01
The dominant male sterility gene Ms-cd1 (c, cabbage; d, dominant) was identified as a spontaneous mutation in the spring cabbage line 79-399-3. The Ms-cd1 gene is successfully applied in hybrid seed production of several Brassica oleracea cultivars in China. Amplified fragment length polymorphism
Genetic and phylogenetic analysis of ten Gobiidae species in China ...
African Journals Online (AJOL)
To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...
Yam ( Dioscorea spp.) molecular breeding
African Journals Online (AJOL)
Some progress has been made in recent years in germplasm characterization and the development of molecular markers for genome analysis. A genetic linkage map based on amplified fragment length polymorphism (AFLP) markers has been constructed for Guinea and water yams. These linkage maps were used to scan ...
Genetic diversity analysis and conservation of the Chinese herb ...
African Journals Online (AJOL)
Salvia miltiorrhiza is an economically important floral herb. However, little work has been conducted to further our understanding of the genetics of this herb. In this study, a representative set of germplasm of. S. miltiorrhiza populations was used to analyze genetic diversity using amplified fragment length polymorphism ...
Molecular survey of the Texas Phoenix decline phytoplasma ...
African Journals Online (AJOL)
user
Restriction fragment length polymorphisms (RFLP) analysis of the PCR-amplified 16S-23S IGS region and the gcp gene using a three restriction enzymes showed that the population of the phytoplasmas infecting S. palmetto in West Central Florida is probably homogenous. The S. palmetto phytoplasma also appeared ...
Assessing Date Palm Genetic Diversity Using Different Molecular Markers.
Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S
2017-01-01
Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.
Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.
Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing
2016-02-02
Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.
MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan
2007-01-01
Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...
RAPD analysis of alfalfa DNA mutation via N+ implantation
International Nuclear Information System (INIS)
Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang
2003-01-01
Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength
Inter simple sequence repeat (ISSR) analysis of Ethiopian white ...
African Journals Online (AJOL)
Oumer
2015-05-06
May 6, 2015 ... flowers are quite distinctive and mainly self-pollinating but can be occasionally ... AFLP, amplified fragment length polymorphism. Author(s) agree that this ... Lupine plants growing on an individual farmers plot of land were considered as ..... PROTA (plant resources of tropical Africa /ressourcesvégétales de.
Genetic characterization of two traditional leafy vegetables ...
African Journals Online (AJOL)
Genetic characterization of two traditional leafy vegetables (Sesamum radiatum Thonn. ex Hornem and Ceratotheca sesamoides Endl.) of Benin, using flow cytometry and amplified fragment length polymorphism (AFLP) markers. K Adéoti, A Rival, A Dansi, S Santoni, S Brown, T Beule, A Nato, Y Henry, R Vodouhe, L Loko, ...
Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F
2016-06-01
To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine
Association Analysis of the Leptin and Ghrelin Receptor Gene Polymorphism in the Human with BMI
Directory of Open Access Journals (Sweden)
Zuzana Lieskovská
2011-05-01
Full Text Available The aim of this work was identification of Leptin and Ghrelin receptor gene polymorphism in the population. Leptin is a product of obese (ob gene expression that plays a role in energy metabolism and body weight. The human leptin gene is located in the 17 chromosome. The restriction site is located at the position 2549 bp (C→A. Ghrelin, a peptide hormone predominantly produced by the stomach, was isolated as the endogenous ligand for the growth hormone secretagogue receptor. Ghrelin is a potent stimulator of growth hormone (GH secretion and is the only circulatory hormone known to potently enhance feeding and weight gain and to regulate energy homeostasis following central and systemic administration. Therapeutic intervention with ghrelin in catabolic situations may induce a combination of enhanced food intake, increased gastric emptying and nutrient storage, coupled with an increase in GH thereby linking nutrient partitioning with growth and repair processes. The present study included 35 human samples. The average value of BMI was estimate on 24.45. The size of amplified PCR product is 242bp. Subsequently we used the specific restriction enzyme HhaI and length of fragments is 181+61 bp in the homozygote CC, 242+181+61 bp in the heterozygote AC and 242 bp in the homozygote AA. The restriction site is located at the position 171T/C. Examination of the polymorphism of the GHSR gene was accomplished used PCR-RFLP method. We used amplified the 593 bp product, which was subsequently digested with restriction enzyme LweI and length of fragmetnts is 593 bp in the homozygote TT, 593+567+26 bp in the heterozygote TC and 593+26 bp in the homozygote CC. We assume that this mutation has connection with human obesity level.
Energy Technology Data Exchange (ETDEWEB)
Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)
2012-09-15
Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.
Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.
2011-01-01
Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746
using random amplified polymorphic DNA (RAPD)
African Journals Online (AJOL)
To study the pattern of genetic diversity in 45 genotypes of common bean, 19 RAPD primers were used. Of 253 bands produced, 236 bands (94.22%) were polymorphic in which maximum number (20 polymorphic bands) were observed in the profiles of the primer OPB-07. Highest PIC value (0.79) was observed for the ...
Composting oily sludges: Characterizing microflora using randomly amplified polymorphic DNA
International Nuclear Information System (INIS)
Persson, A.; Quednau, M.; Ahrne, S.
1995-01-01
Laboratory-scale composts in which oily sludge was composted under mesophilic conditions with amendments such as peat, bark, and fresh or decomposed horse manure, were studied with respect to basic parameters such as oil degradation, respirometry, and bacterial numbers. Further, an attempt was made to characterize a part of the bacterial flora using randomly amplified polymorphic DNA (RAPD). The compost based on decomposed horse manure showed the greatest reduction of oil (85%). Comparison with a killed control indicated that microbial degradation actually had occurred. However, a substantial part of the oil was stabilized rather than totally broken down. Volatiles, on the contrary, accounted for a rather small percentage (5%) of the observed reduction. RAPD indicated that a selection had taken place and that the dominating microbial flora during the active degradation of oil were not the same as the ones dominating the different basic materials. The stabilized compost, on the other hand, had bacterial flora with similarities to the ones found in peat and bark
Mee-Sook Kim; Bryce A. Richardson; Geral I. McDonald; Ned B. Klopfenstein
2010-01-01
Western white pine (Pinus monticola) is an economically and ecologically important species in western North America that has declined in prominence over the past several decades, mainly due to the introduction of Cronartium ribicola (cause of white pine blister rust) and reduced opportunities for regeneration. Amplified fragment length polymorphism (AFLP) markers were...
Roche, P.; Arkel, van G.; Heusden, van A.W.
1997-01-01
This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this
Assessment of genetic diversity among accessions of two traditional ...
African Journals Online (AJOL)
Assessment of genetic diversity among accessions of two traditional leafy vegetables (Acmella uliginosa (L.) and Justicia tenella (Nees) T.) consumed in Benin using amplified fragment length polymorphism (AFLP) markers. K Adéoti, A Rival, A Dansi, BS Ahohuendo, S Santoni, T Beule, A Nato, Y Henry, A Ahanchédé, ...
Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.
2001-07-01
The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.
PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)
Energy Technology Data Exchange (ETDEWEB)
McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))
1991-09-25
Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.
Bruijnesteijn van Coppenraet, L. E. S.; Savelkoul, P. H. M.; Buffing, N.; van der Bijl, M. W.; Woudenberg, J.; Lindeboom, J. A.; Kiehn, T. E.; Haverkort, F.; Samra, Z.; Kuijper, E. J.
2009-01-01
The role of the species Mycobacterium haemophilum as a pathogenic non-tuberculous microorganism is becoming better defined with the use of specific detection methods. However, epidemiological investigations of this species are still scarce. We analysed the genetic diversity of M. haemophilum by
Hedayatizadeh-Omran, Akbar; Rafiei, Alireza; Khajavi, Rezvan; Alizadeh-Navaei, Reza; Mokhberi, Vahid; Moradzadeh, Kambiz
2014-02-01
Research shows that ghrelin gene polymorphism has some association with coronary artery diseases (CAD). Due to genetic differences among nations and the high prevalence of CAD, we conducted this study to examine the possible association between the polymorphism of ghrelin gene Leu72Met and CAD among an Iranian population. This case-control study was undertaken with patients who were referred to referral heart center, in 2011, with chest pain or a positive exercise test. Patients with risk factors for heart disease or who were surgery candidates, who underwent angiography and echocardiography, were also included. DNA extractions were performed using a modified salting out method, and the ghrelin region was amplified using polymerase chain reaction. The presence of the Leu72Met polymorphism and the serum levels of ghrelin were determined using the restriction fragment length polymorphism method and the enzyme-linked immunosorbent assay, respectively. The results indicated that in CAD patients, the incidence of heart failure was significantly different between the groups with genotypes CC or AA+CA (p=0.041). Mean serum level of ghrelin in the CAD group was significantly higher than that in the control group (pghrelin genotypes and serum levels of ghrelin in both the CAD and control groups (ppolymorphism, as well as an increase in serum levels of ghrelin associated with genotype distribution such that ghrelin levels have an inverse relationship with the frequency of the CC genotype.
DNA polymorphism of HLA class II genes in systemic lupus erythematosus
DEFF Research Database (Denmark)
Cowland, J B; Andersen, V; Halberg, P
1994-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3...
AFLP diversity between the Novosibirsk and Tomsk chromosome races of the common shrew (Sorex araneus
Directory of Open Access Journals (Sweden)
Andrey Polyakov
2009-12-01
Full Text Available Genetic diversity between of the Novosibirsk and Tomsk chromosome races of the common shrew (Sorex araneus was analyzed using 39 polymorphic AFLP (amplified fragments length polymorphism markers. Exact and F-statistics tests for population differentiation demonstrated significant interracial difference in allele frequencies and significant subdivision between the races. The value of the genetic distance between the chromosome races observed in this study corresponds to that found between subspecies of mammals studied so far.
Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain
2011-01-01
cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.
Directory of Open Access Journals (Sweden)
Bianca W. Bertoni
2010-01-01
Full Text Available Jacaranda decurrens (Bignoniaceae is an endemic species of the Cerrado with validated antitumoral activity. The genetic diversity of six populations of J. decurrens located in the State of São Paulo was determined in this study by using molecular markers for randomly amplified polymorphic DNA (RAPD and amplified fragment length polymorphism (AFLP. Following optimization of the amplification reaction, 10 selected primers generated 78 reproducible RAPD fragments that were mostly (69.2% polymorphic. Two hundred and five reproducible AFLP fragments were generated by using four selected primer combinations; 46.3% of these fragments were polymorphic, indicating a considerable level of genetic diversity. Analysis of molecular variance (AMOVA using these two groups of markers indicated that variability was strongly structured amongst populations. The unweighted pair group method with arithmatic mean (UPGMA and Pearson's correlation coefficient (RAPD -0.16, p = 0.2082; AFLP 0.37, p = 0.1006 between genetic matrices and geographic distances suggested that the population structure followed an island model in which a single population of infinite size gave rise to the current populations of J. decurrens, independently of their spatial position. The results of this study indicate that RAPD and AFLP markers were similarly efficient in measuring the genetic variability amongst natural populations of J. decurrens. These data may be useful for developing strategies for the preservation of this medicinal species in the Cerrado.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1990-01-01
investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...
Directory of Open Access Journals (Sweden)
Fei Cheng
Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.
Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S
2015-12-15
Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome.
RAPD, RFLP, T-RFLP, AFLP, RISA
International Nuclear Information System (INIS)
Denman, S.E.; McSweeney, C.S.; Makoto Mitsumori
2005-01-01
focus on the conserved ribosomal regions for phylogenetic diversity studies are those that amplify up random genomic sequences. The two most common methods are random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP)
Applicability of SCAR markers to food genomics: olive oil traceability.
Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson
2007-07-25
DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.
Effects of heat stress on gene expression in eggplant ( Solanum ...
African Journals Online (AJOL)
In order to identify differentially expressed genes involved in heat shock response, cDNA amplified fragment length polymorphism (cDNA-AFLP) and quantitative real-time polymerase chain reaction (QPCR) were used to study gene expression of eggplant seedlings subjected to 0, 6 and 12 h at 43°C. A total of 53 of over ...
AFLP/SSR mapping of resistance genes to Alectra vogelii in cowpea ...
African Journals Online (AJOL)
To find and map the resistance gene to A. vogelii in cowpea, a F2 population from a cross involving a resistant parent IT81D-994 and a susceptible TVX3236 was screened. Amplified fragment length polymorphism (AFLP) in combination with Single Sequence Repeat (SSR) analysis was used to identify markers that may be ...
Genetic relationships among Rosa species based on random ...
African Journals Online (AJOL)
To investigate the genetic diversity of Rosa accessions, random amplified polymorphism DNA (RAPD) approach was employed. Nine of ten primers amplified 138 scorable RAPD loci with 111 polymorphic bands (80%). Percentages of polymorphic bands ranged from 75 to 100%. Sizes of amplified DNA fragments ranged ...
Use of AFLP marker system on sugarcane somaclones to study their resistance to rust
Directory of Open Access Journals (Sweden)
María Ileana Oloriz
2002-10-01
Full Text Available AFLPs (amplified fragment length polymorphism was carried out from genomic DNA of five rust resistant sugar cane somaclons and their susceptible donor, Saccharum officinarum var B 4362, using three combinations of primers (EcoRI/aca: MseI/acc; EcoRI/aca: MseI/atg and EcoRI/aca: MseI/agg. Six polymorphic bands were obtained, two of these only appeared in the resistant genotypes, which are probably DNA sequences, related to rust resistance locus. These fragments have been cloned to study their nucleotide sequence and to investigate their roll in resistance mechanism develop by these mutants during Puccinia melanocephala infection. Key words: molecular markers, Puccinia. melanocephala, Saccharum
Munguia-Vega, A.; Rodriguez-Estrella, R.; Nachman, M.; Culver, M.
2009-01-01
Fifteen polymorphic microsatellite loci were isolated from an enriched genomic library of the sand pocket mouse Chaetodipus arenarius. The mean number of alleles per locus was 11.53 (range five to 19) and the average observed heterozygosity was 0.764 (range 0.121 to 1.0). The markers will be used for detecting the impact of human-induced habitat fragmentation on patterns of gene flow, genetic structure, and extinction risk. In addition, these markers will be useful across the genus because most of the loci cross-amplified and were polymorphic in three other species of Chaetodipus. ?? 2008 The Authors.
