WorldWideScience

Sample records for amplified polymorphic dna

  1. Sexing birds using random amplified polymorphic DNA (RAPD) markers

    NARCIS (Netherlands)

    Lessells, C.M.; Mateman, A.C.

    1998-01-01

    We used random amplified polymorphic DNA (RAPD) markers to sex birds from small tissue (usually blood) samples. Arbitrarily chosen 10-mer PCR primers were screened with DNA from known-sex individuals for the production of a bright female-specific band. Suitable primers were found for seven bird spec

  2. Composting oily sludges: Characterizing microflora using randomly amplified polymorphic DNA

    International Nuclear Information System (INIS)

    Laboratory-scale composts in which oily sludge was composted under mesophilic conditions with amendments such as peat, bark, and fresh or decomposed horse manure, were studied with respect to basic parameters such as oil degradation, respirometry, and bacterial numbers. Further, an attempt was made to characterize a part of the bacterial flora using randomly amplified polymorphic DNA (RAPD). The compost based on decomposed horse manure showed the greatest reduction of oil (85%). Comparison with a killed control indicated that microbial degradation actually had occurred. However, a substantial part of the oil was stabilized rather than totally broken down. Volatiles, on the contrary, accounted for a rather small percentage (5%) of the observed reduction. RAPD indicated that a selection had taken place and that the dominating microbial flora during the active degradation of oil were not the same as the ones dominating the different basic materials. The stabilized compost, on the other hand, had bacterial flora with similarities to the ones found in peat and bark

  3. Selection of unique Escherichia coli clones by random amplified polymorphic DNA (RAPD)

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Godfrey, Paul A; Stegger, Marc;

    2014-01-01

    Identifying and characterizing clonal diversity are important when analysing fecal flora. We evaluated random amplified polymorphic DNA (RAPD) PCR, applied for selection of Escherichia coli isolates, by whole genome sequencing. RAPD was fast, and reproducible as screening method for selection...

  4. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  5. Stability of randomly amplified polymorphic DNA fingerprinting in genotyping clinical isolates of Helicobacter pylori

    OpenAIRE

    Han, Feng-chan; Ng, Han-Chong; Ho, Bow

    2003-01-01

    AIM: H pylori genomes are highly diversified. This project was designed to genotype H pylori isolates by the polymerase chain reaction (PCR)-based randomly amplified polymorphic DNA (RAPD) fingerprinting technique and to verify its stability by Southern blotting and DNA sequencing.

  6. Paternity determination in the adder (Vipera berus)--DNA fingerprinting or random amplified polymorphic DNA?

    Science.gov (United States)

    Tegelström, H; Höggren, M

    1994-08-01

    We performed breeding experiments with adders (Vipera berus) to determine whether multiple matings may result in multiple paternity. DNA fingerprinting of mothers, their offspring, and possible fathers using a polydinucleotide probe [(TG)n] gave a low overall similarity between unrelated individuals (0.18 +/- 0.07; SD) and an average of 17 bands that were male-specific. In no cases were there fewer than seven paternal-specific bands present in the fingerprint of an offspring, enabling us unambiguously to identify the biological father among five males. Multiple paternity was detected in the investigated broods with offspring sired exclusively by the captive males. PCR amplification of random amplified polymorphic DNA (RAPD) using 16 decamer primers gave 76 bands and an average similarity of 0.95 (+/- 0.01) between the males, which were collected at different, geographically well-separated localities. Although there were on average 8.3 (+/- 1.9) bands that differ between males in pairwise comparisons, there were only 1.9 (+/- 1.1) bands per male that are specific for a particular individual. Thus, RAPDs are adequate for paternity determination only in experiments with a low number of males, whereas DNA fingerprinting offers sufficient information to discriminate between large numbers of putative fathers. PMID:7826312

  7. Rapid identification of some Leptospira isolates from cattle by random amplified polymorphic DNA fingerprinting.

    OpenAIRE

    Corney, B G; Colley, J; Djordjevic, S P; Whittington, R.; Graham, G C

    1993-01-01

    We compared random amplified polymorphic DNA (RAPD) fingerprinting with cross-absorption agglutination and restriction enzyme analysis for typing bovine leptospires. Using RAPD fingerprinting, we examined a number of Leptospira serovars, namely, hardjo genotypes bovis and prajitno, pomona, balcanica, tarassovi, swajizak, kremastos, australis, and zanoni, which are likely to be isolated from Australian cattle. Each serovar and genotype had a unique RAPD profile. Of 26 field isolates of Leptosp...

  8. Randomly Amplified Polymorphic DNA PCR as a Tool for Assessment of Marine Viral Richness▿ †

    OpenAIRE

    Winget, Danielle M.; Wommack, K Eric

    2008-01-01

    Recent discoveries have uncovered considerable genetic diversity among aquatic viruses and raised questions about the variability of this diversity within and between environments. Studies of the temporal and spatial dynamics of aquatic viral assemblages have been hindered by the lack of a common genetic marker among viruses for rapid diversity assessments. Randomly amplified polymorphic DNA (RAPD) PCR bypasses this obstacle by sampling at the genetic level without requiring viral isolation o...

  9. The Use of Random Amplified Polymorphic DNA (RAPD) Markers in Sex Discrimination in Nile Tilapia, Oreochromis niloticus (Pisces: Cichlidae)

    OpenAIRE

    Bardakci, Fevzi

    2000-01-01

    Random amplified polymorphic DNA (RAPD) markers were successfully used in discrimination of sexes in Nile tilapia fish ( Oreochromis niloticus) using linear discriminant function analysis. The results provide support for the view that major genetical sex determining factors exist in tilapia.

  10. Use of Random Amplified Polymorphic DNA Analysis for Economically Important Food Crops

    Institute of Scientific and Technical Information of China (English)

    Halima Hassan Salem; Bahy Ahmed Ali; Tian-Hua Huang; Da-Nian Qin; Xiao-Mei Wang; Qing-Dong Xie

    2007-01-01

    The objective of this review is to summarize numerous studies on the use of the random amplified polymorphic DNA (RAPD) technique on rice, corn, wheat, sorghum, barley, rye, and oats to examine its feasibility and validity for assessment of genetic variation, population genetics, mapping, linkage and marker assisted selection, phylogenetic analysis, and the detection of somaclonal variation.Also we discuss the advantages and limitations of RAPD.Molecular markers have entered the scene of genetic improvement in different fields of agricultural research.The simplicity of the RAPD technique made it ideal for genetic mapping, plant and animal breeding programs, and DNA fingerprinting, with particular utility in the field of population genetics.

  11. Estimation of genetic variability among elite wheat genotypes using random amplified polymorphic DNA (RAPD) analysis

    International Nuclear Information System (INIS)

    Twenty four wheat varieties/lines were assessed through RAPD for genetic diversity. Of forty primers, thirteen were able to amplify the genomic DNA and yielded 269 polymorphic bands. The percentage of the polymorphic loci was 86.22%. Nei's genetic diversity (h) ranged from 0.248 to 0.393, with an average of 0.330. Shanon's index ranged from 0.382 to 0.567, with an average of 0.487. The proportion of genetic variation among the populations ( Ds) accounted for 28.58 % of the whole genetic diversity. The level of gene flow (Nm) was 1.25. Some specific RAPD bands were also identified, variety C-591, and QM-4531 contain a specific segment of 4.9 kbp. Whereas SARC-1 and PKV-1600 amplified a specific DNA segment with primer A-09. Marvi-2000 contains two specific segments of 3.2 kb and 200 bp amplified with primer B-07. Genetically most similar genotypes were C-591 and Pasban-90 (76%) and most dissimilar genotypes were Rawal-87 and Khirman (36.1%). On the basis of results, 24 wheat varieties under study could be divided into 'two' groups and five clusters 'A' to 'E. (author)

  12. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M

    2003-01-01

    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  13. Genetic variation in Opisthorchis viverrini (Trematoda: Opisthorchiidae) from northeast Thailand and Laos PDR based on random amplified polymorphic DNA analyses

    OpenAIRE

    Sithithaworn, Paiboon; Nuchjungreed, Chadaporn; Srisawangwong, Tuanchai; Ando, Katsuhiko; Petney, Trevor N.; Chilton, Neil B.; Andrews, Ross H.

    2006-01-01

    Genetic variation in Opisthorchis viverrini adults originating from different locations in northeast Thailand and Laos, People’s Democratic Republic (PDR), was examined using random amplified polymorphic DNA (RAPD) analyses. In an initial analysis, the genomic DNA of one fluke from each of ten localities was amplified using 15 random primers (10-mers); however, genetic variation among O. viverrini specimens was detected reliably for only four primers. A more detailed RAPD analysis using these...

  14. Random amplified polymorphic DNA (RAPD) markers readily distinguish cryptic mosquito species (Diptera: Culicidae: Anopheles).

    Science.gov (United States)

    Wilkerson, R C; Parsons, T J; Albright, D G; Klein, T A; Braun, M J

    1993-01-01

    The usefulness of random amplified polymorphic DNA (RAPD) was examined as a potential tool to differentiate cryptic mosquito species. It proved to be a quick, effective means of finding genetic markers to separate two laboratory populations of morphologically indistinguishable African malaria vectors, Anopheles gambiae and An. arabiensis. In an initial screening of fifty-seven RAPD primers, 377 bands were produced, 295 of which differed between the two species. Based on criteria of interpretability, simplicity and reproducibility, thirteen primers were chosen for further screening using DNA from thirty individuals of each species. Seven primers produced diagnostic bands, five of which are described here. Some problematic characteristics of RAPD banding patterns are discussed and approaches to overcome these are suggested. PMID:8269099

  15. [Identification of Aloe species by random amplified polymorphic DNA (RAPD) analysis].

    Science.gov (United States)

    Shioda, Hiroko; Satoh, Kanako; Nagai, Fumiko; Okubo, Tomoko; Seto, Takako; Hamano, Tomoko; Kamimura, Hisashi; Kano, Itsu

    2003-08-01

    Juice and integument of leaves of 3 Aloe species, Aloe vera, A. ferox and A. africana, are not allowed to be used as food according to the Pharmaceutical Affairs Law in Japan. On the other hand, whole leaves of A. arborescens can be used as food. The present study was designed to distinguish Aloe species by random amplified polymorphic DNA (RAPD) analysis. DNA was isolated from fresh and dried leaves of the 4 Aloe species. Five out of 32 different 10-mer primers examined were useful for analysis. By comparison of the characteristic bands of PCR products on agarose gel, it was possible to distinguish the 4 species. Thus, the botanical species of Aloe in commercial food products can be identified by RAPD analysis. PMID:14606430

  16. Random amplified polymorphic DNA analysis of Anopheles nuneztovari (Diptera: Culicidae from Western and Northeastern Colombia

    Directory of Open Access Journals (Sweden)

    Carmen Elisa Posso

    2003-06-01

    Full Text Available Random amplified polymorphic DNA (RAPD markers were used to analyze 119 DNA samples of three Colombian Anopheles nuneztovari populations to study genetic variation and structure. Genetic diversity, estimated from heterozygosity, averaged 0.34. Genetic flow was greater between the two populations located in Western Colombia (F ST: 0.035; Nm: 6.8 but lower between these two and the northeastern population (F ST: 0.08; Nm: 2.8. According to molecular variance analysis, the genetic distance between populations was significant (phiST 0.1131, P < 0.001. The variation among individuals within populations (phiST 0.8869, P < 0.001was also significant, suggesting a greater degree of population subdivision, not considered in this study. Both the parameters evaluated and the genetic flow suggest that Colombian An. nuneztovari populations are co-specific.

  17. Genetic variability analysis among clinical Candida spp. isolates using random amplified polymorphic DNA

    Directory of Open Access Journals (Sweden)

    Patrícia M Pinto

    2004-03-01

    Full Text Available The patterns of genetic variation of samples of Candida spp. isolated from patients infected with human immunodeficiency virus in Vitória, state of Espírito Santo, Brazil, were examined. Thirty-seven strains were isolated from different anatomical sites obtained from different infection episodes of 11 patients infected with the human immunodeficiency virus (HIV. These samples were subjected to randomly amplified polymorphic DNA (RAPD analysis using 9 different primers. Reproducible and complex DNA banding patterns were obtained. The experiments indicated evidence of dynamic process of yeast colonization in HIV-infected patients, and also that certain primers are efficient in the identification of species of the Candida genus. Thus, we conclude that RAPD analysis may be useful in providing genotypic characters for Candida species typing in epidemiological investigations, and also for the rapid identification of pathogenic fungi.

  18. Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

    Science.gov (United States)

    Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

    2015-01-01

    The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level. PMID:26782491

  19. Amethod for genotoxicity detection using random amplified polymorphism DNA with Danio rerio

    Institute of Scientific and Technical Information of China (English)

    RongZY; YinHW

    2002-01-01

    The increasing presence of genotoxic pollutants in the equatic environment has led to the development of quick monitoring methods.We have applied the random amplified polymorphism DNA(RKAPD) method to evaluate the toxic effects of genotoxic chemicals.In all 22 of normal wild type Danio rerio(zebrafish),78 amplified bands were obtained after PCR using primers set,in which the frequency of emergency above 60 percent is 21.There do exist 4 stable bands in the amplifed product,which appear in all normal test samples.The zebrafish RAPD fingerprinting database is set up on this base.The RAPD pattern from zebrafishes exposed to genotoxic chemicals such as cyclophosphamide 0.1-10mg·L-1 and dimethoate 10-100mg·L-1 displayed some changes in polymorphism of band pattern including the lost of stable bands.There also exists distinct distance between the band pattern of exposed zebrafishes and the control samples via the cluster method.In addition,the result derived from numeric analysis is more sensitive than the result obtained from stable band analysis because it can reveal the distance between the band pattern of 0.05mg·L-1 cyclophosphamide exposed zebrafish and the control sample.These results showed the accuracy and the sensitivity of the two analyses of genotoxicity based on the RAPD fingerprinting research.

  20. Development of Random Amplified Polymorphism DNA Markers Linked to Powdery Mildew Resistance Gene in Melon

    Directory of Open Access Journals (Sweden)

    Budi Setiadi Daryono

    2015-11-01

    Full Text Available A random amplified polymorphic DNA (RAPD marker linked to powdery mildew resistance gene (Pm-I in melon PI 371795 was reported. However, the RAPD marker has problem in scoring. To detect powdery mildew resistance gene (Pm-I in melon accurately, the RAPD marker was cloned and sequenced to design sequence characterized amplified region (SCAR markers. SCAPMAR5 marker derived from pUBC411 primer yielded a single DNA band at 1061 bp. Segregation of SCAPMAR5 marker in bulk of F2 plants demonstrated that the marker was co-segregated with RAPD marker from which the SCAR marker was originated. Moreover, results of SCAR analysis in diverse melons showed SCAPMAR5 primers obtained a single 1061 bp linked to Pm-I in resistant melon PI 371795 and PMAR5. On the other hand, SCAPMAR5 failed to detect Pm-I in susceptible melons. Results of this study revealed that SCAR analysis not only confirmed melons that had been clearly scored for resistance to Pm-I evaluated by RAPD markers, but also clarified the ambiguous resistance results obtained by the RAPD markers.   Key words: Cucumis melo L., Pm-I, RAPD, SCAPMAR5

  1. Molecular Characterization of Some Turkish Olive Cultivars Using Random Amplified Polymorphic DNA (RAPD Markers

    Directory of Open Access Journals (Sweden)

    Ergün KAYA

    2015-03-01

    Full Text Available Olive (Olea europea L. is one of the oldest cultivated plants characteristic in the Mediterranean area, where it is the most important oilproducing crop. The cultivated olive (O. europaea L. var. europaea is propagated by cutting or grafting, whereas wild olive (O. europaea L. var. sylvestris is reproduced from seeds. These two olive types are interfertile and have led to a large number of varieties. Morphological descriptions are not entirely reliable, due to numerous synonyms and homonyms in designations, labelling mistakes, the presence of varietal clones, and the uncertain identification methods thus far applied. Molecular markers, as random amplified polymorphic DNA (RAPD markers, are environment-independent and efficient to identify olive varieties and to detect synonymous and homonymous. In this study, fifteen selected RAPD markers are used for determination of relationships among twenty individuals belonging to four important Turkish olive cultivars. Our results showed that RAPD markers can be used to differentiate olive cultivars

  2. Comparative Serological and Random Amplified Polymorphic DNA Typing for Bordetella avium Isolates in China

    Directory of Open Access Journals (Sweden)

    Ping-Ping Yang, Rong-De Ma1, Xue Zhao and Rui-Liang Zhu*

    2012-10-01

    Full Text Available To study the similarity among Bordetella avium isolates in China, antigens and diagnostic antiserum of 22 B. avium isolates were prepared for serotyping, and a set of 20 commercially available primers was screened out to identify suitable primers for random amplified polymorphic DNA fingerprinting (RAPD analysis in this study. Twenty-two B. avium isolates were divided into two serovars (A and B based on their reaction in the plate-agglutination test. Four primers R1, R2, R4 and R10 resulted in informative fingerprints and were used to evaluate the B. avium isolates. Based on their RAPD patterns, a dendrogram allowed the separation of the B. avium isolates into six genetic similarity clusters. However, no direct correlation was observed between serotypes and RAPD typing among the isolates.

  3. Molecular diversity of Renibacterium salmoninarum isolates determined by randomly amplified polymorphic DNA analysis.

    Science.gov (United States)

    Grayson, T H; Atienzar, F A; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-01-01

    The molecular diversity among 60 isolates of Renibacterium salmoninarum which differ in place and date of isolation was investigated by using randomly amplified polymorphic DNA (RAPD) analysis. Isolates were grouped into 21 banding patterns which did not reflect the biological source. Four 16S-23S rRNA intergenic spacer (ITS1) sequence variations and two alleles of an exact tandem repeat locus, ETR-A, were the bases for formation of distinct groups within the RAPD clusters. This study provides evidence that the most common ITS1 sequence variant, SV1, possesses two copies of a 51-bp repeat unit at ETR-A and has been widely dispersed among countries which are associated with mainstream intensive salmonid culture. PMID:10618262

  4. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hong Xian; Wen-Ming Cong; Shu-Hui Zhang; Meng-Chao Wu

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments.METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD)with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated,purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data.RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size,histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene.CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcinogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis.

  5. Randomly amplified polymorphic DNA PCR as a tool for assessment of marine viral richness.

    Science.gov (United States)

    Winget, Danielle M; Wommack, K Eric

    2008-05-01

    Recent discoveries have uncovered considerable genetic diversity among aquatic viruses and raised questions about the variability of this diversity within and between environments. Studies of the temporal and spatial dynamics of aquatic viral assemblages have been hindered by the lack of a common genetic marker among viruses for rapid diversity assessments. Randomly amplified polymorphic DNA (RAPD) PCR bypasses this obstacle by sampling at the genetic level without requiring viral isolation or previous sequence knowledge. In this study, the utility of RAPD-PCR for assessing DNA viral richness within Chesapeake Bay water samples was evaluated. RAPD-PCR using single 10-mer oligonucleotide primers successfully produced amplicons from a variety of viral samples, and banding patterns were highly reproducible, indicating that each band likely represents a single amplicon originating from viral template DNA. In agreement with observations from other community profiling techniques, resulting RAPD-PCR banding patterns revealed more temporal than spatial variability in Chesapeake Bay virioplankton assemblages. High-quality hybridization probes and sequence information were also easily generated from single RAPD-PCR products or whole reactions. Thus, the RAPD-PCR technique appears to be practical and efficient for routine use in high-resolution viral diversity studies by providing assemblage comparisons through fingerprinting, probing, or sequence information. PMID:18344351

  6. Coupling technique of random amplified polymorphic DNA and nanoelectrochemical sensor for mapping pancreatic cancer genetic fingerprint

    Directory of Open Access Journals (Sweden)

    Liu Q

    2011-11-01

    Full Text Available Qicai Liu1,2, Ailin Liu3,4, Feng Gao5, Shaohuang Weng3,4, Guangxian Zhong3,4, Jingfeng Liu6, Xinhua Lin3,4, Jian-hua Lin7, Xuhai Chen81Department of Laboratory Medicine, Fujian Medical University, Fuzhou, 2Department of Gene Diagnosis, Fujian Medical University, Fuzhou, 3Department of Nano-Biomedical Research Center, Fujian Medical University, Fuzhou, 4Department of Pharmaceutical Analysis, Fujian Medical University, Fuzhou, 5Department of Pathology, Fujian Medical University, Fuzhou, 6Department of Surgery, Fujian Medical University, Fuzhou, 7Department of Bone Oncology, First Affiliated Hospital, Fujian Medical University, Fuzhou, 8College of Electrical Engineering and Automation, Fuzhou University, Fuzhou, People's Republic of ChinaObjective: To review the feasibility of coupling the techniques of random amplified polymorphic DNA (RAPD with carbon nanotube-based modified electrode for guanine/deoxy-guanine triphosphate (dGTP electrochemical sensing for mapping of the pancreatic cancer genetic fingerprint and screening of genetic alterations.Methods: We developed a new method to study the electrochemical behavior of dGTP utilizing carbon multiwalled nanotube (MWNT-modified glassy carbon electrodes (GCEs. RAPD was applied for amplification of DNA samples from healthy controls and patients with pancreatic cancer under the same conditions to determine the different surplus quantity of dGTP in the polymerase chain reaction (PCR, thereby determining the difference/quantity of PCR products or template strands. Using this method we generated a genetic fingerprint map of pancreatic cancer through the combination of electrochemical sensors and gel electrophoresis to screen for genetic alterations. Cloning and sequencing were then performed to verify these gene alterations.Results: dGTP showed favorable electrochemical behavior on the MWNTs/GCE. The results indicated that the electrical signal and dGTP had a satisfactory linear relationship with the d

  7. Randomly Amplified Polymorphic DNA of Trichoderma isolates and antagonism against Rhizoctonia solani

    Directory of Open Access Journals (Sweden)

    Larissa Brandão Góes

    2002-06-01

    Full Text Available Random Amplified Polymorphic DNA (RAPD procedure was used to examine the genetic variability among fourteen isolates of Trichoderma and their ability to antagonize Rhizoctonia solani using a dual-culture assay for correlation among RAPD products and their hardness to R. solani. Seven oligodeoxynucleotide primers were selected for the RAPD assays which resulted in 197 bands for 14 isolates of Trichoderma. The data were entered into a binary matrix and a similarity matrix was constructed using DICE similarity (SD index. A UPGMA cluster based on SD values was generated using NTSYS (Numerical Taxonomy System, Applied Biostatistics computer program. A mean coefficient of similarity obtained for pairwise comparisons among the most antagonics isolates was around 40%. The results presented here showed that the variability among the isolates of Trichoderma was very high. No relationship was found between the polymorphism showed by the isolates and their hardness, origin and substrata.A técnica de RAPD (Random Amplified Polymorphic DNA foi utilizada para examinar a variabilidade genética em quatorze isolados de Trichoderma além de sua capacidade de antagonizar o fungo fitopatogênico Rhizoctonia solani usando pareamento in vitro, e a possível relação entre perfís de RAPD e agressividade dos isolados de Trichoderma a R. solani. Foram selecionados sete primers para os ensaios de RAPD, os quais produziram 197 bandas. Os dados foram introduzidos no programa de computador NTSYS (Numerical Taxonomy System, Applied Biostatisticsna forma de uma matrix binária, sendo construída uma matriz de similaridade utilizando-se o coeficiente de similaridade de DICE (SD e baseado nos valores SD, pelo método de agrupamento UPGMA um dendrograma. Observou-se que o grau de similaridade das amostras que apresentaram melhor desempenho antagônico foi bastante baixo, em torno de 40%. Os resultados demonstraram que a variabilidade entre os isolados de Trichoderma é muito

  8. Allelic imbalance analysis by high-density single-nucleotide polymorphic allele (SNP) array with whole genome amplified DNA

    OpenAIRE

    Wong, Kwong-Kwok; Tsang, Yvonne T.M.; Shen, Jianhe; Cheng, Rita S.; Chang, Yi-Mieng; Man, Tsz-Kwong; Lau, Ching C.

    2004-01-01

    Besides their use in mRNA expression profiling, oligonucleotide microarrays have also been applied to single-nucleotide polymorphism (SNP) and loss of heterozygosity (LOH) or allelic imbalance studies. In this report, we evaluate the reliability of using whole genome amplified DNA for analysis with an oligonucleotide microarray containing 11 560 SNPs to detect allelic imbalance and chromosomal copy number abnormalities. Whole genome SNP analyses were performed with DNA extracted from osteosar...

  9. A Randomly Amplified Polymorphic DNA Marker Specific for the Bacillus cereus Group Is Diagnostic for Bacillus anthracis

    OpenAIRE

    Daffonchio, Daniele; Borin, Sara; Frova, Giuseppe; Gallo, Romina; Mori, Elena; Fani, Renato; Sorlini, Claudia

    1999-01-01

    Aiming to develop a DNA marker specific for Bacillus anthracis and able to discriminate this species from Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides, we applied the randomly amplified polymorphic DNA (RAPD) fingerprinting technique to a collection of 101 strains of the genus Bacillus, including 61 strains of the B. cereus group. An 838-bp RAPD marker (SG-850) specific for B. cereus, B. thuringiensis, B. anthracis, and B. mycoides was identified. This fragment included a pu...

  10. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M F; Bosio, C. F.; COTTON, J; W. Sweeney; Strand, M.R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  11. Genotoxicity assessment of pesticides on terrestrial snail embryos by analysis of random amplified polymorphic DNA profiles.

    Science.gov (United States)

    Baurand, Pierre-Emmanuel; Capelli, Nicolas; de Vaufleury, Annette

    2015-11-15

    The study explores the relevance of coupling Random Amplified Polymorphic DNA (RAPD) and a High-Resolution capillary electrophoresis System (HRS) method for assessing the genotoxic potential of the wide variety commercial formulations of pesticides. Using this technique, the genotoxic potential of a glyphosate-based herbicide (Roundup Flash(®) (RU)) and two fungicide formulations based on tebuconazole and copper (Corail(®) and Bordeaux mixture (BM), respectively) was evaluated on terrestrial snail embryos. Clutches of Cantareus aspersus were exposed during their entire embryonic development to a range of concentration around the EC50 values (based on hatching success) for each compound tested. Three primers were used for the RAPD amplifications of pesticides samples. RAPD-HRS revealed concentration-dependent modifications in profiles generated with the three primers in RU(®)-exposed embryos from 30 mg/L glyphosate. For Corail(®)-exposed embryos, only two of the three primers were able to show alterations in profiles from 0.05 mg/L tebuconazole. For BM-exposed embryos, no signs of genotoxicity were observed. All changes observed in amplification profiles have been detected at concentrations lower than the recommended doses for vineyard field applications. Our study demonstrates the efficiency of coupling RAPD and HRS to efficiently screen the effect of pesticide formulations on DNA. PMID:26160746

  12. Genetic variability of Amorphophallus muelleri Blume in Java based on Random Amplified Polymorphic DNA

    Directory of Open Access Journals (Sweden)

    DIYAH MARTANTI

    2008-10-01

    Full Text Available Amorphophallus muelleri Blume (Araceae is valued for its glucomanan content for use in food industry (healthy diet food, paper industry, pharmacy and cosmetics. The species is triploid (2n=3x=39 and the seed is developed apomictically. The present research is aimed to identify genetic variability of six population of A. muelleri from Java (consisted of 50 accessions using random amplified polymorphic DNA (RAPD. The six populations of the species are: East Java: (1 Silo-Jember, (2 Saradan-Madiun, (3 IPB (cultivated, from Saradan-Madiun, (4 Panti-Jember, (5 Probolinggo; and Central Java: (6 Cilacap. The results showed that five RAPD primers generated 42 scorable bands of which 29 (69.05% were polymorphic. Size of the bands varied from 300bp to 1.5kbp. The 50 accessions of A. muelleri were divided into two main clusters, some of them were grouped based on their populations, and some others were not. The range of individual genetic dissimilarity was from 0.02 to 0.36. The results showed that among six populations investigated, Saradan population showed the highest levels of genetic variation with mean values of na = 1.500+ 0.5061, ne = 1.3174 + 0.3841, PLP = 50% and He = 0, 0.1832+0.2054, whereas Silo-Jember population showed the lowest levels of genetic variation with mean values na = 1.2619+ 0.4450, ne = 1.1890 + 0.3507, PLP = 26.19% and He = 0.1048+0.1887. Efforts to conserve, domesticate, cultivate and improve genetically should be based on the genetic properties of each population and individual within population, especially Saradan population which has the highest levels of genetic variation, need more attention for its conservation.

  13. Genetic Diversity of Eurycoma longifolia Jack Based on Random Amplified Polymorphic DNA Marker

    Directory of Open Access Journals (Sweden)

    Rosmaina Rosmaina

    2013-08-01

    Full Text Available Eurycoma longifolia Jack is one of the extensively exploited medicinal plants in Indonesia. The objectives of this study were to obtain information on genetic diversity and population genetic structure of E. longifolia to formulate effective conservation plan. RAPD marker was used to assess the genetic diversity of E. longifolia collected from 5 natural populations in Riau Province. A total of 25 plants were analyzed using 5 RAPD primers, which amplified produced 44 scored DNA bands. The mean observed number of alleles per locus (No, number of effective alleles (Ne, and percentage of polymorphic loci (PPL of E. longifolia were 1.57, 1.34, and 56.80%, respectively. The degree of differentiation among populations of E. longifolia was 0.31 (Ht = 0.29; Hs = 0.20.  The mean value of estimated gene flow among populations of E. longifolia was 1.11 individual per generation. The UPGMA dendogram formed 2 significant clusters. The first cluster consisted of Pelalawan and Kampar populations, while the second cluster was formed from Kuansing, Rohul, and Rohil population. The genetic diversity information in this study is very important to perform efficient conservation and effective future management of its genetic resources.Keywords: Eurycoma longifolia, RAPD marker, genetic variation, conservation DOI: 10.7226/jtfm.19.2.138

  14. Intraspecific differentiation of Hancornia speciosa revealed by simple sequence repeat and random amplified polymorphic DNA markers.

    Science.gov (United States)

    Nogueira, C A; Stafuzza, N B; Ribeiro, T P; Prado, A D L; Menezes, I P P; Peixoto, N; Gonçalves, P J; Almeida, L M

    2015-01-01

    Hancornia speciosa, popularly known as mangabeira, is a fruit tree native to the Brazilian Cerrado that shows great economic potential, due to its multiple uses. Intraspecific classification of this species is difficult because it shows high morphological diversity. An early study of the species reported that there are six botanic varieties that differ morphologically mainly in the shapes of their leaves and flowers. Except to note the wide morphological variation and economic potential of this species, few studies have been published about the genetic diversity of mangabeira. Knowledge of the genetic variability of this species among populations would be useful for genetic conservation and breeding programs. Therefore, we tested the transferability of 12 simple sequence repeats from expressed sequence tags (EST-SSRs) from Catharanthus roseus to H. speciosa and used 10 random amplified polymorphic DNA markers to evaluate the genetic variability among botanical varieties of H. speciosa. We obtained a high transferability frequency of EST-SSR markers from C. roseus to H. speciosa (75%). However, EST-SSR markers showed low heterozygosity and locus variability (two or three alleles by locus), which suggest low genetic diversity in the mangabeira samples. The Jaccard dissimilarity index and an examination of geographic distances indicated a non-spatial structuring of the genetic variability. Our markers were unable to distinguish H. speciosa botanical varieties. PMID:26662392

  15. Identification of Random Amplified Polymorphic DNA Markers Linked to Sex Determination in Calamus simplicifolius C. F. Wei

    Institute of Scientific and Technical Information of China (English)

    Hua YANG; Si-Ming GAN; Guang-Tian YIN; Huang-Can XU

    2005-01-01

    The random amplified polymorphic DNA (RAPD) molecular marker technique was used to determine the sex of Calamus simplicifolius C. F. Wei In the present study, DNA samples were extracted individually from 10 male and 10 female plants. After a total of 1 040 decamer primers had been tested, an approximate 500-bp male-specific DNA fragment was generated with the S1443 primer. It is feasible to identify sex at the early stages of plant life, which is beneficial for improving breeding programs of this dioecious species. In addition, we have obtained a proper RAPD protocol that is useful for other species of rattan.