Directory of Open Access Journals (Sweden)
Carlos M Restrepo
Full Text Available American Tegumentary Leishmaniasis is caused by parasites of the genus Leishmania, and causes significant health problems throughout the Americas. In Panama, Leishmania parasites are endemic, causing thousands of new cases every year, mostly of the cutaneous form. In the last years, the burden of the disease has increased, coincident with increasing disturbances in its natural sylvatic environments. The study of genetic variation in parasites is important for a better understanding of the biology, population genetics, and ultimately the evolution and epidemiology of these organisms. Very few attempts have been made to characterize genetic polymorphisms of parasites isolated from Panamanian patients of cutaneous leishmaniasis. Here we present data on the genetic variability of local isolates of Leishmania, as well as specimens from several other species, by means of Amplified Fragment Length Polymorphisms (AFLP, a technique seldom used to study genetic makeup of parasites. We demonstrate that this technique allows detection of very high levels of genetic variability in local isolates of Leishmania panamensis in a highly reproducible manner. The analysis of AFLP fingerprints generated by unique selective primer combinations in L. panamensis suggests a predominant clonal mode of reproduction. Using fluorescently labeled primers, many taxon-specific fragments were identified which may show potential as species diagnostic fragments. The AFLP permitted a high resolution genetic analysis of the Leishmania genus, clearly separating certain groups among L. panamensis specimens and highly related species such as L. panamensis and L. guyanensis. The phylogenetic networks reconstructed from our AFLP data are congruent with established taxonomy for the genus Leishmania, even when using single selective primer combinations. Results of this study demonstrate that AFLP polymorphisms can be informative for genetic characterization in Leishmania parasites, at
Biochemical and Molecular Characterization of Plant-Parasitic Nematodes
Directory of Open Access Journals (Sweden)
I.M. de O. Abrantes
2004-08-01
Full Text Available Nematologists need correct species identification to carry out research, teaching, extension and other activities. Therefore, nematode taxonomy must be pursued diligently at all levels. The identification of plant-parasitic nematodes is not always easy and that of some species is especially difficult. Most of the information that nematologists use when characterizing and identifying specimens is based on morphological and morphometrical characters. Although these characters are of primary importance, in the last three decades they have been supplemented by biochemical/ molecular characters. Biochemical approaches include the separation of proteins (general proteins and isozymes by one-dimensional gel electrophoresis, isoelectric focusing, two-dimensional gel electrophoresis, and sodium dodecyl sulphate-capillary gel electrophoresis. Serology has also been found effective in the identification and quantification of nematodes, monoclonal antibodies being a more useful immunological tool than polyclonal antibodies. Identification based on the direct examination of DNA is potentially a more powerful method to characterize inter- and intra-specific variability. The development of techniques such as the polymerase chain reaction, restriction fragment length polymorphism, randomly amplified polymorphic DNA, and amplified fragment length polymorphism has increased the accuracy and speed of nematode characterization/identification. Progress continues to be made and more and more nematologists are using molecular techniques for diagnostic purposes and to assess genetic variation.
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight
Shi, Jinming
In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.
Flores Berrios, E P; Alba González, J F; Arrizon Gaviño, J P; Romano, P; Capece, A; Gschaedler Mathis, A
2005-01-01
The objectives were to determine the variability and to compare the genetic diversity obtained using amplified fragment length polymorphism (AFLP) markers in analyses of wine, tequila, mezcal, sotol and raicilla yeasts. A molecular characterization of yeasts isolated from Mexican agave musts, has been performed by AFLP marker analysis, using reference wine strains from Italian and South African regions. A direct co-relation between genetic profile, origin and fermentation process of strains was found especially in strains isolated from agave must. In addition, unique molecular markers were obtained for all the strains using six combination primers, confirming the discriminatory power of AFLP markers. This is the first report of molecular characterization between yeasts isolated from different Mexican traditional agave-distilled beverages, which shows high genetic differences with respect to wine strains.
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D
2012-09-01
Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.
Ningombam, Somorjit Singh; Chhungi, Varhlun; Newmei, Masan Kambo; Rajkumari, Sunanda; Devi, Naorem Kiranmala; Mondal, Prakash Ranjan; Saraswathy, Kallur Nava
2018-03-20
The fat mass and obesity associated (FTO) rs9939609 gene polymorphism is most widely studied in terms of obesity in various populations. Recently, the prevalence of obesity has been reported to be very high among the North-Eastern State of India. The major aim of the present study is to understand the extent of FTO rs9939609 gene polymorphism and its association with obesity among the two North-East Indian tribal populations with similar East Asian ancestry. Somatometric data and fasting blood sample were collected from 521 tribal individuals (258 Liangmai and 263 Mizo) of Manipur after obtaining written informed consent. Genotyping of FTO rs9939609 single nucleotide polymorphism (SNP) was done using restriction fragment length polymorphism method for PCR-amplified fragments. Both the presently studied populations were not following Hardy-Weinberg law. The prevalence of obesity and minor allele frequency of FTO rs9939609 polymorphism was found to be significantly higher among the Mizo tribe compared to that of Liangmai. The selected polymorphism was found to be significantly associated with obesity (BMI) only among the Liangmai tribe (Odds ratio-3.0; 95% CI-1.4, 6.4; p-0.003), after adjusting for age and occupation. Age-cohort wise distribution and absolute fitness analysis indicated the lower fitness of minor allele in the higher age group among the Liangmai tribe. To the best of the author's knowledge this is the first study, associating FTO rs9939609 gene polymorphism and obesity in the North-eastern Indian tribal populations with East-Asian ancestry. This study revealed the FTO rs9939609 polymorphism is observed to be associated with obesity only among the Liangmai tribe not among the Mizo tribe. The differential distribution and association observed in the two selected tribes, inhabited in a similar geographical region, could be attributed to differences in their migratory histories in terms of both route and time of settlement. Copyright © 2018 Elsevier B
Alonso, Sergio; Suzuki, Koichi; Yamamoto, Fumiichiro; Perucho, Manuel
2018-01-01
Somatic, and in a minor scale also germ line, epigenetic aberrations are fundamental to carcinogenesis, cancer progression, and tumor phenotype. DNA methylation is the most extensively studied and arguably the best understood epigenetic mechanisms that become altered in cancer. Both somatic loss of methylation (hypomethylation) and gain of methylation (hypermethylation) are found in the genome of malignant cells. In general, the cancer cell epigenome is globally hypomethylated, while some regions-typically gene-associated CpG islands-become hypermethylated. Given the profound impact that DNA methylation exerts on the transcriptional profile and genomic stability of cancer cells, its characterization is essential to fully understand the complexity of cancer biology, improve tumor classification, and ultimately advance cancer patient management and treatment. A plethora of methods have been devised to analyze and quantify DNA methylation alterations. Several of the early-developed methods relied on the use of methylation-sensitive restriction enzymes, whose activity depends on the methylation status of their recognition sequences. Among these techniques, methylation-sensitive amplification length polymorphism (MS-AFLP) was developed in the early 2000s, and successfully adapted from its original gel electrophoresis fingerprinting format to a microarray format that notably increased its throughput and allowed the quantification of the methylation changes. This array-based platform interrogates over 9500 independent loci putatively amplified by the MS-AFLP technique, corresponding to the NotI sites mapped throughout the human genome.
Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R
2015-12-28
The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.
Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...
African Journals Online (AJOL)
The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...
Tumour necrosis factor-α polymorphism as one of the complex inherited factors in pemphigus
Directory of Open Access Journals (Sweden)
Jolanta Dorota Torzecka
2003-01-01
Full Text Available The aim of our study was to analyse a significance of tumour necrosis factor (TNF-α promoter gene polymorphisms in relation to the HLA-DR locus in genetic predisposition to pemphigus. TNF-α gene polymorphisms in position -238 and -308 were identified using a modified polymerase chain reaction-restriction fragment length polymorphism method in 53 patients with pemphigus (38 with pemphigus vulgaris, 15 with pemphigus foliaceus and 87 healthy controls. The HLA-DRB1 locus was typed using the polymerase chain reaction SSO method in all the patients and 152 population controls.
Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.
He, S P; Sun, J L; Du, X M
2011-10-03
Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.
Fc receptor gamma subunit polymorphisms and systemic lupus erythematosus
International Nuclear Information System (INIS)
Al-Ansari, Aliya; Ollier, W.E.; Gonzalez-Gay, Miguel A.; Gul, Ahmet; Inanac, Murat; Ordi, Jose; Teh, Lee-Suan; Hajeer, Ali H.
2004-01-01
To investigate the possible association between Fc receptor gamma polymorphisms and systemic lupus erythematosus (SLE). We have investigated the full FcR gamma gene for polymorphisms using polymerase chain reaction (PCR)-single strand confirmational polymorphisms and DNA sequencing .The polymorphisms identified were genotype using PCR-restriction fragment length polymorphism. Systemic lupus erythematosus cases and controls were available from 3 ethnic groups: Turkish, Spanish and Caucasian. The study was conducted in the year 2001 at the Arthritis Research Campaign, Epidemiology Unit, Manchester University Medical School, Manchester, United Kingdom. Five single nucleotide polymorphisms were identified, 2 in the promoter, one in intron 4 and, 2 in the 3'UTR. Four of the 5 single nucleotide polymorphisms (SNPs) were relatively common and investigated in the 3 populations. Allele and genotype frequencies of all 4 investigated SNPs were not statistically different cases and controls. fc receptor gamma gene does not appear to contribute to SLE susceptibility. The identified polymorphisms may be useful in investigating other diseases where receptors containing the FcR gamma subunit contribute to the pathology. (author)
Singh, Gurpreet; Singh, Maninder Lal
2015-08-01
A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.
IDENTIFICATION OF GH|ALUI AND GHR|ALUI GENES POLYMORPHISMS IN INDONESIAN BUFFALO
Directory of Open Access Journals (Sweden)
E. Andreas
2014-10-01
Full Text Available Growth hormone (GH is an anabolic hormone which sintesized and secreted by somatrotop cell inpituitary anterior lobe. GH exert its effect on growth and metabolism by interacting with a specificreceptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested ascandidate gene for traits related to meat production in Bovidae. The objectives of this study were toidentify polymorphism of GH and GHR genes in buffalo. The 452 DNA samples buffalo were collectedfrom five populations in Indonesia (Siborong-Borong-Medan (65, Lebak-Banten (29, Pandeglang-Banten (180, Semarang-Central Java, and Mataram-West Nusa Tenggara (103. A gene fragment of theGH|AluI gene at 432 bp located on exon 3 and GHR|AluI gene at 298 bp on exon 10 were successfullyamplified by using the techniques of a PCR (polymerase chain reaction and genotyped by PCR-RFLP(restriction fragment length polymorphism then -SSCP (single strand conformation polymorphism. Theresults showed no polymorphisms were detected in these genes. All buffaloes tested had LL genotype forlocus GH|AluI and AA genotype for locus GHR|AluI.
Guenni, K; Aouadi, M; Chatti, K; Salhi-Hannachi, A
2016-10-17
Sequence-related amplified polymorphism (SRAP) markers preferentially amplify open reading frames and were used to study the genetic diversity of Tunisian pistachio. In the present study, 43 Pistacia vera accessions were screened using seven SRAP primer pairs. A total of 78 markers was revealed (95.12%) with an average polymorphic information content of 0.850. The results suggest that there is strong genetic differentiation, which characterizes the local resources (G ST = 0.307). High gene flow (N m = 1.127) among groups was explained by the exchange of plant material among regions. Analysis of molecular variance revealed significant differences within groups and showed that 73.88% of the total genetic diversity occurred within groups, whereas the remaining 26.12% occurred among groups. Bayesian clustering and principal component analysis identified three pools, El Guettar, Pollenizers, and the rest of the pistachios belonging to the Gabès, Kasserine, and Sfax localities. Bayesian analysis revealed that El Guettar and male genotypes were assigned with more than 80% probability. The BayeScan method proposed that locus 59 (F13-R9) could be used in the development of sex-linked SCAR markers from SRAP since it is a commonly detected locus in comparisons involving the Pollenizers group. This is the first application of SRAP markers for the assessment of genetic diversity in Tunisian germplasm of P. vera. Such information will be useful to define conservation strategies and improvement programs for this species.
Patil, Tejas Suresh; Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Bhosale, Amrut Ravindra; Govindwar, Sanjay Prabhu; Muley, Dipak Vishwanathrao
2016-01-01
Genus Nemacheilus, Nemachilichthys and Schistura belong to the family Nemacheilidae of the order Cypriniformes. The present investigation was undertaken to observe genetic diversity, phylogenetic relationship and to develop a molecular-based tool for taxonomic identification. For this purpose, four different types of molecular markers were utilized in which 29 random amplified polymorphic DNA (RAPD), 25 inter-simple sequence repeat (ISSR) markers, and 10 amplified fragment length polymorphism (AFLP) marker sets were screened and mitochondrial COI gene was sequenced. This study added COI barcodes for the identification of Nemacheilus anguilla, Nemachilichthys rueppelli and Schistura denisoni. RAPD showed higher polymorphism (100%) than the ISSR (93.75-100%) and AFLP (93.86-98.96%). The polymorphic information content (PIC), heterozygosity, multiplex ratio, and gene diversity was observed highest for AFLP primers, whereas the major allele frequency was observed higher for RAPD (0.5556) and lowest for AFLP (0.1667). The COI region of all individuals was successfully amplified and sequenced, which gave a 100% species resolution. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.
Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan
2015-09-01
Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.
Directory of Open Access Journals (Sweden)
Huyen Mai NT
2013-02-01
Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.
Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM
Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis
Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.
2003-01-01
Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis
Wang, Haibin; Jiang, Jiafu; Chen, Sumei; Qi, Xiangyu; Fang, Weimin; Guan, Zhiyong; Teng, Nianjun; Liao, Yuan; Chen, Fadi
2014-01-01
The Asteraceae family is at the forefront of the evolution due to frequent hybridization. Hybridization is associated with the induction of widespread genetic and epigenetic changes and has played an important role in the evolution of many plant taxa. We attempted the intergeneric cross Chrysanthemum morifolium × Leucanthemum paludosum. To obtain the success in cross, we have to turn to ovule rescue. DNA profiling of the amphihaploid and amphidiploid was investigated using amplified fragment length polymorphism, sequence-related amplified polymorphism, start codon targeted polymorphism, and methylation-sensitive amplification polymorphism (MSAP). Hybridization induced rapid changes at the genetic and the epigenetic levels. The genetic changes mainly involved loss of parental fragments and gaining of novel fragments, and some eliminated sequences possibly from the noncoding region of L. paludosum. The MSAP analysis indicated that the level of DNA methylation was lower in the amphiploid (∼45%) than in the parental lines (51.5–50.6%), whereas it increased after amphidiploid formation. Events associated with intergeneric genomic shock were a feature of C. morifolium × L. paludosum hybrid, given that the genetic relationship between the parental species is relatively distant. Our results provide genetic and epigenetic evidence for understanding genomic shock in wide crosses between species in Asteraceae and suggest a need to expand our current evolutionary framework to encompass a genetic/epigenetic dimension when seeking to understand wide crosses. PMID:24407856
Wang, Haibin; Jiang, Jiafu; Chen, Sumei; Qi, Xiangyu; Fang, Weimin; Guan, Zhiyong; Teng, Nianjun; Liao, Yuan; Chen, Fadi
2014-01-01
The Asteraceae family is at the forefront of the evolution due to frequent hybridization. Hybridization is associated with the induction of widespread genetic and epigenetic changes and has played an important role in the evolution of many plant taxa. We attempted the intergeneric cross Chrysanthemum morifolium × Leucanthemum paludosum. To obtain the success in cross, we have to turn to ovule rescue. DNA profiling of the amphihaploid and amphidiploid was investigated using amplified fragment length polymorphism, sequence-related amplified polymorphism, start codon targeted polymorphism, and methylation-sensitive amplification polymorphism (MSAP). Hybridization induced rapid changes at the genetic and the epigenetic levels. The genetic changes mainly involved loss of parental fragments and gaining of novel fragments, and some eliminated sequences possibly from the noncoding region of L. paludosum. The MSAP analysis indicated that the level of DNA methylation was lower in the amphiploid (∼45%) than in the parental lines (51.5-50.6%), whereas it increased after amphidiploid formation. Events associated with intergeneric genomic shock were a feature of C. morifolium × L. paludosum hybrid, given that the genetic relationship between the parental species is relatively distant. Our results provide genetic and epigenetic evidence for understanding genomic shock in wide crosses between species in Asteraceae and suggest a need to expand our current evolutionary framework to encompass a genetic/epigenetic dimension when seeking to understand wide crosses.