  16. Comparison of Haemophilus parasuis reference strains and field isolates by using random amplified polymorphic DNA and protein profiles

    OpenAIRE

    Zehr Emilie S; Lavrov Dennis V; Tabatabai Louisa B

    2012-01-01

    Abstract Background Haemophilus parasuis is the causative agent of Glässer’s disease and is a pathogen of swine in high-health status herds. Reports on serotyping of field strains from outbreaks describe that approximately 30% of them are nontypeable and therefore cannot be traced. Molecular typing methods have been used as alternatives to serotyping. This study was done to compare random amplified polymorphic DNA (RAPD) profiles and whole cell protein (WCP) lysate profiles as methods for dis...

  17. Genetic Dissection of New Genotypes of Drumstick Tree (Moringa oleifera Lam.) Using Random Amplified Polymorphic DNA Marker

    OpenAIRE

    Shamsuddeen Rufai; Hanafi, M. M.; Rafii, M. Y.; Ahmad, S; Arolu, I. W.; Jannatul Ferdous

    2013-01-01

    The knowledge of genetic diversity of tree crop is very important for breeding and improvement program for the purpose of improving the yield and quality of its produce. Genetic diversity study and analysis of genetic relationship among 20 Moringa oleifera were carried out with the aid of twelve primers from, random amplified polymorphic DNA marker. The seeds of twenty M. oleifera genotypes from various origins were collected and germinated and raised in nursery before transplanting to the fi...

  18. SDS-PAGE of Whole-Cell Proteins and Random Amplified Polymorphic DNA (RAPD) Analyses of Leptotrichia Isolates

    OpenAIRE

    Eribe, Emenike Ribs K.; Olsen, Ingar

    2011-01-01

    In a polyphasic approach to improve the taxonomy of Leptotrichia we have recently demonstrated heterogeneity in the enzymatic/biochemical reactions and cellular fatty acid content of Leptotrichia isolates. In the present study, SDS-PAGE of whole-cell proteins and random amplified polymorphic DNA (RAPD) analyses were used to further characterize and distinguish these isolates of which 57 had been assigned as Leptotrichia buccalis and two as ‘Leptotrichia pseudobuccalis’. The phylog...

  19. Diversity, molecular phylogeny and fingerprint profiles of airborne Aspergillus species using random amplified polymorphic DNA.

    Science.gov (United States)

    Kermani, Firoozeh; Shams-Ghahfarokhi, Masoomeh; Gholami-Shabani, Mohammadhassan; Razzaghi-Abyaneh, Mehdi

    2016-06-01

    In the present study, diversity and phylogenetic relationship of Aspergillus species isolated from Tehran air was studied using random amplified polymorphic DNA (RAPD)-polymerase chain reaction (RAPD-PCR). Thirty-eight Aspergillus isolates belonging to 12 species i.e. A. niger (28.94 %, 11 isolates), A. flavus (18.42 %, 7 isolates), A. tubingensis (13.15 %, 5 isolates), A. japonicus (10.52 %, 4 isolates), A. ochraceus (10.52 %, 4 isolates), and 2.63 %, 1 isolate from each A. nidulans, A. amstelodami, A. oryzae, A. terreus, A. versicolor, A. flavipes and A. fumigatus were obtained by settle plate method which they were distributed in 18 out of 22 sampling sites examined. Fungal DNA was extracted from cultured mycelia of all Aspergillus isolates on Sabouraud Dextrose Agar and used for amplification of gene fragments in RAPD-PCR using 11 primers. RAPD-PCR data was analyzed using UPGMA software. Resulting dendrogram of combined selected primers including PM1, OPW-04, OPW-05, P160, P54, P10 and OPA14 indicated the distribution of 12 Aspergillus species in 8 major clusters. The similarity coefficient of all 38 Aspergillus isolates ranged from 0.02 to 0.40 indicating a wide degree of similarities and differences within and between species. Taken together, our results showed that various Aspergillus species including some important human pathogenic ones exist in the outdoor air of Tehran by different extents in distribution and diversity and suggested inter- and intra-species genetic diversity among Aspergillus species by RAPD-PCR as a rapid, sensitive and reproducible method. PMID:27116962

  20. Intra-specific relationships among Tibetan Eared-pheasants based on randomly amplified polymorphic DNA(RAPD) analysis

    Institute of Scientific and Technical Information of China (English)

    DING Wei; ZHANG Zhengwang; CHANG Jiang; ZHANG Er; WU Xiushan; ZHANG Jinguo

    2006-01-01

    The Tibetan Eared-pheasant Crossoptilon harmani is a rare species native to China.A captive population has been established in the Beijing Zoo since 1999.In order to determine the kinship of the offsprings in 2001,randomly amplified polymorphic DNA (RAPD) was used to examine the parenthood of seven Tibetan Eared-pheasants in the Beijing Zoo.To amplify the genomic DNA of each individual,53 arbitrary primers were selected.The results of amplifica tions showed that 14 primers had clear and distinct RAPD patterns.Totally,226 amplified fragments were generated by RAPD in this study.Cluster analysis of the seven Tibetan Eared-pheasants indicated that all the four young birds had the same father (No.5 male).This study provides a practical method to determine the relationship of offsprings whose parents are unknown in birds.

  1. Random amplified polymorphic DNA assay is less discriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus.

    OpenAIRE

    Saulnier, P; Bourneix, C; Prévost, G; Andremont, A

    1993-01-01

    Twenty-six strains of methicillin-resistant Staphylococcus aureus with different pulsed-field gel electrophoresis fingerprints were tested by random amplified polymorphic DNA assay with three primers, resulting in 15 to 20 different random amplified polymorphic DNA fingerprints. By summing the results for the three primers, the number of different fingerprints increased to 25, but two strains could not be differentiated. We conclude that pulsed-field gel electrophoresis remains the best metho...

  2. Genotoxicity of Thermopsis turcica on Allium cepa L. roots revealed by alkaline comet and random amplified polymorphic DNA assays.

    Science.gov (United States)

    Ciğerci, İbrahim Hakkı; Cenkci, Süleyman; Kargıoğlu, Mustafa; Konuk, Muhsin

    2016-08-01

    This study was undertaken to evaluate genotoxic potential of Thermopsis turcica aqueous extracts on the roots of onion bulb (Allium cepa L.) by comet assay and random amplified polymorphic DNA technique. The Allium root growth inhibition test indicated that the EC50 and 2×EC50 values were 8 and 16 mg/ml concentrations of T. turcica aqueous extracts, respectively. The negative control (distilled water), positive control (methyl methane sulfonate, 10 mg/l) and 8 and 16 mg/ml concentrations of T. turcica extracts were introduced to the roots of onion bulbs for 24 and 96 h. The root growth, DNA damage in root cells and randomly amplified polymorphic DNA (RAPD) profiles of root tissue were used as endpoints of the genotoxicity. The comet assay clearly indicated that dose-dependent single strand DNA breaks in the root nuclei of onions were determined for the treatment concentrations of T. turcica extracts. In comparison to RAPD profile of negative control group, RAPD polymorphisms became evident as disappearance and/or appearance of RAPD bands in treated roots. The diagnostic and phenetic numerical analyses of RAPD profiles obviously indicated dose-dependent genotoxicity induced by Thermopsis extracts. In conclusion, the results clearly indicated that water extract of T. turcica has genotoxic potential on the roots of onion bulbs as shown by comet assay and RAPD technique. PMID:25550040

  3. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.; Gram, Lone; Ahrens, Peter

    2004-01-01

    other methods. Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was...... different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included for...... virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  4. Randomly amplified polymorphic DNA-polymerase chain reaction analysis of two different populations of cultured Korean catfish Silurus asotus

    Indian Academy of Sciences (India)

    Jong-Man Yoon; Gye-Woong Kim

    2001-12-01

    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic bands per primer. The polymorphic bands in these populations ranged from 56.4% to 59.6%. Polymorphic bands per lane within populations ranged from 4.9% to 5.3%. The similarity within the Kunsan population varied from 0.39 to 0.82 with a mean (± SD) of 0.56 ± 0.08. The level of bandsharing values was 0.59 ± 0.07 within the catfish population from Yesan. The genetic similarity in cultured catfish populations may have been caused because individuals from two populations were reared in the same environmental conditions or by inbreeding during several generations. However, in view of bandsharing values, polymorphic bands and also the specific major bands that were inter-population-specific, significant genetic differentiation between these populations were present even if bandsharing (BS) values were somewhat numerically different. Therefore, the number of RAPD polymorphisms identified in this study may be sufficient to permit estimating genetic similarity and diversity. However, in future, additional populations, sampling sites and individuals will be necessary to make up for these weak points.

  5. Use of random amplified polymorphic DNA as a typing method for Candida albicans in epidemiological surveillance of a burn unit.

    OpenAIRE

    F. Robert; Lebreton, F; Bougnoux, M. E.; Paugam, A; Wassermann, D.; Schlotterer, M; Tourte-Schaefer, C; Dupouy-Camet, J

    1995-01-01

    Burn patients are particularly exposed to deep-seated nosocomial infections caused by Candida species. Superficial carriage of C. albicans is a potential source of infection and dissemination, and typing methods could be useful to trace the different isolates. We report the use of random amplified polymorphic DNA to type isolates of C. albicans in the Hôpital Cochin burn unit. This molecular typing method, which is based on PCR with arbitrary short primers, was evaluated on a panel of 32 C. a...

  6. Comparison of the genetic diversity of wild and captive groups of Microcebus murinus using the random amplified polymorphic DNA method.

    Science.gov (United States)

    Neveu, H; Hafen, T; Zimmermann, E; Rumpler, Y

    1998-01-01

    Continued survival of most animal species depends on population management and active protection. It is generally agreed that, in order to avoid extinction of endangered species, ex situ and in situ conservation must be developed in tandem. However, even though many recommendations have been put forward to promote the survival of captive populations, some rapidly become extinct due to loss of genetic diversity (drift effect). Genetic markers, such as random amplified polymorphic DNA (RAPD) markers, can be applied to rapid testing of many individuals. They also permit analysis of very small amounts of DNA, when small species such as mouse lemurs (Microcebus) are to be tested. Using RAPD markers, we compare genetic diversity in four captive groups of Microcebus murinus to that in a sample of 70 wild mouse lemurs. Following the principles of Mendelian inheritance, each amplified fragment of DNA may be considered as a 'locus' (or an amplifying site). The series of bands amplified by a particular primer in any individual is referred to as the individual's 'profile'. We tested 5 primers, or, in the above terms, we studied 98 different 'loci'. Results showed that the captive groups had lost genetic information with respect to the wild sample. Among the four captive groups, the loss of genetic diversity varied according to their number of founders and/or the management of their captive reproduction. Our study of polymorphism permitted us to establish tools for the genetic management of captive breeding, and for the determination of paternity which frequently give better results than behavioural studies; and simulation of introductions or departures of individuals in one very monomorphic group permitted estimation of future increases in its genetic diversity. PMID:9595690

  7. Characterization of Pseudomonas aeruginosa in Burn Patients Using PCR- Restriction Fragment Length Polymorphism and Random Amplified Polymorphic DNA Analysis

    OpenAIRE

    Abdolaziz Rastegar Lari; Bagher Yakhchali; Parviz Owlia; Hassan Salimi

    2010-01-01

    One of the major opportunistic pathogens in patients with burninjuries is Pseudomonas aeruginosa, which causes severe infectionsin burned patients. The objective of the study was to examinethe molecular epidemiology of P. aeruginosa colonization inthe burn unit of Shahid Motahari Hospital in Tehran, Iran. Restrictionfragment length polymorphism (RFLP) and random amplifiedpolymorphic DNA (RAPD) analysis were employed tostudy 127 clinical and two environmental P. aeruginosa isolatescollected fr...

  8. Random amplified polymorphic DNA profiles as a tool for the characterization of Brazilian keratitis isolates of the genus Acanthamoeba

    Directory of Open Access Journals (Sweden)

    Alves J.M.P.

    2000-01-01

    Full Text Available The genus Acanthamoeba comprises free-living amebae identified as opportunistic pathogens of humans and other animal species. Morphological, biochemical and molecular approaches have shown wide genetic diversity within the genus. In an attempt to determine the genetic relatedness among isolates of Acanthamoeba we analyzed randomly amplified polymorphic DNA (RAPD profiles of 11 Brazilian isolates from cases of human keratitis and 8 American type culture collection (ATCC reference strains. We found that ATCC strains belonging to the same species present polymorphic RAPD profiles whereas strains of different species show very similar profiles. Although most Brazilian isolates could not be assigned with certainty to any of the reference species, they could be clustered according to pattern similarities. The results show that RAPD analysis is a useful tool for the rapid characterization of new isolates and the assessment of genetic relatedness of Acanthamoeba spp. A comparison between RAPD analyses and morphological characteristics of cyst stages is also discussed.

  9. Use of random amplified polymorphic DNA as a typing method for Candida albicans in epidemiological surveillance of a burn unit.

    Science.gov (United States)

    Robert, F; Lebreton, F; Bougnoux, M E; Paugam, A; Wassermann, D; Schlotterer, M; Tourte-Schaefer, C; Dupouy-Camet, J

    1995-01-01

    Burn patients are particularly exposed to deep-seated nosocomial infections caused by Candida species. Superficial carriage of C. albicans is a potential source of infection and dissemination, and typing methods could be useful to trace the different isolates. We report the use of random amplified polymorphic DNA to type isolates of C. albicans in the Hôpital Cochin burn unit. This molecular typing method, which is based on PCR with arbitrary short primers, was evaluated on a panel of 32 C. albicans strains isolated from various anatomical sites of unrelated patients, and the strains showed 22 different patterns. Random amplified polymorphic DNA was then used in the epidemiological surveillance of the patients in the burn unit over a 9-month period. Seven patterns were identified among 84 isolates from 18 patients. One pattern (pattern A) corresponding to isolates from 7 of the 18 patients (68% of isolates) predominated throughout the 9-month study, while some strains with other profiles were isolated only once. Some profiles appeared to show a particular geographic pattern within the unit, suggesting transmission from room to room. These results underline the importance of fungal surveillance in such patients and the need to inform nursing staff of measures to prevent the spread of Candida spp. from patient to patient. PMID:7494029

  10. Use of random amplified polymorphic DNA (RAPD to detect DNA damage induced by Prangos ferulacea (Umbelliferae essential oil against the Mediterranean flour moth Ephestia kuehniella Zeller (Lepidoptera: Pyralidae

    Directory of Open Access Journals (Sweden)

    Ercan Fahriye Sumer

    2015-01-01

    Full Text Available DNA damage detection in Ephestia kuehniella by RAPD-PCR Abstract - The random amplified polymorphic DNA (RAPD assay is a useful method for detecting genotoxin-induced DNA damage. In the present study, this assay was evaluated to measure the essential oil of Prangos ferulacea-induced DNA changes in Ephestia kuehniella Zeller larvae. The third instar larvae of E. kuehniella were exposed to 500 μl L-1 essential oil for 24 h. Forty random primers were used for RAPD-PCR of which eleven produced unique polymorphic band patterns. In comparison with control larvae, the essential oil-treated larvae showed greater changes in RAPD profiles. This is the first report of an analysis of the genotoxic effect of P. ferulacea essential oil against E. kuehniella larvae using RAPD-PCR.

  11. DNA methylation changes detected by methylation-sensitive amplified polymorphism in two contrasting rice genotypes under salt stress

    Institute of Scientific and Technical Information of China (English)

    Wensheng Wang; Xiuqin Zhao; Yajiao Pan; Linghua Zhu; Binying Fu; Zhikang Li

    2011-01-01

    DNA methylation,one of the most important epigenetic phenomena,plays a vital role in tuning gene expression during plant development as well as in response to environmental stimuli.In the present study,a rnethylation-sensitive amplified polymorphism (MSAP) analysis was performed to profile DNA methylation changes in two contrasting rice genotypes under salt stress.Consistent with visibly different phenotypes in response to salt stress,epigenetic markers classified as stable inter-cultivar DNA methylation differences were determined between salttolerant FL478 and salt-sensitive IR29.In addition,most tissue-specific DNA methylation loci were conserved,while many of the growth stage-dependent DNA methylation loci were dynamic between the two genotypes.Strikingly,salt stress induced a decrease in DNA methylation specifically in roots at the seedling stage that was more profound in IR29 than in the FL478.This result may indicate that demethylation of genes is an active epigenetic response to salt stress in roots at the seedling stage,and helps to further elucidate the implications of DNA methylation in crop growth and development.

  12. Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

    Directory of Open Access Journals (Sweden)

    KUSUMADEWI SRI YULITA

    2011-07-01

    Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

  13. Uso do Random Amplified Polymorphic DNA (RAPD no estudo populacional do Triatoma brasiliensis Neiva, 1911 Use of Random Amplified Polymorphic DNA (RAPD in the populational study of Triatoma brasiliensis Neiva, 1911

    Directory of Open Access Journals (Sweden)

    Érika C. Borges

    2000-01-01

    Full Text Available Para o estudo de variabilidade genética em Triatoma brasiliensis, o principal vetor da doença de Chagas no Nordeste brasileiro, espécimes de três diferentes populações intradomiciliares foram analisados. Regiões do DNA genômico foram amplificadas utilizando dois iniciadores randômicos através da técnica de RAPD (Random Amplified Polymorphic DNA, visualizados em géis de poliacrilamida corados pela prata. Os perfis originados se mostraram bastante homogêneos quando comparados intrapopulacionalmente. Populações capturadas em duas regiões diferentes do Estado do Ceará também apresentaram homogeneidade entre si, mas, quando comparadas com a população proveniente do Piauí, foi possível diferenciá-las. Esses resultados, preliminares, indicam que o RAPD pode ser usado com sucesso nos estudos de variabilidade em triatomíneos, bem como sugerem a existência de variabilidade entre diferentes populações de T. brasiliensis pertencentes a uma mesma subespécie.We evaluated the genetic variability of Triatoma brasiliensis, the main vector of Chagas disease in Northeast Brazil, using specimens from three populations. Regions of genomic DNA were amplified by RAPD (Random Amplified Polimorphic DNA, using two primers. The products were visualized after polyacrylamide gel electrophoresis followed by silver staining. A dendrogram constructed through the Dice similarity coefficient allowed for separation of the tested specimens into three distinct groups. The populations captured in areas from Ceará State showed similar profiles, but different from that captured in Piauí State. Our results indicate that RAPD can be used successfully in triatomine studies and suggest the presence of genetic variability between different populations of T. brasiliensis.

  14. Genetic variability in geographical populations of Culex quinquefasciatus Say (Diptera: Culicidae) from India based on random amplified polymorphic DNA analysis.

    Science.gov (United States)

    Sharma, A K; Mendki, M J; Tikar, S N; Chandel, K; Sukumaran, D; Parashar, B D; Veer, Vijay; Agarwal, O P; Prakash, Shri

    2009-10-01

    Genetic variability and environmental factors may influence the refractiveness, propagation of pathogen and transmission of disease. Random amplified polymorphic DNA (RAPD) is one of the widely used molecular markers for population genetic diversity studies. In present study, RAPD is used to ascertain the genetic variability in Culex quinquefasciatus populations collected from various Indian geographical locations. Out of 50 RAPD primers screened, 14 primers exhibited clear, concrete and distinct banding pattern showing up to 100% polymorphism. Primer OPBD3 was tested with DNA of 14 geographical populations from India (including one laboratory population) showed 21 loci representing 14 populations with 100% polymorphism. The genetic diversity among the populations indicated the Shannon index (I) and gene diversity index (H(ST)), 0.48 and 0.31, respectively among the population, displaying rich genetic variation among the Cx. quinquefasciatus populations. Consensus tree showed two clusters indicating the genetic variation among the various geographical populations. The findings of this study may be useful to understand the population variation under different ecological conditions and development of effective vector management strategies. PMID:19577531

  15. Assessment of Genetic Variation Within Indian Mustard(Brassica juncea) Germplasm Using Random Amplified Polymorphic DNA Markers

    Institute of Scientific and Technical Information of China (English)

    Muhammad Ayub Khan; Malik Ashiq Rabbani; Muharnmad Munir; Saifullah Khan Ajmal; Muhammad Azim Malik

    2008-01-01

    Genetic diversity among 45 Indian mustard (Brassica Juncea L.) genotypes comprising 37 germplasm collections, five advance breeding lines and three improved cultivars was investigated at the DNA level using the random amplified polymorphic DNA (RAPD) technique. Fifteen primers used generated a total of 92 RAPD fragments, of which 81 (88%) were polymorphic. Of these, 13 were unique to accession 'Pak85559'. Each primer produced four to nine amplified products with an average of 6.13 bands per primer. Based on pairwise comparisons of RAPD amplification products, Nei and Li's similarity coefficients were calculated to evaluate the relationships among the accessions. Pairwise similarity indices were higher among the oilseed accessions and cultivars showing narrow ranges of 0.77-0.99. An unweighted pair-group method with arithmetic averages cluster analysis based on these genetic similarities placed most of the collections and oilseed cultivars close to each other, showing a low level of polymorphism between the accessions used. However, the clusters formed by oilseed collections and cultivars were comparatively distinct from that of advanced breeding lines. Genetically, all of the accessions were classified into a few major groups and a number of individual accessions. Advanced breeding lines were relatively divergent from the rest of the accessions and formed independent clusters. Clustering of the accessions did not show any pattern of association between the RAPD markers and the collection sites. A low level of genetic variability of oilseed mustard was attributed to the selection for similar traits and horticultural uses. Perhaps close parentage of these accessions further contributed towards their little diversity. The study demonstrated that RAPD is a simple and fast technique to compare the genetic relationship and pattern of variation among the gene pool of this crop.

  16. Random amplified polymorphic DNA assay is less discriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Saulnier, P; Bourneix, C; Prévost, G; Andremont, A

    1993-04-01

    Twenty-six strains of methicillin-resistant Staphylococcus aureus with different pulsed-field gel electrophoresis fingerprints were tested by random amplified polymorphic DNA assay with three primers, resulting in 15 to 20 different random amplified polymorphic DNA fingerprints. By summing the results for the three primers, the number of different fingerprints increased to 25, but two strains could not be differentiated. We conclude that pulsed-field gel electrophoresis remains the best method of typing methicillin-resistant S. aureus strains. PMID:8463406

  17. Genetic Characterization and Relatedness among Cherry Cultivars in a Germplasm Bank by Randomly Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Jesus Moreno

    2005-12-01

    Full Text Available Random amplified polymorphic DNA (RAPD analysis was performed on 38 cultivars of cherry (Prunus avium L. grown in the Jerte Valley, Cáceres, Spain. Thirty five selected decamer primers produced 69 reproducible polymorphic amplification products. The degree of polymorphism detected made possible the identification of all the cultivars by combining the RAPD banding patterns of only seven primers: OPK-08, OPQ-14, OPR-09, OPS-19, OPX-02, OPX-15 and OPZ-13. Eleven unique markers allowed identification of nine cultivars while 15 cultivars were identified by unique banding patterns. A similarity matrix derived from the RAPD amplification products generated by all the primers was obtained using the index of similarity of Jaccard. The similarity coefficients among cultivars ranged from 0.27 to 0.81 with an average of 0.50. A dendrogram based on UPGMA clustering method was constructed using the similarity matrix. The dendrogram showed a good correlation between the clustering of cherry cultivars and their geographic origin, especially revealing a stronger genetic proximity between some of the most characteristic cultivars of the Jerte Valley. This result supports the autochthonous origin hypothesis for these cultivars.

  18. High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) for the characterisation of pathogenic leptospires

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Craig, S B; Graham, G C;

    2010-01-01

    High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) is a novel technology that has emerged as a possible method to characterise leptospires to serovar level. RAPD-HRM has recently been used to measure intra-serovar convergence between strains of the same serovar as ...

  19. Characterization of Pseudomonas aeruginosa in Burn Patients Using PCR- Restriction Fragment Length Polymorphism and Random Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Abdolaziz Rastegar Lari

    2010-09-01

    Full Text Available One of the major opportunistic pathogens in patients with burninjuries is Pseudomonas aeruginosa, which causes severe infectionsin burned patients. The objective of the study was to examinethe molecular epidemiology of P. aeruginosa colonization inthe burn unit of Shahid Motahari Hospital in Tehran, Iran. Restrictionfragment length polymorphism (RFLP and random amplifiedpolymorphic DNA (RAPD analysis were employed tostudy 127 clinical and two environmental P. aeruginosa isolatescollected from January to June 2008. In RFLP, the PCR productsof 16S rRNA gene were digested with restriction enzyme Alu I,Hae III, and Rsa I, and the fragments generated were analyzed byagarose electrophoresis. Molecular typing by RFLP did show nodiscriminatory power for P. aeruginosa isolates, but RAPD-PCRrevealed eight different genotypes; RAPD1to RAPD8 in clinicaland environmental isolates. RAPD1 was the major genotype inclinical (n=64, 50.4% and environmental isolates (n=1, 50%.The findings suggest that RAPD might have a superior typeabilityand discriminatory power over RFLP to study P. aeruginusa.Moreover, they highlight the need for further attention to the controlof infection sources in Burn Units to prevent the transmissionof the bacterium.

  20. Genetic Differentiation of Archachatina marginata Populations from Three Vegetation Zones Using Radom Amplified Polymorphic DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Comfort O. AFOLAYAN

    2015-09-01

    Full Text Available The genetic differentiation of Archachatina marginata populations from three different zones of Nigeria was studied with a view to delimiting them into sub-species. One hundred and nineteen (119 snail specimens were collected, comprising of forty (40 specimens from Yenagoa (Mangrove forest and from Kabba (Guinea Savanna and thirty nine (39 specimens were from Ile-Ife (Rainforest. Eight parameters of the shell specimens of A. marginata which included height of shell, width of shell, aperture height, aperture width, spire length, spire width, penultimate whorl length and first whorl length were subjected to Principal Component Analysis (PCA and Canonical Variates Analysis (CVA to delimit the populations into sub-species. DNA of the various populations was extracted from the foot muscle using CTAB (Cetyl Trimethyl Ammonium Bromide method, which was subjected to RAPD analysis. The RAPD studies employed five (5 oligonucleotide primers (OPB – 17, OPH – 12, OPH – 17, OPI – 06 and OPU – 14 to amplify DNA from 27 samples of A. marginata selected. All five primers produced different band patterns, and the number of fragments amplified per primer varied. Among them, OPB- 17 gave DNA profiles with more numerous bands than the others primers. Both PCA and CVA produced overlapped clusters of A. marginata specimens from the three vegetation zones. The height of shell was observed to be the most variable feature and preferably the most suitable parameter for population grouping. Analysis of the proportions of polymorphic loci and band sharing based on similarity indices for A. marginata samples indicated a relatively high level of genetic variation in the populations from the three areas.

  1. Genetic diversity analysis of Penicillium marneffei isolated from AIDS patients in Guangdong, China using randomly amplified polymorphic DNA

    Institute of Scientific and Technical Information of China (English)

    LI Ling-hua; HU Feng-yu; CHEN Wan-shan; CAI Wei-ping; SONG Wei-nan; KUANG Yan-ling; TANG Xiao-ping

    2012-01-01

    Background Penicillium mameffei (P.mameffei) is an emerging pathogenic fungus that can cause invasive mycosis in patients with AIDS.The epidemiological features of P.mameffei infection in AIDS patients in Guangdong province remain unclear so far.This study aimed to investigate the genetic diversity within a population of 163 P.mameffei isolates obtained from AIDS patients and search for the dominant clinical strains in Guangdong province.Methods One hundred and sixty-three P.marneffeiisolates obtained from AIDS patients in Guangdong province during January 2004 and December 2009 were studied by randomly amplified polymorphic DNA (RAPD) using two random primers (H2 and H22).The degree of similarity between samples was calculated through similarity coefficients from RAPD fragment data and the dendrogram was assessed using the unweighted pair group method with arithmetic mean (UPGMA).Results Two primers showed a high degree of discrimination and good stability.Primer H2 yielded eight different patterns (H2-1 to H2-8) among 163 isolates with the discriminatory power being 0.413.Primer H22 identified seven types (H22-1 to H22-7) among 163 isolates with the discriminatory power being 0.467.Genetic similarity coefficients based on RAPD data among 163 P.marneffei isolates ranged from 0.681 to 0.957,61.96% of which were no less than 0.83.The discriminatory power of the two primers was 0.524.One hundred and sixty-three P.marneffei isolates were clustered into nine distinct groups (groups I to IX) at the similarity coefficient value of 0.83 and group Ⅰ was the most common,including 101 strains (61.96%).Conclusion The RAPD analyses could provide important information as to the degree of genetic diversity and the relationship among clinical P.mameffei isolates,revealing genetic polymorphism and dominant strains.

  2. Diversity of Listeria monocytogenes isolates from cold-smoked salmon produced in different smokehouses as assessed by Random Amplified Polymorphic DNA analyses

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Jørgensen, Lasse Vigel; Ojeniyi, B.;

    2001-01-01

    One hundred and forty-eight Listeria monocytogenes isolates originating from vacuum packed cold-smoked salmon produced in 10 different Danish smokehouses were compared by Random Amplified Polymorphic DNA (RAPD) profiling. A total of 16 different reproducible RAPD profiles were obtained using a...... indicate a possible persistence of closely related strains of L. monocytogenes in smokehouses. (C) 2001 Elsevier Science B.V. All rights reserved...

  3. Diversity of Listeria monocytogenes isolates from cold-smoked salmon produced in different smokehouses as assessed by Random Amplified Polymorphic DNA analyses

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Jørgensen, Lasse Vigel; Ojeniyi, B.; Huss, Hans Henrik; Gram, Lone

    One hundred and forty-eight Listeria monocytogenes isolates originating from vacuum packed cold-smoked salmon produced in 10 different Danish smokehouses were compared by Random Amplified Polymorphic DNA (RAPD) profiling. A total of 16 different reproducible RAPD profiles were obtained using a st...... indicate a possible persistence of closely related strains of L. monocytogenes in smokehouses. (C) 2001 Elsevier Science B.V. All rights reserved...

  4. Application of random amplified polymorphic DNA (RAPD) analysis for identification of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets.

    Science.gov (United States)

    Asensio, Luis; González, Isabel; Fernández, Alicia; Rodríguez, Miguel A; Lobo, Esther; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2002-02-01

    A random amplified polymorphic DNA (RAPD) method was developed for the specific identification of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets. Using two different reaction primers (S1 and L1), RAPD analysis produced clear fingerprints from which the three fish species could be easily identified. This approach is rapid and reliable and offers the potential to detect fraudulent or unintentional mislabeling of these species in routine seafood authentication analysis. PMID:11848581

  5. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  6. Using Random Amplified Polymorphic DNA to Assess Genetic Diversity and Structure of Natural Calophyllum brasiliense (Clusiaceae) Populations in Riparian Forests

    OpenAIRE

    Evânia Galvão Mendonça; Anderson Marcos de Souza; Fábio de Almeida Vieira; Regiane Abjaud Estopa; Cristiane Aparecida Fioravante Reis; Dulcinéia de Carvalho

    2014-01-01

    The objective of this study was to assess the genetic variability in two natural populations of Calophyllum brasiliense located along two different rivers in the state of Minas Gerais, Brazil, using RAPD molecular markers. Eighty-two polymorphic fragments were amplified using 27 primers. The values obtained for Shannon index (I) were 0.513 and 0.530 for the populations located on the margins of the Rio Grande and Rio das Mortes, respectively, demonstrating the high genetic diversity in the st...