Directory of Open Access Journals (Sweden)
Santos Carlos A.F.
2002-01-01
Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.
DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.
García-Vilchis, David; Aranda-Anzaldo, Armando
2017-12-01
Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Assessment of genetic diversity in okra (abelmoschus esculentus l.) using rapd markers
International Nuclear Information System (INIS)
Haq, I.; Khan, A.A.; Azmat, M.A.
2013-01-01
Thirty nine okra genotypes were assessed for genetic variability using Random Amplified Polymorphic DNA (RAPD) markers. Twenty polymorphic RAPD primers amplified 111 DNA fragments, with an average of 5.5 fragments per primer. Among 39 okra genotypes, 107 fragments (96%) were found to be polymorphic. The UPGMA cluster analysis placed okra genotypes into seven main clusters. Sabzpari 2001 and Acc. No. 019221 had shown maximum similarity (83%) while the minimum similarity (44.14%) was observed between the genotypes Punjab Selection and Acc. No. 019217. Thus, by using RAPD primers a considerable polymorphism appeared to exist, which showed genetic variability in the okra genotypes. (author)
Institute of Scientific and Technical Information of China (English)
Jiren Zhang; Yubo Wang; Jincheng Zhang
2012-01-01
A preliminary study by our research group showed that 6-mm-long regeneration chamber bridging is equivalent to autologous nerve transplantation for the repair of 12-mm nerve defects.In this study,we compared the efficacy of different lengths (6,8,10 mm) of nerve fragments bridging 6-mm regeneration chambers for the repair of 12-mm-long nerve defects.At 16 weeks after the regeneration chamber was implanted,the number,diameter and myelin sheath thickness of the regenerated nerve fibers,as well as the conduction velocity of the sciatic nerve and gastrocnemius muscle wet weight ratio,were similar to that observed with autologous nerve transplantation.Our results demonstrate that 6-,8-and 10-mm-long nerve fragments bridging 6-mm regeneration chambers effectively repair 12-mm-long nerve defects.Because the chemoattractive capacity is not affected by the length of the nerve fragment,we suggest adopting 6-mm-long nerve fragments for the repair of peripheral nerve defects.
Wang, L F; Ding, Y J; Zhao, Q; Zhang, X L
2015-12-09
We conducted a case-control study to investigate the association between 3 common NALP3 polymorphisms (rs10754558, rs7512998, and rs12137901) and the susceptibility to primary gout. A total of 320 patients with primary gout and 320 controls were included in this study. The genotyping of NALP3 rs10754558, rs7512998, and rs12137901 were conducted by polymerase chain reaction-restriction fragment length polymorphism. Comparison analysis showed that primary gout patients were more likely to have higher body mass index, prevalence of hypertension, blood glucose, triglycerides, urea nitrogen, and uric acid (P gene polymorphisms and the risk of primary gout.
Peredo, Elena L; Revilla, M Angeles; Arroyo-García, Rosa
2006-10-01
Organogenic calli induced from internodal segments were subcultured three times. Regenerated plants obtained from each subculture were analysed by molecular methods. No major genetic rearrangements were detected in the callus-derived plants since none of the amplified fragment-length polymorphism (AFLP) loci were found to be polymorphic. However, epigenetic changes due to a demethylation process were detected by methylation-sensitive amplified polymorphism (MSAP) technique. The results allowed inference of the possible relationship among the plants derived from different calli subcultures and the in vitro control. The plants recovered from the first and second callus subcultures clustered with the in vitro control pools in the phenogram while the regenerants from the third callus subculture showed the highest genetic distance with the controls. This is the first study reporting data about the genetic stability of callus-derived Humulus lupulus L. plants.
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Does epigenetic polymorphism contribute to phenotypic variances in Jatropha curcas L.?
Directory of Open Access Journals (Sweden)
Bui Ha TN
2010-11-01
Full Text Available Abstract Background There is a growing interest in Jatropha curcas L. (jatropha as a biodiesel feedstock plant. Variations in its morphology and seed productivity have been well documented. However, there is the lack of systematic comparative evaluation of distinct collections under same climate and agronomic practices. With the several reports on low genetic diversity in jatropha collections, there is uncertainty on genetic contribution to jatropha morphology. Result In this study, five populations of jatropha plants collected from China (CN, Indonesia (MD, Suriname (SU, Tanzania (AF and India (TN were planted in one farm under the same agronomic practices. Their agronomic traits (branching pattern, height, diameter of canopy, time to first flowering, dormancy, accumulated seed yield and oil content were observed and tracked for two years. Significant variations were found for all the agronomic traits studied. Genetic diversity and epigenetic diversity were evaluated using florescence Amplified Fragment Length Polymorphism (fAFLP and methylation sensitive florescence AFLP (MfAFLP methods. Very low level of genetic diversity was detected (polymorphic band Conclusion Our study confirmed climate and practice independent differences in agronomic performance among jatropha collections. Such agronomic trait variations, however, were matched by very low genetic diversity and medium level but significant epigenetic diversity. Significant difference in inner cytosine and double cytosine methylation at CCGG sites was also found among populations. Most epigenetic differential markers can be inherited as epialleles following Mendelian segregation. These results suggest possible involvement of epigenetics in jatropha development.
Wang, Y S; Liu, Z Y; Li, Y F; Zhang, Y; Yang, X F; Feng, H
2013-04-02
Artistic diversiform leaf color is an important agronomic trait that affects the market value of ornamental kale. In the present study, genetic analysis showed that a single-dominant gene, Re (red leaf), determines the red leaf trait in ornamental kale. An F2 population consisting of 500 individuals from the cross of a red leaf double-haploid line 'D05' with a white leaf double-haploid line 'D10' was analyzed for the red leaf trait. By combining bulked segregant analysis and sequence-related amplified polymorphism technology, we identified 3 markers linked to the Re/re locus. A genetic map of the Re locus was constructed using these sequence-related amplified polymorphism markers. Two of the markers, Me8Em4 and Me8Em17, were located on one side of Re/re at distances of 2.2 and 6.4 cM, whereas the other marker, Me9Em11, was located on the other side of Re/re at a distance of 3.7 cM. These markers could be helpful for the subsequent cloning of the red trait gene and marker-assisted selection in ornamental kale breeding programs.
Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu
2014-12-15
A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.
Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas
2012-08-01
The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.
Directory of Open Access Journals (Sweden)
Evânia Galvão Mendonça
2014-01-01
Full Text Available The objective of this study was to assess the genetic variability in two natural populations of Calophyllum brasiliense located along two different rivers in the state of Minas Gerais, Brazil, using RAPD molecular markers. Eighty-two polymorphic fragments were amplified using 27 primers. The values obtained for Shannon index (I were 0.513 and 0.530 for the populations located on the margins of the Rio Grande and Rio das Mortes, respectively, demonstrating the high genetic diversity in the studied populations. Nei’s genetic diversity (He was 0.341 for the Rio Grande population and 0.357 for the Rio das Mortes population. These results were not significantly different between populations and suggest a large proportion of heterozygote individuals within both populations. AMOVA showed that 70.42% of the genetic variability is found within populations and 29.58% is found among populations (ФST=0.2958. The analysis of kinship coefficients detected the existence of family structures in both populations. Average kinship coefficients between neighboring individuals were 0.053 (P<0.001 in Rio das Mortes and 0.040 (P<0.001 in Rio Grande. This could be due to restricted pollen and seed dispersal and the history of anthropogenic disturbance in the area. These factors are likely to contribute to the relatedness observed among these genotypes.
DNA polymorphism of HLA class II genes in systemic lupus erythematosus
DEFF Research Database (Denmark)
Cowland, J B; Andersen, V; Halberg, P
1994-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3......- and DRw6-associated 7.00 kb DRB TaqI DNA fragment was found in SLE patients compared to normal controls (83.3% vs 35.5%; RR = 9.1, p 1*0501-associated 4.56 kb DQA TaqI fragment and the DRB3*01/03-associated 9.79 kb TaqI fragment were also found to be significantly...... increased in SLE patients (70.8% vs 29.7%; RR = 5.8, p 1%; RR = 4.3, p
Sekar, Sandhya; Karanth, Praveen
2013-01-01
High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.
[Polymorphism of vitamin D receptor gene Fok I in Mongolian population of China].
Xing, Shao-ji; Zhou, Li-she; Xu, Xiu-ju
2006-04-01
To investigate the polymorphism distribution of vitamin D receptor (VDR) gene Fok I in Mongolian population of China. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to analyze three genotypes FF, Ff and ff in the start codon of VDR gene (Fok I) in unrelated normal healthy Mongolian individuals of China. In the population, we obtained the allelic frequencies of 57% and 43% for (F) and (f) allele and the percentage of genotypes FF, Ff and ff to be 31%, 52%, and 17% respectively. The polymorphism frequency and distribution of this VDR gene Fok I in Mongolian population of China exhibit its own characteristics.
Dalva, Monica; El Jellas, Khadija; Steine, Solrun J; Johansson, Bente B; Ringdal, Monika; Torsvik, Janniche; Immervoll, Heike; Hoem, Dag; Laemmerhirt, Felix; Simon, Peter; Lerch, Markus M; Johansson, Stefan; Njølstad, Pål R; Weiss, Frank U; Fjeld, Karianne; Molven, Anders
We have recently described copy number variants (CNVs) of the human carboxyl-ester lipase (CEL) gene, including a recombined deletion allele (CEL-HYB) that is a genetic risk factor for chronic pancreatitis. Associations with pancreatic disease have also been reported for the variable number of tandem repeat (VNTR) region located in CEL exon 11. Here, we examined if CEL CNVs and VNTR length polymorphisms affect the risk for developing pancreatic cancer. CEL CNVs and VNTR were genotyped in a German family with non-alcoholic chronic pancreatitis and pancreatic cancer, in 265 German and 197 Norwegian patients diagnosed with pancreatic adenocarcinoma, and in 882 controls. CNV screening was performed using PCR assays followed by agarose gel electrophoresis whereas VNTR lengths were determined by DNA fragment analysis. The investigated family was CEL-HYB-positive. However, an association of CEL-HYB or a duplication CEL allele with pancreatic cancer was not seen in our two patient cohorts. The frequency of the 23-repeat VNTR allele was borderline significant in Norwegian cases compared to controls (1.2% vs. 0.3%; P = 0.05). For all other VNTR lengths, no statistically significant difference in frequency was observed. Moreover, no association with pancreatic cancer was detected when CEL VNTR lengths were pooled into groups of short, normal or long alleles. We could not demonstrate an association between CEL CNVs and pancreatic cancer. An association is also unlikely for CEL VNTR lengths, although analyses in larger materials are necessary to completely exclude an effect of rare VNTR alleles. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Fyhrquist, Frej; Eriksson, Anders; Saijonmaa, Outi
2013-01-01
INTRODUCTION: Short telomeres are often associated with cardiovascular risk factors and age-related diseases, while the angiotensin converting enzyme (ACE) gene insertion/deletion polymorphism (DD, ID, II) has shown such associations less consistently. We hypothesized that telomere length...... and association of telomere length with cardiovascular risk is affected by ACE (I/D) genotype. METHODS: We measured leucocyte telomere length (LTL) by Southern blot and analysed ACE I/D genotypes in 1249 subjects with hypertension and left ventricular hypertrophy (LVH). We examined interactions of ACE I...
Mohler, Volker; Zeller, Friedrich J; Hsam, Sai L K
2012-05-01
Powdery mildew is a prevalent fungal disease affecting oat (Avena sativa L.) production in Europe. Common oat cultivar Rollo was previously shown to carry the powdery mildew resistance gene Eg-3 in common with cultivar Mostyn. The resistance gene was mapped with restriction fragment length polymorphism (RFLP) markers from Triticeae group-1 chromosomes using a population of F(3) lines from a cross between A. byzantina cv. Kanota and A. sativa cv. Rollo. This comparative mapping approach positioned Eg-3 between cDNA-RFLP marker loci cmwg706 and cmwg733. Since both marker loci were derived from the long arm of barley chromosome 1H, the subchromosomal location of Eg-3 was assumed to be on the long arm of oat chromosome 17. Amplified fragment length polymorphism (AFLP) marker technology featured as an efficient means for obtaining markers closely linked to Eg-3.
Saeidi, Hojjatollah; Rahiminejad, Mohammad Reza; Heslop-Harrison, J S
2008-04-01
The diploid goat grass Aegilops tauschii (2n = 2x = 14) is native to the Middle East and is the D-genome donor to hexaploid bread wheat. The aim of this study was to measure the diversity of different subspecies and varieties of wild Ae. tauschii collected across the major areas where it grows in Iran and to examine patterns of diversity related to the taxa and geography. Inter-retroelement amplified polymorphism (IRAP) markers were used to analyse the biodiversity of DNA from 57 accessions of Ae. tauschii from northern and central Iran, and two hexaploid wheats. Key Results Eight IRAP primer combinations amplified a total of 171 distinct DNA fragments between 180 and 3200 bp long from the accessions, of which 169 were polymorphic. On average, about eight fragments were amplified with each primer combination, with more bands being amplified from accessions from the north-west of the country than from other accessions. The IRAP markers showed high levels of genetic diversity. Analysis of all accessions together did not allow the allocation of individuals to taxa based on morphology, but showed a tendency to put accessions from the north-west apart from others regions. It is speculated that this could be due to different activity of retroelements in the different regions. Within the two taxa with most accessions, there was a range of IRAP genotypes that could be correlated closely with geographical origin. This supports suggestions that the centre of origin of the species is towards the south-east of the Caspian Sea. IRAP is an appropriate marker system to evaluate genetic diversity and evolutionary relationships within the taxa, but it is too variable to define the taxa themselves, where more slowly evolving morphological, DNA sequence or chromosomal makers may be more appropriate.
Association of ghrelin polymorphisms with metabolic syndrome in Han Nationality Chinese.
Xu, Ling-Ling; Xiang, Hong-Ding; Qiu, Chang-Chun; Xu, Qun
2008-06-01
To investigate the association of ghrelin gene polymorphisms with metabolic syndrome in Han Nationality Chinese. A total of 240 patients with metabolic syndrome and 427 adults aged above forty years were recruited. Genotypes were determined by polymerase chain reaction and restriction fragment length polymorphism analysis. The allelic frequency of the Leu72Met polymorphism was 17.3% in the patient group and 11.9% in the control group (chi2 = 7.36, P = 0.007). Metabolic syndrome was more prevalent among carriers of the Met72 variant (43.8 vs 33.1%, age- and sex-adjusted odds ratio = 1.57, P = 0.01). No Arg51Gln variants were found in our study subjects. Rather than being associated with its individual components, Leu72Met polymorphism is associated with metabolic syndrome in the Han Nationality Chinese. Arg51Gln polymorphism is rare in the Han Nationality Chinese.