  7. The random amplified polymorphic DNA (RAPD) assay to determine DNA alterations, repair and transgenerational effects in B(a)P exposed Daphnia magna.

    Science.gov (United States)

    Atienzar, Franck A; Jha, Awadhesh N

    2004-08-18

    The random amplified polymorphic DNA (RAPD) is a useful assay for the detection of genotoxin-induced DNA damage and mutations. In this study, we have further evaluated the potential of this assay to measure benzo(a)pyrene [B(a)P]-induced DNA changes, and repair (in kinetic experiments) as well as transgenerational effects in the water fleas, Daphnia magna. The organisms, which reproduce parthenogenetically, were exposed to 50 microg L(-1) B(a)P for 3 or 6 days and were allowed to recover in clean medium for 12 or 9 days, respectively. Qualitative and quantitative changes were observed in RAPD profiles generated not only from the B(a)P exposed Daphnia but also from previously treated organisms during the recovery experiments. The fact that some of the RAPD changes disappeared at the end of both recovery experiments suggested that the DNA effects were fully repaired or reversed. In addition, some of the B(a)P-induced RAPD alterations detected in parental D. magna were also observed in the offspring patterns. This suggested that DNA alterations that occurred in germ cells were probably transmitted to the next cohorts. The present study shows that the RAPD method can be useful to qualitatively assess the kinetics of DNA changes, repair and transgenerational effects and such effects could potentially be linked to survival and reproductive success at higher levels of biological organisation. In addition, the water fleas have efficient capabilities to repair or reverse B(a)P-induced DNA effects. Finally, unrepaired or misrepaired genetic damage induced by genotoxins such as B(a)P could be transmitted to next generations in these parthenogenetically reproducing organisms. PMID:15288546

  8. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    OpenAIRE

    Iñiguez Alena M; Araújo Adauto; Ferreira Luiz Fernando; Vicente Ana Carolina P

    2003-01-01

    The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA) present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pre...

  9. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. PMID:25461675

  10. Molecular Diversity of Antagonistic Streptomyces spp. against Botrytis allii, the agent of onion gray mold using Random Amplified Polymorphic DNA (RAPD Markers

    Directory of Open Access Journals (Sweden)

    M. Jorjandi

    2014-08-01

    Full Text Available As an aim in sustainable agriculture, biological control of plant diseases has received intensive attention mainly as a response to public concern about the use of chemical fungicides in the environment. Soil Actinomycetes particularly Streptomyces spp. enhance soil fertility and have antagonistic activity against wide range of plant pathogens. To investigate for biocontrol means against the pathogen, 30 isolates of Actinomycetes have been isolated from agricultural soils of Kerman province of Iran and assayed for antagonistic activity against Botrytis allii, the agent of onion gray mold. RAPD DNA analysis has been used to determine the relatedness of active and non-active isolates based on their RAPD-PCR fingerprints. PCR amplifiable DNA samples have been isolated using the CTAB method and amplified fragments have been obtained from 5 random 10-mer primers. Different DNA fingerprinting patterns have been obtained for all of the isolates. Electrophoretic and cluster analysis of the amplification products has revealed incidence of polymorphism among the isolates. A total of 138 bands, ranging in size from 150-2800 bp, have been amplified from primers which 63.7% of the observed bands have been polymorphic. Genetic distances among different varieties have been analyzed with a UPGMA (Unweighted pair-group method, arithmetic average-derived dendrogram. Resulting dendrogram has showed from 0.65 to 0.91 similarities among varieties and divided the isolates into five major groups. Isolates which haven’t had any antagonistic activity against B. allii have been separated into a group and other isolates classified into four groups. The results indicate that RAPD is an efficient method for discriminating and studying genetic diversity of Streptomyces isolates.

  11. An Analysis on DNA Fingerprints of Thirty Papaya Cultivars (Carica papaya L., Grown in Thailand with the Use of Amplified Fragment Length Polymorphisms Technique

    Directory of Open Access Journals (Sweden)

    Janthasri Ratchadaporn

    2007-01-01

    Full Text Available The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1 Kaeg Dum and Malador (2 Kaeg Nuan (3 Pakchong and Solo (4 Taiwan (5 Co Coa Hai Nan and (6 Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  12. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found. PMID:19090101

  13. A Preliminary Genetic Investigation of Rastrelliger Kanagurta Based on Random Amplified Polymorphic DNA and Mitochondrial ND2 Gene

    Institute of Scientific and Technical Information of China (English)

    Siti Azizah Mohd Nor; Abu Talib A; Mohd Ghows M A; Samsudin B

    2008-01-01

    In a preliminary investigation, Random Amplified Polymorphie DNA (RAPD) analysis and partial mitochon-drial ND2 gene sequencing were conducted to study the genetic variation of the Indian mackerel, Rastrelliger kanagurta along a 450 km stretch of its distribution on the west coast of Peninsular Malaysia. A total of 53 individuals from 6 popu-lations were analyzed using 4 RAPD primers and a sub-sample of 15 individuals was chosen for sequencing of partial ND2 gene. Comparison between the 2 markers revealed genetic structuring in the RAPD results but genetic homogeneity for ND2 gene. Based on the former there may be at least 2 genetically differentiated groups of Rastrelliger kanagurta a-long this stretch.

  14. Identification of a differentially expressed thymidine kinase gene related to tapping panel dryness syndrome in the rubber tree (Hevea brasiliensis Muell. Arg. by random amplified polymorphic DNA screening

    Directory of Open Access Journals (Sweden)

    Arjunan Thulaseedharan

    2010-01-01

    Full Text Available Tapping panel dryness (TPD syndrome is one of the latex yield affecting factors in the rubber tree (Hevea brasiliensis Mull. Arg.. Therefore, identification of a DNA marker will be highly useful for screening progenies in breeding programs. The major goal of this study was to detect genetic variations and/or identification of gene fragments among 37 Hevea clones by the random amplified polymorphic DNA “fingerprinting” technique. Different levels of DNA polymorphism were detected with various primers and a distinct polymorphic band (2.0 kb was obtained with OPA-17 primer. It was cloned into a plasmid vector for further sequence characterization and the nucleotide sequence shows homology with a novel putative plant thymidine kinase (TK gene, designated as HbTK (Hevea brasiliensis thymidine kinase; GenBank accession number AY130829. The protein HbTK has 67%, 65%, 64%, and 63% similarity to TK genes of Medicago, Oryza, Arabidopsis, and Lyco- persicon, respectively, and it was highly conserved in all species analyzed. The predicted amino acid sequence contained conserved domains of TK proteins in the C-terminal half. Southern blot analysis indicated that HbTK is one of the members of a small gene family. Northern blot results revealed that the expression of the HbTK gene was up-regulated in mature bark tissues of the healthy tree while it was down-regulated in the TPD-affected one. These results suggest that this gene may play important roles in maintaining active nucleotide metabolism during cell division at the tapped site of bark tissues in the healthy tree under stress (tapping conditions for normal latex biosynthesis.

  15. Clonality Analysis of Helicobacter pylori in Patients Isolated from Several Biopsy Specimens and Gastric Juice in a Japanese Urban Population by Random Amplified Polymorphic DNA Fingerprinting

    Directory of Open Access Journals (Sweden)

    Nariaki Toita

    2013-01-01

    Full Text Available Background. The number of Helicobacter pylori clones infecting a single host has been discussed in numerous reports. The number has been suggested to vary depending on the regions in the world. Aim. The purpose of this study was to examine the number of clones infecting a single host in a Japanese urban population. Materials and Methods. Thirty-one Japanese patients undergoing upper gastrointestinal endoscopy were enrolled in this study. H. pylori isolates (total 104 strains were obtained from biopsy specimens (antrum, corpus, and duodenum and gastric juice. Clonal diversity was examined by the random amplified polymorphic DNA (RAPD fingerprinting method. Results. The RAPD fingerprinting patterns of isolates from each patient were identical or very similar. And the isolates obtained from several patients with 5- to 9-year intervals showed identical or very similar RAPD patterns. Conclusion. Each Japanese individual of an urban population is predominantly infected with a single H. pylori clone.

  16. First characterization of Candida albicans by random amplified polymorphic DNA method in Nicaragua and comparison of the diagnosis methods for vaginal candidiasis in Nicaraguan women

    Directory of Open Access Journals (Sweden)

    Bello Martha Darce

    2002-01-01

    Full Text Available A total of 106 women with vaginitis in Nicaragua were studied. The positive rate for the identification of Candida species was 41% (44 positive cultures out of 106 women with vaginitis. The sensitivity of microscopic examination of wet mount with the potassium hydroxide (KOH was 61% and 70% with Gram's stain when using the culture of vaginal fluid as gold standard for diagnosis of candidiasis. Among the 44 positives cultures, isolated species of yeast from vaginal swabs were C. albicans (59%, C. tropicalis (23%, C. glabrata (14% and C. krusei (4%. This study reports the first characterization of 26 C. albicans stocks from Nicaragua by the random amplified polymorphic DNA method. The genetic analysis in this small C. albicans population showed the existence of linkage disequilibrium, which is consistent with the hypothesis that C. albicans undergoes a clonal propagation.

  17. Existence of two geographically-linked clonal lineages in the bacterial fish pathogen Photobacterium damselae subsp. piscicida evidenced by random amplified polymorphic DNA analysis.

    Science.gov (United States)

    Magariños, B; Toranzo, A E; Barja, J L; Romalde, J L

    2000-08-01

    In this work, we applied the random amplified polymorphic DNA (RAPD) technique to evaluate the genetic diversity in Photobacterium damselae subsp. piscicida (formerly Pasteurella piscicida), an important pathogen for different marine fish. Regardless of the oligonucleotide primer employed, the 29 isolates of Ph. damselae subsp. piscicida tested were separated into two groups, the RAPD-PCR analysis differentiated the European strains from the Japanese strains. The similarity between both groups estimated on the basis of the Dice coefficient was 75-80%. These results show that European and Japanese isolates of Ph. damselae subsp. piscicida, regardless of their host fish species, belong to two different clonal lineages. Our findings also indicate that RAPD profiling constitutes a useful tool for epidemiological studies of this fish pathogen. PMID:11057980

  18. Characterization of Grain Amaranth (Amaranthus spp. Germplasm in South West Nigeria Using Morphological, Nutritional, and Random Amplified Polymorphic DNA (RAPD Analysis

    Directory of Open Access Journals (Sweden)

    Pamela E. Akin-Idowu

    2016-01-01

    Full Text Available Efficient utilization of plant genetic resources for nutrition and crop improvement requires systematic understanding of the important traits. Amaranthus species are distributed worldwide with an interesting diversity of landraces and cultivars whose leaves and seeds are consumed. Despite their potential to enhance food security and economic livelihoods, grain amaranth breeding to improve nutritional quality and adoption by farmers in sub-Saharan Africa is scanty. This study assessed the variation among 29 grain amaranth accessions using 27 phenotypic (10 morphological and 17 nutritional characters and 16 random amplified polymorphic DNA (RAPD primers. Multivariate analysis of phenotypic characters showed the first four principal components contributing 57.53% of observed variability, while cluster analysis yielded five groups at 87.5% similarity coefficient. RAPD primers generated a total of 193 amplicons with an average of 12.06 amplicons per primer, 81% of which were polymorphic. Genetic similarities based on Jaccard’s coefficient ranged from 0.61 to 0.88. The RAPD-based unweighted pair group method with arithmetic mean dendrogram grouped the accessions into nine clusters, with the same species clustering together. RAPD primers distinguished the accessions more effectively than phenotypic markers. Accessions in the different clusters as obtained can be exploited for heterotic gain in desired nutritional traits.

  19. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    OpenAIRE

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open readin...

  20. 用RAPD技术检测不同来源微孢子虫基因组DNA多态性%Genomic DNA Polymorphisms in Eight Species of the Microsporidian Spores by Using Randomly Amplified Polymorphic DNA (RAPD) Method

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威

    1999-01-01

    @@ 家蚕微粒子病是由微粒子原虫(微孢子虫)类寄生于蚕体引起的病害.微粒子病对蚕丝业生产危害极大,一直被列为蚕种制造检疫对象.许多学者对病原的传播途径、侵染机制及分类地位作了大量研究.其中微孢子虫的分类又以血清学关系、发育增殖方式和孢子超微结构作为主要划分依据,这些表型依据仍然具有局限性.随机扩增多态性DNA技术(Randomly Amplified Polymorphic DNA,RAPD)因能方便、快速提供DNA多态性的丰富信息而被广泛用于动植物和微生物的遗传差异、亲缘关系和进化分类等领域,但应用于微孢子虫的分类研究尚未见报道.本文用60个随机引物构建了8种微孢子虫的DNA指纹图谱,以探讨其相互间的亲缘关系.

  1. Differential gene expression in response to Papaya ringspot virus infection in Cucumis metuliferus using cDNA-amplified fragment length polymorphism analysis.

    Directory of Open Access Journals (Sweden)

    Yu-Tsung Lin

    Full Text Available A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV, Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP method. Transcript derived fragments (TDFs identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future.

  2. Differential gene expression in response to Papaya ringspot virus infection in Cucumis metuliferus using cDNA-amplified fragment length polymorphism analysis.

    Science.gov (United States)

    Lin, Yu-Tsung; Jan, Fuh-Jyh; Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  3. Amplified fragment length polymorphism and virulence polymorphism in Puccinia hordei

    Science.gov (United States)

    Puccinia hordei is the causal agent of barley leaf rust. To study the genetic diversity in P. hordei, 45 isolates with diverse virulence patterns and geographical origins were analyzed using amplified fragment length polymorphism markers. Two pathotypes of Puccinia graminis f. sp. tritici and one is...

  4. Detection of genetic variability in Basmati and non-Basmati rice varieties and their radiation induced mutants through random amplified polymorphic DNA (RAPD)

    International Nuclear Information System (INIS)

    Random Amplified Polymorphic DNA (RAPDs) markers were utilized to detect polymorphism between pure lines and commercially available Basmati rice varieties to assess variation which may be helpful in quality control and varietal identification (Basmati-370 and derived radiation induced mutants), differentiation of mutants and parents, and identification of RAPD markers co-segregating with important agronomic traits including plant height, days to flower and grain quality. Basmati varieties were distinguished from non-Basmati varieties with the help of five diagnostic markers which will be useful for detecting mixing of non-Basmati and Basmati rices, currently a serious marketing problem. Different Basmati cultivars were identified with the help of diagnostic RAPD markers which can be used in quality control as well as for ''fingerprinting'' of cultivars. Different radiation induced mutants were also successfully distinguished from the parents on the basis of variety specific and mutant specific markers which will be useful for varietal identification. In addition to this, other markers were also identified which can differentiate mutants from each other and are being, used for the fingerprinting of different mutants, particularly the dwarf mutants having similar appearance but different parentage. For identification of RAPD markers co-segregating with plant height and days to flower, 50 F2 plants and four F3 families were studied from a reciprocal cross made between Kashmir Basmati (tall and early) and Basmati-198 (dwarf and late). Segregating bands were observed within these populations, and indicating the possible use of RAPD markers for tagging gene(s) of agronomic importance in rice. (author)

  5. Random amplified polymorphic DNA markers for DNA fingerprinting and genetic variability assessment of minute parasitic wasp species (Hymenoptera: Mymaridae and Trichogrammatidae) used in biological control programs of phytophagous insects.

    Science.gov (United States)

    Landry, B S; Dextraze, L; Boivin, G

    1993-06-01

    Biological control of insects that feed on our crops has become more practical in recent years by mass release of egg parasitoid microhymenoptera. Trichogramma species are now commercially reared and spread in commercial fields to control specific insect pests. Microhymenoptera species are, however, very small and morphologically indistinguishable within species, although strains of a given species differ in their efficiency to control specific insect pests. Traditional taxonomy is unable to differentiate microhymenoptera species at the strain level. It is becoming increasingly important to develop a reliable system to monitor genetic variations both within and between strains of commercially important microhymenoptera, to detect genetic drift occurring during several generations of multiplication, to protect patents, and to certify the lots of commercially released microhymenoptera. We have developed a system based on DNA markers to rapidly characterize individuals of five species of microhymenoptera from the genus Anaphes and Trichogramma including a new species of Anaphes not previously described. The main components of our system are a rapid and simple DNA micro-extraction method and fast DNA polymorphism analyses based on random amplified polymorphic DNA markers. PMID:8349128

  6. High-resolution melt-curve analysis of random-amplified-polymorphic-DNA markers, for the characterisation of pathogenic Leptospira

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Craig, S B; Graham, G C;

    2010-01-01

    A new test for pathogenic Leptospira isolates, based on RAPD-PCR and high-resolution melt (HRM) analysis (which measures the melting temperature of amplicons in real time, using a fluorescent DNA-binding dye), has recently been developed. A characteristic profile of the amplicons can be used to d...

  7. Randomly Amplified DNA Fingerprinting: A Culmination of DNA Marker Technologies Based on Arbitrarily-Primed PCR Amplification

    OpenAIRE

    Waldron Julie; Peace Cameron P.; Searle Iain R.; Furtado Agnelo; Wade Nick; Findlay Ian; Graham Michael W.; Carroll Bernard J.

    2002-01-01

    Arbitrarily-primed DNA markers can be very useful for genetic fingerprinting and for facilitating positional cloning of genes. This class of technologies is particularly important for less studied species, for which genome sequence information is generally not known. The technologies include Randomly Amplified Polymorphic DNA (RAPD), DNA Amplification Fingerprinting (DAF), and Amplified Fragment Length Polymorphism (AFLP). We have modified the DAF protocol to produce a robust PCR-based DNA ma...

  8. Differentiation by random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) of Candida albicans isolated from upper respiratory tract in patients with non-small cell lung cancer.

    Science.gov (United States)

    Biernasiuk, Anna; Korona-Głowniak, Izabela; Grzegorczyk, Agnieszka; Malm, Anna

    2014-01-01

    Cancer patients are predisposed to fungal infections caused by Candida albicans, especially to oral or respiratory tract candidiasis. The aim of this study was to estimate genetic diversity by RAPD-PCR (random amplified polymorphic DNA-polymerase chain reaction) of C. albicans isolated from upper respiratory tract of 100 patients with non-small cell lung cancer. Among 52 strains, 34 genotypes were defined. 10 clusters comprising 28 (53.85%) isolates with similarity coefficient ≥ 80% were formed. The remaining 24 (46.15%) isolates represented individual genotypes. The RAPD-PCR technique revealed genomic variability within C. albicans isolated from upper respiratory tract of the cancer patients. PMID:25371918

  9. "Use of Random Amplified Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR and ITS2 PCR assays for differentiation of populations and putative sibling species of Anopheles fluviatilis (Diptera: Culicidae in Iran"

    Directory of Open Access Journals (Sweden)

    SR Naddaf Dezfouli

    2002-09-01

    Full Text Available Anopheles fluviatilis complex is known to be a vector of malaria in Iran. Since mosquitoes of this species cover a wide geographical range in Iran, they might have evolved into different separated populations. Random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR assay was used to differentiate geographic populations of this species. DNA was extracted from individual mosquitoes from 8 localities in 4 south and southeast provinces and amplified in PCR reactions using 18 single primers of arbitrary nucleotide sequence. Results of RAPD-PCR showed that Kazeroun populations could simply be differentiated from other populations using a diagnostic fragment amplified with primer UBC-306. But other populations could not be differentiated either visually or by means of statistical analysis. Moreover ITS2 fragments of some selected specimens were amplified using a pair of universal primer and sequenced as a key standard for detection of putative sibling species. Sequence analysis of the ITS2 fragments revealed a very high (100% homology among the populations. These findings are crucial in epidemiological studies concerning relatedness of geographic populations and vector movement in the region. Results of RAPD-PCR and ITS2 analysis suggest that this taxon in Iran comprises of only one species with a low genetic variation among geographic populations.

  10. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  11. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.; Ahrens, Peter

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  12. DNA amplification polymorphisms of the cultivated mushroom Agaricus bisporus.

    OpenAIRE

    Khush, R S; Becker, E; Wach, M.

    1992-01-01

    Single 10-bp primers were used to generate random amplified polymorphic DNA (RAPD) markers from commercial and wild strains of the cultivated mushroom Agaricus bisporus via the polymerase chain reaction. Of 20 primers tested, 19 amplified A. bisporus DNA, each producing 5 to 15 scorable markers ranging from 0.5 to 3.0 kbp. RAPD markers identified seven distinct genotypes among eight heterokaryotic strains; two of the commercial strains were shown to be related to each other through single-spo...

  13. Random Amplified Polymorphic DNA (RAPD) Analysis of Natural Lilium brownii from Guangdong, China%广东省野百合天然居群的随机扩增多态性DNA(RAPD)分析

    Institute of Scientific and Technical Information of China (English)

    蒋建平; 杨懋勋; 黄永芳

    2011-01-01

    representative mountain areas in Guangdong China were analyzed by RAPD markers , so as to provide good foundation for further natural germplasm resources and related studies of Lilium brownii populations, and provide good evidence of the discrimination of Brown lily and Greenish lily at molecular level. DNA from all samples was extracted from leaves and scales, which amplified clear, bright and steady RAPD bands. 20 primers were screened from 273 random primers, and a total 433 DNA bands were amplified, 430 (99. 3% ) of which were polymorphic, the percentage of polymorphic bands (PPB) at the population level was 60. 67% on average. The unweighted pair group method arithmetic average (UPGMA) clustery analysis of the RAPD data from 199 samples showed that all Brown lily samples and Greenish lily samples in the same population separated obviously atthe value of 0. 68 of genetic similarity coefficient, which was a good evidence of the discrimination of Brown lily and Greenish lily at molecular level.

  14. Random Amplified Polymorphic DNA (RAPD) Analyses among Hibiscus cannabinus and Related Species%红麻及其近缘种的RAPD分析

    Institute of Scientific and Technical Information of China (English)

    郭安平; 周鹏; 粟建光

    2002-01-01

    利用随机扩增多态性DNA(RAPD)技术分析了木槿属(Hibiscus)Furcaria组中纤维作物红麻(H.canabinus)及其6个近缘种植物的25份材料.用筛选出的16个引物扩增出192个RAPD条带,它们表现出丰富的多态性.根据得到的RAPD指纹图谱,计算其Nei氏相似系数和遗传距离,并构建了它们的系统树.结果表明:25份材料可划分为7个组,H.penduriformis和H.calyphyllus两个种为一组;红麻种分为两个组,一组为栽培品种,另1组为野生型材料;其余4个种各成为1组.玫瑰麻(H.sabdariffa)和金线吊芙蓉(H.radiatus)的关系较近,而且两者与红麻的亲缘关系也较近,而其它四个种与红麻的关系较远.H.trionum与其它六个种的关系较远.%RAPDs were used to study the relationships among species in Hibiscus sect. Furcaria.Twenty-five accessions of 7 species were examined. Sixteen primers of arbitrary sequences were screened from 80 primers for DNA amplification. A total of 192 bands were generated, of which 149 bands were polymorphic markers. Dendrogram was constructed using Nei's genetic similarity value and MINTS program. The result showed that 25 accessions were clustered in 7 clades, H.penduriformis and H. calyphyllus formed a clade, and 15 accessions of H. cannabinus were clustered in two clades, one being the cultivars, and the other, the wild type materials. The rest 4 species formed 4 individual clades. The most parsimonious dendrogram shows that H. radiatus is closely related to H. sabdariffa. The closely related species to the cultivars of H. cannabinus are H. sabdariffa and H. radiatus, whereas H. trionum appears to be highly diverged from all the other taxa.

  15. Evidence of sibling species in brown planthopper, Nilaparvata lugens complex, detected from long primer random amplified polymorphic DNA (LP-RAPD) fingerprints

    International Nuclear Information System (INIS)

    The brown planthopper, N. lugens (Staal), has become a serious threat to rice production throughout tropical and sub-tropical Asia with the spread of high yielding rice varieties and intensive culture practices since about 1970. It causes 'hopperburn' and complete wilting and drying of rice plants. Another N. lugens population was found to infest a weed grass, Leersia hexandra that grows abundantly in canals near irrigated rice fields in southeastern Asia. The Leersia infesting N. lugens population fails to survive on rice plants. Conversely, rice infesting N. lugens does not thrive on Leersia. Two sympatric populations of N. lugens, one from rice and other from L. hexandra were collected from five locations in Malaysia. The locations were University Putra Malaysia (UPM), Tanjung Karang (TK), Melaka (MK), Perak (PK) and Sabah (SB). An out group, N. bakeri was also collected from Cameron Highlands (CH). The insects used for long primer RAPD analysis were tested for esterase activity on a simple filter paper using the method reported by Pasteur and Georghiou. DNA extraction and PCR protocols were followed as described by Gillings and Holley. Four Long RAPD primers were used in this study. The primer, pehA no.6, 5'ATCGCACTTGATGCGCAGGCCGTT was diagnostic and the other three yielded the strongest bands and showed polymorphisms in rice and Leersia populations of N. lugens. Cluster analysis based on genetic distance revealed that the 10 brown planthopper populations and an out group, N. bakeri were divided into three major clusters. N. bakeri formed the most isolated cluster from populations of either rice or Leersia infesting populations of N. lugens. The rice infesting populations of five localities clustered together as a group. On the other hand Leersia infesting populations of the same localities formed another distinct cluster. An analysis of molecular variance was also performed and confirmed the differentiation into two groups. One RAPD band that was obtained

  16. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  17. Fluorescent Amplified Fragment Length Polymorphism Analysis of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis Isolates

    OpenAIRE

    Hill, Karen K.; Ticknor, Lawrence O.; Okinaka, Richard T.; Asay, Michelle; Blair, Heather; Bliss, Katherine A.; Laker, Mariam; Pardington, Paige E.; Richardson, Amber P.; Tonks, Melinda; Beecher, Douglas J.; Kemp, John D.; Kolstø, Anne-Brit; Wong, Amy C. Lee; Keim, Paul

    2004-01-01

    DNA from over 300 Bacillus thuringiensis, Bacillus cereus, and Bacillus anthracis isolates was analyzed by fluorescent amplified fragment length polymorphism (AFLP). B. thuringiensis and B. cereus isolates were from diverse sources and locations, including soil, clinical isolates and food products causing diarrheal and emetic outbreaks, and type strains from the American Type Culture Collection, and over 200 B. thuringiensis isolates representing 36 serovars or subspecies were from the U.S. D...

  18. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter; Johansson, K.E.

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...... found by 16S rDNA analysis. The present data support previous observations regarding genetic homogeneity of M. capricolum subsp. capripneumoniae, and confirm the two evolutionary lines of descent found by analysis of 16S rRNA genes....

  19. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    Mycoplasma hyosynoviae strains from Denmark, Germany, Japan, Sweden, the Netherlands and the UK were examined for variations in the genomic DNA and within the 16S ribosomal RNA (rRNA) gene. Variations in the chromosomal DNA among 57 isolates recovered from the respiratory tract and joints of pigs...... examined for variation within the 16S rRNA gene. Ten field strains possessed the 16S rDNA sequences identical to the type strain, while the remaining six strains had sequences that differed by one to two nucleotides from that obtained from the type strain....

  20. Low Genetic Diversity Among Garlic (Allium sativum L. Accessions Detected Using Random Amplified Polymorphic DNA (RAPD Escasa Diversidad Genética entre Accesiones de Ajo (Allium sativum L. Detectada Mediante ADN Polimórfico Amplificado al Azar (RAPD

    Directory of Open Access Journals (Sweden)

    Mario Paredes C

    2008-03-01

    Full Text Available Garlic (Allium sativum L. is a species of vegetative propagation, showing high morphological diversity. Besides, its clones have specific adaptations to different agroclimatic regions. The objective of this study was to determine the genetic diversity of 65 garlic clones collected in Chile and introduced from different countries, by using RAPD (Random Amplified Polymorphic DNA. Fourty random primers of 10 mers generated a total of 398 bands with an 87% of polymorphism. Each primer amplified between two and 20 bands. The size of the fragments obtained fluctuated between 3200 and 369 bp. The results showed that the clones analyzed had a genetic similarity rate of 94%. In addition, 70% of them were clustered in one major group. However, in spite of that situation several clones have different agronomic characteristicsEl ajo (Allium sativum L. es una especie de propagación vegetativa, que presenta una amplia variabilidad morfológica. Los clones de esta especie tienen una adaptación específica a diferentes regiones agroclimáticas. El objetivo de este estudio fue determinar la diversidad genética existente en 65 clones de ajos colectados en Chile e introducidos desde diferentes países, utilizando RAPD (ADN Polimórfico Amplificado al Azar. Para esta evaluación se utilizaron 40 partidores de 10-mers. Los partidores generaron entre dos y 20 bandas, observándose un alto número de patrones con bandas múltiples. Los fragmentos generados difieren en su tamaño entre 3.200 y 369 pb. Los partidores generaron 398 bandas, de las cuales un 87% fueron polimórficas. El análisis estadístico realizado detectó una similitud genética alta, de un 94% entre las accesiones evaluadas, donde aproximadamente un 70% de los clones formaron un grupo homogéneo. Sin embargo, este grupo incluye clones que presentan diferentes características agronómicas

  1. 从花斑糠疹皮损分离的马拉色菌随机扩增多态性DNA研究%Random amplified polymorphic DNA analysis of Malassezia isolates from cutaneous lesions of pityriasis versicolor

    Institute of Scientific and Technical Information of China (English)

    谢震; 冉玉平; 刘瑞; 杨如学; 李志瑜; 代亚玲

    2009-01-01

    目的 用随机扩增多态性DNA方法 研究分离自花斑糠疹的马拉色菌种间和株间差异,了解随机扩增多态性DNA分析(RAPD)与生理生化方法 在菌种分型上的差异及菌株DNA型别和菌种间的关系.方法 用氯化苄法提取马拉色菌标准株(10株7个种)和临床分离株(47株)的基因组DNA,其中临床株分离自34例花斑糠疹患者,经形态学和生理生化方法 鉴定为5个种(合轴马拉色菌、糠秕马拉色菌、钝形马拉色菌、球形马拉色菌、限制马拉色菌),用4种随机引物(S22、SS24、S25、S33)对菌株DNA做PCR随机扩增,NTSYS软件自动生成树状分支图.结果 绝大多数标本均可被4种引物扩增而获得清晰条带,其中2种引物(S22、S24)的条带更为稳定、清晰.共82条DNA片段被扩增,所有菌株均可见种间和株间多态性.有4例患者皮损同时分离出不同种的菌株显示遗传相似性高,在树状图中归入一类.结论 来自同一宿主的不同菌株遗传趋同现象提示马拉色菌的种特异性、菌种演化与宿主间存在密切关系.%Objective To investigate intraspecific and interspecific variation within Malassezia iso-lates from patients with pityriasis versicolor by random amplified polymorphic DNA (RAPD) analysis, to learn the difference between RAPD analysis and physiological and biochemical methods in the typing of Malassezia species, and to explore the relationship between RAPD patterns and Malassezia species. Methods A total of 47 Malassezia isolates were obtained from 34 patients with pityriasis versicolor, and they were classified into 5 species by morphological, physiological and biochemical features, I.e., M. Fin'fur, M. Obtusa, M. Globosa, M. Restricta and M. Sympodialis. Genomic DNA was extracted from the 47 clinical isolates and 10 reference strains (including 7 species) of Malassezia. PCR was performed using 4 random primers including S22, S24, S25 and S33. RAPD patterns were analyzed by NTSYS

  2. Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis

    Directory of Open Access Journals (Sweden)

    Ramalho-Ortigão JM

    2001-01-01

    Full Text Available Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST. We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V. braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

  3. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    OpenAIRE

    Yu-Tsung Lin; Fuh-Jyh Jan; Chia-Wei Lin; Chien-Hung Chung; Jo-Chu Chen; Shy-Dong Yeh; Hsin-Mei Ku

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially exp...

  4. 9种芦荟亲缘关系的RAPD分析%The Analysis of Phylogenetic Relationship among Nine Aloesby Random Amplified Polymorphic DNA

    Institute of Scientific and Technical Information of China (English)

    侯和胜; 刘洪艳; 佟少明

    2001-01-01

    应用40个引物对中国芦荟(Aloe vera var. chinese),鹿角芦荟库拉索芦荟(Aloe barbadensis L.),木立芦荟皂质芦荟(Aloe saponaria),Aloe vera hybrid 1 ,Aloe vera hybrid 2,皮具刺芦荟朱旺纳芦荟(Aloe juvenna)等9种芦荟的亲缘关系进行了初步分析。其中18个引物的扩增结果具有非常明显的品系间多态性。将结果以Phylip软件包,由程序Neighbor-Joining和UPGMA,分别构建聚类图。结果表明中国芦荟,Aloe vera hybrid 1和皮具刺芦荟具有较近的亲缘。鹿角芦荟,木立芦荟和库拉索芦荟具有较近的亲缘,其中鹿角芦荟,木立芦荟的遗传距离特别近,可认为是同一品种的变种,由于形态上的一些分化而出现了不同的命名。皂质芦荟,Aloe vera hybrid2 的亲缘关系较近。朱旺纳芦荟与各品种之间都保持着相当远的遗传距离,原因可能是该品种未广泛栽培,从而还保持着某些自己的遗传特性。%The phylogenetic relationship of nine Aloes,including Aloe vera var. chinese, Aloe arborescens var. natalensis bgr. ,Aloe barbadensis L. ,Aloe arboreseens , Aloe saponaria , Aloe vera hybrid 1, Aloe vera hybrid 2, Aloe aculeata and Aloe juvenna was investigated by RAPD analysis. 18 single primers were selected out of 40 random primers. The amplified fragments of 18 primers were analyzed by the Phylip software packet, and the phylogenetic trees were constructed by UPGMA method and N-J method respectively. The results indicated as the following: Aloe vera var. chinese, Aloe vera hybrid 1 and Aloe aculeata have close phylogenetic relationship. Aloe arborescens var. natalensis bgr., Aloe barbadensis L. and Aloe arborescens have close phylogenetic relationship. The phylogenetic relationship between Aloe arborescens and Aloe arborescens was much closer. Aloe saponaria and Aloe vera hybrid 2 have close phylogenetic relationship too. The phylogenetic relationship of Aloe juvenna was far away from the others.

  5. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.;

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including......I restriction endonucleases and subsequent ligation of corresponding site-specific adapters. The amplification of AFLP templates with a single set of nonselective primers resulted in reproducible fingerprints of approximately 60 to 80 fragments in the size range of 50 to 500 bp, The method was able to...

  6. Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

    International Nuclear Information System (INIS)

    Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

  7. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  8. Optimization of random amplified polymorphic DNA protocol for molecular identification of Lophius gastrophysus Otimização do protocolo de amplificação randômica de DNA polimórfico para identificação molecular de Lophius gastrophysus

    Directory of Open Access Journals (Sweden)

    Micheline S. Ramella

    2005-12-01

    Full Text Available Lophius gastrophysus has important commercial value in Brazil particularly for foreign trade. In this study, we described the optimization of Random Amplified Polymorphic DNA (RAPD protocol for identification of L. gastrophysus. Different conditions (annealing temperatures, MgCl concentrations, DNA quantity were tested to find reproducible and adequate profiles. Amplifications performed with primers A01, ² A02 and A03 generate the best RAPD profiles when the conditions were annealing temperature of 36ºC, 25 ng of DNA quantity and 2.5 mM MgCl2. Exact identification of the species and origin of marine products is necessary and RAPD could be used as an accurate, rapid tool to expose commercial fraud.Lophius gastrophysus apresenta importante valor comercial no Brasil, principalmente para a exportação. Neste estudo, descrevemos uma otimização do protocolo de amplificação aleatória de DNA polimórfico (RAPD para identificação de L. gastrophysus. Diferentes condições (temperatura de recozimento, quantidade de DNA e concentração de MgCl2 foram testadas para obter perfis reprodutíveis. Os iniciadores A01, A02 e A03 geraram os melhores resultados de amplificação quando utilizados temperatura de recozimento de 36ºC, 25 ng de DNA e 2,5 mM de MgCl2. A identificação exata de espécies e da origem dos produtos marinhos faz-se necessária e a RAPD é uma ferramenta rápida e precisa para expor fraudes comerciais.

  9. RANDOM AMPLIFIED POLYMORPHIC DNA (RAPD) REVEALED THE HETEROKARYON OF AGARICUS ARVENSIS PRODUCED BY MATING REACTIONS%随机扩增多态DNA(RAPD)在野蘑菇杂交育种中的应用

    Institute of Scientific and Technical Information of China (English)

    李荣春; 张丽梅

    2001-01-01

    野蘑菇(Agaricus arvensis Schaeff ex.Fr.)是蘑菇属(Agaricus)又一种近年来广泛栽培的食用菌.由于它的菌丝细胞具有多核,无锁状联合,以及人们对它的繁殖模式和生活史认识的不足,给杂交育种工作造成了较多困难.运用随机扩增多态DNA遗传标记技术,结合拮抗试验和核相分析,对自育的单孢菌株之间的杂交试验进行分析研究.结果表明:两个相互亲合的同核体菌株被配对培养时,交配反应出现,并形成异核体的后代.可能野蘑菇具有双重的交配繁殖系统--同宗配合和异宗配合.在食用菌杂交育种研究中,机扩增多态DNA(RAPD)是一种非常有效和方便的检验杂合子的方法.

  10. Intraspecific phylogeography of the gopher tortoise, Gopherus polyphemus: RFLP analysis of amplified mtDNA segments.

    Science.gov (United States)

    Osentoski, M F; Lamb, T

    1995-12-01

    The slow rate of mtDNA evolution in turtles poses a limitation on the levels of intraspecific variation detectable by conventional restriction fragment surveys. We examined mtDNA variation in the gopher tortoise (Gopherus polyphemus) using an alternative restriction assay, one in which PCR-amplified segments of the mitochondrial genome were digested with tetranucleotide-site endonucleases. Restriction fragment polymorphisms representing four amplified regions were analysed to evaluate population genetic structure among 112 tortoises throughout the species' range. Thirty-six haplotypes were identified, and three major geographical assemblages (Eastern, Western, and Mid-Florida) were resolved by UPGMA and parsimony analyses. Eastern and Western assemblages abut near the Apalachicola drainage, whereas the Mid-Florida assemblage appears restricted to the Brooksville Ridge. The Eastern/Western assemblage boundary is remarkably congruent with phylogeographic profiles for eight additional species from the south-eastern U.S., representing both freshwater and terrestrial realms. PMID:8564009

  11. Nucleosomes shape DNA polymorphism and divergence.

    Directory of Open Access Journals (Sweden)

    Sasha A Langley

    2014-07-01

    Full Text Available An estimated 80% of genomic DNA in eukaryotes is packaged as nucleosomes, which, together with the remaining interstitial linker regions, generate higher order chromatin structures [1]. Nucleosome sequences isolated from diverse organisms exhibit ∼10 bp periodic variations in AA, TT and GC dinucleotide frequencies. These sequence elements generate intrinsically curved DNA and help establish the histone-DNA interface. We investigated an important unanswered question concerning the interplay between chromatin organization and genome evolution: do the DNA sequence preferences inherent to the highly conserved histone core exert detectable natural selection on genomic divergence and polymorphism? To address this hypothesis, we isolated nucleosomal DNA sequences from Drosophila melanogaster embryos and examined the underlying genomic variation within and between species. We found that divergence along the D. melanogaster lineage is periodic across nucleosome regions with base changes following preferred nucleotides, providing new evidence for systematic evolutionary forces in the generation and maintenance of nucleosome-associated dinucleotide periodicities. Further, Single Nucleotide Polymorphism (SNP frequency spectra show striking periodicities across nucleosomal regions, paralleling divergence patterns. Preferred alleles occur at higher frequencies in natural populations, consistent with a central role for natural selection. These patterns are stronger for nucleosomes in introns than in intergenic regions, suggesting selection is stronger in transcribed regions where nucleosomes undergo more displacement, remodeling and functional modification. In addition, we observe a large-scale (∼180 bp periodic enrichment of AA/TT dinucleotides associated with nucleosome occupancy, while GC dinucleotide frequency peaks in linker regions. Divergence and polymorphism data also support a role for natural selection in the generation and maintenance of these

  12. Use of Multienzyme Multiplex PCR Amplified Fragment Length Polymorphism Typing in Analysis of Outbreaks of Multiresistant Klebsiella pneumoniae in an Intensive Care Unit

    OpenAIRE

    van der Zee, Anneke; Steer, Niels; Thijssen, Eveline; Nelson, Jolande; van't Veen, Annemarie; Buiting, Anton

    2003-01-01

    We developed and optimized a new modified amplified fragment length polymorphism (AFLP) typing method to obtain a multibanding fingerprint that can be separated by agarose gel electrophoresis. Both to maximize the discriminatory power and to facilitate the computer-assisted analysis, bacterial DNA was digested with four different restriction enzymes. After ligation of adaptors to the DNA fragments, PCR testing of various single primers was performed. Two single primers that gave optimal resul...

  13. DNA polymorphisms in banana and sugar cane varieties revealed by RAPD analysis

    International Nuclear Information System (INIS)

    Sugar cane is the fourth most important cash crop of Pakistan and is grown on 1 million hectares of land, with a total production of 37 million tonnes. It does not flower under existing environmental conditions. Sugar cane is vegetatively propagated and the national breeding programmes is restricted to the adaptation and multiplication of exotic varieties. Random amplified polymorphic DNA (RAPD) markers were used to establish polymorphisms among various local sugar cane varieties. DNA from the varieties L-118, L-116, BL-4, BF-162, Col-44, Col-54, Triton and Puri was isolated and amplified by polymerase chain reaction using ten nucleotide primers. The amplification profiles of all the sugar cane varieties were compared and the polymorphisms detected. DNA was isolated from the embryogenic calli of sugar cane subjected to gamma irradiation at different doses (0, 0.5, 2.0, 4.0 and 6.0 krad) and salt stresses (NaCl: 0, 50, 100, 150 and 200 mM), and was amplified with random primers to detect the polymorphisms introduced by stress. The banana is another important vegetatively propagated crop in Pakistan. DNA isolation from micropropagated banana was optimized and RAPD analysis performed on several clones of the banana variety Williams. The level of genetic variability revealed from calli and vegetatively propagated sugar cane and banana by RAPD analysis is discussed. (author). 10 refs, 5 figs, 2 tabs

  14. Establishment of Ecotilling for Discovery of DNA Polymorphisms in Brassica rapa Natural Population

    Institute of Scientific and Technical Information of China (English)

    WU Jian; SUN Ri-fei; ZHANG Yan-guo; WANG Xiao-wu

    2005-01-01

    Ecotilling is a new approach based on enzyme-mediated heteroduplex cleavage to discover DNA polymorphisms in natural population. We used mung bean nuclease(MBN) instead of routinely used CELI to cleave single base pair mismatches in heteroduplex DNA templates. Nested set of primers were designed to amplify targeted region to avoid the influence of the variation in quality and quantity of the genomic DNA. To reduce the costs in fluorescently labeled primers, we added M13 adapter to 5'end of gene specific primers to make IRD dye labeled M13 forward and reverse primers possibly universal for different genes. A Brassica rapa ZIP gene homologue was subjected to the analysis to practise the feasibility of the method in polymorphisms detection. Our experiment showed this method is efficient in discovering DNA polymorphisms in Brassica rapa natural population.

  15. DNA amplification polymorphisms of the cultivated mushroom Agaricus bisporus.

    Science.gov (United States)

    Khush, R S; Becker, E; Wach, M

    1992-09-01

    Single 10-bp primers were used to generate random amplified polymorphic DNA (RAPD) markers from commercial and wild strains of the cultivated mushroom Agaricus bisporus via the polymerase chain reaction. Of 20 primers tested, 19 amplified A. bisporus DNA, each producing 5 to 15 scorable markers ranging from 0.5 to 3.0 kbp. RAPD markers identified seven distinct genotypes among eight heterokaryotic strains; two of the commercial strains were shown to be related to each other through single-spore descent. Homokaryons recovered from protoplast regenerants of heterokaryotic strains carried a subset of the RAPD markers found in the heterokaryon, and both of the haploid nuclei from two heterokaryons were distinguishable. RAPD markers also served to verify the creation of a hybrid heterokaryon and to analyze meiotic progeny from this new strain: most of the basidiospores displayed RAPD fingerprints identical to that of the parental heterokaryon, although a few selected slow growers were homoallelic at a number of loci that were heteroallelic in the parent, suggesting that they represented rare homokaryotic basidiospores; crossover events between a RAPD marker locus and its respective centromere appeared to be infrequent. These results demonstrate that RAPD markers provide an efficient alternative for strain fingerprinting and a versatile tool for genetic studies and manipulations of A. bisporus. PMID:1444410

  16. GENETIC VARIATIONS AMONG AQUILARIA SPECIES AND GYRINOPS VERSTEEGII USING AMPLIFIED FRAGMENT LENGTH POLYMORPHISM MARKERS

    Directory of Open Access Journals (Sweden)

    NURITA TORUAN-MATHIUS

    2009-01-01

    Full Text Available Aquilaria sp. (Thymelaeaceae is the most valuable non wood production of forestry plant in Indonesia. It produces a fragrant resin when subjected to fungal attack and has been traded internationally known as gaharu. Knowledge of genetic diversity and relationship among species and genus is important for breeding purposes and species conservation. In this study, genetic variabilityof six Aquilaria species were analyzed using the AmplifiedFragment Length Polymorphism (AFLP markers. Ten AFLP primercombinations amplified 1353 DNA fragments ranging in size from100 to 350 bp of which 1285 (95% of them were polymorphic. Genetic similarities among Aquilaria sp. consisted of A. malaccensis, A. beccariana, A. microcarpa, and A. crassna ranged from 63.90 to 72.00 % based on Dice coefficient. The dendrogram derivedby the unweighted pair group method with arithmetic mean of germplasm analysis were clustered into two main groups. Hence, a genetic variation among species is quiet high. Bootstrap valuesfor the groups supported 70% of the cluster using a linear relationship equation of (r = 0.724, P < 0.0001 was observedbetween known pedigrees and AFLP-derived genetic similarityfor 136 pairwise comparisons of Aquilaria species. For example, A. malacensis and A. microcarpa have the highest genetic similarity (72.00% compared with another Aquilaria species. Primer pairs E-ACG/M-CTA produced a specific fragment for A. beccariana (850 bp, A. crasna (550 bp, 180 bp, and 140 bp, A. malaccencis (1500 bp, A. microcarpa (250 bp and Gyrinops versteegii (150 bp. Primer pairs E-ACG/M-CAA produced a specific DNA fragment only for A. beccariana (1500 bp and 100 bp. Primer pairs E-ACC/M-CAC also produced only specific fragment for A. crassna (1500 bp. Study showed the usefulness of AFLPanalysis in Aquilaria sp. and its potential application for breedingand species conservation. Further, molecular diversity estimated in the present study combined with the datasets on other

  17. 神经外科重症监护室肺炎克雷伯菌随机扩增多态性DNA分子流行病学研究%Analysis of randomly amplified polymorphic DNA of Klebsiella pneumonia, in neurosurgical department ICU: a molecular epidemiological study

    Institute of Scientific and Technical Information of China (English)

    郭泽兴; 李红玉

    2008-01-01

    目的 采用随机扩增多态性DNA(RAPD)基因分型方法 监测肺炎克雷伯菌医院感染情况. 方法 对我院神经外科重症监护室临床分离的72株肺炎克雷伯菌进行RAPD基因分型,并通过指纹图谱比较分析,确证医院感染爆发. 结果 72株肺炎克雷伯菌共分得68型,未发生肺炎克雷伯菌医院感染局部流行. 结论 RAID基因分型方法 可对肺炎克雷伯菌进行分子流行病学调查.%Objective To monitor nosocomial infections of Klebsiella pneumoniae by analyzing the randomly amplified polymorphic DNA (RAPD). Methods RAPD analysis was used to genotype 72 Klebsiella pneumoniae strains isolated from the intensive care unit (ICU) of the neurosurgical department, and the fingerprints were compared to confirm the outbreak of nosocomial infection of Klebsiella pneumoniae. Results 72 strains Klebsiella pneurnoniae were classified into 68 RAPD types, suggesting the absence of an outbreak of nosocomial infection of glebsiella pneurnoniae in the ICU.Conclusian RAPD genotyping can be used in the molecular epidemiological study ofKlebsiella pneurnoniae.

  18. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette; Leser, T.D.; Ahrens, Peter

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due to the...

  19. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.;

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  20. Evaluation of Amplified Fragment Length Polymorphism for Differentiation of Avian Mycoplasma Species

    OpenAIRE

    Hong, Y; Garcia, M.; Levisohn, S; Lysnyansky, I.; Leiting, V.; Savelkoul, P. H. M.; Kleven, S. H.

    2005-01-01

    Amplified fragment length polymorphism (AFLP) was used for typing avian mycoplasma species. Forty-four avian mycoplasma strains were successfully typed into eight distinct groups, with each representing a different species. Homology of AFLP patterns of 35% or less was used as a cutoff value to differentiate avian mycoplasma strains into different species.

  1. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  2. ‘‘Blind'' mapping of genic DNA sequence polymorphisms in Lolium perenne L. by high resolution melting curve analysis

    DEFF Research Database (Denmark)

    Studer, Bruno; Jensen, Louise Bach; Fiil, Alice;

    2009-01-01

    High resolution melting curve analysis (HRM) measures dissociation of double stranded DNA of a PCR product amplified in the presence of a saturating fluorescence dye. Recently, HRM proved successful to genotype DNA sequence polymorphisms such as SSRs and SNPs based on the shape of the melting...... curves. In this study, HRM was used for simultaneous screening and genotyping of genic DNA sequence polymorphisms identified in the Lolium perenne F2 mapping population VrnA. Melting profiles of PCR products amplified from previously published gene loci and from a novel gene putatively involved...... in vernalization response successfully discriminated genotypes in absence of allelic sequence information, and allowed to determine allele segregation in VrnA. Here we introduce the concept of "blind" mapping based on HRM as a powerful, fast and cheap method to map any DNA sequence polymorphisms without prior...

  3. Adaptive Epigenetic Differentiation between Upland and Lowland Rice Ecotypes Revealed by Methylation-Sensitive Amplified Polymorphism

    Science.gov (United States)

    Xiong, Jie; Tao, Tao; Zheng, Xiaoguo; Wei, Haibin; Yue, Yunxia; Chen, Liang; Luo, Lijun

    2016-01-01

    The stress-induced epimutations could be inherited over generations and play important roles in plant adaption to stressful environments. Upland rice has been domesticated in water-limited environments for thousands of years and accumulated drought-induced epimutations of DNA methylation, making it epigenetically differentiated from lowland rice. To study the epigenetic differentiation between upland and lowland rice ecotypes on their drought-resistances, the epigenetic variation was investigated in 180 rice landraces under both normal and osmotic conditions via methylation-sensitive amplified polymorphism (MSAP) technique. Great alterations (52.9~54.3% of total individual-locus combinations) of DNA methylation are recorded when rice encountering the osmotic stress. Although the general level of epigenetic differentiation was very low, considerable level of ΦST (0.134~0.187) was detected on the highly divergent epiloci (HDE). The HDE detected in normal condition tended to stay at low levels in upland rice, particularly the ones de-methylated in responses to osmotic stress. Three out of four selected HDE genes differentially expressed between upland and lowland rice under normal or stressed conditions. Moreover, once a gene at HDE was up-/down-regulated in responses to the osmotic stress, its expression under the normal condition was higher/lower in upland rice. This result suggested expressions of genes at the HDE in upland rice might be more adaptive to the osmotic stress. The epigenetic divergence and its influence on the gene expression should contribute to the higher drought-resistance in upland rice as it is domesticated in the water-limited environment. PMID:27380174

  4. How to interpret Methylation Sensitive Amplified Polymorphism (MSAP) profiles?

    Czech Academy of Sciences Publication Activity Database

    Fulneček, Jaroslav; Kovařík, Aleš

    2014-01-01

    Roč. 15, JAN 2014 (2014). ISSN 1471-2156 R&D Projects: GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GA13-10057S; GA ČR(CZ) GA206/09/1751 Institutional support: RVO:68081707 Keywords : MSAP * DNA methylation * Methylcytosine Subject RIV: BO - Biophysics Impact factor: 2.397, year: 2014

  5. Analysis of genetic diversity identified by amplified fragment length polymorphism marker in hybrid wheat.

    Science.gov (United States)

    Ejaz, M; Qidi, Z; Gaisheng, Z; Na, N; Huiyan, Z; Qunzhu, W

    2015-01-01

    Amplified fragment length polymorphism markers were used to assess genetic diversity in 10 male sterile wheat crop lines (hetero-cytoplasm with the same nucleus) in relation to a restorer wheat line. These male sterile lines were evaluated using 64 amplified fragment length polymorphism primer combinations, and 13 primers produced polymorphic bands, generating a total 682 fragments. Of the 682 fragments, 113 were polymorphic. The polymorphic information content and marker index values demonstrated the utility of the primer combinations used in the present study. Unweighted pair group method with arithmetic mean and principal coordinate analysis of the genotypic data revealed clustering of accessions based on genetic relationships, and accessions were separated into 2 groups with their restorer line. Jaccard's similarity coefficient values suggested good variability among the male sterile lines, indicating their utility in breeding programs. The fallouts of analysis of molecular variance showed large within-group population variation, accounting for 77% of variation, while among-group comparison accounted for 23% of the total molecular variation, which was statistically significant. The molecular diversity observed in this study will be useful for selecting appropriate accessions for plant improvement and hybridization through molecular-breeding approaches and for developing suitable conservation strategies. PMID:26345825

  6. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology. PMID:18979924

  7. MITOCHONDRIAL DNA POLYMORPHISM IN CONTROL REGION FROM CHINESE YUGU POPULATION

    Institute of Scientific and Technical Information of China (English)

    刘新社; 李生斌

    2004-01-01

    Objective To investigate the mitochondrial DNA sequence polymorphism sites in Chinese YUGU ethnic group and to provide basic data used in forensic purpose. Methods Genomic DNA was extracted from the hole blood of 100 unrelated individuals of Chinese YUGU ethnic group by standard chelex-100 method. The sequence polymorphism sites was determined by PCR amplification and direct sequencing. Results 54 polymorphic sites were noted in mtDNA np16091-16418 region, and 46 haplotypes were identified. The genetic diversity was calculated to be 0.9691, and the genetic identity was calculated to be 0.0406. Conclusion There are some particular polymorphism sites in Chinese YUGU ethnic group. The results suggest that sequence polymorphism from np16091-16418 in human mitochondrial DNA can be used as a biological marker for forensic identity.

  8. Genetic diversity in Capsicum germplasm based on microsatellite and random amplified microsatellite polymorphism markers

    OpenAIRE

    Rai, Ved Prakash; Kumar, Rajesh; Kumar, Sanjay; Rai, Ashutosh; Kumar, Sanjeet; Singh, Major; Singh, Sheo Pratap; Rai, Awadesh Bahadur; Paliwal, Rajneesh

    2013-01-01

    A sound knowledge of the genetic diversity among germplasm is vital for strategic germplasm collection, maintenance, conservation and utilisation. Genomic simple sequence repeats (SSRs) and random amplified microsatellite polymorphism (RAMPO) markers were used to analyse diversity and relationships among 48 pepper (Capsicum spp.) genotypes originating from nine countries. These genotypes covered 4 species including 13 germplasm accessions, 30 improved lines of 4 domesticated species and 5 lan...

  9. GENETIC VARIATIONS AMONG AQUILARIA SPECIES AND GYRINOPS VERSTEEGII USING AMPLIFIED FRAGMENT LENGTH POLYMORPHISM MARKERS

    OpenAIRE

    NURITA TORUAN-MATHIUS; DEWI RAHMAWATI; ANIDAH

    2009-01-01

    Aquilaria sp. (Thymelaeaceae) is the most valuable non wood production of forestry plant in Indonesia. It produces a fragrant resin when subjected to fungal attack and has been traded internationally known as gaharu. Knowledge of genetic diversity and relationship among species and genus is important for breeding purposes and species conservation. In this study, genetic variabilityof six Aquilaria species were analyzed using the AmplifiedFragment Length Polymorphism (AFLP) markers. Ten ...

  10. Fluorescent Amplified Fragment Length Polymorphism Probabilistic Database for Identification of Bacterial Isolates from Urinary Tract Infections

    OpenAIRE

    Kassama, Yankuba; Rooney, Paul J.; Goodacre, Royston

    2002-01-01

    The ability of the fluorescent amplified fragment length polymorphism (FAFLP) technique to identify bacterial isolates from urinary tract infections (UTIs) was investigated. FAFLP was carried out using the single primer combination MseI plus CT and EcoRI plus 0, and information-rich FAFLP profiles were generated from all 69 UTI isolates studied, which comprised both gram-negative and gram-positive bacteria encompassing eight genera. The genetic relatedness of these 69 bacteria was determined ...

  11. Fluorescent Amplified Fragment Length Polymorphism Subtyping of Multiresistant Salmonella enterica Serovar Typhimurium DT104

    OpenAIRE

    Lawson, Andrew J.; Stanley, John; Threlfall, E. John; Desai, Meeta

    2004-01-01

    Fluorescent amplified fragment length polymorphism (FAFLP) subtyping analysis was used to genotype multiresistant Salmonella enterica serovar Typhimurium definitive phage type 104. Thirteen distinct FAFLP profiles were found among 85 isolates exhibiting identical pulsed-field gel electrophoresis (PFGE) profiles. A single FAFLP profile was shared by 93% of outbreak-associated isolates and 82% of sporadic isolates. This study demonstrates the value of FAFLP as a high-resolution tool for epidemi...

  12. Genetic diversity and phylogenetic relationship among Tunisian cactus species (Opuntia) as revealed by random amplified microsatellite polymorphism markers.

    Science.gov (United States)

    Bendhifi Zarroug, M; Baraket, G; Zourgui, L; Souid, S; Salhi Hannachi, A

    2015-01-01

    Opuntia ficus indica is one of the most economically important species in the Cactaceae family. Increased interest in this crop stems from its potential contribution to agricultural diversification, application in the exploitation of marginal lands, and utility as additional income sources for farmers. In Tunisia, O. ficus indica has been affected by drastic genetic erosion resulting from biotic and abiotic stresses. Thus, it is imperative to identify and preserve this germplasm. In this study, we focused on the use of random amplified microsatellite polymorphisms to assess genetic diversity among 25 representatives of Tunisian Opuntia species maintained in the collection of the National Institute of Agronomic Research of Tunisia. Seventy-two DNA markers were screened to discriminate accessions using 16 successful primer combinations. The high percentage of polymorphic band (100%), the resolving power value (5.68), the polymorphic information content (0.94), and the marker index (7.2) demonstrated the efficiency of the primers tested. Therefore, appropriate cluster analysis used in this study illustrated a divergence among the cultivars studied and exhibited continuous variation that occurred independently of geographic origin. O. ficus indica accessions did not cluster separately from the other cactus pear species, indicating that their current taxonomical classifications are not well aligned with their genetic variability or locality of origin. PMID:25730081

  13. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko; Manning, G.; Cheasty, T.; Newell, D. G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according to th...

  14. A NEW APPROACH TO GENE DIAGNOSIS OF DUCHENNE/BECKER MUSCULAR DYSTROPHY AMPLIFIED FRAGMENT LENGTH POLYMORPHISMS

    Institute of Scientific and Technical Information of China (English)

    许顺斌; 黄尚志; 罗会元

    1994-01-01

    Four (CA), repeats, located in introns,44,45,49 and 50 of the dystrophin gene,were evaluated in Chinese.These loci are highly polymorphic,with polymorphism information contents of 0.872,0.772,0.870 and 0.718,respectively.All four loci can be easily amplified and labelled using two duplex PCR reactions with α-32P-dCTP and can be detected by denaturing polyacrylamide gel electrophoresis.Using these four loci and the two polymorphic(CA)n repeats located at the 5′ and 3′ ends of the dystrophin gene,we have developed a new PCR-based procedure-Amp-FLP( amplified fragment length polymorphism)linkage analysis for the gene diagnosis of DMD/BMD.This method can detect intragenic recombination rapidly and efficiently and greatly improves the success rate of carrier deterction and prenatal diagnosis in non-deletion DMD/BMD families.All of the loci used in this procedure are intragenic.In addition ,the loci in introns 44,45,49 and 50 are located in the deletion-prone region of the dystrophin gene,making them valuable and usefui in the identification of deletion mutations.Here we report one case of deletion detection using these four loci.

  15. Mitochondrial DNA polymorphism among populations of Melipona quadrifasciata quadrifasciata Lepeletier (Apidae: Meliponini) from southern Brazil.

    Science.gov (United States)

    Torres, Rogelio R; Arias, Maria C; Moretto, Geraldo

    2009-01-01

    The geographical distribution of the Brazilian endemic stingless bee Melipona quadrifasciata quadrifasciata Lepeletier ranges from Rio Grande do Sul to Minas Gerais states. The objective of the present study was to verify mtDNA polymorphisms among samples of M. q. quadrifasciata collected in southern Brazil. Twenty nine colonies from three localities (Blumenau and Mafra/SC and Prudentópolis/ PR) were sampled. Seven mtDNA regions were amplified and further digested with 15 restriction enzymes (PCR-RFLP). Five composite haplotypes were identified, with two unique to samples from Prudentópolis and the remaining three to samples from Mafra and/or Blumenau. PMID:19488509

  16. Application and genotyping of multi-resistant pseudomonas aeruginosa by randomly amplified polymorphic DNA%多重耐药铜绿假单胞菌随机扩增多态性DNA的分型及应用

    Institute of Scientific and Technical Information of China (English)

    王苏建; 王家平; 王仕忠; 鲁科峰; 钱丽萍

    2005-01-01

    目的应用髓机扩增多态性DNA(RAPD)技术,对多重耐药铜绿假单胞菌(MRPA)进行基因多态性研究.方法对临床分离的32株MRPA进行随机引物PCR扩增,扩增产物进行电泳和聚类分析.结果32株MRPA通过RAPD分型可分为19个基因型.耐药表型相同,基因型可相同;但绝大多数则不同.结论通过RAPD分析,了解MAPA基因型特性,明确其耐药表型与基因型的关系,并为该菌的感染控制提供分子流行病学依据.