Shan, X H; Li, Y D; Liu, X M; Wu, Y; Zhang, M Z; Guo, W L; Liu, B; Yuan, Y P
2012-08-17
We analyzed genetic diversity and population genetic structure of four artificial populations of wild barley (Hordeum brevisubulatum); 96 plants collected from the Songnen Prairie in northeastern China were analyzed using amplified fragment length polymorphism (AFLP), specific-sequence amplified polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) markers. Indices of (epi-)genetic diversity, (epi-)genetic distance, gene flow, genotype frequency, cluster analysis, PCA analysis and AMOVA analysis generated from MSAP, AFLP and SSAP markers had the same trend. We found a high level of correlation in the artificial populations between MSAP, SSAP and AFLP markers by the Mantel test (r > 0.8). This is incongruent with previous findings showing that there is virtually no correlation between DNA methylation polymorphism and classical genetic variation; the high level of genetic polymorphism could be a result of epigenetic regulation. We compared our results with data from natural populations. The population diversity of the artificial populations was lower. However, different from what was found using AFLP and SSAP, based on MSAP results the methylation polymorphism of the artificial populations was not significantly reduced. This leads us to suggest that the DNA methylation pattern change in H. brevisubulatum populations is not only related to DNA sequence variation, but is also regulated by other controlling systems.
Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C
2007-03-01
Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.
TARC: Carlo Rubbia's Energy Amplifier
Laurent Guiraud
1997-01-01
Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.
How to interpret methylation sensitive amplified polymorphism (MSAP) profiles?
Fulneček, Jaroslav; Kovařík, Aleš
2014-01-06
DNA methylation plays a key role in development, contributes to genome stability, and may also respond to external factors supporting adaptation and evolution. To connect different types of stimuli with particular biological processes, identifying genome regions with altered 5-methylcytosine distribution at a genome-wide scale is important. Many researchers are using the simple, reliable, and relatively inexpensive Methylation Sensitive Amplified Polymorphism (MSAP) method that is particularly useful in studies of epigenetic variation. However, electrophoretic patterns produced by the method are rather difficult to interpret, particularly when MspI and HpaII isoschizomers are used because these enzymes are methylation-sensitive, and any C within the CCGG recognition motif can be methylated in plant DNA. Here, we evaluate MSAP patterns with respect to current knowledge of the enzyme activities and the level and distribution of 5-methylcytosine in plant and vertebrate genomes. We discuss potential caveats related to complex MSAP patterns and provide clues regarding how to interpret them. We further show that addition of combined HpaII + MspI digestion would assist in the interpretation of the most controversial MSAP pattern represented by the signal in the HpaII but not in the MspI profile. We recommend modification of the MSAP protocol that definitely discerns between putative hemimethylated mCCGG and internal CmCGG sites. We believe that our view and the simple improvement will assist in correct MSAP data interpretation.
Analysis of three polymorphisms in Bidayuh ethnic of Sarawak ...
African Journals Online (AJOL)
Insertion/deletion polymorphism of YAP (DYS287), M96 and M120 polymorphisms in Bidayuh ethnic populations of Sarawak, Malaysia were analyzed in this study. Genomic DNA was extracted from 180 buccal samples and amplified by Hot-Start PCR method. The amplified PCR products were separated by using 2% ...
DEFF Research Database (Denmark)
Hviid, T V; Madsen, H O; Morling, N
1992-01-01
endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...
Sofyanti, Ervina; Boel, Trelia; Soegiharto, Benny; Ilyas, Syafruddin; Irani Nainggolan, Lidya; Auerkari, Elza Ibrahim
2018-03-01
Pituitary Homeobox 2 (PITX2), is an active gene as a paired-related homeobox gene that encodes multiple isoforms. Its Nodal pathway in determination of left-right patterning during embryogenesis has been reported in satellite cells and expressed in adult human skeletal muscle. PITX2A and PITX2B are produced by alternative splicing and used of different promoters. PITX2C uses an alternative promoter located upstream of exon 4. PITX2D is produced by PITX2C alternative promoter and differential splicing. The 5’-primers and 3’- antisense primer were unique for each isoforms. Variability measurement in vertical dimension showed stronger genetic component than sagittal. This study aims to obtain the genotype marker of vertical mandibular asymmetry related to PITX2A and PITX2D isoform by visualization of the amplified product on stained gel to allele specific oligonucleotide between the case and control with Restriction Fragment Length Polymorphism (RFLP). Determination of vertical mandibular asymmetry based on condylar height asymmetry index of pre-treatment panoramic radiograph using Kjellberg’s technique whilst vertical mandibular growth pattern using lateral cephalogram. The differences of condylar height asymmetry in case-control based on vertical growth pattern was compared using Pearson’s chi-squared test. DNA extraction of 129 out-coming orthodontic patients in Universitas Sumatera Utara Dental Hospital were obtained from Buccal swab. Then DNA samples were amplified by Polymerase chain reaction (PCR) and digested with NciI restriction enzyme prior to electrophoresis visualization. There was no significant statistical difference in vertical mandibular asymmetry compared to vertical mandibular growth pattern. The RFLP analysis did not show any polymorphism for PITX2A and PITX2D isoform. All of the samples showed wild type homozygote. Further analysis method, except RFLP, were required to understand the genetic factor in the variance of vertical mandibular
DNA polymorphism of HLA class II genes in primary biliary cirrhosis
DEFF Research Database (Denmark)
Morling, Niels; Dalhoff, K; Fugger, L
1992-01-01
We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary...... than 0.05, 'corrected' P greater than 0.05). No DNA fragments specific for DRB1*0301 (DR3) could be identified. The frequencies in PBC of other genetic markers including DRw8, DRB1*08, HLA-DP antigens, DPA, and DPB genes did not differ significantly from those in controls. The associations between PBC...
Inter simple sequence repeats (ISSR) and random amplified ...
African Journals Online (AJOL)
21 of 30 random amplified polymorphic DNA (RAPD) primers produced 220 reproducible bands with average of 10.47 bands per primer and 80.12% of polymorphism. OPR02 primer showed the highest number of effective allele (Ne), Shannon index (I) and genetic diversity (H). Some of the cultivars had specific bands, ...
Genetic diversity of Santalum album using random amplified ...
African Journals Online (AJOL)
In the present study Random Amplified Polymorphic DNA (RAPD) technique was used to accesses the genetic diversity among 30 accessions of S. album collected from different parts of South India. A total of 248 polymorphic amplicons were obtained from 30 primers. The value of Jaccard coefficient ranged from 0.66 to ...
Quantification of DNA fragmentation in processed foods using real-time PCR.
Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi
2017-07-01
DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Birla, Bhagyashree S; Chou, Hui-Hsien
2015-01-01
Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Directory of Open Access Journals (Sweden)
Bhagyashree S Birla
Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Angiopoietin-2 polymorphism in women with idiopathic recurrent miscarriage.
Pietrowski, Detlef; Tempfer, Clemens; Bettendorf, Hertha; Bürkle, Bernd; Nagele, Fritz; Unfried, Gertrud; Keck, Christoph
2003-10-01
To investigate the relationship between idiopathic recurrent miscarriage and a polymorphism of the gene encoding for angiopoietin-2 (ANGPT2), an autochthonous modulator of angiogenesis during pregnancy. Prospective case control study. Academic research institution. One hundred thirty-one women with a history of three or more consecutive pregnancy losses before 20 weeks' gestation, and 125 healthy, postmenopausal controls with at least two live births and no history of pregnancy loss. Peripheral venous puncture. Polymerase chain reaction and restriction fragment length polymorphism analysis were performed to identify the different ANGPT2 alleles. No association between mutant (mt) allele and the occurrence of idiopathic recurrent miscarriage was found. Between women with primary and secondary idiopathic recurrent miscarriage, no statistically significant differences with respect to allele frequencies were observed. This is the first report on the ANGPT2 gene polymorphism in women with idiopathic recurrent miscarriage, demonstrating that the investigated polymorphism is not associated with idiopathic recurrent miscarriage in a white population.
Khoshdel, Abolfazl; Kheiri, Soleiman; Omidvari, Peyman; Moradi, Fahimeh; Hamidi, Majid; Teimori, Hossein
2017-01-01
Cytokine polymorphisms may contribute to the prevalence of respiratory distress syndrome. The present study was done to investigate the frequency of interleukin- (IL-) 10 and tumor necrosis factor- (TNF-) ? gene polymorphisms and their association with the risk of RDS in preterm infants. One-hundred and nineteen patients with RDS and 119 healthy preterm infants were enrolled. PCR restriction fragment length polymorphism was used to determine the frequency of IL-10 and TNF-? genotypes at -1082...
Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng
2008-06-01
Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.
Association of Genetic Polymorphisms in TNF and MIF Gene with the Risk of Primary Dysmenorrhea.
Dogru, Hatice Yilmaz; Ozsoy, Asker Zeki; Karakus, Nevin; Delibas, Ilhan Bahri; Isguder, Cigdem Kunt; Yigit, Serbulent
2016-08-01
Primary dysmenorrhea, which affects 90 % of adolescent girls and more than 50 % of menstruating women worldwide, is characterized by recurrent pain during menses in the absence of a detectable organic disease. The aim of this study is to assess the association between MIF -173 and TNF -308 genetic polymorphisms and the clinical features of primary dysmenorrhea. The study population comprised 154 unrelated female patients with clinical diagnosis of dysmenorrhea, and a total of 144 control subjects were recruited consecutively. The MIF -173G > C promoter polymorphism (rs755622) and TNF gene -308G > A (rs1800629) polymorphism were analyzed by polymerase chain reaction-based restriction fragment length polymorphism assay. Two fragments (268 and 97 bp) were seen when the G allele was present at position -173, and three fragments (206, 97, and 62 bp) were observed when the C allele was present. Two fragments (87 and 20 bp) were seen when G allele was present at position -308. There were statistically significant associations between age at menarche and history of back pain among dysmenorrhea patients and MIF gene -173G > C polymorphism (p = 0.003 and p = 0.042, respectively). The genotype and allele frequencies of -308G > A polymorphism showed statistically significant differences between dysmenorrhea patients and controls (p = 0.023 and p = 0.009, respectively). A high association was also observed when the patients were compared with the controls according to the GG genotype versus GA+AA genotypes (p = 0.009). The present study showed that the TNF-α -308 GG genotype may be a useful tool to predict the susceptibility of dysmenorrhea.
Molecular typing of Sarcocystis neurona: current status and future trends.
Elsheikha, Hany M; Mansfield, Linda S
2007-10-21
Sarcocystis neurona is an important protozoal pathogen because it causes the serious neurological disease equine protozoal myeloencephalitis (EPM). The capacity of this organism to cause a wide spectrum of neurological signs in horses and the broad geographic distribution of observed cases in the Americas drive the need for sensitive, reliable and rapid typing methods to characterize strains. Various molecular methods have been developed and used to diagnose EPM due to S. neurona, to identify S. neurona isolates and to determine the heterogeneity and evolutionary relatedness within this species and related Sarcocystis spp. These methods included sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), immuno-fluorescent assay (IFA), slide agglutination test (SAT), SnSAG-specific ELISA, random amplified polymorphic DNA (RAPD), PCR-based restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP) fingerprinting, and sequence analysis of surface protein genes, ribosomal genes, microsatellite alleles and other molecular markers. Here, the utility of these molecular methods is reviewed and evaluated with respect to the need for molecular approaches that utilize well-characterized polymorphic, simple, independent, and stable genetic markers. These tools have the potential to add to knowledge of the genetic population structure of S. neurona and to provide new insights into the pathogenesis of EPM and S. neurona epidemiology. In particular, these methods provide new tools to address the hypothesis that particular genetic variants are associated with adverse clinical outcomes (severe pathotypes). The ultimate goal is to utilize them in future studies to improve treatment and prevention strategies.
Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).
Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J
2014-01-01
DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic
DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa
Directory of Open Access Journals (Sweden)
Xu Yanhao
2017-01-01
Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.
Directory of Open Access Journals (Sweden)
Carmen Elisa Posso
2003-06-01
Full Text Available Random amplified polymorphic DNA (RAPD markers were used to analyze 119 DNA samples of three Colombian Anopheles nuneztovari populations to study genetic variation and structure. Genetic diversity, estimated from heterozygosity, averaged 0.34. Genetic flow was greater between the two populations located in Western Colombia (F ST: 0.035; Nm: 6.8 but lower between these two and the northeastern population (F ST: 0.08; Nm: 2.8. According to molecular variance analysis, the genetic distance between populations was significant (phiST 0.1131, P < 0.001. The variation among individuals within populations (phiST 0.8869, P < 0.001was also significant, suggesting a greater degree of population subdivision, not considered in this study. Both the parameters evaluated and the genetic flow suggest that Colombian An. nuneztovari populations are co-specific.
Evolution of finger millet: evidence from random amplified polymorphic DNA.
Hilu, K W
1995-04-01
Finger millet (Eleusine coracana ssp. coracana) is an annual tetraploid member of a predominantly African genus. The crop is believed to have been domesticated from the tetraploid E. coracana ssp. africana. Cytogenetic and isozyme data point to the allopolyploid nature of the species and molecular information has shown E. indica to be one of the genomic donors. A recent isozyme study questioned the proposed phylogenetic relationship between finger millet and its direct ancestor subspecies africana. An approach using random amplified polymorphic DNA (RAPD) was employed in this study to examine genetic diversity and to evaluate hypotheses concerning the evolution of domesticated and wild annual species of Eleusine. Unlike previous molecular approaches, the RAPD study revealed genetic diversity in the crop. The pattern of genetic variation was loosely correlated to geographic distribution. The allotetraploid nature of the crop was confirmed and molecular markers that can possibly identify the other genomic donor were proposed. Genotypes of subspecies africana did not group closely with those of the crop but showed higher affinities to E. indica, reflecting the pattern of similarity revealed by the isozyme study. The multiple origin of subspecies africana could explain the discrepancy between the isozyme-RAPD evidence and previous information. The RAPD study showed the close genetic affinity of E. tristachya to the E. coracana--E. indica group and understood the distinctness of E. multiflora.
Genotyping via Sequence Related Amplified Polymorphism Markers in Fusarium culmorum
Directory of Open Access Journals (Sweden)
Işıl Melis Zümrüt
2018-02-01
Full Text Available Fusarium culmorum is predominating causal agent of head blight (HB and root rot (RR in cereals worldwide. Since F. culmorum has a great level of genetic diversity and the parasexual stage is assumed for this phytopathogen, characterization of isolates from different regions is significant step in food safety and controlling the HB. In this study, it was aimed to characterize totally 37 F. culmorum isolates from Turkey via sequence related amplified polymorphism (SRAP marker based genotyping. MAT-1/MAT-2 type assay was also used in order to reveal intraspecific variation in F. culmorum. MAT-1 and MAT-2 specific primer pairs for mating assays resulted in 210 and 260 bp bands, respectively. 11 of isolates were belonged to MAT-1 type whereas 19 samples were of MAT-2. Remaining 7 samples yielded both amplicons. Totally 9 SRAP primer sets yielded amplicons from all isolates. Genetic similarity values were ranged from 39 to 94.7%. Total band number was 127 and PCR product sizes were in the range of 0.1-2.5 kb. Amplicon numbers for individuals were ranged from 1 to 16. According to data obtained from current study, SRAP based genotyping is powerful tool for supporting the data obtained from investigations including phenotypic and agro-ecological characteristics. Findings showed that SRAP-based markers could be useful in F. culmorum characterization.