  17. Random amplified polymorphic DNA reveals that TiO2 nanoparticles are genotoxic to Cucurbita pepo%随机扩增多态性DNA技术研究发现二氧化钛纳米颗粒对西葫芦具有基因毒性

    Institute of Scientific and Technical Information of China (English)

    Fabiola MORENO-OLIVAS; Vincent U.GANT Jr; Kyle L.JOHNSON; Jose R.PERALTA-VIDEA; Jorge L.GARDEA-TORRESDEY

    2014-01-01

      重要结论:采用随机扩增多态性DNA技术,发现TiO2纳米颗粒污染处理的西葫芦样品与未处理样品的基因组DNA图谱相比,不仅在谱带强度有明显差异,而且存在谱带消失和新谱带产生现象,表明TiO2纳米颗粒对西葫芦具有基因毒性。%Titanium dioxide nanoparticles (TiO2 NPs) are used in cosmetics, sunscreens, paints, and toothpaste, among other applications. These NPs are very stable and can be transported and dispersed in wastewater and biosolids. Animal species have shown negative reactions to TiO2 NPs. However, little is known about their toxicity in plants, specifically the possibility of gen-otoxic effects. In this study, we used a random amplified polymorphic DNA (RAPD) technique to study the genotoxic effects of TiO2 NPs on hydroponically cultivated zucchini (Cucurbita pepo) plants. Seeds were allowed to germinate for 7 d and plants were selected at random for individual and population studies. Four plants were selected for the individual study and 18 for the popu-lation study. RAPD profiles of TiO2 NPs treated plants showed differences in band intensity, loss of bands, or appearance of new bands, compared to untreated plants. To the authors’ knowledge, this is the first report of the genotoxic potential of TiO2 NPs in zucchini.

  18. Restriction Fragment Length Polymorphism Analysis of Ribosomal DNA Intergenic Regions Is Useful for Differentiating Strains of Trichophyton mentagrophytes

    OpenAIRE

    Mochizuki, Takashi; Ishizaki, Hiroshi; Barton, Richard C.; Moore, Mary K.; Jackson, Colin J.; Kelly, Steven L.; Evans, E. Glyn V.

    2003-01-01

    Twenty isolates of Tricophyton mentagrophytes var. mentagrophytes and 47 isolates of T. mentagrophytes var. interdigitale, identified by morphological characteristics, were screened by restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified internal transcribed spacer (ITS) region of ribosomal DNA (rDNA). Sixty isolates (14 of 20 T. mentagrophytes var. mentagrophytes isolates and 46 of 47 T. mentagrophytes var. interdigitale isolates) shared an identical ITS RFLP profile...

  19. A survey of DNA polymorphism within the genus Capsicum and the fingerprinting of pepper cultivars.

    Science.gov (United States)

    Prince, J P; Lackney, V K; Angeles, C; Blauth, J R; Kyle, M M

    1995-04-01

    Interspecific genetic variation was examined in the genus Capsicum based on shared restriction fragments in Southern analyses. Four distinct clusters were delineated among 21 accessions of cultivated and wild pepper (C. annuum, C. baccatum, C. chacoense, C. chinense, and C. frutescens). Three tight clusters comprised of accessions belonging to C. annuum, C. frutescens, and C. baccatum, respectively, were formed, along with a fourth cluster comprised of one accession each of C. chinense and C. chacoense. All accessions were differentiated by this technique, and the clusters corresponded closely to previous morphology-based classification. Sufficient DNA polymorphism exists among these accessions that segregating populations useful for restriction fragment length polymorphism (RFLP) mapping could be constructed using any two pepper accessions as parents. Regression analysis indicates that genetic distance is a good predictor (R2 = 0.872) of the level of mappable DNA polymorphism in Capsicum. Intraspecific variability was examined among four C. annuum cultivars (NuMex R Naky, Jupiter, Perennial, and Criollo de Morelos 334) using both RFLPs and randomly amplified polymorphic DNA (RAPDs), allowing a comparative evaluation of the two techniques. Seventeen percent of the clones used singly in RFLP analyses were sufficient for the differentiation of these varieties, as were 12.5% of the RAPD PCR amplifications. Dendrograms constructed from RFLP and RAPD analyses of the intraspecific data are similar but not identical. Southern analysis and RAPD PCR should be useful for DNA fingerprinting and the discrimination of closely related C. annuum genotypes. PMID:7774796

  20. Genotyping of Escherichia coli by random amplified polymorphic DNA analysis and its application%大肠艾希菌的随机扩增多态性DNA基因分型及应用

    Institute of Scientific and Technical Information of China (English)

    叶明亮; 李晓娣; 公衍文; 侯晓琦; 吕波; 薛燕; 袁著忻

    2003-01-01

    目的对大肠艾希菌(E.coli)进行随机扩增多态性DNA(RAPD)基因分型并应用于医院感染的判断.方法以优化的随机引物、反应体系和扩增条件对临床分离的161株E.coli进行RAPD基因分型并按指纹图上DNA条带数及片段大小绘制基因分型图谱,同时对E.coli的医院内感染及个体感染的连续性进行了观察与分析.结果161株临床分离E.coli共得RAPD 120型;E.coli的医院内感染确实存在.结论RAPD可将E.coli分为120型并有效应用于E.coli医院内感染的判断.

  1. DIFFERENTIATION OF BARLEY GENOTYPES BASED ON DNA POLYMORPHISM

    Directory of Open Access Journals (Sweden)

    Marián Tomka

    2013-02-01

    Full Text Available Identification and characterization of genotypes is essential for improving the quality of cultivated varieties in breeding programs. Information about the origin of varieties can help farmers in selecting appropriate varieties to specific growing conditions or end use of crops. A set of ten microsatellite markers was used to describe genetic diversity in a sample of 30 barley (Hordeum vulgare L. genotypes. A total of 55 different alleles were amplified using ten SSR markers localized on chromosomes 1H, 2H, 3H, 5H, 6H, 7H with an average number of 5.5 alleles per locus. On the basis of allele frequencies we have calculated diversity index, polymorphic information content and index of probability, which have mean values of 0.664; 0.643 and 0.126 respectively. These values indicate high differentiation ability of SSR markers. In the created dendrogram using hierarchical cluster analysis using UPGMA algorithm we were able to differentiate all 30 barley genotypes. The results show that DNA markers are suitable for the identification and differentiation of genotypes and indicated the effectiveness of microsatellite markers to describe genetic diversity.

  2. Analysis of Genetic Diversity and Relationships in a Tunisian Fig (Ficus carica) Germplasm Collection by Random Amplified Microsatellite Polymorphisms

    Institute of Scientific and Technical Information of China (English)

    Khaled Chatti; Olfa Saddoud; Amel Salhi-Hannachi; Messaoud Mars; Mohamed Marrakchi; Mokhtar Trifi

    2007-01-01

    The random amplified mirosatellite polymorphism method was performed in a set of Tunisian fig landraces using eighteen primer combinations. Atotal of sixty three random amplified microsatellite polymorphism (RAMPO) markers were scored and used either to assess the genetic diversity in these cultivars or to detect cases of mislabeling. Opportunely, data proved that the designed procedure constitutes an attractive and fast method with low costs and prevents radio exposure. As a result, we have identified the primer combinations that are the most efficient to detect genetic polymorphism in this crop. Therefore, the derived unweighted pair-group method with arithmetic averages (UPGMA) dendrogram illustrates the genetic divergence among the landraces studied and exhibits a typically continuous variation. Moreover, no evident correlation between the sexes of trees was observed. In addition, using these markers, discrimination between landraces has been achieved. Thus, random amplified mirosatellite polymorphism is proved to be powerful for characterizing the local fig germplasm.

  3. Genetic diversity in Capsicum germplasm based on microsatellite and random amplified microsatellite polymorphism markers.

    Science.gov (United States)

    Rai, Ved Prakash; Kumar, Rajesh; Kumar, Sanjay; Rai, Ashutosh; Kumar, Sanjeet; Singh, Major; Singh, Sheo Pratap; Rai, Awadesh Bahadur; Paliwal, Rajneesh

    2013-10-01

    A sound knowledge of the genetic diversity among germplasm is vital for strategic germplasm collection, maintenance, conservation and utilisation. Genomic simple sequence repeats (SSRs) and random amplified microsatellite polymorphism (RAMPO) markers were used to analyse diversity and relationships among 48 pepper (Capsicum spp.) genotypes originating from nine countries. These genotypes covered 4 species including 13 germplasm accessions, 30 improved lines of 4 domesticated species and 5 landraces derived from natural interspecific crosses. Out of 106 SSR markers, 25 polymorphic SSR markers (24 %) detected a total of 76 alleles (average, 3.04; range, 2-5). The average polymorphic information content (PIC) was 0.69 (range, 0.29-0.92). Seventeen RAMPO markers produced 87 polymorphic fragments with average PIC of 0.63 (range, 0.44-0.81). Dendrograms based on SSRs and RAMPOs generated two clusters. All 38 Capsicum annuum genotypes and an interspecific landrace clustered together, whereas nine non-annuum (three Capsicum frutescens, one Capsicum chinense, one Capsicum baccatum and four interspecific landraces) genotypes clustered separately. Genetic variation within non-annuum genotypes was greater than the C. annuum genotypes. Distinctness of interspecific derivative landraces grown in northeast India was validated; natural crossing between sympatric Capsicum species has been proposed as the mechanism of their origin. PMID:24431527

  4. Polymorphic DNA sequences and their application in paternity testing

    International Nuclear Information System (INIS)

    Characteristics of polymorphic sequences of DNA, especially satellite, mini satellite and micro satellite sequences are presented. Own experience from the use of multi and single locus analysis of DNA in paternity testing has been compared with the results of research in other laboratories. Critical points of both types of analysis are discussed. (author). 53 refs, 4 figs, 2 tabs

  5. Random amplified polymorphic DNA analysis of eel genome

    Institute of Scientific and Technical Information of China (English)

    QIUJIAJING; YIPINGLI

    1999-01-01

    Eel family is a huge one, in which many kinds of eels especially some migratory eels, bear strong resemblance to each other, and are therefore difficult to be identified. In this study 29 random primers were used to make RAPD analysis for Japaneses eel (Anguilla japonica), European eel (Anguilla anguilla) and Pike eel (Muraenesox cinereus).And totally 299 fragments were counted.Shared or specific fragments were counted and genetic similarity or genetic distance were calculated.The genetic similarity between Japanese eel and Pike eel is 0.68 and the genetic distance between them is 0.32;those between European eel and Pike eel are 0.72 and 0.28 respectively,and between Japanese eel and European eel are 0.74 and 0.25 respectively.The method has been shown to be suitable to molecular identification of eels.It provides an alternative approach to determine the relationship between species.

  6. Polymorphisms in DNA Repair Genes, Smoking, and Pancreatic Adenocarcinoma Risk

    OpenAIRE

    Robert R McWilliams; William R Bamlet; Cunningham, Julie M.; Goode, Ellen L.; de ANDRADE, MARIZA; Lisa A Boardman; Petersen, Gloria M.

    2008-01-01

    Base excision repair and nucleotide excision repair are vital responses to multiple types of DNA damage, including damage from tobacco exposure. Single-nucleotide polymorphisms (SNP) in these pathways may affect DNA repair capacity and therefore influence risk for cancer development. We performed a clinic-based, case-control study comprising 481 consecutive patients with confirmed pancreatic adenocarcinoma and 625 healthy controls. Allele and genotype frequencies for 16 SNPs in DNA repair gen...

  7. Intra- and interspecific polymorphisms ofLeishmania donovani andL. tropica minicircle DNA

    OpenAIRE

    Dobner, P; Löscher, Thomas; Rinder, H

    1994-01-01

    A pair of degenerate polymerase chain reaction (PCR) primers (LEI-1, TCG GAT CC[C,T] [G,C]TG GGT AGG GGC GT; LEI-2, ACG GAT CC[G,C] [G,C][A,C]C TAT [A,T]TT ACA CC) defining a 0.15-kb segment ofLeishmania minicircle DNA was constructed. These primers amplified not only inter- but also intraspecifically polymorphic sequences. Individual sequences revealed a higher intraspecific than interspecific divergence. It is concluded that individual sequences are of limited relevance for species determin...

  8. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    International Nuclear Information System (INIS)

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  9. DNA Polymorphisms in River Buffalo Leptin Gene

    Directory of Open Access Journals (Sweden)

    B. Moioli

    2010-02-01

    Full Text Available Leptin is a protein involved in the regulation of feed intake, fat metabolism, whole body energy balance, reproduction and hematopoiesis. In cattle Leptin gene has been considered a potential QTL influencing several production traits like meat production, milk performance and reproduction. Several studies on bovine leptin gene have found association between polymorphisms and traits like milk yield, feed intake, fat content, carcass and meat quality. With the aim to assess the presence of sequences polymorphisms in the Buffalo leptin gene, we sequenced the entire coding region and part of the introns on a panel of Italian River Buffalos. In this study we identified a new set of SNP (Single Nucleotide Polymorphism useful for association studies.

  10. [Study of Chloroplast DNA Polymorphism in the Sunflower (Helianthus L.)].

    Science.gov (United States)

    Markina, N V; Usatov, A V; Logacheva, M D; Azarin, K V; Gorbachenko, C F; Kornienko, I V; Gavrilova, V A; Tihobaeva, V E

    2015-08-01

    The polymorphism of microsatellite loci of chloroplast genome in six Helianthus species and 46 lines of cultivated sunflower H. annuus (17 CMS lines and 29 Rf-lines) were studied. The differences between species are confined to four SSR loci. Within cultivated forms of the sunflower H. annuus, the polymorphism is absent. A comparative analysis was performed on sequences of the cpDNA inbred line 3629, line 398941 of the wild sunflower, and the American line HA383 H. annuus. As a result, 52 polymorphic loci represented by 27 SSR and 25 SNP were found; they can be used for genotyping of H. annuus samples, including cultural varieties: twelve polymorphic positions, of which eight are SSR and four are SNP. PMID:26601486

  11. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  12. Application of restriction site amplified polymorphism (RSAP) to genetic diversity in Saccharina japonica

    Science.gov (United States)

    Zhao, Cui; Liu, Cui; Li, Wei; Chi, Shan; Feng, Rongfang; Liu, Tao

    2013-07-01

    Restriction site amplified polymorphism (RSAP) was used, for the first time, to analyze the genetic structure and diversity of four, mainly cultivated, varieties of the brown alga, Saccharina japonica. Eighty-eight samples from varieties " Rongfu ", " Fujian ", " Ailunwan " and " Shengchanzhong " were used for the genetic analyses. One hundred and ninety-eight bands were obtained using eight combinations of primers. One hundred and ninety-one (96.46%) were polymorphic bands. Nei's genetic diversity was 0.360, and the coefficient of genetic differentiation was 0.357. No inbreeding-type recession was found in the four brown alga varieties and the results of the " Ailunwan " variety using samples from 2 years showed that the variety was becoming less diverse during the selection inherent in the breeding program. Genetic diversity and cluster analyses results were consistent with these genetic relationships. The results show the RSAP method is suitable for genetic analysis. Continuous inbreeding and selection could reduce the genetic diversity effectively; therefore periodical supervision is required.

  13. Application of restriction site amplified polymorphism (RSAP) to genetic diversity in Saccharina japonica

    Institute of Scientific and Technical Information of China (English)

    ZHAO Cui; LIU Cui; LI Wei; CHI Shan; FENG Rongfang; LIU Tao

    2013-01-01

    Restriction site amplified polymorphism (RSAP) was used,for the first time,to analyze the genetic structure and diversity of four,mainly cultivated,varieties of the brown alga,Saccharinajaponica.Eighty-eight samples from varieties "Rongfu","Fujian","Ailunwan" and "Shengchanzhong" were used for the genetic analyses.One hundred and ninety-eight bands were obtained using eight combinations of primers.One hundred and ninety-one (96.46%) were polymorphic bands.Nei's genetic diversity was 0.360,and the coefficient of genetic differentiation was 0.357.No inbreeding-type recession was found in the four brown alga varieties and the results of the "Ailunwan" variety using samples from 2 years showed that the variety was becoming less diverse during the selection inherent in the breeding program.Genetic diversity and cluster analyses results were consistent with these genetic relationships.The results show the RSAP method is suitable for genetic analysis.Continuous inbreeding and selection could reduce the genetic diversity effectively; therefore periodical supervision is required.

  14. Genetic Variability in Rhizoctonia solani Isolated from Vitis vinifera Based on Amplified Fragment Length Polymorphism

    Directory of Open Access Journals (Sweden)

    Amparo Meza-Moller

    2011-01-01

    Full Text Available Problem statement: Rhizoctonia solani is a potential grapevine pathogen. In order to develop effective methods of control, it is necessary to document its genetic diversity. Approach: The objective of this study was to analyze the genetic variability of R. solani isolated from the rhizosphere of ungrafted V. vinifera var. perlette seedless planted in Sonora, Mexico using Amplified Fragment Length Polymorphism (AFLP. Results: In the selective amplification using eight primer combinations we obtained a total of 446 AFLP markers with a 100% polymorphism. Out of 41 isolates, 36 different AFLP patterns were observed and five were replicates of the same pattern. The dendrogram shows inter- and intrapopulation similarity indexes of 0.26, 0.98 and 0.31, 0.98, respectively. Six groups emerged from the principal components analysis, five of which were clearly defined, while the other one was spread out. Conclusion: We conclude that R. solani growing in Sonoran vineyards shows a high degree of genetic variability, even under similar environmental conditions.

  15. Genetic diversity and relationship of chicory (Cichorium intybus L.) using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Liang, X Y; Zhang, X Q; Bai, S Q; Huang, L K; Luo, X M; Ji, Y; Jiang, L F

    2014-01-01

    Chicory is a crop with economically important roles and is cultivated worldwide. The genetic diversity and relationship of 80 accessions of chicories and endives were evaluated by sequence-related amplified polymorphism (SRAP) markers to provide a theoretical basis for future breeding programs in China. The polymorphic rate was 96.83%, and the average polymorphic information content was 0.323, suggesting the rich genetic diversity of chicory. The genetic diversity degree of chicory was higher (GS = 0.677) than that of endive (GS = 0.701). The accessions with the highest genetic diversity (effective number of alleles, NE = 1.609; Nei's genetic diversity, H = 0.372; Shannon information index, I = 0.556) were from Italy. The richest genetic diversity was revealed in a chicory line (NE = 1.478, H = 0.289, I = 0.443) among the 3 types (line, wild, and cultivar). The chicory genetic structure of 8 geographical groups showed that the genetic differentiation coefficient (GST) was 14.20% and the number of immigrants per generation (Nm) was 3.020. A GST of 6.80% and an Nm of 6.853 were obtained from different types. This observation suggests that these chicory lines, especially those from the Mediterranean region, have potential for providing rich genetic resources for further breeding programs, that the chicory genetic structure among different countries obviously differs with a certain amount of gene flow, and that SRAP markers could be applied to analyze genetic relationships and classifications of Cichorium intybus and C. endivia. PMID:25299087

  16. [Mitochondrial DNA Polymorphism in Different Populations of Spangled Orloff Chickens].

    Science.gov (United States)

    Oyuna, N Yu; Moiseyeva, I G; Sevastianova, A A; Vakhrameev, A B; Alexandrov, A V; Kuzevanova, A Yu; Alimov, A A; Sulimova, G E

    2015-09-01

    For the first time, the genetic diversity of the Spangled Orloff chickens was studied by analyzing the polymorphism of the hypervariable region in the D-loop of mitochondrial DNA (mtDNA). Samples for the analysis were collected at the farms ofthe All-Russia Poultry Research and Technological Institute (VNITIP), the All-Russia Institute of Farm Animal Genetics and Breeding (VNIIGRZh), and the Moscow Zoo. The D-loop partial sequences (between nucleotide positions 57 and 523) were determined according to the reference sequence of Gallus gallus spadiceus mtDNA, NC_007235 in 39 individuals obtained from these populations (GenBank Accession Nos. KM391754-KM391792). In the analyzed mtDNA fragment, a total of 20 polymorphic sites localized between positions 167 and 368, as well as at position 446, were described in Spangled Orloff chickens. One polymorphic site at position 221 (haplogroup E, haplotype ORL-2) was unique. All of the identified nucleotide changes were transition-type substitutions. Overall, based on the analysis of poly- morphic sites in the hypervariable fragment of the D-loop of Spangled Orloff chicken mtDNA, we found seven haplotypes belonging to four haplogroups (A, B, C, and E). Haplogroup E (haplotypes ORL-1, ORL-2, and ORL-3) was present in the majority of the studied individual, with the frequencies of 0.77 in the total sample and 0.47 in the VNIIGRZh farm population. Haplogroups A (haplotypes ORL-4 and ORL-7), B (ORL-6), and C (ORL-5) were found only in samples from the VNIIGRZh farm. The studied mtDNA region revealed a lower level of polymorphism in the VNITIP and Moscow Zoo populations, which only had the ORL-1 and ORL-3 haplotypes belonging to Haplogroup E, respectively. Our data suggested that the studied Spangled Orloff chicken populations differed in the composition and frequencies of mtDNA haplogroups and haplotypes. PMID:26606802

  17. Single nucleotide polymorphism analysis of European archaeological M. leprae DNA.

    Directory of Open Access Journals (Sweden)

    Claire L Watson

    Full Text Available BACKGROUND: Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA from medieval bones and single nucleotide polymorphism (SNP typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. METHODS AND FINDINGS: Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia and are dated around the medieval period (476 to 1350 A.D.. we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3. CONCLUSIONS: These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide.

  18. The Science and Issues of Human DNA Polymorphisms: A Training Workshop for High School Biology Teachers

    Energy Technology Data Exchange (ETDEWEB)

    Micklos, David A.

    2006-10-30

    This project achieved its goal of implementing a nationwide training program to introduce high school biology teachers to the key uses and societal implications of human DNA polymorphisms. The 2.5-day workshop introduced high school biology faculty to a laboratory-based unit on human DNA polymorphisms â which provides a uniquely personal perspective on the science and Ethical, Legal and Social Implications (ELSI) of the Human Genome Project. As proposed, 12 workshops were conducted at venues across the United States. The workshops were attended by 256 high school faculty, exceeding proposed attendance of 240 by 7%. Each workshop mixed theoretical, laboratory, and computer work with practical and ethical implications. Program participants learned simplified lab techniques for amplifying three types of chromosomal polymorphisms: an Alu insertion (PV92), a VNTR (pMCT118/D1S80), and single nucleotide polymorphisms (SNPs) in the mitochondrial control region. These polymorphisms illustrate the use of DNA variations in disease diagnosis, forensic biology, and identity testing - and provide a starting point for discussing the uses and potential abuses of genetic technology. Participants also learned how to use their Alu and mitochondrial data as an entrée to human population genetics and evolution. Our work to simplify lab techniques for amplifying human DNA polymorphisms in educational settings culminated with the release in 1998 of three Advanced Technology (AT) PCR kits by Carolina Biological Supply Company, the nationâÂÂs oldest educational science supplier. The kits use a simple 30-minute method to isolate template DNA from hair sheaths or buccal cells and streamlined PCR chemistry based on Pharmacia Ready-To-Go Beads, which incorporate Taq polymerase, deoxynucleotide triphosphates, and buffer in a freeze-dried pellet. These kits have greatly simplified teacher implementation of human PCR labs, and their use is growing at a rapid pace. Sales of human

  19. Use of RAPD marker for identification of DNA polymorphism in gamma rays treated Jatropha Curcas L

    International Nuclear Information System (INIS)

    The aim of this study is to examine the discriminatory power of random amplified polymorphic DNA (RAPD) marker in Jatropha curcas, and to determine the effect of various dose exposures (0, 5, 10, f, 20 and 25 Kr) of gamma rays on J. curcas, at molecular level. All the ten random primers used produced reproducible polymorphic bands. PCR products of mutant genome revealed a total of 40 bands, out of which 27 were polymorphic. Polymorphism information content (PIC) values were ranged from 0.00 to 0.40 and the highest PIC value of 0.40 was observed in primer OPU-13 followed by primers OPAL-II and OPT-18 (0.30) while no PIC value were reported in primers OPH-18 and OPM-13. Jaccard's coefficient of similarity varied from 0.476 to 0.723, indicative of high level of genetic variation among the mutants studied. UPGMA cluster analysis indicated three distinct clusters, one comprising control while the second included four mutants viz., 10, 15, 25 and 20 Kr. The mutant 5 Kr remained distinct and formed third cluster indicating its higher genetic diversity from the rest of the mutants and control. The primer OPU-13 produced maximum number of bands (8) showed highest discriminatory power and PIC (0.40) by showing maximum number of polymorphic bands (5) when compared to other primers used. The study reveals that RAPD molecular markers can be used to assess polymorphism among the mutants and can be a useful tool to supplement the distinctness, uniformity and stability analysis for plant varietal identification and protection. (author)

  20. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    Science.gov (United States)

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals. PMID:24377284

  1. Veronaea botryosa: molecular identification with amplified fragment length polymorphism (AFLP) and in vitro antifungal susceptibility.

    Science.gov (United States)

    Badali, Hamid; Yazdanparast, Seyed Amir; Bonifaz, Alexandro; Mousavi, Bita; de Hoog, G Sybren; Klaassen, Corné H W; Meis, Jacques F

    2013-06-01

    Inter- and intraspecific genomic variability of 18 isolates of Veronaea botryosa originating from clinical and environmental sources was studied using amplified fragment length polymorphism (AFLP). The species was originally described from the environment, but several severe cases of disseminated infection in apparently healthy individuals have been reported worldwide. All tested strains of V. botryosa, identified on the basis of sequencing and phenotypic and physiological criteria prior to our study, were confirmed by AFLP analysis, yielding a clear separation of V. botryosa as a rather homogeneous group from related species. In vitro antifungal susceptibility testing resulted in MIC90s across all strains in increasing order posaconazole (0.25 μg/ml), itraconazole (1 μg/ml), voriconazole (4 μg/ml), terbinafine (4 μg/ml), caspofungin (8 μg/ml), anidulafungin (8 μg/ml), isavuconazole (16 μg/ml), amphotericin B (16 μg/ml), and fluconazole (32 μg/ml). Overall, the isolates showed a uniform pattern of low MICs of itraconazole and posaconazole, but high MICs for remaining agents. The echinocandins (caspofungin and anidulafungin) had no activity against V. botryosa. There was no statistically significant difference between susceptibilities of environmental (n = 11) and clinical (n = 7) isolates of V. botryosa (P > 0.05). PMID:23463524

  2. Optimization of a Reaction System of Sequence Related Amplified Polymorphism and Segregation of Polymorphic Loci in an F2 Population of Rice

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    An effective PCR protocol for detecting the sequence related amplified polymorphism (SRAP) in rice was developed.One hundred and ten pairs of SRAP primers were used for segregation analysis in an F2 population derived from a cross between Shennong 606 and Lijiangxintuanheigu.Among the 110 primer pairs,35 pairs generated 143 polymorphic bands with an average of 4.09 polymorphic bands per primer pair,and 24 pairs (16.78%) showed the genetic distortion (P<0.05).Of the 24 primer pairs,12 pairs deviated toward the male parent Shennong 606 and 11 pairs toward the female parent Lijiangxintuanheigu,only one toward heterozygote.It was found that the segregation distortion might be caused by the joint gametic and zygotic effects.

  3. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H.M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  4. DNA Polymorphism Among American Watermelon Cultivars Based on DNA Methylation

    Science.gov (United States)

    American watermelon heirlooms are diverse in their growth habits, fruit qualities and responses to biotic and abiotic stress. Wide ranging DNA marker tools resolved a narrow molecular diversity among these collections. The current research explored additional insights such as extent of diversity a...

  5. Genetic Mapping of Laminaria japonica and L. longissima Using Amplified Fragment Length Polymorphism Markers in a "Two-Way Pseudo-Testcross" Strategy

    Institute of Scientific and Technical Information of China (English)

    Yuhui Li; Yingxia Yang; Jidong Liu; Xiuliang Wang; Tianxiang Gao; Delin Duan

    2007-01-01

    With a "two-way pseudo-testcross" mapping strategy, we applied the amplified fragment length polymorphism (AFLP) markers to construct two moderate density genetic linkage maps for Laminaria. The linkage maps were generated from the 60 progenies of the F1 cross family (Laminaria longissima Aresch. x L. japonica Miyabe) with twenty pairs of primer combinations. Of the 333 polymorphic loci scored in 60 progenies, 173 segregated in a 1:1ratio, corresponding to DNA polymorphisms heterozygous in a single parent, and the other 58 loci existing in both parents followed a 3:1 Mendelian segregation ratio. Among the loci with 1:1 segregating ratios, 79 loci were ordered in 14 linkage groups (648.6 cM) of the paternal map, and 72 loci were ordered in 14 linkage groups (601.9 cM) of the maternal map. The average density of loci was approximately 1 per 8 cM. To investigate the homologies between two parental maps, we used 58 loci segregated 3:1 for further analysis, and deduced one homologous linkage group. The linkage data developed in these maps will be useful for detecting loci-controlling commercially important traits for Laminaria.

  6. Genetic relatedness among Campylobacter jejuni serotyped isolates of diverse origin as determined by numerical analysis of amplified fragment length polymorphism (AFLP) profiles

    DEFF Research Database (Denmark)

    Siemer, B.L.; Harrington, C.S.; Nielsen, E.M.;

    2004-01-01

    analysis of AFLP profiles derived from genomic DNA. Extensive genetic diversity was seen among the strains examined; however, 43 groups of isolates were identified at the 92% similarity (S-) level. Thirteen groups contained isolates from a single host, possibly representing genotypes of 'low risk' to human......Aims: To use amplified fragment length polymorphism (AFLP) analysis to evaluate the genetic relatedness among 254 Campylobacter jejuni reference and field strains of diverse origin representing all defined 'Penner' serotypes for this species. Methods and Results: Field strains (n = 207) from human...... diarrhoea and diverse animal and environmental sources were collected mainly through a National surveillance programme in Denmark and serotyped by use of the established 'Penner' scheme. Genetic relationships among these isolates, and the archetypal serotype reference strains, were assessed by numerical...

  7. DNA polymorphisms revealed by the RAPD technique show differences between radionuclide-contaminated and uncontaminated mosquitofish populations

    International Nuclear Information System (INIS)

    In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations

  8. Whole-genome amplified DNA from stored dried blood spots is reliable in high resolution melting curve and sequencing analysis

    DEFF Research Database (Denmark)

    Winkel, Bo G; Hollegaard, Mads Vilhelm; Olesen, Morten S; Svendsen, Jesper H; Haunsø, Stig; Hougaard, David M; Tfelt-Hansen, Jacob

    2011-01-01

    The use of dried blood spots (DBS) samples in genomic workup has been limited by the relative low amounts of genomic DNA (gDNA) they contain. It remains to be proven that whole genome amplified DNA (wgaDNA) from stored DBS samples, constitutes a reliable alternative to gDNA.We wanted to compare m...

  9. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  10. Fast solid support detection of PCR amplified viral DNA sequences using radioiodinated or hapten labelled primers.

    OpenAIRE

    Sauvaigo, S; Fouqué, B; Roget, A; Livache, T; BAZIN, H.; Chypre, C; Téoule, R

    1990-01-01

    Oligonucleotides with novel modifications have been synthesized and incorporated into enzymatically amplified DNA sequences. They allow the fast detection of viral DNA sequences after two rounds of amplification. The hybrids formed are immobilized by affinity on coated tubes and detected by direct beta (32P) or gamma (125I) counting or by colorimetric revelation. The effect of a dilution step between the two amplifications is studied to obtain optimal sensitivity and specificity. This test is...