Ge, Y; Li, X; Yang, X X; Cui, C S; Qu, S P
2015-05-22
Cucurbita maxima is one of the most widely cultivated vegetables in China and exhibits distinct morphological characteristics. In this study, genetic linkage analysis with 57 simple-sequence repeats, 21 amplified fragment length polymorphisms, 3 random-amplified polymorphic DNA, and one morphological marker revealed 20 genetic linkage groups of C. maxima covering a genetic distance of 991.5 cM with an average of 12.1 cM between adjacent markers. Genetic linkage analysis identified the simple-sequence repeat marker 'PU078072' 5.9 cM away from the locus 'Rc', which controls rind color. The genetic map in the present study will be useful for better mapping, tagging, and cloning of quantitative trait loci/gene(s) affecting economically important traits and for breeding new varieties of C. maxima through marker-assisted selection.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Extensive genetic and DNA methylation variation contribute to heterosis in triploid loquat hybrids.
Liu, Chao; Wang, Mingbo; Wang, Lingli; Guo, Qigao; Liang, Guolu
2018-04-24
We aim to overcome the unclear origin of the loquat and elucidate the heterosis mechanism of the triploid loquat. Here we investigated the genetic and epigenetic variations between the triploid plant and its parental lines using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified fragment length polymorphism (MSAP) analyses. We show that in addition to genetic variations, extensive DNA methylation variation occurred during the formation process of triploid loquat, with the triploid hybrid having increased DNA methylation compared to the parents. Furthermore, a correlation existed between genetic variation and DNA methylation remodeling, suggesting that genome instability may lead to DNA methylation variation or vice versa. Sequence analysis of the MSAP bands revealed that over 53% of them overlap with protein-coding genes, which may indicate a functional role of the differential DNA methylation in gene regulation and hence heterosis phenotypes. Consistent with this, the genetic and epigenetic alterations were associated closely to the heterosis phenotypes of triploid loquat, and this association varied for different traits. Our results suggested that the formation of triploid is accompanied by extensive genetic and DNA methylation variation, and these changes contribute to the heterosis phenotypes of the triploid loquats from the two cross lines.
He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming
2011-01-01
The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.
El-Beshbishy, Hesham A.; Tawfeek, Manal A.; Taha, Inass M.; FadulElahi, Thoraya; Shaheen, Amal Y.; Bardi, Fouad A.; Sultan, Intessar I.
2015-01-01
Objective: Vitamin D receptor (VDR) gene polymorphism have a role in diabetes mellitus pathogenesis. Present study was conducted to determine VDR gene variants among Saudi gestational diabetics (GDM) in Madina, KSA. Methods: This cross sectional study was conducted on 112 GDM patients and 218 normal healthy control. Age, body mass index and blood pressure levels were recorded. Serum triglycerides (mg/dl), total cholesterol, HDL-cholesterol, LDL-cholesterol, fasting blood glucose FBG and post-prandial blood glucose PPBG were estimated. Extracted DNA template was amplified by PCR reaction and genotyped for single nucleotide polymorphism of BsmI and FokI by restriction fragment length polymorphism-PCR (RFLP-PCR) analysis. Results: FBG and PPBG levels in GDM patients were significantly elevated by +48.6% and +50%, respectively (P=0.005). Serum triglycerides, total cholesterol and LDL-cholesterol (mg/dl) levels in GDM patients were elevated significantly by +40.5% (P=0.005), +16% (P=0.01) and +30.8% (P=0.005), respectively. Serum HDL-cholesterol (mg/dl) showed significant decline by -10.5%. FokI VDR genotypes showed association with PPBG (P=0.05) among GDM patients. The Ff, FF and ff genotype percentage among GDM patients was 48.2%, 30.4% and 21.4%, respectively. FokI (F and f) and BsmI (B and b) alleles frequency showed no significant difference between GDM patients and control. Percentage BsmI and FokI total homozygous and heterozygous variants among GDM was 45.5% and 81.4%, respectively. Conclusion: VDR BsmI and FokI polymorphic marker not associated with Saudi GDM. PMID:26870091
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...
Emma Suryati; Lida Puspaningtyas; Utut Widyastuti; Suharsono Suharsono
2013-01-01
Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Ba...
Genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC
International Nuclear Information System (INIS)
Liu Xiaolan; Wang Weili; Zhang Xueying; Hao Ming; Liu Linlin; Wu Zhenfeng; Jiang Hongwei
2008-01-01
Objective: To investigate the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of non-small cell lung cancer (NSCLC). Methods: Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) was used to identify mdm2 genotypes. The Pearson Chi square test and Woolf statistic method were used to analyze the relative risk and 95% confidence interval (CI) in order to find the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC. Results: In the SNP rs1196337 (a G to A base change) AA genotype showed association with cough of NSCLC (P<0.05). Conclusion: The polymorphism of mdm2 gene may be associated with symptom as cough of NSCLC. (authors)
Jobet, E; Bougnoux, M E; Morand, S; Rivault, C; Cloarec, A; Hugot, J P
1998-03-01
Random amplified DNA markers (RAPD; Williams et al., 1990) were used to obtained specific RAPD fragments characterising different species of oxyuroids. We tested six species of worms parasitizing vertebrates or invertebrates: Passalurus ambiguus Rudolphi, 1819, parasite of Leporids; Syphacia obvelata (Rudolphi, 1802) Seurat, 1916, a parasite of rodents; Blatticola blattae (Graeffe, 1860) Chitwood, 1932 parasite of the cockroach Blattella germanica; Hammerschmidtiella diesingi (Hammerschmidt, 1838) Chitwood, 1932 and Thelastoma bulhoesi (Magalhaes, 1990) Travassos, 1929, parasites of the cockroach Periplaneta americana, and an undescribed parasite species of a passalid insect from New Caledonia. Among 15 oligonucleotides tested, nine produced several specific bands allowing the interspecific discrimination.
Research on the relativity between gene polymorphism and children cardiac insufficiency.
He, X-H; Li, C-L; Ling, N; Wang, Q-W; Wang, Z-Z; An, X-J
2017-08-01
We analyzed the relationship between Mink-S27 gene polymorphism and children with cardiac insufficiency. From April 2013 to April 2015, we enrolled 73 cases of children with cardiac insufficiency for this study, and all 73 were placed in the observation group. 76 normal cases were selected for the control group. Restriction fragment length polymorphism (RFLP) was used to make polymorphism analysis of the Mink-S27. Our results showed no significant differences in Mink-S27 genotype and allele distribution in both observation and control groups (p>0.05). In lesion samples collected from children with cardiac insufficiency, we detected significant difference in AA, CC genotype frequency and allele frequency between the observation group and the control group (prelatively high. GNAS2 gene polymorphism was associated with the prevalence of cardiac insufficiency in children. And also the patients' condition was correlated to the frequency of different genotypes and alleles.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Directory of Open Access Journals (Sweden)
Yuming Lu
Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Khayhan, Kantarawee; Hagen, Ferry; Norkaew, Treepradab; Puengchan, Tanpalang; Boekhout, Teun; Sriburee, Pojana
2017-04-01
The pathogenic yeast Cryptococcus gattii was isolated from a tree hollow of a Castanopsis argyrophylla King ex Hook.f. (Fagaceae) in Chiang Mai, Thailand. Molecular characterization with amplified fragment length polymorphism analysis and multi-locus sequence typing showed that this isolate belonged to genotype AFLP4/VGI representing C. gattii sensu stricto. Subsequent comparison of the environmental isolate with those from clinical samples from Thailand showed that they grouped closely together in a single cluster.
Emoto, Takuo; Yamashita, Tomoya; Kobayashi, Toshio; Sasaki, Naoto; Hirota, Yushi; Hayashi, Tomohiro; So, Anna; Kasahara, Kazuyuki; Yodoi, Keiko; Matsumoto, Takuya; Mizoguchi, Taiji; Ogawa, Wataru; Hirata, Ken-Ichi
2017-01-01
The association between atherosclerosis and gut microbiota has been attracting increased attention. We previously demonstrated a possible link between gut microbiota and coronary artery disease. Our aim of this study was to clarify the gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism (T-RFLP). This study included 39 coronary artery disease (CAD) patients and 30 age- and sex- matched no-CAD controls (Ctrls) with coronary risk factors. Bacterial DNA was extracted from their fecal samples and analyzed by T-RFLP and data mining analysis using the classification and regression algorithm. Five additional CAD patients were newly recruited to confirm the reliability of this analysis. Data mining analysis could divide the composition of gut microbiota into 2 characteristic nodes. The CAD group was classified into 4 CAD pattern nodes (35/39 = 90 %), while the Ctrl group was classified into 3 Ctrl pattern nodes (28/30 = 93 %). Five additional CAD samples were applied to the same dividing model, which could validate the accuracy to predict the risk of CAD by data mining analysis. We could demonstrate that operational taxonomic unit 853 (OTU853), OTU657, and OTU990 were determined important both by the data mining method and by the usual statistical comparison. We classified the gut microbiota profiles in coronary artery disease patients using data mining analysis of T-RFLP data and demonstrated the possibility that gut microbiota is a diagnostic marker of suffering from CAD.
Medrano, Mónica; Herrera, Carlos M; Bazaga, Pilar
2014-10-01
The ecological significance of epigenetic variation has been generally inferred from studies on model plants under artificial conditions, but the importance of epigenetic differences between individuals as a source of intraspecific diversity in natural plant populations remains essentially unknown. This study investigates the relationship between epigenetic variation and functional plant diversity by conducting epigenetic (methylation-sensitive amplified fragment length polymorphisms, MSAP) and genetic (amplified fragment length polymorphisms, AFLP) marker-trait association analyses for 20 whole-plant, leaf and regenerative functional traits in a large sample of wild-growing plants of the perennial herb Helleborus foetidus from ten sampling sites in south-eastern Spain. Plants differed widely in functional characteristics, and exhibited greater epigenetic than genetic diversity, as shown by per cent polymorphism of MSAP fragments (92%) or markers (69%) greatly exceeding that for AFLP ones (41%). After controlling for genetic structuring and possible cryptic relatedness, every functional trait considered exhibited a significant association with at least one AFLP or MSAP marker. A total of 27 MSAP (13.0% of total) and 12 AFLP (4.4%) markers were involved in significant associations, which explained on average 8.2% and 8.0% of trait variance, respectively. Individual MSAP markers were more likely to be associated with functional traits than AFLP markers. Between-site differences in multivariate functional diversity were directly related to variation in multilocus epigenetic diversity after multilocus genetic diversity was statistically accounted for. Results suggest that epigenetic variation can be an important source of intraspecific functional diversity in H. foetidus, possibly endowing this species with the capacity to exploit a broad range of ecological conditions despite its modest genetic diversity. © 2014 John Wiley & Sons Ltd.
Francischini, J H M B; Kemper, E L; Costa, J B; Manechini, J R V; Pinto, L R
2017-05-04
Micropropagation is an important tool for large-scale multiplication of plant superior genotypes. However, somaclonal variation is one of the drawbacks of this process. Changes in DNA methylation have been widely reported as one of the main causes of somaclonal variations in plants. In order to investigate the occurrence of changes in the methylation pattern of sugarcane somaclonal variants, the MSAP (methylation-sensitive amplified polymorphism) technique was applied to micro-propagated plantlets sampled at the third subculture phase. The mother plant, in vitro normal plantlets, and in vitro abnormal plantlets (somaclonal variants) of four sugarcane clones were screened against 16 MSAP selective primers for EcoRI/MspI and EcoRI/HpaII restriction enzymes. A total of 1005 and 1200 MSAP-derived markers with polymorphism percentages of 28.36 and 40.67 were obtained for EcoRI/HpaII and EcoRI/MspI restriction enzyme combinations, respectively. The genetic similarity between the mother plant and the somaclonal variants ranged from 0.877 to 0.911 (EcoRI/MspI) and from 0.928 to 0.955 (EcoRI/HpaII). Most of the MASPs among mother plant and micro-propagated plantlets were derived from EcoRI/MspI restriction enzymes suggesting alteration due to gain or loss of internal cytosine methylation. A higher rate of loss of methylation (hypomethylation) than gain of methylation (hypermethylation) was observed in the abnormal in vitro sugarcane plantlets. Although changes in the methylation pattern were also observed in the in vitro normal plantlets, they were lower than those observed for the in vitro abnormal plantlets. The MASP technique proved to be a promising tool to early assessment of genetic fidelity of micro-propagated sugarcane plants.
Jo, Ick-Hyun; Sung, Jwakyung; Hong, Chi-Eun; Raveendar, Sebastin; Bang, Kyong-Hwan; Chung, Jong-Wook
2018-05-01
Licorice ( Glycyrrhiza glabra ) is an important medicinal crop often used as health foods or medicine worldwide. The molecular genetics of licorice is under scarce owing to lack of molecular markers. Here, we have developed cleaved amplified polymorphic sequence (CAPS) and high-resolution melting (HRM) markers based on single nucleotide polymorphisms (SNP) by comparing the chloroplast genomes of two Glycyrrhiza species ( G. glabra and G. lepidota ). The CAPS and HRM markers were tested for diversity analysis with 24 Glycyrrhiza accessions. The restriction profiles generated with CAPS markers classified the accessions (2-4 genotypes) and melting curves (2-3) were obtained from the HRM markers. The number of alleles and major allele frequency were 2-6 and 0.31-0.92, respectively. The genetic distance and polymorphism information content values were 0.16-0.76 and 0.15-0.72, respectively. The phylogenetic relationships among the 24 accessions were estimated using a dendrogram, which classified them into four clades. Except clade III, the remaining three clades included the same species, confirming interspecies genetic correlation. These 18 CAPS and HRM markers might be helpful for genetic diversity assessment and rapid identification of licorice species.