  11. Enzyme-free amplified detection of DNA by an autonomous ligation DNAzyme machinery.

    Science.gov (United States)

    Wang, Fuan; Elbaz, Johann; Willner, Itamar

    2012-03-28

    The Zn(2+)-dependent ligation DNAzyme is implemented as a biocatalyst for the amplified detection of a target DNA by the autonomous replication of a nucleic acid reporter unit that is generated by the catalyzed ligation process. The reporter units enhance the formation of active DNAzyme units, thus leading to the isothermal autocatalytic formation of the reporter elements. The system was further developed and applied for the amplified detection of Tay-Sachs genetic disorder mutant, with a detection limit of 1.0 × 10(-11) M. Besides providing a versatile paradigm for the amplified detection of DNA, the system reveals a new, enzyme-free, isothermal, autocatalytic mechanism that introduces means for effective programmed synthesis. PMID:22404383

  12. Buccal cells DNA extraction to obtain high quality human genomic DNA suitable for polymorphism genotyping by PCR-RFLP and Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Erika Calvano Küchler

    2012-08-01

    Full Text Available OBJECTIVE: The aim of this study was to evaluate, by PCR-RFLP and real-time PCR, the yield and quality of genomic DNA collected from buccal cells by mouthwash after different storage times at room temperature. MATERIAL AND METHODS: A group of volunteers was recruited to collect buccal cells using a mouthwash solution. The collected solution was divided into 3 tubes, one tube were used for immediate extraction and the remaining received ethanol and were kept at room temperature for 4 and 8 days followed by dna extraction. The concentration, purity and integrity of the dna were determined using spectrophotometry and electrophoresis. DNA quality differences among the three incubation times were also evaluated for genotyping EGF +61 a/g (rs 4444903 polymorphism by PCR-RFLP and for IRF6 polymorphism (rs 17015215 using real-time PCR. RESULTS: There was no significant difference of dna yield (p=0.75 and purity (p=0.86 among the three different incubation times. DNA obtained from different incubation times presented high-molecular weight. The PCR-RFLP and real time pcr reactions were successfully performed for all DNA samples, even those extracted after 8 days of incubation. All samples genotyped by real-time pcr presented c allele for irf6 gene polymorphism (homozygous: cc; heterozygous: Ct and the C allele was used as a reference for Ct values. The samples presented the same genotype for the different times in both techniques. CONCLUSION: We demonstrated that the method described herein is simple and low cost, and that DNA can be extracted and pcr amplified after storage in mouthwash solution at room temperature.

  13. Polyvinylpyrrolidone-Agarose Gel Electrophoresis Purification of Polymerase Chain Reaction-Amplifiable DNA from Soils

    OpenAIRE

    Young, Charles C.; Burghoff, Robert L.; Keim, Lois G.; Minak-Bernero, Vera; Lute, James R.; Hinton, Stephen M.

    1993-01-01

    This communication describes a modification of agarose gel electrophoresis to provide a rapid and simple method for the purification of polymerase chain reaction-amplifiable DNA from soil. This modification is to add polyvinylpyrrolidone to the agarose gel. The polyvinylpyrrolidone addition retards the electrophoretic mobility of denaturing phenolic compounds so that they do not comigrate with nucleic acids.

  14. Human polymorphic variants of the NEIL1 DNA glycosylase.

    Science.gov (United States)

    Roy, Laura M; Jaruga, Pawel; Wood, Thomas G; McCullough, Amanda K; Dizdaroglu, Miral; Lloyd, R Stephen

    2007-05-25

    In mammalian cells, the repair of DNA bases that have been damaged by reactive oxygen species is primarily initiated by a series of DNA glycosylases that include OGG1, NTH1, NEIL1, and NEIL2. To explore the functional significance of NEIL1, we recently reported that neil1 knock-out and heterozygotic mice develop the majority of symptoms of metabolic syndrome (Vartanian, V., Lowell, B., Minko, I. G., Wood, T. G., Ceci, J. D., George, S., Ballinger, S. W., Corless, C. L., McCullough, A. K., and Lloyd, R. S. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 1864-1869). To determine whether this phenotype could be causally related to human disease susceptibility, we have characterized four polymorphic variants of human NEIL1. Although three of the variants (S82C, G83D, and D252N) retained near wild type levels of nicking activity on abasic (AP) site-containing DNA, G83D did not catalyze the wild type beta,delta-elimination reaction but primarily yielded the beta-elimination product. The AP nicking activity of the C136R variant was significantly reduced. Glycosylase nicking activities were measured on both thymine glycol-containing oligonucleotides and gamma-irradiated genomic DNA using gas chromatography/mass spectrometry. Two of the polymorphic variants (S82C and D252N) showed near wild type enzyme specificity and kinetics, whereas G83D was devoid of glycosylase activity. Although insufficient quantities of C136R could be obtained to carry out gas chromatography/mass spectrometry analyses, this variant was also devoid of the ability to incise thymine glycol-containing oligonucleotide, suggesting that it may also be glycosylase-deficient. Extrapolation of these data suggests that individuals who are heterozygous for these inactive variant neil1 alleles may be at increased risk for metabolic syndrome. PMID:17389588

  15. Associations between polymorphisms in DNA repair genes and glioblastoma.

    Science.gov (United States)

    McKean-Cowdin, Roberta; Barnholtz-Sloan, Jill; Inskip, Peter D; Ruder, Avima M; Butler, Maryann; Rajaraman, Preetha; Razavi, Pedram; Patoka, Joe; Wiencke, John K; Bondy, Melissa L; Wrensch, Margaret

    2009-04-01

    A pooled analysis was conducted to examine the association between select variants in DNA repair genes and glioblastoma multiforme, the most common and deadliest form of adult brain tumors. Genetic data for approximately 1,000 glioblastoma multiforme cases and 2,000 controls were combined from four centers in the United States that have conducted case-control studies on adult glioblastoma multiforme, including the National Cancer Institute, the National Institute for Occupational Safety and Health, the University of Texas M. D. Anderson Cancer Center, and the University of California at San Francisco. Twelve DNA repair single-nucleotide polymorphisms were selected for investigation in the pilot collaborative project. The C allele of the PARP1 rs1136410 variant was associated with a 20% reduction in risk for glioblastoma multiforme (odds ratio(CT or CC), 0.80; 95% confidence interval, 0.67-0.95). A 44% increase in risk for glioblastoma multiforme was found for individuals homozygous for the G allele of the PRKDC rs7003908 variant (odds ratio(GG), 1.44; 95% confidence interval, 1.13-1.84); there was a statistically significant trend (P = 0.009) with increasing number of G alleles. A significant, protective effect was found when three single-nucleotide polymorphisms (ERCC2 rs13181, ERCC1 rs3212986, and GLTSCR1 rs1035938) located near each other on chromosome 19 were modeled as a haplotype. The most common haplotype (AGC) was associated with a 23% reduction in risk (P = 0.03) compared with all other haplotypes combined. Few studies have reported on the associations between variants in DNA repair genes and brain tumors, and few specifically have examined their impact on glioblastoma multiforme. Our results suggest that common variation in DNA repair genes may be associated with risk for glioblastoma multiforme. PMID:19318434

  16. Optimization of randomly amplified polymorphic DNA-polymerase chain reaction for molecular typing of Salmonella enterica serovar Typhi Otimização da reação de amplificação aleatória do DNA polimórfico - reação em cadeia da polimerase para tipagem molecular de Salmonella enterica sorovar Typhi

    Directory of Open Access Journals (Sweden)

    Bianca Ramalho Quintaes

    2004-03-01

    Full Text Available Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.A otimização da reação de RAPD para a caracterização de cepas de Salmonella enterica sorovar Typhi foi estudada com o objetivo de assegurar a reprodutibilidade e o poder discriminatório desta técnica. Oito cepas de Salmonella sorovar Typhi isoladas de algumas regiões do Brasil foram usadas para examinar os padrões de fragmentação produzidos quando foram empregadas concentrações diferentes do DNA molde, do iniciador, do MgCl2 e da enzima Taq DNA polimerase. Com a utilização de dois diferentes perfis de ciclos termais de baixa estringência, foram comparados os padrões de bandeamento obtidos. Um conjunto de dezesseis iniciadores foi avaliado quanto à capacidade de produzir elevado número de fragmentos distintos. Observou-se que variações associadas a todos os parâmetros testados modificaram os padrões de bandeamento. Para as amostras de Salmonella enterica sorovar Typhi utilizadas neste experimento, definiu-se um conjunto de condições para a reação de RAPD-PCR que resultou num método de tipagem simples, rápido e

  17. Delineation of Campylobacter concisus genomospecies by amplified fragment length polymorphism analysis and correlation of results with clinical data

    DEFF Research Database (Denmark)

    Aabenhus, R.; On, Stephen L.W.; Siemer, Berit L.; Permin, H.; Andersen, L.P.

    2005-01-01

    phenotypically indistinguishable but genetically distinct taxa (i.e., genornospecies) that may vary in pathogenicity. We examined 62 C concisus strains by amplified fragment length polymorphism (AFLP) profiling and correlated the results with clinical data. All C. concisus strains gave unique AFLP profiles, and...... numerical analysis of these data distributed the strains among four clusters. The clustering was of taxonomic significance: two clusters contained, respectively, the type strain (of oral origin) and a reference strain (from diarrhea) of each of the known genomospecies. Genomospecies 2 strains were more...

  18. A new polymorphic positions discovered in mitochondrial DNA hypervariable region HVIII from central and north-central of Iraq.

    Science.gov (United States)

    Kareem, Muhanned Abdulhassan; Abdulzahra, Ameer Ibrahim; Hameed, Imad Hadi; Jebor, Mohammed Abdullah

    2016-09-01

    The aim of this research is to study the mitochondria non-coding region by using Sanger sequencing technique and establish the degree of variation characteristic of a fragment. FTA® Technology (FTA™ paper DNA extraction) is utilized to extract DNA. A portion of a non-coding region encompassing positions 438 to 574 for HVIII amplified in accordance with the Anderson reference sequence. PCR products purified by EZ-10 spin column were then sequenced and detected by using the ABI 3730xL DNA analyzer. The new polymorphic positions 469 and 482 that are described in this study may in future be suitable sources for identification purpose. The data obtained can be used to identify variable nucleotide positions characterized by frequent occurrence, most promising for identification variants. PMID:25703852

  19. Population Structure and Genetic Relationships of Melia Taxa in China Assayed with Sequence-Related Amplified Polymorphism (SRAP Markers

    Directory of Open Access Journals (Sweden)

    Boyong Liao

    2016-04-01

    Full Text Available The uncertainty about whether, in China, the genus Melia (Meliaceae consists of one species (M. azedarach Linnaeus or two species (M. azedarach and M. toosendan Siebold & Zuccarini remains to be clarified. Although the two putative species are morphologically distinguishable, genetic evidence supporting their taxonomic separation is lacking. Here, we investigated the genetic diversity and population structure of 31 Melia populations across the natural distribution range of the genus in China. We used sequence-related amplified polymorphism (SRAP markers and obtained 257 clearly defined bands amplified by 20 primers from 461 individuals. The polymorphic loci (P varied from 35.17% to 76.55%, with an overall mean of 58.24%. Nei’s gene diversity (H ranged from 0.13 to 0.31, with an overall mean of 0.20. Shannon’s information index (I ranged from 0.18 to 0.45, with an average of 0.30. The genetic diversity of the total population (Ht and within populations (Hs was 0.37 ± 0.01 and 0.20 ± 0.01, respectively. Population differentiation was substantial (Gst = 0.45, and gene flow was low. Of the total variation, 31.41% was explained by differences among putative species, 19.17% among populations within putative species, and 49.42% within populations. Our results support the division of genus Melia into two species, which is consistent with the classification based on the morphological differentiation.

  20. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-01-01

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P < 0.05). Most of the variance was within populations. These findings will be important for more sustainable octopus fisheries, so that this marine resource can be conserved for its long-term utilization. PMID:26634529

  1. DNA polymorphism of HLA class II genes in alopecia areata

    DEFF Research Database (Denmark)

    Morling, N; Frentz, G; Fugger, L;

    1992-01-01

    We investigated the DNA restriction polymorphism (RFLP) of the Major Histocompatibility Complex (MHC) class II genes: HLA-DQA, -DQB, -DPA, and -DPB in 20 Danish patients with alopecia areata (AA) and in healthy Danes. The frequency in AA of the DQB1*0301 and DQw7 associated DQB Bgl/II 4.2 kb...... of the serologically defined HLA-DQw7 specificity. Individuals who carried both DQA1*0501 and DQB1*0301 seemed to have a further increased risk of developing AA compared to individuals carrying only one of these HLA class II genes. Analysis of the combined presence of DQB1*0301 and DPA1*0103 in AA suggests...

  2. Gene polymorphisms and increased DNA damage in morbidly obese women.

    Science.gov (United States)

    Luperini, B C O; Almeida, D C; Porto, M P; Marcondes, J P C; Prado, R P; Rasera, I; Oliveira, M R M; Salvadori, D M F

    2015-06-01

    Obesity is characterized by increased adipose tissue mass resulting from a chronic imbalance between energy intake and expenditure. Furthermore, there is a clearly defined relationship among fat mass expansion, chronic low-grade systemic inflammation and reactive oxygen species (ROS) generation; leading to ROS-related pathological events. In the past years, genome-wide association studies have generated convincing evidence associating genetic variation at multiple regions of the genome with traits that reflect obesity. Therefore, the present study aimed to evaluate the relationships among the gene polymorphisms ghrelin (GHRL-rs26802), ghrelin receptor (GHSR-rs572169), leptin (LEP-rs7799039), leptin receptor (LEPR-rs1137101) and fat mass and obesity-associated (FTO-rs9939609) and obesity. The relationships among these gene variants and the amount of DNA damage were also investigated. Three hundred Caucasian morbidly obese and 300 eutrophic (controls) women were recruited. In summary, the results demonstrated that the frequencies of the GHRL, GHSR, LEP and LEPR polymorphisms were not different between Brazilian white morbidly obese and eutrophic women. Exceptions were the AA-FTO genotype and allele A, which were significantly more frequent in obese women than in the controls (0.23% vs. 0.10%; 0.46 vs. 0.36, respectively), and the TT-FTO genotype and the T allele, which were less frequent in morbidly obese women (p<0.01). Furthermore, significant differences in the amount of genetic lesions associated with FTO variants were observed only in obese women. In conclusion, this study demonstrated that the analyzed SNPs were not closely associated with morbid obesity, suggesting they are not the major contributors to obesity. Therefore, our data indicated that these gene variants are not good biomarkers for predicting risk susceptibility for obesity, whereas ROS generated by the inflammatory status might be one of the causes of DNA damage in obese women, favoring

  3. Multiplexed aptasensors and amplified DNA sensors using functionalized graphene oxide: application for logic gate operations.

    Science.gov (United States)

    Liu, Xiaoqing; Aizen, Ruth; Freeman, Ronit; Yehezkeli, Omer; Willner, Itamar

    2012-04-24

    Graphene oxide (GO) is implemented as a functional matrix for developing fluorescent sensors for the amplified multiplexed detection of DNA, aptamer-substrate complexes, and for the integration of predesigned DNA constructs that activate logic gate operations. Fluorophore-labeled DNA strands acting as probes for two different DNA targets are adsorbed onto GO, leading to the quenching of the luminescence of the fluorophores. Desorption of the probes from the GO, through hybridization with the target DNAs, leads to the fluorescence of the respective label. By coupling exonuclease III, Exo III, to the system, the recycling of the target DNAs is demonstrated, and this leads to the amplified detection of the DNA targets (detection limit 5 × 10(-12) M). Similarly, adsorption of fluorophore-functionalized aptamers against thrombin or ATP onto the GO leads to the desorption of the aptamer-substrate complexes from GO and to the triggering of the luminescence corresponding to the respective fluorophore, thus, allowing the multiplexed analysis of the aptamer-substrate complexes. By designing functional fluorophore-labeled DNA constructs and their interaction with GO, in the presence (or absence) of nucleic acids, or two different substrates for aptamers, as inputs, the activation of the "OR" and "AND" logic gates is demonstrated. PMID:22404375

  4. Genotype characterization of Haematobia irritans from different Brazilian geographic regions based on randomly amplified polymorphic DNA (RAPD analysis Caracterização genotípica de Haematobia irritans procedentes de diferentes regiões geográficas brasileiras baseada na análise do DNA polimórfico amplificado ao acaso (RAPD-PCR

    Directory of Open Access Journals (Sweden)

    Luciana G. Brito

    2007-01-01

    Full Text Available Blood-sucking diptera are important parasites in bovine production systems, especially regarding confinement conditions. Haematobia irritans, the horn fly, is one of the most troublesome species within bovine production systems, due to the intense stress imposed to the animals. An important aspect while studying the variability within a species is the study of the geographic structure of its populations and, attempting to find out the genetic flow of Brazilian populations of horn fly, the RAPD technique, which is suited for this purpose, has been used. The use of molecular markers generated from RAPD made it possible to identify the geographic origin of samples from different Brazilian geographic regions, as well as to estimate the genotypic flow among the different Brazilian populations of the horn fly.Dípteras hematófagos são importantes parasitas dentro de sistemas de produção de bovinos, especialmente em confinamento. Haematobia irritans, a mosca-dos-chifres, é uma das espécies que maiores problemas causa em sistemas de produção de bovinos, dado ao intenso estresse que impõe aos animais. Um importante aspecto quando se estuda a variabilidade genética dentro das espécies é o estudo da estrutura geográfica destas populações. Buscando-se estimar a similaridade genotípica das diferentes populações brasileiras da mosca do chifre utilizou-se a técnica do DNA polimórfico amplificado ao acaso (RAPD-PCR, que mostrou-se eficiente para tal propósito. A utilização dos marcadores moleculares gerados através da técnica de RAPD-PCR tornou possível a identificação da origem geográfica das amostras das diferentes regiões geográficas brasileiras, assim como, estimar o fluxo genotípico entre as diferentes populações brasileiras da mosca-dos-chifres.

  5. AFLP (Amplified Fragment Length Polymorphism:増幅断片長多型)解析による3倍性ギンブナ(Carassius auratus langsdorfi)に特徴的なゲノムマーカーの探索

    OpenAIRE

    高瀬, 有加里; 藤谷, 英男; 村上, 賢; タカセ, ユカリ; フジタニ, ヒデオ; ムラカミ, マサル; Yukari, TAKASE; Hideo, Fujitani; Masaru, MURAKAMI

    2007-01-01

    The Japanese silver crucian carp (so-called ginbuna, Carassius auratus langsdrofi) has two reproduction systems; one is a sexual reproduction practiced by diploid individuals and the other is gynogenetic reproduction by triploid individuals. In this study, AFLP (Amplified Fragment Length Polymorphism) analysis was carried out to isolate and characterize genomic DNA markers for triploid ginbuna, as a step toward revealing the genomic makeup and origin of triploid ginbuna. Two valuable DNA mark...

  6. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue.

    OpenAIRE

    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L

    1997-01-01

    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molec...

  7. Isolation of human mdr DNA sequences amplified in multidrug-resistant KB carcinoma cells.

    OpenAIRE

    Roninson, I B; Chin, J E; Choi, K. G.; Gros, P.; Housman, D.E.; Fojo, A; Shen, D. W.; Gottesman, M M; Pastan, I

    1986-01-01

    The ability of tumor cells to develop simultaneous resistance to structurally different cytotoxic drugs constitutes a major problem in cancer chemotherapy. It was previously demonstrated that multidrug-resistant Chinese hamster cell lines contain an amplified, transcriptionally active DNA sequence designated mdr. This report presents evidence that multidrug-resistant sublines of human KB carcinoma cells, selected for resistance to either colchicine, vinblastine, or Adriamycin (doxorubicin), d...

  8. Use of mitochondrial and ribosomal DNA polymorphisms to classify clinical and soil isolates of Histoplasma capsulatum.

    OpenAIRE

    Spitzer, E. D.; Lasker, B A; Travis, S J; Kobayashi, G. S.; Medoff, G

    1989-01-01

    We have developed an improved scheme for the classification of environmental and clinical isolates of Histoplasma capsulatum that is based on analysis of mitochondrial DNA (mtDNA) and ribosomal DNA (rDNA). Strains were initially divided into mtDNA groups according to restriction digests of whole-cell DNA and Southern hybridization with cloned mtDNA probes. Strains within a mtDNA class could be further grouped by polymorphisms in rDNA. The majority of soil and clinical isolates from the United...

  9. Zn(2+)-ligation DNAzyme-driven enzymatic and nonenzymatic cascades for the amplified detection of DNA.

    Science.gov (United States)

    Lu, Chun-Hua; Wang, Fuan; Willner, Itamar

    2012-06-27

    A generic fluorescence sensing platform for analyzing DNA by the Zn(2+)-dependent ligation DNAzyme as amplifying biocatalyst is presented. The platform is based on the target DNA induced ligation of two substrate subunits and the subsequent opening of a beacon hairpin probe by the ligated product. The strand displacement of the ligated product by the beacon hairpin is, however, of limited efficiency. Two strategies are implemented to overcome this limitation. By one method, a "helper" nucleic acid sequence is introduced into the system, and this hybridizes with the DNAzyme components and releases the ligated product for opening of the hairpin. By the second method, a nicking enzyme (Nt.BspQI) is added to the system, and this nicks the duplex between the beacon and ligated product while recycling the free ligation product. By combining the two coadded components ("helper" sequence and nicking enzyme), the sensitive detection of the analyte is demonstrated (detection limit, 20 pM). The enzyme-free amplified fluorescence detection of the target DNA is further presented by the Zn(2+)-dependent ligation DNAzyme-driven activation of the Mg(2+)-dependent DNAzyme. According to this method, the Mg(2+)-dependent DNAzyme subunits displace the ligated product, and the resulting assembled DNAzyme cleaves a fluorophore/quencher-modified substrate to yield fluorescence. The method enabled the detection of the target DNA with a detection limit corresponding to 10 pM. The different sensing platforms are implemented to detect the Tay-Sachs genetic disorder mutant. PMID:22612395

  10. Genetic variation between susceptible and non-susceptible snails to Schistosoma infection using random amplified polymorphic DNA analysis (RAPDs Variação genética entre moluscos susceptíveis e não susceptíveis à infecção pelo Schistosoma através da análise do DNA polimórfico amplificado aleatóriamente (RAPDs

    Directory of Open Access Journals (Sweden)

    Abdel-Hamid Zaki ABDEL-HAMID

    1999-09-01

    Full Text Available Susceptibility of snails to infection by certain trematodes and their suitability as hosts for continued development has been a bewildering problem in host-parasite relationships. The present work emphasizes our interest in snail genetics to determine what genes or gene products are specifically responsible for susceptibility of snails to infection. High molecular weight DNA was extracted from both susceptible and non-susceptible snails within the same species Biomphalaria tenagophila. RAPD was undertaken to distinguish between the two types of snails. Random primers (10 mers were used to amplify the extracted DNA by the polymerase chain reaction (PCR followed by polyacrylamide gel electrophoresis (PAGE and silver staining. The results suggest that RAPD represents an efficient means of genome comparison, since many molecular markers were detected as genetic variations between susceptible and non-susceptible snails.A susceptibilidade de moluscos à infecção por certos trematódeos e a sua capacidade como hospedeiro para o contínuo desenvolvimento é o problema mais deslumbrante nas relações parasita hospedeiro. O presente trabalho, focaliza nosso interesse na genética dos moluscos para determinar quais genes ou produtos gênicos são especificamente responsáveis pela susceptibilidade do molusco à infecção. DNA de alto peso molecular, foi extraído de ambos moluscos susceptíveis e não susceptíveis da espécie Biomphalaria tenagophila. Iniciadores aleatórios com 10 pares de bases foram usados na amplificação aleatória (RAPD de ambos os DNAs e análise por eletroforese em gel de poliacrilamida e coloração com prata. Os resultados mostram que a amplificação aleatória do DNA representa um eficiente caminho para a comparação dos genomas desde que marcadores moleculares foram detectados como variantes genéticos entre os moluscos susceptíveis e não susceptíveis.

  11. Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

    Science.gov (United States)

    The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

  12. Interference of Co-Amplified Nuclear Mitochondrial DNA Sequences on the Determination of Human mtDNA Heteroplasmy by Using the SURVEYOR Nuclease and the WAVE HS System

    OpenAIRE

    Yen, Hsiu-Chuan; Li, Shiue-Li; Hsu, Wei-Chien; Tang, Petrus

    2014-01-01

    High-sensitivity and high-throughput mutation detection techniques are useful for screening the homoplasmy or heteroplasmy status of mitochondrial DNA (mtDNA), but might be susceptible to interference from nuclear mitochondrial DNA sequences (NUMTs) co-amplified during polymerase chain reaction (PCR). In this study, we first evaluated the platform of SURVEYOR Nuclease digestion of heteroduplexed DNA followed by the detection of cleaved DNA by using the WAVE HS System (SN/WAVE-HS) for detectin...

  13. The use of linked DNA polymorphisms for genotype prediction in families with Duchenne muscular dystrophy.

    OpenAIRE

    Harper, P S; O'Brien, T.; Murray, J M; Davies, K. E.; Pearson, P; Williamson, R

    1983-01-01

    Two DNA restriction fragment length polymorphisms show genetic linkage to the Duchenne muscular dystrophy locus on the short arm of the X chromosome. Examples are given of families in which these polymorphisms can be used in the prediction of genotype for this disorder.

  14. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. (Mount Sinai School of Medicine, New York, NY (United States))

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  15. Mitochondrial DNA polymorphisms in Khoisan populations from southern Africa.

    Science.gov (United States)

    Soodyall, H; Jenkins, T

    1992-10-01

    Mitochondrial DNA (mtDNA) restriction fragment length polymorphisms (RFLPs) were investigated in 95 individuals, consisting of 49 San ('Bushmen') and 46 Nama ('Hottentot') individuals from Namibia, using the restriction enzymes HpaI, BamHI, HaeII, MspI, AvaII and HincII. Six of the eleven types found in the pooled Khoisan sample are shared, albeit at varying frequencies, suggesting that both the San and Nama have evolved from a recent common ancestor. However, San and Nama groups differ appreciably, in particular, type 3-2 (3-1-1-2-2-2) was found in 7/49 Sekele and 25/46 Nama (chi 2 [1] = 15.3, P = 9.17 x 10(-5)). In addition, type 4 makes up 42.8% of the types found in the San, and is not found in the Nama group. This suggests that the San and Nama have evolved along separate lineages, with little gene flow between them, following their proposed separation from a common Khoisan ancestor. Type 7-2 (3-1-1-1-1-2), most common in Negroid populations, is found at a higher frequency in the San (20.4%) than the Nama (6.5%), suggesting that miscegenation involving Negroid females and San males is more common than that between Negroid females and Nama men. The higher frequency of type 21-2 (2-1-1-1-2-2) in the Nama (13%) than in the San (4.1%), may be attributable to gene flow from the Dama into the Nama, consistent with the consequences of enslavement of the Dama by the Nama. PMID:1362872

  16. RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF PCR-AMPLIFIED NIFH SEQUENCES FROM WETLAND PLANT RHIZOSPHERE COMMUNITIES

    Science.gov (United States)

    We describe a method to assess the community structure of N2-fixing bacteria in the rhizosphere. Total DNA was extracted from Spartina alterniflora and Sesbania macrocarpa root zones by bead-beating and purified by CsCl-EtBr gradient centrifugation. The average DNA yield was 5.5 ...

  17. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko; Baumgartner, Andreas; Wassenaar, Trudy M.; Wittwer, Matthias; Bissig-Choisat, Beatrice; Frey, Joachim

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping ba...

  18. Identification and molecular epidemiology of Campylobacter coli isolates from human gastroenteritis, food, and animal sources by amplified fragment length polymorphism analysis and Penner serotyping

    DEFF Research Database (Denmark)

    Siemer, B.L.; Nielsen, Elsa; On, Stephan L.w.

    2005-01-01

    Campylobacter coli is an infrequently studied but important food-borne pathogen with a wide natural distribution. We investigated its molecular epidemiology by use of amplified fragment length polymorphism (AFLP)-based genotyping and Penner serotyping. Serotype reference strains and 177 Danish is...

  19. Initial determination of DNA polymorphism of some Primula veris L. populations from Kosovo and Austria

    OpenAIRE

    Berisha, Naim; Millaku, Fadil; Gashi, Bekim; Krasniqi, Elez; Novak, Johannes

    2014-01-01

    Primula veris L. (Primulaceae) is a long lived perennial and well known pharmaceutical plant, widely collected for these reasons in almost all SE Europe and particularly in Kosovo. The aim of the study is to determine molecular polymorphism of cowslip (P. veris L.) populations from Kosovo. DNA extracted from leaves were  investigated in details for presence of polymorphism. RAPD analyses were conducted using 20 different short primers. Genomic DNA amplification profiles were analyzed and proc...

  20. DNA Repair Gene Polymorphisms May Be Associated with Prognosis of Upper Urinary Tract Transitional Cell Carcinoma

    OpenAIRE

    Miwa Sasaki; Shigeru Sakano; Naoko Okayama; Jumpei Akao; Tomohiko Hara; Yoshihisa Kawai; Chietaka Ohmi; Yuji Hinoda; Katsusuke Naito

    2008-01-01

    Upper urinary tract transitional cell carcinoma (UUT-TCC) is quite an uncommon disease, and its prognosis differs among individuals irrespective of tumor stage. DNA repair gene polymorphisms are reported to result in the modulation of the repair capacity and might influence the prognosis of UUT-TCC. We examined the associations between functional polymorphisms in five DNA repair genes, and the prognosis of UUT-TCC in 103 UUT-TCC patients. Variant alleles in xeroderma pigmentosum complementati...

  1. Mitochondrial DNA Variability in Populations of Alectoris rufa: A Single-Stranded Conformation Polymorphism (SSCP Approach.

    Directory of Open Access Journals (Sweden)

    Martínez-Fresno, M.

    2006-06-01

    Full Text Available A variable domain of the mitochondrial DNA of the red-legged partridge Alectoris rufa was analysed by single-stranded DNA polymorphism (SSCP, in animals of different populations. Ten mitochondrial types were detected unevenly distributed among samples. A preserved natural population in Northern Spain, Fuentes Carrionas, showed the highest degree of polymorphism. Farm bred animals seem to be less variable and show some genotypes not usually found in the natural sites, suggesting an alien origin of many breeders.

  2. Comparison of detection platforms and post-polymerase chain reaction DNA purification methods for use in conjunction with Cleavase fragment length polymorphism analysis.