Genetic Diversity of Hibiscus tiliaceus (Malvaceae) in China Assessed using AFLP Markers
TANG, TIAN; ZHONG, YANG; JIAN, SHUGUANG; SHI, SUHUA
2003-01-01
Amplified fragment length polymorphism (AFLP) markers were used to investigate the genetic variations within and among nine natural populations of Hibiscus tiliaceus in China. DNA from 145 individuals was amplified with eight primer pairs. No polymorphisms were found among the 20 samples of a marginal population of recent origin probably due to a founder effect. Across the other 125 individuals, 501 of 566 bands (88·5 %) were polymorphic, and 125 unique AFLP phenotypes were observed. Estimates of genetic diversity agreed with life history traits of H. tiliaceus and geographical distribution. AMOVA analysis revealed that most genetic diversity resided within populations (84·8 %), which corresponded to results reported for outcrossing plants. The indirect estimate of gene flow based on ϕST was moderate (Nm = 1·395). Long-distance dispersal of floating seeds and local environments may play an important role in shaping the genetic diversity of the population and the genetic structure of this species. PMID:12930729
Directory of Open Access Journals (Sweden)
Adriaenssens Sandy
2011-08-01
Full Text Available Abstract Background Population extinction risk in a fragmented landscape is related to the differential ability of the species to spread its genes across the landscape. The impact of landscape fragmentation on plant population dynamics will therefore vary across different spatial scales. We quantified successful seed-mediated dispersal of the dioecious shrub Juniperus communis in a fragmented landscape across northwestern Europe by using amplified fragment length polymorphism (AFLP markers. Furthermore we investigated the genetic diversity and structure on two spatial scales: across northwestern Europe and across Flanders (northern Belgium. We also studied whether seed viability and populations size were correlated with genetic diversity. Results Unexpectedly, estimated seed-mediated dispersal rates were quite high and ranged between 3% and 14%. No population differentiation and no spatial genetic structure were detected on the local, Flemish scale. A significant low to moderate genetic differentiation between populations was detected at the regional, northwest European scale (PhiPT = 0.10. In general, geographically nearby populations were also genetically related. High levels of within-population genetic diversity were detected but no correlation was found between any genetic diversity parameter and population size or seed viability. Conclusions In northwestern Europe, landscape fragmentation has lead to a weak isolation-by-distance pattern but not to genetic impoverishment of common juniper. Substantial rates of successful migration by seed-mediated gene flow indicate a high dispersal ability which could enable Juniperus communis to naturally colonize suitable habitats. However, it is not clear whether the observed levels of migration will suffice to counterbalance the effects of genetic drift in small populations on the long run.
Identification of some Rice Mutants using Morphological and Molecular Methods
International Nuclear Information System (INIS)
Sobieh, S.E.S.
2006-01-01
This investigation was conducted at the experimental farm of plant research department, nuclear research center, atomic energy authority, abu zaabal in order to verify four rice genotypes i.e sakha 102, giza 178, high yielding mutant (Ms 6) and high yielding mutant (MG 16). the (UPOV) rice descriptor was used to identify the germplasm morphologically .Molecular RAPD-PCR was used to identify genetic variability on the molecular level for the tested genotypes. 1- the results indicated that according to (UPOV) rice descriptor eight morphological traits were completely different between mutant Ms 6 in comparison with the parent sakha 102 and mut. MG 16 in comparison parent giza 178, the traits were ; stem thickness, stem length, panicle length, 1000-grain weight, grain length, grain width decorticated grain length and decorticated grain width. 2- using 10 arbitrary primers, through four rice genotypes on the molecular level using RAPD markers. the size of the amplified fragments were ranged from 0.201 to 2.036 k bp. two primers OPB-13 and OPB-16 showed no polymorphism among genotypes tested. 3- the total number of amplicons produced by the 8 polymorphic RAPD profiels was 66. the total number of monomorphic amplicons was 32. however, the total number of polymorphic amplicons was 34. 4- the percentage of polymorphism ranged from (22.22%) for primer OPA-18 to (90%) for primer OPB-11. 5-the highest genetic similarity (90.3%) was between sakha 102 and high yielding mut. (Ms 6). the genetic similarity (75.5%) was between giza 178 and high yielding mut.(MG 16). 6- one positive unique marker amplified by OPA-18 Primer identified the high yielding mutant Ms 6 but three positive unique markers amplified by OPB-17 primer and OPA-18 primer identified the high yielding mutant MG 16
Basak, Supriyo; Ramesh, Aadi Moolam; Kesari, Vigya; Parida, Ajay; Mitra, Sudip; Rangan, Latha
2014-12-01
Molecular genetic fingerprints of eleven Hedychium species from Northeast India were developed using PCR based markers. Fifteen inter-simple sequence repeats (ISSRs) and five amplified fragment length polymorphism (AFLP) primers produced 547 polymorphic fragments. Positive correlation (r = 0.46) was observed between the mean genetic similarity and genetic diversity parameters at the inter-species level. AFLP and ISSR markers were able to group the species according to its altitude and intensity of flower aroma. Cophenetic correlation coefficients between the dendrogram and the original similarity matrix were significant for ISSR (r = 0.89) compared to AFLP (r = 0.83) markers. This genetic characterization of Hedychium from Northeast India contributes to the knowledge of genetic structure of the species and can be used to define strategies for their conservation and management.
Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao
2004-01-01
RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.
GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients
International Nuclear Information System (INIS)
Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir
2005-01-01
Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer
P.L.A. van Dalen; C.M. van Duijn (Cornelia); J.C. Birkenhäger (Jan); J.P.T.M. van Leeuwen (Hans); H.A.P. Pols (Huib); A.G. Uitterlinden (André); A. Hofman (Albert)
1996-01-01
textabstractConflicting results have been reported on the association between restriction fragment length polymorphisms (RFLPs) at the vitamin D receptor (VDR) gene locus (i.e., for BsmI, ApaI, and TaqI) and bone mineral density (BMD). We analyzed this association in a large population-based sample
Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T
1997-12-01
A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.
Akdemir, Hülya; Suzerer, Veysel; Tilkat, Engin; Onay, Ahmet; Çiftçi, Yelda Ozden
2016-12-01
Determination of genetic stability of in vitro-grown plantlets is needed for safe and large-scale production of mature trees. In this study, genetic variation of long-term micropropagated mature pistachio developed through direct shoot bud regeneration using apical buds (protocol A) and in vitro-derived leaves (protocol B) was assessed via DNA-based molecular markers. Randomly amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), and amplified fragment length polymorphism (AFLP) were employed, and the obtained PIC values from RAPD (0.226), ISSR (0.220), and AFLP (0.241) showed that micropropagation of pistachio for different periods of time resulted in "reasonable polymorphism" among donor plant and its 18 clones. Mantel's test showed a consistence polymorphism level between marker systems based on similarity matrices. In conclusion, this is the first study on occurrence of genetic variability in long-term micropropagated mature pistachio plantlets. The obtained results clearly indicated that different marker approaches used in this study are reliable for assessing tissue culture-induced variations in long-term cultured pistachio plantlets.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija
1999-01-01
A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 33...
Liu, H D; Zhao, Z G; Du, D Z; Deng, C R; Fu, G
2016-01-08
This study aimed to reveal the genetic and epigenetic variations involved in a resynthesized Brassica napus (AACC) generated from a hybridization between a B. rapa (AA) landrace and B. alboglabra (CC). Amplified fragment length polymorphism (AFLP), methylation-sensitive amplified polymorphism, and the cDNA-AFLP technique were performed to detect changes between different generations at the genome, methylation, and transcription levels. We obtained 30 lines of resynthesized B. napus with a mean 1000-seed weight of over 7.50 g. All of the lines were self-compatible, probably because both parents were self-compatible. At the genome level, the S0 generation had the lowest frequency of variations (0.18%) and the S3 generation had the highest (6.07%). The main variation pattern was the elimination of amplified restriction fragments on the CC genome from the S0 to the S4 generations. At the methylation level, we found three loci that exhibited altered methylation patterns on the parental A genome; the variance rate was 1.35%. At the transcription level, we detected 43.77% reverse mutations and 37.56% deletion mutations that mainly occurred on the A and C genomes, respectively, in the S3 generation. Our results highlight the genetic variations that occur during the diploidization of resynthesized B. napus.
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
Hu, Ke; Yang, Peizeng; Jiang, Zhengxuan; Hou, Shengping; Du, Liping; Li, Fuzhen
2010-07-01
This study investigated the association of rs7574865 polymorphism in STAT4 with Vogt-Koyanagi-Harada (VKH) syndrome and Behçet's disease (BD) in a Chinese Han population. Genotyping of rs7574865 polymorphism in the STAT4 gene was performed using polymerase chain reaction restriction fragment length polymorphisms in 379 VKH patients, 366 BD patients, and 414 controls. Of the samples, 20% were sequenced to validate polymerase chain reaction restriction fragment length polymorphism results. A binary logistic regression analysis was used to assess the influence of the gender on the association of STAT4 polymorphism with BD. A significantly increased frequency of TT genotype of the STAT4 rs7574865 was observed in VKH patients (p = 0.013). GT genotypic frequency was significantly lower in BD patients than in controls (p = 0.003) However the significance of rs7574865 was lost in all tested BD patients when adjusted for gender (p = 0.775). A significantly lower frequency of GT genotype and a significantly higher frequency of GG genotype was found in male BD patients compared with male controls (p = 0.000458 and p = 0.009, respectively). Stratification analysis according to tinnitus, alopecia, poliosis, headache, and vitiligo for VKH syndrome and oral ulceration, genital ulceration, skin lesions and arthritis for BD failed to find any association between the tested single nucleotide polymorphism and any of the extraocular findings. Our results suggest that TT genotype of rs7574865 may be a susceptible factor for VKH syndrome in a Chinese Han population, and that GG genotype of this SNP may confer susceptibility in male BD patients. Crown Copyright 2010. Published by Elsevier Inc. All rights reserved.
Williams, D W; Wilson, M J; Lewis, M A; Potts, A J
1995-01-01
The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.
Lactobacillus hammesii sp. nov., isolated from French sourdough.
Valcheva, Rosica; Korakli, Maher; Onno, Bernard; Prévost, Hervé; Ivanova, Iskra; Ehrmann, Matthias A; Dousset, Xavier; Gänzle, Michael G; Vogel, Rudi F
2005-03-01
Twenty morphologically different strains were chosen from French wheat sourdough isolates. Cells were Gram-positive, non-spore-forming, non-motile rods. The isolates were identified using amplified-fragment length polymorphism, randomly amplified polymorphic DNA and 16S rRNA gene sequence analysis. All isolates were members of the genus Lactobacillus. They were identified as representing Lactobacillus plantarum, Lactobacillus paralimentarius, Lactobacillus sanfranciscensis, Lactobacillus spicheri and Lactobacillus sakei. However, two isolates (LP38(T) and LP39) could be clearly discriminated from recognized Lactobacillus species on the basis of genotyping methods. 16S rRNA gene sequence similarity and DNA-DNA relatedness data indicate that the two strains belong to a novel Lactobacillus species, for which the name Lactobacillus hammesii is proposed. The type strain is LP38(T) (=DSM 16381(T)=CIP 108387(T)=TMW 1.1236(T)).
Epigenetic variability in the genetically uniform forest tree species Pinus pinea L.
Sáez-Laguna, Enrique; Guevara, María-Ángeles; Díaz, Luis-Manuel; Sánchez-Gómez, David; Collada, Carmen; Aranda, Ismael; Cervera, María-Teresa
2014-01-01
There is an increasing interest in understanding the role of epigenetic variability in forest species and how it may contribute to their rapid adaptation to changing environments. In this study we have conducted a genome-wide analysis of cytosine methylation pattern in Pinus pinea, a species characterized by very low levels of genetic variation and a remarkable degree of phenotypic plasticity. DNA methylation profiles of different vegetatively propagated trees from representative natural Spanish populations of P. pinea were analyzed with the Methylation Sensitive Amplified Polymorphism (MSAP) technique. A high degree of cytosine methylation was detected (64.36% of all scored DNA fragments). Furthermore, high levels of epigenetic variation were observed among the studied individuals. This high epigenetic variation found in P. pinea contrasted with the lack of genetic variation based on Amplified Fragment Length Polymorphism (AFLP) data. In this manner, variable epigenetic markers clearly discriminate individuals and differentiates two well represented populations while the lack of genetic variation revealed with the AFLP markers fail to differentiate at both, individual or population levels. In addition, the use of different replicated trees allowed identifying common polymorphic methylation sensitive MSAP markers among replicates of a given propagated tree. This set of MSAPs allowed discrimination of the 70% of the analyzed trees.
Epigenetic variability in the genetically uniform forest tree species Pinus pinea L.
Directory of Open Access Journals (Sweden)
Enrique Sáez-Laguna
Full Text Available There is an increasing interest in understanding the role of epigenetic variability in forest species and how it may contribute to their rapid adaptation to changing environments. In this study we have conducted a genome-wide analysis of cytosine methylation pattern in Pinus pinea, a species characterized by very low levels of genetic variation and a remarkable degree of phenotypic plasticity. DNA methylation profiles of different vegetatively propagated trees from representative natural Spanish populations of P. pinea were analyzed with the Methylation Sensitive Amplified Polymorphism (MSAP technique. A high degree of cytosine methylation was detected (64.36% of all scored DNA fragments. Furthermore, high levels of epigenetic variation were observed among the studied individuals. This high epigenetic variation found in P. pinea contrasted with the lack of genetic variation based on Amplified Fragment Length Polymorphism (AFLP data. In this manner, variable epigenetic markers clearly discriminate individuals and differentiates two well represented populations while the lack of genetic variation revealed with the AFLP markers fail to differentiate at both, individual or population levels. In addition, the use of different replicated trees allowed identifying common polymorphic methylation sensitive MSAP markers among replicates of a given propagated tree. This set of MSAPs allowed discrimination of the 70% of the analyzed trees.
Matsuyama, T; Fukuda, Y; Sakai, T; Tanimoto, N; Nakanishi, M; Nakamura, Y; Takano, T; Nakayasu, C
2017-08-01
Bacterial haemolytic jaundice caused by Ichthyobacterium seriolicida has been responsible for mortality in farmed yellowtail, Seriola quinqueradiata, in western Japan since the 1980s. In this study, polymorphic analysis of I. seriolicida was performed using three molecular methods: amplified fragment length polymorphism (AFLP) analysis, multilocus sequence typing (MLST) and multiple-locus variable-number tandem repeat analysis (MLVA). Twenty-eight isolates were analysed using AFLP, while 31 isolates were examined by MLST and MLVA. No polymorphisms were identified by AFLP analysis using EcoRI and MseI, or by MLST of internal fragments of eight housekeeping genes. However, MLVA revealed variation in repeat numbers of three elements, allowing separation of the isolates into 16 sequence types. The unweighted pair group method using arithmetic averages cluster analysis of the MLVA data identified four major clusters, and all isolates belonged to clonal complexes. It is likely that I. seriolicida populations share a common ancestor, which may be a recently introduced strain. © 2016 John Wiley & Sons Ltd.
PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products
Directory of Open Access Journals (Sweden)
Y. Erwanto
2011-04-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.
Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.
2012-01-01
Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...
Bossolini, Eligio; Klahre, Ulrich; Brandenburg, Anna; Reinhardt, Didier; Kuhlemeier, Cris
2011-01-01
Two linkage maps were constructed for the model plant Petunia. Mapping populations were obtained by crossing the wild species Petunia axillaris subsp. axillaris with Petunia inflata, and Petunia axillaris subsp. parodii with Petunia exserta. Both maps cover the seven chromosomes of Petunia, and span 970 centimorgans (cM) and 700 cM of the genomes, respectively. In total, 207 markers were mapped. Of these, 28 are multilocus amplified fragment length polymorphism (AFLP) markers and 179 are gene...