    Science.gov (United States)

    Sander, T; Olson, S; Hall, J; Siebert, M; Grooms, K; Heisler, L; de Arruda, M; Neri, B

    1999-06-01

    The removal of impurities and contaminants from PCR-amplified fragments is important for mutation detection methods which identify mutations based on shifts in electrophoretic mobility. This is particularly critical for assays and detection methods which use target DNA that is labeled prior to analysis and electrophoretic detection. We examined several procedures for purifying DNA amplified by the polymerase chain reaction (PCR) and their use in conjunction with a novel DNA scanning method, the Cleavase fragment length polymorphism (CFLP)* assay. In this study, a 480 bp DNA fragment, fluorescently labeled on the 5'-end of one strand, was amplified and subjected to various widely used purification procedures, including several commercially available clean-up kits. We demonstrate that visualization of the fluorescent label, as opposed to simple ethidium bromide staining, reveals the presence of considerable levels of labeled, truncated, amplification products. The various procedures were evaluated on the basis of their ability to remove these unwanted DNA fragments as well as on the degree to which they inhibited or promoted the CFLP reaction. Several procedures are recommended for use with CFLP analysis, including isopropanol precipitation, gel excision, and several commercially available spin columns. Concurrently, we evaluated (compared) a number of commonly used visualization platforms, including fluorescence imaging, chemiluminescence, and post-electrophoretic staining, for the ability to detect CFLP pattern changes. The advantages and disadvantages of different methods are discussed and amounts of DNA to be used for CFLP analysis on different detection platforms are recommended. PMID:10380752

  3. Polymorphic DNA sequences and their application in paternity testing; Polimorficzne sekwencje DNA i ich zastosowanie w dochodzeniu spornego ojcostwa

    Energy Technology Data Exchange (ETDEWEB)

    Slomski, R. [Polska Akademia Nauk, Poznan (Poland). Zaklad Genetyki Czlowieka]|[Akademia Rolnicza, Poznan (Poland)]|[Laboratorium Genetyki Molekularnej, Poznan (Poland); Kwiatkowska, J.; Chlebowska, H. [Polska Akademia Nauk, Poznan (Poland). Zaklad Genetyki Czlowieka; Siemieniallo, B. [Akademia Rolnicza, Poznan (Poland); Slomska, M. [Laboratorium Genetyki Molekularnej, Poznan (Poland)

    1994-12-31

    Characteristics of polymorphic sequences of DNA, especially satellite, mini satellite and micro satellite sequences are presented. Own experience from the use of multi and single locus analysis of DNA in paternity testing has been compared with the results of research in other laboratories. Critical points of both types of analysis are discussed. (author). 53 refs, 4 figs, 2 tabs.

  4. Sequence related amplified polymorphism (SRAP) reaction system optimization and its application

    Institute of Scientific and Technical Information of China (English)

    Li Li

    2006-01-01

    In this study, three methods such as CTAB,SDS and Shanlichun methods were used to extract genomic DNA from the seedling of rape to find the best method. The principle, characters and application of SRAP were introduced. In order to obtain the optimal SRAP reaction system, the factors including concentrations of DNA, dNTP, etc. of reaction system were modified to better the system of rape. The result showed that the optimum concentrations were15ng DNA template, 0.2mM dNTP, 1.0μM primer and 2.0U Taq enzyme in this 25μL SRAP-PCR system.

  5. Characterization of Nomuraea rileyi strains using polymorphic DNA, virulence and enzyme activity

    Directory of Open Access Journals (Sweden)

    Vargas Lúcia Rosane Bertholdo

    2003-01-01

    Full Text Available The characterization of entomopathogenic microorganisms is important for the selection of more effective strains for use in integrated pest-control programs. Five Nomuraea rileyi strains (SA86101, GU87401, SR86151, CG128 and VA9101 were characterized using random amplified polymorphic DNA (RAPD analysis, virulence studies and assessment of chitinolytic and proteolytic activity. RAPD analysis divided the strains into two groups with a similarity coefficient of 0,76%, group 1 consisting of strains SA86101, GU87401 and SR86151 and group 2 of strains CG128 and VA9101. The LT50 varied from 165h with strain VA9101 to 246h with strain GU87401. Chitinolytic and proteolytic activity of the fungi after 144h growth in minimal medium were tested using colloidal chitin as substrate. All strains exhibited enzyme activity, with strain VA9101 having the highest chitinase activity (0,0040 mumol/mL/min the 40ºC and strain SA86101 the highest proteolytic activity. No relationship was found between RAPD analysis, virulence and chitinase or protease activity.

  6. A simple and rapid method for HLA-DQA1 genotyping by digestion of PCR-amplified DNA with allele specific restriction endonucleases.

    Science.gov (United States)

    Maeda, M; Murayama, N; Ishii, H; Uryu, N; Ota, M; Tsuji, K; Inoko, H

    1989-11-01

    The second exon of the HLA-DQA1 genes was selectively amplified from genomic DNAs of 72 HLA-homozygous B cell lines by the polymerase chain reaction (PCR). Amplified DNAs were digested with HaeIII, Ddel, ScrFI, FokI and RsaI, which recognize allelic sequence variations in the polymorphic segments of the DQA1 second exon, and then subjected to electrophoresis in polyacrylamide gels. Eight different polymorphic patterns of restriction fragments were obtained, and seven were identical to patterns predicted from the known DNA sequences, correlating with each HLA-DQw type defined by serological typing. The remaining one pattern cannot be explained from the sequence data, suggesting the presence of a novel DQA1 allele at the nucleotide level. This PCR-RFLP method provides a simple and rapid technique for accurate definition of the HLA-DQ types at the nucleotide level, eliminating the need for radioisotope as well as allele specific oligonucleotide probes and can be extended and applied to HLA-DR, -Dw DP typing. PMID:2576477

  7. Nanoparticle-based detection and quantification of DNA with single nucleotide polymorphism (SNP) discrimination selectivity

    OpenAIRE

    Qin, Wei Jie; Yung, Lin Yue Lanry

    2007-01-01

    Sequence-specific DNA detection is important in various biomedical applications such as gene expression profiling, disease diagnosis and treatment, drug discovery and forensic analysis. Here we report a gold nanoparticle-based method that allows DNA detection and quantification and is capable of single nucleotide polymorphism (SNP) discrimination. The precise quantification of single-stranded DNA is due to the formation of defined nanoparticle-DNA conjugate groupings in the presence of target...

  8. A novel, simplified technique to amplify Eimeria (Coccidia: Apicomplexa) DNA from oocysts.

    Science.gov (United States)

    Gerhold, R W; McDougald, L R; Beckstead, R B

    2015-02-01

    A new method to amplify coccidia DNA by polymerase chain reaction (PCR) was developed by placing freeze-thawed oocysts in Ready-to-Go PCR bead tubes and using a 5-min initial heat denaturation step. Positive PCR reactions were found in 3 of 3 samples containing 20 or 50 oocysts; when ≤5 oocysts were used, 1 of 3 samples was positive. This technique shows potential for effectively and efficiently detecting and identifying oocysts from soil, feces, and other matter. PMID:25019284

  9. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Silvia Sterpone

    2010-01-01

    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  10. Extensive variation in the density and distribution of DNA polymorphism in sorghum genomes.

    Directory of Open Access Journals (Sweden)

    Joseph Evans

    Full Text Available Sorghum genotypes currently used for grain production in the United States were developed from African landraces that were imported starting in the mid-to-late 19(th century. Farmers and plant breeders selected genotypes for grain production with reduced plant height, early flowering, increased grain yield, adaptation to drought, and improved resistance to lodging, diseases and pests. DNA polymorphisms that distinguish three historically important grain sorghum genotypes, BTx623, BTx642 and Tx7000, were characterized by genome sequencing, genotyping by sequencing, genetic mapping, and pedigree-based haplotype analysis. The distribution and density of DNA polymorphisms in the sequenced genomes varied widely, in part because the lines were derived through breeding and selection from diverse Kafir, Durra, and Caudatum race accessions. Genomic DNA spanning dw1 (SBI-09 and dw3 (SBI-07 had identical haplotypes due to selection for reduced height. Lower SNP density in genes located in pericentromeric regions compared with genes located in euchromatic regions is consistent with background selection in these regions of low recombination. SNP density was higher in euchromatic DNA and varied >100-fold in contiguous intervals that spanned up to 300 Kbp. The localized variation in DNA polymorphism density occurred throughout euchromatic regions where recombination is elevated, however, polymorphism density was not correlated with gene density or DNA methylation. Overall, sorghum chromosomes contain distal euchromatic regions characterized by extensive, localized variation in DNA polymorphism density, and large pericentromeric regions of low gene density, diversity, and recombination.

  11. RAPD analysis of alfalfa DNA mutation via N+ implantation

    Institute of Scientific and Technical Information of China (English)

    LI Yu-Feng; HUANG Qun-Ce; LIANG Yun-Zhang; YU Zeng-Liang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N+ implantation manifests oscillations goingdown with dose strength. From analyzing alfalfa genome DNA under low energy N+ implantation by RAPD (RandomAmplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primersin total 100 primers, and fluorescence intensity of the identical DNA fragments amplified by RAPD is different be-tween CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N+ im-plantation manifests going up with dose strength.

  12. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Germination capacity of alfalfa seeds under low energy N+ implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N+ implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N+ implantation manifests going up with dose strength

  13. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir;

    2008-01-01

    only one specific restriction enzyme (TspRI) is used. The cohesive ends of the DNA fragments are ligated with two types of oligonucleotide. A long oligonucleotide containing the primer site and the specific 9 nt 3 prime end, which is complementary to specific 9 nt, cohesive 3 prime end of the Tsp......RI genomic DNA fragment, and a short, degenerated, oligonucleotide covering the remaining TspRI cohesive ends. Other cohesive ends are covered by a short degenerated oligonucleotide lacking the primer site. The ligation mixture is used as a template for amplification using a single primer corresponding to...... for differentiation of the organisms without previous knowledge of their DNA sequence. The usefulness of the method is confirmed by genotyping of 70 previously characterized clinical E. coli isolates. The grouping obtained was identical to the results of REA-PFGE. Versatility of the method is...

  14. Multiplex SNP analysis on whole genome amplified DNA from archived dried bloodspots, a validation study

    DEFF Research Database (Denmark)

    Tvedegaard, Kristine C.; Parner, Erik; Hooper, Craig W.;

    Multiplex SNP analysis on whole genome amplified DNA from archived dried bloodspots, a validation study Kristine C. Tvedegaard,1 Erik Parner,1 Craig W. Hooper,2 Jørn Atterman,1 Niels Gregersen3, Poul Thorsen,1 1Institute of Public Health, NANEA at Department of Epidemiology, University of Aarhus...... further development of allele specific primer extension (ASPE) for multiplex SNP analysis based on the Luminex 100 IS platform. It uses isobases (isoC and isoG) and the software MultiCode-PLx platform for data analysis and data handling. We validate the EraGen multicode system in two 6-plex assays used on.......3-100%, repeatability ranged from 99.2-99.7% and robustness ranged from 94.1-99.3%. CONCLUSION: The Multi-Code System is a highly sensitive and specific method for multiplex SNP analysis on WGA DNA from archived dried bloodspots....

  15. Optimization of PCR conditions to amplify microsatellite loci in the bunchgrass lizard (Sceloporus slevini genomic DNA

    Directory of Open Access Journals (Sweden)

    d'Orgeix Christian A

    2011-01-01

    Full Text Available Abstract Background Microsatellites, also called Simple Sequence Repeats (SSRs, repetitions of nucleotide motifs of 1-5 bases, are currently the markers of choice due to their abundant distribution in the genomes, and suitability for high-throughput analysis. A total of five different primer pairs were optimized for polymerase chain reaction (PCR to amplify microsatellite loci in total genomic DNA of bunchgrass lizards (Sceloporus slevini collected from three sites in southeastern Arizona; the Sonoita Plain, Chiricahua Mountains and Huachuca Mountains. Findings The primers used for current investigation were originally designed for the Eastern Fence Lizard (Sceloporus undulatus. Five primer pairs were selected based on annealing temperatures for optimizing the PCR conditions to amplify with bunchgrass lizards. Different concentrations of DNA and annealing temperature were optimized. While keeping other reagents constant, a DNA concentration, 37.5 ng in the final reaction volume and PCR conditions of an initial denaturation of 94°C for five minutes, an annealing temperature of 55°C and final extension of 72°C for four minutes gave the best amplification for all the primer pairs. Conclusions Modifying the standard protocol for annealing temperatures and final extension time increases the success of cross amplification of specific microsatellite loci in the bunchgrass lizard. A loading volume of 5 ul DNA at a concentration of 10 ng/ul and a 2% agarose for gel electrophoresis were observed the best for cross amplification of selected five primer pairs on bunch grass lizard. Trial Registration The research was conducted with Arizona Game and Fish Department scientific collecting permits SP565256, SP657407 & SP749119 to Dr. Christian A d'Orgeix.

  16. Analysis of Single Nucleotide Polymorphism Panels for Bovine DNA Identification

    OpenAIRE

    Blanchard, Kimberly A.

    2013-01-01

    Single nucleotide polymorphisms (SNPs) are single base-pair variations that exist between individuals. There are approximately a million or more SNPs located throughout the genome of each individual animal. Therefore, by taking advantage of these unique polymorphisms, SNPs can be used to resolve questions of unknown parentage in the livestock industry. Currently a panel of 88 SNPs, obtained from a panel of 121 SNPs originally created by USDA-MARC, is commercially available from Fluidigm®. The...

  17. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    Directory of Open Access Journals (Sweden)

    Hellman Asaf

    2010-05-01

    Full Text Available Abstract Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters, but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome.

  18. Development of fluorescent amplified fragment length polymorphism for Streptococcus suis%猪链球菌荧光DNA扩增片段长度多态性检测方法的建立

    Institute of Scientific and Technical Information of China (English)

    王楷成; Linda van der Graaf; 陆承平; 黄保续; 范伟兴

    2012-01-01

    The fluorescent amplified fragment length for Streptococcus suis was developed using 2 pairs of primers.51 to 98 fragments of highly polymorphic products were obtained by 2 pairs of primers in 12 Streptococcus suis isolates.The fluorescent amplified fragment length technique can be used to detect the DNA polymorphism of Streptococcus suis.Different serotypes or different isolates of the same serotype in Streptococcus suis can be distinguished by the method.It is available in identification or tracking for Streptococcus suis strains.%利用荧光标记技术,采用2对引物初步建立检测猪链球菌荧光DNA扩增片段长度多态性方法,结果表明12株猪链球菌扩增的多态性位点数从51~98条不等,该方法能够检测猪链球菌的多态性,区分不同血清型以及同一血清型不同特性的菌株,可用于菌株鉴定及流行病学研究中细菌源的追踪。

  19. Gene–environment interactions between DNA repair polymorphisms and exposure to the carcinogen vinyl chloride

    OpenAIRE

    Li, Yongliang; Marion, Marie-Jeanne; Zipprich, Jennifer; Santella, Regina M.; Freyer, Greg; Brandt-Rauf, Paul W.

    2009-01-01

    We have recently suggested that polymorphisms in metabolism and repair pathways may play a role in modulating the effects of exposure to the carcinogen vinyl chloride in the production of biomarkers of its mutagenic damage. The aim of the present study was to extend these observations by examining gene–environment interactions between several common polymorphisms in the DNA repair genes XRCC1 and ERCC2/XPD and vinyl chloride exposure on the production of vinyl chloride-induced biomarkers of m...

  20. Specific Detection of Peronospora tabacina by PCR-amplified rDNA Sequences

    OpenAIRE

    Jwu-Guh Tsay; Chishih Chu; Ya-Han Chuang; Ruey-Shyang Chen

    2006-01-01

    Peronospora tabacina Adam, a downy mildew fungus, is a devastating disease of tobacco and a pathogen of import prohibition in Taiwan. For quarantine purpose, we developed a nested PCR method to detect this pathogen. With universal primer pair ITS1/ITS4, internal transcribed spacer (ITS) region of pathogen`s rDNA was amplified. Specific PCR primers (PT1/PT2) were designed based on ITS sequence and used to amplify a 493-bp rDNA fragments from P. tabacina. In order to increase the sensitivity, a...

  1. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  2. Association Between Polymorphisms of DNA Repair Gene XRCC1 and DNA Damage in Asbestos-Exposed Workers

    Institute of Scientific and Technical Information of China (English)

    XIAO-HONG ZHAO; GUANG JIA; YONG-QUAN LIU; SHAO-WEI LIU; LEI YAN; YU JIN; NIAN LIU

    2006-01-01

    Objective To compare the asbestos-induced DNA damage and repair capacities of DNA damage between 104 asbestos exposed workers and 101 control workers in Qingdao City of China and to investigate the possible association between polymorphisms in codon 399 of XRCC1 and susceptibility to asbestosis. Methods DNA damage levels in peripheral bloodlymphocytes were determined by comet assay, and XRCC 1 genetic polymorphisms of DNA samples from 51 asbestosis cases and 53 non-asbestosis workers with a similar asbestos exposure history were analyzed by PCR/RFLP. Results The basal comet scores (3.95±2.95) were significantly higher in asbestos-exposed workers than in control workers (0.10±0.28). After 1 h H2O2 stimulation, DNA damage of lymphocytes exhibited different increases. After a 4 h repair period, the comet scores were 50.98±19.53 in asbestos-exposed workers and 18.32±12.04 in controls. The residual DNA damage (RD) was significantly greater (P<0.01) in asbestos-exposed workers (35.62%) than in controls (27.75%). XRCC1 genetic polymorphism in 104 asbestos-exposed workers was not associated with increased risk of asbestosis. But compared with polymorphisms in the DNA repair gene XRCC1 (polymorphisms in codon 399) and the DNA damage induced by asbestos, the comet scores in asbestosis cases with Gln/Gln, Gln/Arg, and Arg/Arg were 40.26±18.94, 38.03±28.22, and 32.01±11.65, respectively, which were higher than those in non-asbestosis workers with the same genotypes (25.58±11.08, 37.08±14.74, and 29.38±10.15). There were significant differences in the comet scores between asbestosis cases and non-asbestosis workers with Gln/Gln by Student's t-test (P<0.05 or 0.01). The comet scores were higher in asbestosis workers with Gln/Gln than in those with Arg/Arg and in non-asbestosis workers exposed to asbestos, but without statistically significant difference. Conclusions Exposure to asbestos may be related to DNA damage or the capacity of cells to repair H2O2-induced

  3. Mitochondrial DNA hypervariable region 1 polymorphism in Singapore Chinese population.

    Science.gov (United States)

    Shee, Cheng-Yap; Chong, Michelle S M; Ng, Irene; Chia, Tet-Fatt

    2005-03-01

    Sequence polymorphisms of hypervariable region 1 were analyzed in 100 unrelated Singaporean Chinese. Ninety-five different haplotypes resulting from 113 variable sites were found between nucleotide positions 16045 and 16364. Single nucleotide polymorphism at nucleotide positions 16223, 16045, 16129, 16362 and 16189 was amongst the five highest frequencies observed in the sequences, whilst the most frequent haplotype was 16045-16223. Based on polymorphic sites observed at HV1, haplogroups A, F1a, M7b1, B5a and D4b were the most commonly observed clusters. The haplotype, nucleotide diversity and the average number of nucleotide differences were found to be 0.999, 0.028 and 9.082, respectively. The cytosine-stretch region located around nucleotide position 16189 was observed in 22% of this population sample. Transitions were found to be more predominant than transversions. PMID:15708338

  4. An association analysis between mitochondrial DNA A10398G polymorphism and temperament in Japanese young adults.

    Directory of Open Access Journals (Sweden)

    Kunihiro Kishida

    Full Text Available The mitochondrial (mt DNA C5178A and A10398G polymorphisms have been reported to be associated with mental disorders such as bipolar disorder. However, the effects of these polymorphisms on temperament in healthy people are poorly understood. Evaluating healthy subjects can have the advantage of providing new strategies for maintaining psychological health and preventing mental illness. We examined the association between mtDNA polymorphisms and temperament in Japanese students. There was no significant difference in examined temperament when analysed by genotypes, 5178-10398 haplotypes, or sex. The subgroup analysis based on sex indicated that there was an interactive effect of the mtDNA A10398G polymorphism and sex on anxiety and obsession. This finding is preliminary and cannot exclude the possibility of false-positive due to small sample size (144 subjects and multiple statistical testing. Further studies involving a larger sample size or other ethnic groups are necessary to confirm that mtDNA A10398G polymorphism can be a genetic factor for temperament.

  5. Sequence polymorphism of human mitochondrial DNA control region in Chinese Dongxiang unrelated individuals

    Institute of Scientific and Technical Information of China (English)

    LIU Xin-she; CHEN Teng; LI Sheng-bin

    2004-01-01

    Objective: To investigate the mitochondrial DNA sequence polymorphism in Chinese Dongxiang ethnic group and to provide basic data used in ethnic origin investigation and forensic purpose. Methods: Genomic DNA was extracted from the whole blood of 100 unrelated individuals of Chinese Dongxiang ethnic group by standard Chelex-100 method.The sequence polymorphism was determined by PCR amplification and direct sequencing. Results: Eighty-two polymorphic sites were identified in mtDNA D-loop region 16 091 - 16 418 np, and 88 haplotypes were found. The genetic diversity was calculated to be 0.996 9, and the genetic identity was 0.013 2. Conclusion: There are some particular polymorphic sites in Chinese Dongxiang ethnic group, and these sites provide an important basis to investigate the origin of Dongxiang and the relationship between Dongxiang and other ethnic groups. The result also suggested that sequence polymorphism from 16 091 -16 418 np in human mitochondrial DNA control region can be an useful tool for forensic identity.

  6. Analysis of DNA methylation variation in wheat genetic background after alien chromatin introduction based on methylation-sensitive amplification polymorphism

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    During the process of alien germplasm introduced into wheat genome by chromosome engineering,extensive genetic variations of genome structure and gene expression in recipient could be induced.In this study,we performed GISH(genome in situ hybridization)and AFLP(amplified fragment length polymorphism) on wheat-rye chromosome transIocation lines and their parents to detect the identity in genomic structure of different translocation lines.The results showed that the genome primary structure variations were not obviously detected in different translocation lines except the same 1RS chromosome translocation.Methylation sensitive amplification polymorphism(MSAP)analyses on genomic DNA showed that the ratios of fully-methylated sites were significantly increased in translocation lines(CN12,20.15%;CN17,20.91%;CN18,22.42%),but the ratios of hemimethylated sites were significantly lowered(CN12,21.41%;CN17,23.43%;CN18,22.42%),whereas 16.37%were fully-methylated and 25.44%were hemimethylated in case of their wheat parent.Twenty-nine classes of methylation patterns were identified in a comparative assay of cytosine methylation patterns between wheat-rye translocation lines and their wheat parent,including 13 hypermethylation patterns(33.74%),9 demethylation patterns(22.76%)and 7 uncertain patterns(4.07%).In further sequence analysis,the alterations of methylation pattern affected both repetitive DNA sequences,such as retrotransposons and tandem repetitive sequences,and low-copy DNA.

  7. Polymorphisms in human DNA repair genes and head and neck squamous cell carcinoma

    Indian Academy of Sciences (India)

    Rim Khlifi; Ahmed Rebai; Amel Hamza-Chaffai

    2012-12-01

    Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and neck squamous cell carcinoma (HNSCC). Xeroderma pigmentosum group D (XPD) and X-ray repair cross-complementing proteins 1 (XRCC1) and 3 (XRCC3) genes are involved in DNA repair and were found to be associated with HNSCC in numerous studies. To establish our overall understanding of possible relationships between DNA repair gene polymorphisms and development of HNSCC, we surveyed the literature on epidemiological studies that assessed potential associations with HNSCC risk in terms of gene–environment interactions, genotype-induced functional defects in enzyme activity and/or protein expression, and the influence of ethnic origin on these associations.We conclude that large, well-designed studies of common polymorphisms in DNA repair genes are needed. Such studies may benefit from analysis of multiple genes or polymorphisms and from the consideration of relevant exposures that may influence the likelihood of HNSCC when DNA repair capacity is reduced.

  8. Coupling a DNA-Based Machine with Glucometer Readouts for Amplified Detection of Telomerase Activity in Cancer Cells

    OpenAIRE

    Wenjing Wang; Shan Huang; Jingjing Li; Kai Rui; Jian-Rong Zhang; Jun-Jie Zhu

    2016-01-01

    The strong correlation between cancer and telomerase activity has inspired the development of new strategies to evaluate telomerase activity. Here, a personal glucose meter (PGM) system that uses DNA-based machine amplification to detect telomerase in cancer cells is reported. In this assay, telomerase elongation products are amplified in the form of another type of product by a DNA-based machine. This process can only be activated by the hybridization of the extended telomerase substrate (TS...

  9. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  10. Random amplified polymorphisms between two South American subspecies of rattlesnakes (Crotalus durissus collilineatus and Crotalus durissus terrificus

    Directory of Open Access Journals (Sweden)

    Sergio Echeverrigaray

    2001-09-01

    Full Text Available The present work was made to determine the suitability of RAPD analysis for the identification of specimens of two subspecies of South American rattlesnakes (Crotalus durissus terrificus and Crotalus durissus collilineatus. The 11 arbitrary primer sequence tested amplified a total of 161 bands, of which 31% were polymorphics when compared with Crotalus specimens. The combining results from different primers allowed the identification of all the specimens under analysis. Several characteristic bands of each subspecies were identified. Dendrogram, based on RAPD markers, show three groups that corresponded to the subspecies of Crotalus, and to Bothrops jararaca specimen.O presente trabalho foi desenvolvido visando determinar a aplicabilidade da análise de RAPD na identificação de indivíduos pertencentes a duas sub-espécies de cascavéis sul-americanas (Crotalus durissus terrificus e Crotalus durissus collilineatus. As 11 sequências arbitrárias inicializadoras testadas nestes experimentos, amplificaram um total de 161 bandas, das quais 31% foram polimórficas na comparação entre espécimes de Cratalus. Os resultados combinados obtidos com as distintas sequências inicializadoras, permitiram a identificação de todos os indivíduos avaliados. Várias bandas características de cada sub-espécie foram identificadas. O dendrogama, baseado em marcaodres de RAPD, mostra tres grupos que correspondem às duas sub-espécies de Crotalus e ao especimen de Bothrops jararaca.

  11. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue.

    Science.gov (United States)

    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L.

    1997-01-01

    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molecules could be achieved by binding the DNA onto a silica column before further purification. Viral DNA sequences could be amplified by PCR in DNA extracted from routinely processed paraffin blocks from cases with clinically or morphologically suspected cytomegalovirus or Epstein-Barr virus infections. The PCR products were specified by a novel liquid hybridization assay called PCR-enzyme-linked immunosorbent assay. Using this assay, the time-consuming Southern hybridization could be replaced and the time requirement for the detection of PCR products could be reduced from 1 day to 4 hours. The assay system described here represents a reliable, sensitive, and specific method for the detection of viral DNA from paraffin-embedded tissue samples. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:9137080

  12. The quality of DNA recovered from the archival tissues of atomic bomb survivors is good enough for the single nucleotide polymorphism analysis in spite of the decade-long preservation in formalin

    International Nuclear Information System (INIS)

    It is well known that the yield of DNA recovered form tissues preserved in formalin is inversely proportional to the stored duration. How is the quality? We tested the quality of DNA from archival tissues of atomic-bomb survivors stored in formalin for decades with the parameters of gene amplification efficiency by a polymerase chain reaction. All of the DNA extracted from the tissues preserved in formalin for 30 years amplified the 54- and 61-base pairs of the DNA fragments successfully. The direct sequencing of the PCR products confirmed the accurate amplification of the target sequence. A further trial to amplify the longer sequence of 111 base pairs succeeded in 20% of the samples tested. From these results, we propose a new utility of archival samples for the analysis of single nucleotide sequence polymorphism of genes, no matter how long the samples have been preserved in formalin. (author)

  13. Association of DNA adducts and genetic polymorphisms with birth weight

    Czech Academy of Sciences Publication Activity Database

    Šrám, Radim; Binková, Blanka; Dejmek, Jan; Chvátalová, Irena; Solanský, I.; Topinka, Jan

    2006-01-01

    Roč. 608, - (2006), s. 121-128. ISSN 1383-5718 R&D Projects: GA MŽP SL/5/160/05; GA MŽP SL/740/5/03; GA MŽP(CZ) SI/340/2/00 Institutional research plan: CEZ:AV0Z50390512 Keywords : pregnancy outcomes * birth weight * genetic polymorphism Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 2.122, year: 2006

  14. Ten polymorphic microsatellite DNA markers for the platypus, Ornithorhynchus anatinus.

    Science.gov (United States)

    Kolomyjec, Stephen H; Grant, Tom R; Blair, David

    2008-09-01

    We identified and optimized 10 microsatellite loci for the platypus, Ornithorhynchus anatinus (Monotremata: Ornithorhynchidae), and screened 21 individuals from the southern tablelands area of New South Wales, Australia. Each polymorphic locus possessed between two and 12 alleles with observed heterozygosities between 0.118 and 0.950. The intent of this effort was to provide informative loci for studies on the population genetics of this species. PMID:21585993

  15. The specific mitochondrial DNA polymorphism found in Klinefelter's syndrome.

    Science.gov (United States)

    Oikawa, Haruna; Tun, Zaw; Young, David R; Ozawa, Hiroyasu; Yamazaki, Kentaro; Tanaka, Einosuke; Honda, Katsuya

    2002-09-20

    Hypervariable segments of mitochondrial DNA (mtDNA) (HV1 and HV2) were analyzed in Klinefelter's syndrome and compared to normal population data. One pair of samples consisting of a Japanese mother and affected son with Klinefelter's syndrome (involved in a criminal case), and seven unrelated DNA samples from Caucasian Klinefelter males (two involved in criminal cases and five diagnosed) were collected in Japan and the United States. The diagnosis of Klinefelter's syndrome was established previously by multiplex XY-STR typing detecting two X alleles and one Y allele in the samples. Haplotype analysis of the mtDNA sequence in Klinefelter males was found to be identical, unique, and specific, as it was not found in the normal population. Astonishingly, family data exhibited that the haplotype of the mtDNA in the son was apparently different from the mother's, suggesting that the mtDNA of Klinefelter male would not be inherited from mother to son. Our data indicate that possible interaction of the sex chromosome and the mtDNA exists, and suggests that the specific mtDNA haplotype could cause the abnormal cell to fertilize and reproduce itself. PMID:12237124

  16. Analysis of Significance of Unite Examination of AFP and DNA Polymorphism of P3 Promoter of IGF-ⅡGene

    Institute of Scientific and Technical Information of China (English)

    LUO Su; ZHANG Feng-chun; SUN Chang-jiang; LIU Cheng-bai; ZHUANG Jiang-xing; ZHANG Jin

    2004-01-01

    The DNA of P3 promoter region of IGF-Ⅱ gene was obtained by means of PCR technique. The examination of DNA polymorphism by restriction endonuclease BstE Ⅱ and the examination of AFP by bioluminescence immunoassay technique were carried out. The results have a significant difference(P<0.005). But the positive rate of AFP is higher than that of DNA polymorphism. The experimental result shows that the change of the DNA polymorphism of IGF-Ⅱis not the only carcinogenic factor. The suggested unite examination is the best method for the diagnosis of the primary hepatocellular carcinoma.

  17. Identification of mutations leading to the Lesch-Nyhan syndrome by automated direct DNA sequencing of in vitro amplified cDNA

    International Nuclear Information System (INIS)

    The Lesch-Nyhan (LN) syndrome is a severe X chromosome-linked disease that results from a deficiency of the purine salvage enzyme hypoxanthine phosphoribosyltransferase (HPRT). The mutations leading to the disease are heterogeneous and frequently arise as de novo events. The authors have identified nucleotide alterations in 15 independently arising HPRT-deficiency cases by direct DNA sequencing of in vitro amplified HPRT cDNA. They also demonstrate that the direct DNA sequence analysis can be automated, further simplifying the detection of new mutations at this locus. The mutations include DNA base substitutions, small DNA deletions, a single DNA base insertion, and errors in RNA splicing. The application of these procedures allows DNA diagnosis and carrier identification by the direct detection of the mutant alleles within individual families affected by LN

  18. Identification of mutations leading to the Lesch-Nyhan syndrome by automated direct DNA sequencing of in vitro amplified cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Gibbs, R.A. (Baylor College of Medicine, Houston, TX (USA)); Nguyen, Phinga (Howard Hughes Medical Institute, Houston, TX (USA)); McBride, L.J.; Koepf, S.M. (Applied Biosystems, Foster City, CA (USA)); Caskey, C.T. (Baylor College of Medicine, Houston, TX (USA) Howard Hughes Medical Institute, Houston, TX (USA))

    1989-03-01

    The Lesch-Nyhan (LN) syndrome is a severe X chromosome-linked disease that results from a deficiency of the purine salvage enzyme hypoxanthine phosphoribosyltransferase (HPRT). The mutations leading to the disease are heterogeneous and frequently arise as de novo events. The authors have identified nucleotide alterations in 15 independently arising HPRT-deficiency cases by direct DNA sequencing of in vitro amplified HPRT cDNA. They also demonstrate that the direct DNA sequence analysis can be automated, further simplifying the detection of new mutations at this locus. The mutations include DNA base substitutions, small DNA deletions, a single DNA base insertion, and errors in RNA splicing. The application of these procedures allows DNA diagnosis and carrier identification by the direct detection of the mutant alleles within individual families affected by LN.