Trends in plant research using molecular markers.
Garrido-Cardenas, Jose Antonio; Mesa-Valle, Concepción; Manzano-Agugliaro, Francisco
2018-03-01
A deep bibliometric analysis has been carried out, obtaining valuable parameters that facilitate the understanding around the research in plant using molecular markers. The evolution of the improvement in the field of agronomy is fundamental for its adaptation to the new exigencies that the current world context raises. In addition, within these improvements, this article focuses on those related to the biotechnology sector. More specifically, the use of DNA markers that allow the researcher to know the set of genes associated with a particular quantitative trait or QTL. The use of molecular markers is widely extended, including: restriction fragment length polymorphism, random-amplified polymorphic DNA, amplified fragment length polymorphism, microsatellites, and single-nucleotide polymorphisms. In addition to classical methodology, new approaches based on the next generation sequencing are proving to be fundamental. In this article, a historical review of the molecular markers traditionally used in plants, since its birth and how the new molecular tools facilitate the work of plant breeders is carried out. The evolution of the most studied cultures from the point of view of molecular markers is also reviewed and other parameters whose prior knowledge can facilitate the approach of researchers to this field of research are analyzed. The bibliometric analysis of molecular markers in plants shows that top five countries in this research are: US, China, India, France, and Germany, and from 2013, this research is led by China. On the other hand, the basic research using Arabidopsis is deeper in France and Germany, while other countries focused its efforts in their main crops as the US for wheat or maize, while China and India for wheat and rice.
Directory of Open Access Journals (Sweden)
Dolores González
2012-12-01
Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m
Application of randomly amplified polymorphic DNA (RAPD ...
African Journals Online (AJOL)
Jane
2011-10-10
Oct 10, 2011 ... and T7-010 based on functional markers according to He et al. (2007). These primers were constructed by Invitrogen GmbH,. Karlsruhe, Germany, and used to amplify the polyphenol oxidases genes. The sequences of these primers were as follows: T3-001: 5`-CCA TTA ACC CTC ACT AAA GGG ACC GTA ...
Li, Gao-De
2015-01-01
It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...
Molecular epidemiology of Blastocystis
Directory of Open Access Journals (Sweden)
Fadime Eroğlu
2015-12-01
Full Text Available Blastocystis pathogenicity and classification was newly illuminated with molecular genetic studies and recently the parasite was found in the focus of many researchers. Several molecular methods such as; polymerase chain reaction (PCR, PCR-restriction fragment length polymorphism, random amplified polymorphic DNA, real-time polymerase chain reaction and DNA sequencing analyses can be used in genotyping of Blastocystis. Blastocystis parasites may cause diarrhea, abdominal pain, bloating, gas, irritability, anorexia, cramps, vomiting, dehydration, insomnia, nausea, loss of appetite, weight loss, fatigue symptoms and also could be asymptomatic cases. In this review, it was aimed to summarize the associations between Blastocystis subtypes and pathogenicity.
Analysis of genetic variation in Ganoderma Lucidum after space flight
Qi, Jian-Jun; Ma, Rong-Cai; Chen, Xiang-Dong; Lan, Jin
A modified CTAB method was used in the extraction of total cellular DNA of Ganoderma lucidum. Four strains Cx, Ch, C3 and C4, and their counterparts, four space flown strains Sx, Xh, S3 and S4, were analysed by amplified fragment length polymorphism (AFLP) with several primer combinations. Polymorphic bands were detected between Sx and Cx, S3 and C3, respectively. Somatic incompatibility tests further confirmed their heterogeneity. However, no disparity between Sh and Ch, S4 and C4 was detectable. The results suggest that spaceflight may be used to accelerate breeding of Ganoderma lucidum strains for commercial cultivation.
DEFF Research Database (Denmark)
Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels
2005-01-01
The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt....... Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis...
Directory of Open Access Journals (Sweden)
Patrícia Carvalho de Sequeira
2005-11-01
Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.
Bhardwaj, Jyoti; Mahajan, Monika; Yadav, Sudesh Kumar
2013-08-01
DNA methylation is known as an epigenetic modification that affects gene expression in plants. Variation in CpG methylation behavior was studied in two natural horse gram (Macrotyloma uniflorum [Lam.] Verdc.) genotypes, HPKC2 (drought-sensitive) and HPK4 (drought-tolerant). The methylation pattern in both genotypes was studied through methylation-sensitive amplified polymorphism. The results revealed that methylation was higher in HPKC2 (10.1%) than in HPK4 (8.6%). Sequencing demonstrated sequence homology with the DRE binding factor (cbf1), the POZ/BTB protein, and the Ty1-copia retrotransposon among some of the polymorphic fragments showing alteration in methylation behavior. Differences in DNA methylation patterns could explain the differential drought tolerance and the epigenetic signature of these two horse gram genotypes.
Heritable alteration of DNA methylation induced by whole-chromosome aneuploidy in wheat.
Gao, Lihong; Diarso, Moussa; Zhang, Ai; Zhang, Huakun; Dong, Yuzhu; Liu, Lixia; Lv, Zhenling; Liu, Bao
2016-01-01
Aneuploidy causes changes in gene expression and phenotypes in all organisms studied. A previous study in the model plant Arabidopsis thaliana showed that aneuploidy-generated phenotypic changes can be inherited to euploid progenies and implicated an epigenetic underpinning of the heritable variations. Based on an analysis by amplified fragment length polymorphism and methylation-sensitive amplified fragment length polymorphism markers, we found that although genetic changes at the nucleotide sequence level were negligible, extensive changes in cytosine DNA methylation patterns occurred in all studied homeologous group 1 whole-chromosome aneuploid lines of common wheat (Triticum aestivum), with monosomic 1A showing the greatest amount of methylation changes. The changed methylation patterns were inherited by euploid progenies derived from the aneuploid parents. The aneuploidy-induced DNA methylation alterations and their heritability were verified at selected loci by bisulfite sequencing. Our data have provided empirical evidence supporting earlier suggestions that heritability of aneuploidy-generated, but aneuploidy-independent, phenotypic variations may have an epigenetic basis. That at least one type of aneuploidy - monosomic 1A - was able to cause significant epigenetic divergence of the aneuploid plants and their euploid progenies also lends support to recent suggestions that aneuploidy may have played an important and protracted role in polyploid genome evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
A high-power two stage traveling-wave tube amplifier
International Nuclear Information System (INIS)
Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.
1991-01-01
Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length
Directory of Open Access Journals (Sweden)
D. Karam
2004-06-01
Full Text Available The Amplified Fragment Length Polymorphism (AFLP technique was used to access genetic diversity between three domestic and nine wild proso millet biotypes from the United States and Canada. Eight primer combinations detected 39 polymorphic DNA fragments, with the genetic distance estimates among biotypes ranging from 0.02 to 0.04. Colorado-Weld County black seeded and Wyoming-Platte County were the most distinct biotypes according to the dissimilarity level. A UPGMA cluster analysis revealed two distinct groups of proso millet without any geographic association. Six weed biotypes exhibiting some characters of cultivated plants were grouped together with domesticated biotypes of proso millet while the three typical wild phenotypes were clearly clustered into another group according to AFLP markers.A técnica de AFLP (Amplified Fragment Length Polymorphism foi empregada para acessar a diversidade genética entre três biótipos domesticados e nove biótipos selvagens de proso millet dos Estados Unidos e do Canadá. Oito combinações de primers detectaram 39 fragmentos polimórficos de DNA, e a estimativa da distância genética entre os biótipos variou de 0,02 a 0,04. Colorado-Weld County de sementes pretas e Wyoming-Platte County foram os biótipos mais distintos de acordo com o índice de dissimilaridade. A análise de cluster por UPGMA revelou dois grupos distintos de proso millet mas sem nenhuma relação geográfica. Seis biótipos selvagens que exibiam algumas características de plantas cultivadas foram agrupados juntamente com os biótipos domesticados de proso millet, enquanto os três fenótipos tipicamente selvagens formaram outro grupo distinto por marcadores AFLP.
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
Comparison of RAPD, RFLP, AFLP and SSR markers for diversity studies in tropical maize inbred lines
Directory of Open Access Journals (Sweden)
Antonio A. F. Garcia
2004-01-01
Full Text Available In order to compare their relative efficiencies as markers and to find the most suitable marker for maize diversity studies we evaluated 18 inbred tropical maize lines using a number of different loci as markers. The loci used were: 774 amplified fragment length polymorphisms (AFLPs; 262 random amplified polymorphic DNAs (RAPDs; 185 restriction fragment length polymorphisms (RFLPs; and 68 simple sequence repeats (SSR. For estimating genetic distance the AFLP and RFLP markers gave the most correlated results, with a correlation coefficient of r = 0.87. Bootstrap analysis were used to evaluate the number of loci for the markers and the coefficients of variation (CV revealed a skewed distribution. The dominant markers (AFLP and RAPD had small CV values indicating a skewed distribution while the codominant markers gave high CV values. The use of maximum values of genetic distance CVs within each sample size was efficient in determining the number of loci needed to obtain a maximum CV of 10%. The number of RFLP and AFLP loci used was enough to give CV values of below 5%, while the SSRs and RAPD loci gave higher CV values. Except for the RAPD markers, all the markers correlated genetic distance with single cross performance and heterosis which showed that they could be useful in predicting single cross performance and heterosis in intrapopulation crosses for broad-based populations. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationships among tropical maize inbred lines with high accuracy.
DEFF Research Database (Denmark)
Aabenhus, R.; On, Stephen L.W.; Siemer, Berit L.
2005-01-01
Campylobacter concisus has been as frequently isolated from human diarrhea as the important enteropathogen Campylobacter jejuni, but it also occurs in the feces of healthy individuals. The role of C concisus in human disease has been difficult to determine, since the species comprises at least two...... infections. We identified two additional C. concisus genomospecies: genomospecies 3 comprised a single strain from an immunocompetent patient, and genomospecies 4 contained five isolates from severely immunodeficient patients, i.e., organ transplantation recipients or those with hematological malignancies...
Association between INS-VNTR polymorphism and polycystic ovary syndrome in a Korean population.
Yun, Ji-Hyun; Gu, Bon-Hee; Kang, Yu-Bin; Choi, Bum-Chae; Song, Sangjin; Baek, Kwang-Hyun
2012-07-01
Polycystic ovary syndrome (PCOS) is a common disorder in women of reproductive ages. But its etiology is not fully understood yet. Variability in the number of tandem repeats of the insulin gene (INS-VNTR) is known to associate with PCOS, and it is associated with an increased risk of diabetes mellitus and other cardiovascular diseases. The aim of our study was to analyze an association between the INS-VNTR polymorphism and PCOS in a Korean population. The -23/Hph I polymorphism was used as a surrogate marker for INS-VNTR polymorphism and a total of 218 PCOS patient and 141 control DNAs were analyzed by restriction fragment length polymorphism method. Statistical analysis of genotyping results were performed using HapAnalyzer. χ² test and logistic regression were used to analyze the association between two groups. A p value VNTR polymorphism (p = 0.0544, odds ratio = 1.69). Our present data demonstrate that INS-VNTR polymorphism is not related with PCOS in Korean women. Thus, it is suggested that INS-VNTR polymorphism is not a key factor in the etiology and the pathogenesis of PCOS in a Korean population.
Lactobacillus nantensis sp. nov., isolated from French wheat sourdough.
Valcheva, Rosica; Ferchichi, Mounir F; Korakli, Maher; Ivanova, Iskra; Gänzle, Michael G; Vogel, Rudi F; Prévost, Hervé; Onno, Bernard; Dousset, Xavier
2006-03-01
A polyphasic taxonomic study of the bacterial flora isolated from traditional French wheat sourdough, using phenotypic characterization and phylogenetic as well as genetic methods, revealed a consistent group of isolates that could not be assigned to any recognized species. These results were confirmed by randomly amplified polymorphic DNA and amplified fragment length polymorphism fingerprinting analyses. Cells were Gram-positive, homofermentative rods. Comparative 16S rRNA gene sequence analysis of the representative strain LP33T indicated that these strains belong to the genus Lactobacillus and that they formed a branch distinct from their closest relatives Lactobacillus farciminis, Lactobacillus alimentarius, Lactobacillus paralimentarius and Lactobacillus mindensis. DNA-DNA reassociation experiments with the three phylogenetically closest Lactobacillus species confirmed that LP33T (= DSM 16982T = CIP 108546T = TMW 1.1265T) represents the type strain of a novel species, for which the name Lactobacillus nantensis sp. nov. is proposed.
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
DNA Sequences of RAPD Fragments in the Egyptian cotton ...
African Journals Online (AJOL)
Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Prakash, Celine; Haeseler, Arndt Von
2017-03-01
RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.
Molecular identification of Mango, Mangifera indica L.var. totupura
Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar
2011-01-01
Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885
Role of the VDR Bsm I and Apa I polymorphisms in the risk of colorectal cancer in Kashmir.
Rasool, Sabha; Kadla, Showkat A; Rasool, Vamiq; Qazi, Falak; Khan, Tanzeela; Shah, Nisar A; Ganai, Bashir A
2014-01-01
A case-control study aiming to evaluate the relationship between Bsm I and Apa I restriction fragment gene polymorphisms and colorectal cancer (CRC) was carried out in Kashmir, including a total of 368 subjects (180 cases and 188 controls). DNA samples extracted from the blood of the subjects were analyzed for 3' untranslated region (3' UTR) Apa I and Bsm I polymorphisms using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR). A statistically significant 2.7-fold increased risk was observed in individuals found homozygous for the presence of the 'b' allele, in comparison to subjects homozygous for the 'B' allele (odds ratio (OR) 2.7, 95% confidence interval (CI) 1.49-4.86 (Bsm I)), and a statistically insignificant 2-fold increased risk was found among individuals with the 'aa' genotype, as compared to subjects with the 'AA' genotype (OR 2.017, 95% CI 0.86-4.7). Our study also yielded statistically significant results when the Apa I polymorphism was stratified by age (≤ 50 years) and dwelling area (rural area), and the Bsm I polymorphism by gender (male gender), suggesting a possible role of Apa I and Bsm I polymorphisms in the etiology of CRC in Kashmir. We conclude that Apa I and Bsm I single-nucleotide polymorphisms (SNPs) in the vitamin D receptor gene (VDR) might be associated with susceptibility to CRC among Kashmiris. © 2014 S. Karger GmbH, Freiburg.
Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.
Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra
2016-01-01
Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.
Directory of Open Access Journals (Sweden)
Miao Yu
2017-01-01
Full Text Available Purpose. Dental caries is a multifactorial infectious disease. In this study, we investigated whether single nucleotide polymorphisms (SNPs in vitamin D receptor (VDR gene were associated with susceptibility to permanent tooth caries in Chinese adolescents. Method. A total of 200 dental caries patients and 200 healthy controls aged 12 years were genotyped for VDR gene polymorphisms using the PCR-restriction fragment length polymorphism (PCR-RFLP assay. All of them were examined for their oral and dental status with the WHO criteria, and clinical information such as the Decayed Missing Filled Teeth Index (DMFT was evaluated. Genomic DNA was extracted from the buccal epithelial cells. The four polymorphic SNPs (Bsm I, Taq I, Apa I, and Fok I in VDR were assessed for both genotypic and phenotypic susceptibilities. Results. Among the four examined VDR gene polymorphisms, the increased frequency of the CT and CC genotype of the Fok I VDR gene polymorphism was associated with dental caries in 12-year-old adolescent, compared with the controls (X2 = 17.813, p≤0.001. Moreover, Fok I polymorphic allele C frequency was significantly increased in the dental caries cases, compared to the controls (X2 = 14.144, p≤0.001, OR = 1.730, 95% CI = 1.299–2.303. However, the other three VDR gene polymorphisms (Bsm I, Taq I, and Apa I showed no statistically significant differences in the caries groups compared with the controls. Conclusion. VDR-Fok I gene polymorphisms may be associated with susceptibility to permanent tooth caries in Chinese adolescent.
A Brief Review of Molecular Techniques to Assess Plant Diversity
Directory of Open Access Journals (Sweden)
Ibrahim A. Arif
2010-05-01
Full Text Available Massive loss of valuable plant species in the past centuries and its adverse impact on environmental and socioeconomic values has triggered the conservation of plant resources. Appropriate identification and characterization of plant materials is essential for the successful conservation of plant resources and to ensure their sustainable use. Molecular tools developed in the past few years provide easy, less laborious means for assigning known and unknown plant taxa. These techniques answer many new evolutionary and taxonomic questions, which were not previously possible with only phenotypic methods. Molecular techniques such as DNA barcoding, random amplified polymorphic DNA (RAPD, amplified fragment length polymorphism (AFLP, microsatellites and single nucleotide polymorphisms (SNP have recently been used for plant diversity studies. Each technique has its own advantages and limitations. These techniques differ in their resolving power to detect genetic differences, type of data they generate and their applicability to particular taxonomic levels. This review presents a basic description of different molecular techniques that can be utilized for DNA fingerprinting and molecular diversity analysis of plant species.
A Brief Review of Molecular Techniques to Assess Plant Diversity
Arif, Ibrahim A.; Bakir, Mohammad A.; Khan, Haseeb A.; Al Farhan, Ahmad H.; Al Homaidan, Ali A.; Bahkali, Ali H.; Sadoon, Mohammad Al; Shobrak, Mohammad
2010-01-01
Massive loss of valuable plant species in the past centuries and its adverse impact on environmental and socioeconomic values has triggered the conservation of plant resources. Appropriate identification and characterization of plant materials is essential for the successful conservation of plant resources and to ensure their sustainable use. Molecular tools developed in the past few years provide easy, less laborious means for assigning known and unknown plant taxa. These techniques answer many new evolutionary and taxonomic questions, which were not previously possible with only phenotypic methods. Molecular techniques such as DNA barcoding, random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellites and single nucleotide polymorphisms (SNP) have recently been used for plant diversity studies. Each technique has its own advantages and limitations. These techniques differ in their resolving power to detect genetic differences, type of data they generate and their applicability to particular taxonomic levels. This review presents a basic description of different molecular techniques that can be utilized for DNA fingerprinting and molecular diversity analysis of plant species. PMID:20559503
Influence of p53 (rs1625895 polymorphism in kidney transplant recipients
Directory of Open Access Journals (Sweden)
Negar Azarpira
2014-01-01
Full Text Available Reperfusion injury predisposes the kidney allograft to acute rejection. Apoptosis is a mechanism that results in graft injury, and TP53 is an important involved gene. To determine the association between single nucleotide polymorphism (SNP in the pro-apoptotic protein p53 (rs1625895 and acute rejection in renal transplants, we studied 100 recipients of kidney allografts and 100 healthy individuals served as controls. The polymorphism was determined by the polymerase chain reaction restriction-fragment length polymorphism (PCR-RFLP test. Overall, 31 recipients developed rejection. There was no difference in the genotype frequencies between the recipients and the controls. However, we found a difference of genotype and allele frequencies between recipients with and those without rejection. The WW genotype was more frequent in recipients with rejection. Although rejection is a complex immunologic event and functional importance of SNPs has not been confirmed yet, we suggest that wild type p53 may promote apoptosis during inflammation.
Ghrelin precursor gene polymorphism and methamphetamine dependence in the Korean population.
Yoon, Su-Jung; Pae, Chi-Un; Lee, Heejin; Choi, Bomoon; Kim, Tae-Suk; Lyoo, In Kyoon; Kwon, Do-Hoon; Kim, Dai-Jin
2005-12-01
Ghrelin is a recently isolated brain-gut peptide that has growth hormone-releasing and appetite-inducing activities. Several recent studies have suggested that ghrelin plays a major role in the pathophysiology of drug-seeking behavior and anxiety. Therefore, we assessed the effect of the ghrelin precursor polymorphism on methamphetamine dependence in the Korean population. One hundred and eighteen patients with methamphetamine dependence, according to the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV) criteria, and the 144 healthy controls were enrolled in this study. Genotyping for the ghrelin precursor polymorphism was performed by the polymerase chain reaction-restriction fragment length polymorphism-based technique. The genotypic and allelic distributions of the ghrelin precursor polymorphism in the patients with methamphetamine dependence were not significantly different from those of the control subjects. However, the Met72 carriers were associated with the emotional problems of methamphetamine dependence. The patients with the Met72 allele were more depressed and anxious than the homozygous patients with the wild Leu72 allele. The present study suggests that the ghrelin precursor polymorphism may not confer a susceptibility to the development of methamphetamine dependence in the Korean population. However, the Leu72Met polymorphism could have a potential role in the emotional problems that are associated with this disease.
Genetic Diversity of Iraqi Date Palm (Phoenix dactylifera L.) by using RAPD Technique
Muhanned Abdul Hasan Kareem; Ali Hmood Al-Saadi ; Hassan Fadhil Naji
2018-01-01
In this study provided all molecular markers of Random amplified polymorphic (RAPD) successfully with the sixty five Iraqi date palm (Phoenix dactylifera L.) cultivars, which collected from Hilla city in Iraq, to determine fingerprinting, polymorphic value, and relationships among varieties of date palm cultivars, and also with the same type of cultivars. Data analysis of ten RAPD has been revealed. Number of amplified DNA fragments were (592) bands, polymorphism per all primers were (%64.2),...
Genetic Diversity of Iraqi Date Palm (Phoenix dactylifera L.) by using RAPD Technique
Muhanned Abdul Hasan; Ali Hmood Al-Saadi; Hassan Fadhil Naji
2017-01-01
In this study provided all molecular markers of Random amplified polymorphic (RAPD) successfully with the sixty five Iraqi date palm (Phoenix dactylifera L.) cultivars, which collected from Hilla city in Iraq, to determine fingerprinting, polymorphic value, and relationships among varieties of date palm cultivars, and also with the same type of cultivars. Data analysis of ten RAPD has been revealed. Number of amplified DNA fragments were (592) bands, polymorphism per all primers were (%64.2),...
A functional EGF+61 polymorphism is associated with severity of obstructive sleep apnea.
Ding, Qunli; Cao, Chao; Chen, Zhongbo; Tabusi, Mahebali; Chen, Li; Deng, Zaichun
2015-05-01
Involvement of epidermal growth factor (EGF) is reported in diseases caused by hypoxia. Its functional polymorphism may alter its transcription, affecting EGF expression, contributing to obstructive sleep apnea (OSA). The aim of this study was to investigate associations of EGF+61 polymorphism and risk of OSA. Two hundred two participants were enrolled in this case-control study. DNA was extracted from peripheral blood, and EGF 61A/G polymorphism was determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. No significant association between EGF 61 A/G polymorphism and risk of OSA was observed in any of the gene models tested (AA vs. GG: OR = 0.97, 95% CI = 0.37-2.55; P = 0.95). However, compared with GG genotype, AG genotype associated with decreased risk of severe OSA (AG vs. GG: OR = 0.32, 95% CI = 0.11-0.94). Our study showed that AG genotype has a protective effect on OSA patients against severe disease, although EGF 61A/G polymorphisms have no role on the risk of the disease. Additional large studies should further validate our findings.
Polymorphism of the renalase gene in gestational diabetes mellitus.
Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna
2017-01-01
Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.
Directory of Open Access Journals (Sweden)
Sunirmal Sheet
2018-03-01
Full Text Available Apart from being fed to silkworms in sericulture, the ecologically important Mulberry plant has been used for traditional medicine in Asian countries as well as in manufacturing wine, food, and beverages. Germplasm analysis among Mulberry cultivars originating from South Korea is crucial in the plant breeding program for cultivar development. Hence, the genetic deviations and relations among 8 Morus alba plants, and one Morus lhou plant, of different cultivars collected from South Korea were investigated using 10 random amplified polymorphic DNA (RAPD and 10 inter-simple sequence repeat (ISSR markers in the present study. The ISSR markers exhibited a higher polymorphism (63.42% among mulberry genotypes in comparison to RAPD markers. Furthermore, the similarity coefficient was estimated for both markers and found to be varying between 0.183 and 0.814 for combined pooled data of ISSR and RAPD. The phenogram drawn using the UPGMA cluster method based on combined pooled data of RAPD and ISSR markers divided the nine mulberry genotypes into two divergent major groups and the two individual independent accessions. The distant relationship between Dae-Saug (SM1 and SangchonJo Sang Saeng (SM5 offers a possibility of utilizing them in mulberry cultivar improvement of Morus species of South Korea.
Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D
2017-12-01
In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Godwill Azeh Engwa
2018-04-01
Full Text Available The association between the Pro12Ala polymorphism of the PPARγ2 gene, type 2 diabetes (T2D, and obesity in certain ethnic populations has been reported. However, this relationship has not yet been described among diabetes patients in Nigeria. This study investigated the relationship between the Pro12Ala polymorphism in the PPARγ2 gene, obesity, and lipid abnormalities characterizing T2D among patients in Nigeria. This case-control study recruited 73 T2D and 75 non-diabetic (ND patients. Demographic and clinical data were collected and blood glucose levels together with serum lipid profile for patients were measured. Pro12Ala polymorphism in the PPARγ2 gene was genotyped by restriction fragment length-Polymerase Chain Reaction (RFLP-PCR. The PPAR-γ2 gene (amplicon size = 270 base pair was successfully amplified for all samples. Following restriction enzyme digestion and analysis by agarose gel electrophoresis, amplicons from samples showed a band of size 270 bp and were of the wild homozygous Pro/Pro genotype. Ala12 variant was totally absent from the study population. Obesity, estimated using Body Mass Index (BMI and waist circumference (WC, was significantly higher (p < 0.05 in T2D patients compared to the non-diabetic patients. More so, the prevalence of lipid abnormalities; hypercholesterolaemia (TC > 200 mg/dL, hypertriglyceridaemia (TG > 150 mg/dL, high HDL (>100 mg/dL, and low HDL (<50 mg/dL was significantly greater (p < 0.001 in T2D patients compared to non-diabetic patients. Results obtained further indicated lack of significant association between PPAR-γ2 gene polymorphism, T2D, and obesity. However, obesity and dyslipidaemia were strongly associated in T2D patients.
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Directory of Open Access Journals (Sweden)
DIYAH MARTANTI
2008-10-01
Full Text Available Amorphophallus muelleri Blume (Araceae is valued for its glucomanan content for use in food industry (healthy diet food, paper industry, pharmacy and cosmetics. The species is triploid (2n=3x=39 and the seed is developed apomictically. The present research is aimed to identify genetic variability of six population of A. muelleri from Java (consisted of 50 accessions using random amplified polymorphic DNA (RAPD. The six populations of the species are: East Java: (1 Silo-Jember, (2 Saradan-Madiun, (3 IPB (cultivated, from Saradan-Madiun, (4 Panti-Jember, (5 Probolinggo; and Central Java: (6 Cilacap. The results showed that five RAPD primers generated 42 scorable bands of which 29 (69.05% were polymorphic. Size of the bands varied from 300bp to 1.5kbp. The 50 accessions of A. muelleri were divided into two main clusters, some of them were grouped based on their populations, and some others were not. The range of individual genetic dissimilarity was from 0.02 to 0.36. The results showed that among six populations investigated, Saradan population showed the highest levels of genetic variation with mean values of na = 1.500+ 0.5061, ne = 1.3174 + 0.3841, PLP = 50% and He = 0, 0.1832+0.2054, whereas Silo-Jember population showed the lowest levels of genetic variation with mean values na = 1.2619+ 0.4450, ne = 1.1890 + 0.3507, PLP = 26.19% and He = 0.1048+0.1887. Efforts to conserve, domesticate, cultivate and improve genetically should be based on the genetic properties of each population and individual within population, especially Saradan population which has the highest levels of genetic variation, need more attention for its conservation.
Caracterización de accesiones de papaya (Carica papaya L.) a través de marcadores AFLP en Cuba
Maruchi Alonso Esquivel; Martín Bautista Alor; Matilde Ortiz García; Adriana Quiroz Moreno; Wolfgang Rohde; Lorenzo Felipe Sánchez Teyer
2010-01-01
Los marcadores moleculares son herramientas valiosas en los estudios genéticos en plantas, y están siendo empleados exitosamente en programas de mejoramiento principalmente en la elección de progenitores y en la selección. El polimorfismo observado mediante la técnica molecular AFLP (Amplified Fragment Length Polymorphism) ha sido de utilidad para estudios de diversidad genética en frutales. En el presente trabajo se realizó la caracterización molecular de 12 accesiones de papaya (Carica papa...
Caracterización de accesiones de papaya (Carica papaya L.) a través de marcadores AFLP en Cuba
Esquivel, Maruchi Alonso; Bautista Alor, Martín; Ortiz García, Matilde; Quiroz Moreno, Adriana; Rohde, Wolfgang; Sánchez Teyer, Lorenzo Felipe
2009-01-01
Los marcadores moleculares son herramientas valiosas en los estudios genéticos en plantas, y están siendo empleados exitosamente en programas de mejoramiento principalmente en la elección de progenitores y en la selección. El polimorfismo observado mediante la técnica molecular AFLP (Amplified Fragment Length Polymorphism) ha sido de utilidad para estudios de diversidad genética en frutales. En el presente trabajo se realizó la caracterización molecular de 12 accesiones de papaya (Carica papa...
DEFF Research Database (Denmark)
Wulff, Gitte; Gram, Lone; Ahrens, Peter
2006-01-01
Contamination of foods with the human pathogen Listeria monocytogenes may occur during processing, and the purpose of this study was to determine whether genetically similar strains colonize different processing plants or whether specific persistent strains are unique to each processing plant. We...... smokehouses and two slaughterhouses and was predominant in three of these plants. A subset of 35 strains was also analyzed by amplified fragment length polymorphism typing, which confirmed the genetic similarity of the groups. Moreover, strains of the dominant RAPD type were indistinguishable from strains...
Development of a sequence characterized amplified region (SCAR ...
African Journals Online (AJOL)
The varieties of rice are difficult to be distinguished because of their similar morphological characters, therefore rice variety identification or differentiation is very important. The authentication by using molecular marker or DNA fingerprinting is the most accurate method. In this study, random amplified polymorphic DNA ...