  19. Mitochondrial DNA polymorphism reveals hidden heterogeneity within some Asian populations.

    OpenAIRE

    Chakraborty, R.

    1990-01-01

    Use of data on mtDNA morph distributions from six Asian populations has shown that the observed number of different mtDNA morphs is too large when compared with the number expected on the basis of the observed gene diversity in the mtDNA genome. This excess number of morphs mainly occurs through an excess of rare morphs, and this discrepancy is more pronounced in a pooled sample of five Asian populations. It is suggested that this discrepancy is probably due to internal heterogeneity in each ...

  20. Characterization of Sporothrix schenckii by random amplification of polymorphic DNA assay

    Institute of Scientific and Technical Information of China (English)

    刘晓明; 廉翠红; 金礼吉; 安利佳; 杨国玲; 林熙然

    2003-01-01

    Objectives To investigate the DNA polymorphism of Sporothrix schenckii (S.schenckii) and to find the relationship between DNA patterns and geographic areas and clinical manifestations. Method The total DNA was extracted with hexadecyltrimethyl-ammonium bromide. Random A mplification of Polymorphic DNA (RAPD) assay was used to study DNA typing of 24 strains of S.schenckii collected from different areas and isolated from di fferent clinical types. Results Of seven random primers used, three primers (OPAA11, OPD18 and OPB07) gave good reactions, the sequences of which were 5'-ACCCGACCTG-3', 5'-GAGAGCCAAC-3', 5 '-GGTGAC~GCAG-3' respectively. The RAPD patterns of the 24 isolates were not completely identical, showing certain degrees of hereditary variability. Differ ent isolates showed a common conserved DNA band with the same primer. Different clinical types showed different genotypes. Conclusion RAPD analysis is useful in DNA typing of S.schenckii, the DNA band type of which is related to geographic origin and Clinical manifestation.

  1. Identification of Thiobacillus ferrooxidans strains based on restriction fragment length polymorphism analysis of 16S rDNA.

    Science.gov (United States)

    Kamimura, K; Wakai, S; Sugio, T

    2001-01-01

    The 16S rDNA sequences from ten strains of Thiobacillus ferrooxidans were amplified by PCR. The products were compared by performing restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases Alu I, Hap II, Hha I, and Hae III. The RFLP patterns revealed that T. ferrooxidans could be distinguished from other iron- or sulphur-oxidizing bacteria such as T. thiooxidans NB1-3, T. caldus GO-1, Leptospirillum ferrooxidans and the marine iron-oxidizing bacterium strain KU2-11. The RFLP patterns obtained with Alu I, Hap II, and Hae III were the same for nine strains of T. ferrooxidans except for strain ATCC 13661. The RFLP patterns for strains NASF-1 and ATCC 13661 with Hha I were distinct from those for other T. ferrooxidans strains. The 16S rDNA sequence of T. ferrooxidans NASF-1 possessed an additional restriction site for Hha I. These results show that iron-oxidizing bacteria isolated from natural environments were rapidly identified as T. ferrooxidans by the method combining RFLP analysis with physiological analysis. PMID:11414499

  2. DNA polymorphisms in the Sahiwal breed of Zebu cattle revealed by synthetic oligonucleotide probes

    International Nuclear Information System (INIS)

    Genomic DNA of 15 randomly selected unrelated animals and from two sire families (11 animals) of the Sahiwal breed of Zebu cattle were investigated. Four oligonucleotide probes - (GTG)5, (TCC)5, (GT)8 and (GT)12 - were used on genomic DNA digested with restriction enzymes AluI, HinfI, MboI, EcoRI and HaeIII in different combinations. All four probes produced multiloci fingerprints with differing levels of polymorphisms. Total bands and shared bands in the fingerprints of each individual were in the range of 2.5 to 23.0 KB. Band number ranged from 9 to 17, with 0.48 average band sharing. Probes (GT)8, (GT)12 and (TCC)5 produced fingerprinting patterns of medium to low polymorphism, whereas probe (GTG)5 produced highly polymorphic patterns. Probe (GTG)5 in combination with the HaeIII enzyme was highly polymorphic with a heterozygosity level of 0.85, followed by (GT)8, (TCC)5 and (GT)12 with heterozygosity levels of 0.70, 0.65 and 0.30, respectively. Probe GTG5 or its complementary sequence CAC5 produced highly polymorphic fingerprints, indicating that the probe can be used for analysing population structure, parentage verification and identifying loci controlling quantitative traits and fertility status. (author)

  3. Analysis of DNA repair gene polymorphisms and survival in low-grade and anaplastic gliomas

    DEFF Research Database (Denmark)

    Berntsson, Shala Ghaderi; Wibom, Carl; Sjöström, Sara;

    2011-01-01

    The purpose of this study was to explore the variation in DNA repair genes in adults with WHO grade II and III gliomas and their relationship to patient survival. We analysed a total of 1,458 tagging single-nucleotide polymorphisms (SNPs) that were selected to cover DNA repair genes, in 81 grade II...... different DNA repair genes (ATM, NEIL1, NEIL2, ERCC6 and RPA4) which were associated with survival. Finally, these eight genetic variants were adjusted for treatment, malignancy grade, patient age and gender, leaving one variant, rs4253079, mapped to ERCC6, with a significant association to survival (OR 0...

  4. A Hybrid Semi-Digital Transimpedance Amplifier With Noise Cancellation Technique for Nanopore-Based DNA Sequencing.

    Science.gov (United States)

    Hsu, Chung-Lun; Jiang, Haowei; Venkatesh, A G; Hall, Drew A

    2015-10-01

    Over the past two decades, nanopores have been a promising technology for next generation deoxyribonucleic acid (DNA) sequencing. Here, we present a hybrid semi-digital transimpedance amplifier (HSD-TIA) to sense the minute current signatures introduced by single-stranded DNA (ssDNA) translocating through a nanopore, while discharging the baseline current using a semi-digital feedback loop. The amplifier achieves fast settling by adaptively tuning a DC compensation current when a step input is detected. A noise cancellation technique reduces the total input-referred current noise caused by the parasitic input capacitance. Measurement results show the performance of the amplifier with 31.6 M Ω mid-band gain, 950 kHz bandwidth, and 8.5 fA/ √Hz input-referred current noise, a 2× noise reduction due to the noise cancellation technique. The settling response is demonstrated by observing the insertion of a protein nanopore in a lipid bilayer. Using the nanopore, the HSD-TIA was able to measure ssDNA translocation events. PMID:26595927

  5. EVALUATION OF THE DNA POLYMORPHISM OF SIX VARIETIES OF CHENOPODIUM QUINOA WILLD, USING AFLP

    Directory of Open Access Journals (Sweden)

    Nolasco, Oscar

    2013-07-01

    Full Text Available The grain of Chenopodium quinoaWilld. (Quinua is important worldwide for its high nutritional value, being the principal source of proteins of the settlers of the Peruvian Bolivian altiplano. In the process of the care and maintenance of the species in the germplasm banks for quinua there have been programs developed to allow the evaluation of genetic variation to increase the quality of the grain, the resistance to diseases, and dryness tolerance and to modulate the content of saponins. A current question is to discriminate among the varieties using molecular sensitive technologies like the RAPDs, microsatellites, RFLP; our aim was to evaluate the polymorphism of six varieties of quinua using AFLP's technology (Amplified Fragment Length Polymorphism. Varieties of quinua: Quillahuaman INIA (Q, Mantaro (M, Hualhuas (H, Real Boliviana (B, Salcedo INIA(S and Illpa INIA(I, were evaluated in combinations of five pairs of primers using adapters for EcoRI and MseI to determine their polymorphisms. Our results found three combinations of major polymorphism E33/M60, E32/M48 and E32/M61, that we were able to discriminate against the variety Mantaro (M as a variety removed from the others of the southern Peruvian altiplano – Bolivian, according to UPGMAanalysis. This combination of primers also discriminate the varieties Illpa INIA and Salcedo INIA as being varieties obtained by crossings for genetic improvement.

  6. Four cleaved amplified polymorphic sequence (CAPS) markers for the detection of the Juglans ailantifolia chloroplast in putatively native J. cinerea populations.

    Science.gov (United States)

    McCleary, Tim S; Robichaud, Rodney L; Nuanes, Steve; Anagnostakis, Sandra L; Schlarbaum, Scott E; Romero-Severson, Jeanne

    2009-03-01

    Hybridization between butternut (Juglans cinerea), a forest tree native to eastern North America, and Japanese walnut (J. ailantifolia), a tree tolerant to the lethal fungal disease butternut canker, casts doubt on the genetic identity of the remaining butternuts. We report a diagnostic test to distinguish the J. cinerea chloroplast from the J. ailantifolia chloroplast using cleaved amplified polymorphic sequences resolvable in 1.5% agarose gels. J. ailantifolia maternal ancestry in naturally regenerated stands provides a site selection criterion for studies of introgression dynamics when the non-native parent and the hybrids tolerate a disease to which the native species is susceptible. PMID:21564682

  7. Mitochondrial DNA polymorphisms associated with longevity in the Turkish population.

    Science.gov (United States)

    Guney, Ozgur; Ak, Handan; Atay, Sevcan; Ozkaya, Ali Burak; Aydin, Hikmet Hakan

    2014-07-01

    The accumulation of mutations in mitochondrial DNA is a widely recognized mechanism for aging and age related diseases. However, studies indicate that some mutations could be beneficial to longevity by slowing down the function of the electron transport chain, reducing free radical production. In this study, we re-sequenced the entire mitochondrial DNA from 50 individuals and examined aging-related variations in the Turkish population. We evaluated sequence data by comparing whole SNP frequencies, individual SNP frequencies, the effect of SNPs, SNP accumulation in certain mtDNA regions and haplotype profiles between elderly and control groups. The frequency of total mitochondrial SNPs was significantly higher in nonagenarians than controls (p=0.0094). Furthermore, non-coding, synonymous and tRNA mutations were more prevalent in the 90+ group compared to controls (p=0.0001, pmutations in the D-loop region and genes encoding Complex I subunits (ND1-6) (pmutation frequency of Complex I genes in aged subjects (p<0.0001). Haplotype H was also significantly increased in the control group (p=0.0405). Overall, our findings support a role for mitochondrial genome variations and the functionality of oxidative phosphorylation in longevity. In this report, we sequenced the whole mtDNA of the Turkish population for the first time. PMID:24792352

  8. Concurrent genotyping of Helicobacter pylori virulence genes and human cytokine SNP sites using whole genome amplified DNA derived from minute amounts of gastric biopsy specimen DNA

    Directory of Open Access Journals (Sweden)

    Borch Kurt

    2008-10-01

    Full Text Available Abstract Background Bacterial and cellular genotyping is becoming increasingly important in the diagnosis of infectious diseases. However, difficulties in obtaining sufficient amount of bacterial and cellular DNA extracted from the same human biopsy specimens is often a limiting factor. In this study, total DNA (host and bacterial DNA was isolated from minute amounts of gastric biopsy specimens and amplified by means of whole genome amplification using the multiple displacement amplification (MDA technique. Subsequently, MDA-DNA was used for concurrent Helicobacter pylori and human host cellular DNA genotyping analysis using PCR-based methods. Results Total DNA was isolated from gastric biopsy specimens of 12 subjects with gastritis and 16 control subjects having a normal mucosa. The DNA was amplified using a multiple displacement amplification (MDA kit. Next, concurrent genotyping was performed using H. pylori-specific virulence gene PCR amplification assays, pyrosequencing of bacterial 16S rDNA and PCR characterisation of various host genes. This includes Interleukin 1-beta (IL1B and Interferon-gamma receptor (IFNGR1 SNP analysis, and Interleukin-1 receptor antagonist (IL1RN variable tandem repeats (VNTR in intron 2. Finally, regions of the vacA-gene were PCR amplified using M13-sequence tagged primers which allowed for direct DNA sequencing, omitting cloning of PCR amplicons. H. pylori specific multiplex PCR assays revealed the presence of H. pylori cagA and vacA genotypic variations in 11 of 12 gastritis biopsy specimens. Using pyrosequencing, 16S rDNA variable V3 region signatures of H. pylori were found in 11 of 12 individuals with gastritis, but in none of the control subjects. Similarly, IL1B and IFNGR1-SNP and IL1RN-VNTR patterns could be established in all individuals. Furthermore, sequencing of M13-sequence tagged vacA-PCR amplicons revealed the presence of highly diverse H. pylori vacA-s/i/m regions. Conclusion The PCR

  9. DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study

    Directory of Open Access Journals (Sweden)

    Raum Elke

    2011-10-01

    Full Text Available Abstract Background Recent studies have reported associations of DNA repair pathway gene variants and risk of various cancers and precancerous lesions, such as chronic atrophic gastritis (CAG. Methods A nested case-control study within the German population-based ESTHER cohort was conducted, including 533 CAG cases and 1054 controls. Polymorphisms in eleven DNA repair genes (APEX1, ERCC1, ERCC2/XPD, PARP1 and XRCC1, in CD3EAP/ASE-1 and PPP1R13L were analysed. Results No association was disclosed for any of the analysed polymorphisms. Nor did stratified analyses according to ages Conclusions The results of this large German case-control study do not reveal associations of DNA repair pathway polymorphisms and risk of CAG. On the basis of a large number of CAG cases, they do not support associations of DNA repair pathway SNPs with CAG risk, but suggest the need of larger studies to disclose or exclude potential weak associations, or of studies with full coverage of candidate genes.

  10. An OGG1 polymorphism is associated with mitochondrial DNA content in pesticide-exposed fruit growers

    International Nuclear Information System (INIS)

    Highlights: → Individuals experiencing pesticide exposure had greater mtDNA content. → OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers. → No association between MnSOD genotypes and mtDNA content was revealed in this study. -- Abstract: Exposure to pesticides has the capacity to cause mitochondrial dysfunction. An increase mitochondrial DNA (mtDNA) content has also been suggested to relate with DNA damaging agent. In mitochondria, the manganese superoxide dismutase (MnSOD) is a scavenger of reactive oxygen species, and the 8-oxoguanine DNA glycosylase (OGG1) is the major DNA glycosylase for the repair of 8-oxoG lesions. However, the alteration of mtDNA content elicited by pesticide exposure in people with genetic variations in MnSOD or OGG1 has not been investigated. In this study, the mitochondrial to nuclear DNA ratio was quantified in the peripheral blood of 120 fruit growers who experienced pesticide exposure and 106 unexposed controls by real-time quantitative polymerase chain reaction (real-time qPCR). Questionnaires were administered to obtain demographic data and occupational history. The MnSOD and OGG1 genotypes were identified by the PCR based restriction fragment length polymorphism analysis. After adjusting for confounding effects, multiple regression model revealed that subjects experiencing high or low pesticide exposure had a greater mtDNA content than that of controls. The OGG1 Ser-Ser genotype was also associated with an increased mtDNA content. No association between MnSOD genotype and mtDNA content was revealed. Thus, subjects experiencing pesticide exposure had greater mtDNA content and the OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers.

  11. ASSOCIATIONS BETWEEN POLYMORPHISMS IN DNA REPAIR GENES AND GLIOBLASTOMA

    OpenAIRE

    McKean-Cowdin, Roberta; Barnholtz-Sloan, Jill; Inskip, Peter; Ruder, Avima; Butler, MaryAnn; Rajaraman, Preetha; Razavi, Pedram; Patoka, Joe; Wiencke, John; Bondy, Melissa; Wrensch, Margaret

    2009-01-01

    A pooled analysis was conducted to examine the association between select variants in DNA repair genes and glioblastoma multiforme (GBM), the most common and deadliest form of adult brain tumors. Genetic data for approximately 1,000 GBM cases and 2,000 controls were combined from four centers in the United States that have conducted case-control studies of adult GBM including the National Cancer Institute, the National Institute for Occupational Safety and Health, the University of Texas M.D....

  12. Application of Mitochondrial DNA Polymorphism to Meloidogyne Molecular Population Biology

    OpenAIRE

    Hyman, B. C.; Whipple, L.E.

    1996-01-01

    Recent advances in molecular biology have enabled the genotyping of individual nematodes, facilitating the analysis of genetic variability within and among plant-pathogenic nematode isolates. This review first describes representative examples of how RFLP, RAPD, AFLP, and DNA sequence analysis have been employed to describe populations of several phytonematodes, including the pinewood, burrowing, root-knot, and cyst nematodes. The second portion of this paper evaluates the utility of a size-v...

  13. Molecular epidemiologic investigations of Mycoplasma gallisepticum conjunctivitis in songbirds by random amplified polymorphic DNA analyses.

    OpenAIRE

    Ley, D. H.; Berkhoff, J. E.; Levisohn, S.

    1997-01-01

    An ongoing outbreak of conjunctivitis in free-ranging house finches (Carpodacus mexicanus) began in 1994 in the eastern United States. Bacterial organisms identified as Mycoplasma gallisepticum (MG) were isolated from lesions of infected birds. MG was also isolated from a blue jay (Cyanocitta cristata) that contracted conjunctivitis after being housed in a cage previously occupied by house finches with conjunctivitis, and from free-ranging American goldfinches (Carduelis tristis) in North Car...

  14. Molecular Characterization of Some Turkish Olive Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers

    OpenAIRE

    Kaya, Ergün; YILMAZ GÖKDOĞAN, Emel

    2015-01-01

    Olive (Olea europea L.) is one of the oldest cultivated plants characteristic in the Mediterranean area, where it is the most important oil-producing crop. The cultivated olive (O. europaea L. var. europaea) is propagated by cutting or grafting, whereas wild olive (O. europaea L. var. sylvestris) is reproduced from seeds. These two olive types are interfertile and have led to a large number of varieties. Morphological descriptions are not entirely reliable, due to numerous synonyms and homony...

  15. Random Amplified Polymorphic DNA (RAPD) for differentiation between Thai and Myanmar strains of Wuchereria bancrofti

    OpenAIRE

    Nuchprayoon, Surang; Junpee, Alisa; Poovorawan, Yong

    2007-01-01

    Background Lymphatic filariasis (LF) is a mosquito-borne disease caused by mosquito-transmitted filarial nematodes, including Wuchereria bancrofti and Brugia malayi. The Lymphatic Filariasis Elimination Program in Thailand has reduced the prevalence of nocturnally subperiodic W. bancrofti (Thai strain), mainly transmitted by the Ochlerotatus (Aedes) niveus group in Thailand to 0.57/100,000 population. However, it is estimated that more than one million Myanmar migrants with high prevalence of...

  16. Random Amplified Polymorphic DNA PCR in the Teaching of Molecular Epidemiology

    Science.gov (United States)

    Reinoso, Elina B.; Bettera, Susana G.

    2016-01-01

    In this article, we describe a basic practical laboratory designed for fifth-year undergraduate students of Microbiology as part of the Epidemiology course. This practice provides the students with the tools for molecular epidemiological analysis of pathogenic microorganisms using a rapid and simple PCR technique. The aim of this work was to assay…

  17. Random amplified polymorphic DNA PCR in the teaching of molecular epidemiology.

    Science.gov (United States)

    Reinoso, Elina B; Bettera, Susana G

    2016-07-01

    In this article, we describe a basic practical laboratory designed for fifth-year undergraduate students of Microbiology as part of the Epidemiology course. This practice provides the students with the tools for molecular epidemiological analysis of pathogenic microorganisms using a rapid and simple PCR technique. The aim of this work was to assay RAPD-PCR technique in order to infer possible epidemiological relationships. The activity gives students an appreciation of the value of applying a simple molecular biological method as RAPD-PCR to a discipline-specific question. It comprises a three-session laboratory module to genetically assay DNAs from strains isolated from a food outbreak. © 2016 by The International Union of Biochemistry and Molecular Biology, 44(4):391-396, 2016. PMID:26898662

  18. Ribo HRM--detection of inter- and intra-species polymorphisms within ribosomal DNA by high resolution melting analysis supported by application of artificial allelic standards.

    Science.gov (United States)

    Masny, Aleksander; Jagiełło, Agata; Płucienniczak, Grażyna; Golab, Elzbieta

    2012-09-01

    Ribo HRM, a single-tube PCR and high resolution melting (HRM) assay for detection of polymorphisms in the large subunit ribosomal DNA expansion segment V, was developed on a Trichinella model. Four Trichinella species: T. spiralis (isolates ISS3 and ISS160), T. nativa (isolates ISS10 and ISS70), T. britovi (isolates ISS2 and ISS392) and T. pseudospiralis (isolates ISS13 and ISS1348) were genotyped. Cloned allelic variants of the expansion segment V were used as standards to prepare reference HRM curves characteristic for single sequences and mixtures of several cloned sequences imitating allelic composition detected in Trichinella isolates. Using the primer pair Tsr1 and Trich1bi, it was possible to amplify a fragment of the ESV and detect PCR products obtained from the genomic DNA of pools of larvae belonging to the four investigated species: T. pseudospiralis, T. spiralis, T. britovi and T. nativa, in a single tube Real-Time PCR reaction. Differences in the shape of the HRM curves of Trichinella isolates suggested the presence of differences between examined isolates of T. nativa, T. britovi and T. pseudospiralis species. No differences were observed between T. spiralis isolates. The presence of polymorphisms within the amplified ESV sequence fragment of T. nativa T. britovi and T. pseudospiralis was confirmed by sequencing of the cloned PCR products. Novel sequences were discovered and deposited in GenBank (GenBank IDs: JN971020-JN971027, JN120902.1, JN120903.1, JN120904.1, JN120906.1, JN120905.1). Screening the ESV region of Trichinella for polymorphism is possible using the genotyping assay Ribo HRM at the current state of its development. The Ribo HRM assay could be useful in phylogenetic studies of the Trichinella genus. PMID:22766326

  19. Exploration of methods to identify polymorphisms associated with variation in DNA repair capacity phenotypes

    Energy Technology Data Exchange (ETDEWEB)

    Jones, I M; Thomas, C B; Xi, T; Mohrenweiser, H W; Nelson, D O

    2006-07-03

    Elucidating the relationship between polymorphic sequences and risk of common disease is a challenge. For example, although it is clear that variation in DNA repair genes is associated with familial cancer, aging and neurological disease, progress toward identifying polymorphisms associated with elevated risk of sporadic disease has been slow. This is partly due to the complexity of the genetic variation, the existence of large numbers of mostly low frequency variants and the contribution of many genes to variation in susceptibility. There has been limited development of methods to find associations between genotypes having many polymorphisms and pathway function or health outcome. We have explored several statistical methods for identifying polymorphisms associated with variation in DNA repair phenotypes. The model system used was 80 cell lines that had been resequenced to identify variation; 191 single nucleotide substitution polymorphisms (SNPs) are included, of which 172 are in 31 base excision repair pathway genes, 19 in 5 anti-oxidation genes, and DNA repair phenotypes based on single strand breaks measured by the alkaline Comet assay. Univariate analyses were of limited value in identifying SNPs associated with phenotype variation. Of the multivariable model selection methods tested: the easiest that provided reduced error of prediction of phenotype was simple counting of the variant alleles predicted to encode proteins with reduced activity, which led to a genotype including 52 SNPs; the best and most parsimonious model was achieved using a two-step analysis without regard to potential functional relevance: first SNPs were ranked by importance determined by Random Forests Regression (RFR), followed by cross-validation in a second round of RFR modeling that included ever more SNPs in declining order of importance. With this approach 6 SNPs were found to minimize prediction error. The results should encourage research into utilization of multivariate

  20. Forecast of the Heterosis of Imported Meat Sheep by Genetic Polymorphism of Microsatellite DNA

    Institute of Scientific and Technical Information of China (English)

    ZHANG Ying-jie; LIU Yue-qin; SUN Hong-xin; SUN Shao-hua; LI Yu

    2007-01-01

    Forecast of the heterosis of Small Tail Han sheep crossed with imported meat sheep by genetic polymorphism of microsatellite DNA was done in different sheep breeds. The gene frequency, the polymorphism information contents, the number of effective alleles, the heterozygosity, and the genetic distances were studied in four imported meat sheep and Small Tail Han sheep using five microsatellite loci. The crossing effects on the Small Tail Han sheep with four imported meat sheep were tested. The results indicate that there are genetic polymorphisms at five microsatellite loci in five sheep breeds. Five microsatellite loci can be used for genetic diversity evaluation in sheep breeds. The genetic variability of Dorset is the highest, and that of the Small Tail Han sheep is the lowest in the five sheep breeds. The order of heterosis from large to small in four imported meat sheep by the analysis of genetic relationship is White-Suffolk, Black-Suffolk,Dorset, and Texel. This accords with the testing results of actual heterosis. It is feasible to forecast the heterosis of Small Tail Han sheep crossed with imported meat sheep by genetic polymorphism of microsatellite DNA, which will have an important value for sheep breeding in the future.

  1. Mitochondrial DNA polymorphism A4917G is independently associated with age-related macular degeneration.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Canter

    Full Text Available The objective of this study was to determine if MTND2*LHON4917G (4917G, a specific non-synonymous polymorphism in the mitochondrial genome previously associated with neurodegenerative phenotypes, is associated with increased risk for age-related macular degeneration (AMD. A preliminary study of 393 individuals (293 cases and 100 controls ascertained at Vanderbilt revealed an increased occurrence of 4917G in cases compared to controls (15.4% vs.9.0%, p = 0.11. Since there was a significant age difference between cases and controls in this initial analysis, we extended the study by selecting Caucasian pairs matched at the exact age at examination. From the 1547 individuals in the Vanderbilt/Duke AMD population association study (including 157 in the preliminary study, we were able to match 560 (280 cases and 280 unaffected on exact age at examination. This study population was genotyped for 4917G plus specific AMD-associated nuclear genome polymorphisms in CFH, LOC387715 and ApoE. Following adjustment for the listed nuclear genome polymorphisms, 4917G independently predicts the presence of AMD (OR = 2.16, 95%CI 1.20-3.91, p = 0.01. In conclusion, a specific mitochondrial polymorphism previously implicated in other neurodegenerative phenotypes (4917G appears to convey risk for AMD independent of recently discovered nuclear DNA polymorphisms.

  2. DNA polymorphisms in chickpea accessions as revealed by PCR-based markers.

    Science.gov (United States)

    Yadav, P; Koul, K K; Shrivastava, N; Mendaki, M J; Bhagyawant, S S

    2015-01-01

    Chickpea is a food legume which is alleged to be a preferred source of protein next only to milk. Germplasm of cultivated chickpea available is deficient in desired genetic variation. Genetic manipulations therefore, necessitate the genetic exploitation of its related annual and wild species. 42 RAPD and 41 ISSR markers were employed to ascertain polymorphism across 20 genotypes which were collected from 10 different geographical areas of the world. RAPD marker detected 51% genetic polymorphisms while ISSR marker detected 54 %. With an average of 6.5 each RAPD primer amplified 5—8 bands. Similarly with an average of 7.9 each ISSR primer amplified 4—12 bands. The cluster dendrogram demonstrated a similarity coefficient range from 0.80 to 0.92 due to RAPD markers, whereas with ISSR primers the cluster dendrogram showed similarity coefficient of 0.60 to 1.00. Accessions from same geographical area seem to be genetically similar than those from geographically distant and isolated ones. When however compared, interestingly the ISSR dendrogram showed more correlation with pedigree data than the RAPD dendrogram. The variability index worked out in the present study ranges from 0.79 to 0.96. Since the ultimate reason for such studies is selection of diverse genetic accessions for their recommendation to breeding programmers, the accessions like ICC6263, ICC6306 and ICC17160 can be recommended as parents. Further breeding programmes can therefore be planned to procure additional variation complexes in chickpea genetic stocks. PMID:26516116

  3. Mitochondrial DNA polymorphism, sex ratio distorters and population genetics in the isopod Armadillidium vulgare.

    OpenAIRE

    Rigaud, T.; Bouchon, D; Souty-Grosset, C.; Raimond, R

    1999-01-01

    Two maternally inherited sex ratio distorters (SRD) impose female-biased sex ratios on the wood louse Armadillidium vulgare by feminizing putative males. These SRD are (i) an intracytoplasmic bacterium of the genus Wolbachia, and (ii) another non-Mendelian element of unknown nature: the f element. Mitochondrial DNA variation was investigated in A. vulgare field populations to trace the evolution of host-SRD relationships and to investigate the effect of SRD on host cytoplasmic polymorphism. T...

  4. Polymorphic DNA haplotypes at the phenlalanine hydroxylase (PAH) locus in Asian families with phenylketonuria (PKU)

    OpenAIRE

    Daiger, Stephen P.; Reed, Lori; Huang, Shu-Shen; Zeng, Yi-Tao; Wang, Tao; Lo, Wilson H. Y.; Okano, Yoshiyuki; Hase, Yutaka; Fukuda, Y; Oura, Toshiaki; Tada, Keiya; Woo, Savio L. C.

    1989-01-01

    DNA polymorphisms at the phenylalanine hydroxylase (PAH) locus have proved highly efiective in linkage diagnosis of phenylketonuria (PKU) in Caucasian families. More than 10 RFLP sites have been reported within the PAH structural locus in Caucasians. With information from affected and unaffected offspring in PKU families it is often possible to reconstruct complete RFLP haplotypes in parents and to use these haplotypes to follow the segregation of PKU within families and to determine the dist...

  5. DNA Repair Gene Polymorphisms May Be Associated with Prognosis of Upper Urinary Tract Transitional Cell Carcinoma1

    OpenAIRE

    SASAKI, Miwa; Sakano, Shigeru; Okayama, Naoko; Akao, Jumpei; Hara, Tomohiko; Kawai, Yoshihisa; Ohmi, Chietaka; Hinoda, Yuji; Naito, Katsusuke

    2008-01-01

    Upper urinary tract transitional cell carcinoma (UUT-TCC) is quite an uncommon disease, and its prognosis differs among individuals irrespective of tumor stage. DNA repair gene polymorphisms are reported to result in the modulation of the repair capacity and might influence the prognosis of UUT-TCC. We examined the associations between functional polymorphisms in five DNA repair genes, and the prognosis of UUT-TCC in 103 UUT-TCC patients. Variant alleles in xeroderma pigmentosum complementati...

  6. GST M1 Polymorphism Associates with DNA Oxidative Damage and Mortality among Hemodialysis Patients

    OpenAIRE

    Lin, Yi-Sheng; Hung, Szu-Chun; Wei, Yau-Huei; Tarng, Der-Cherng

    2009-01-01

    Leukocyte 8-hydroxy-2′-deoxyguanosine (8-OHdG) is a surrogate marker of oxidant-induced DNA damage in patients undergoing maintenance hemodialysis (MHD). Glutathione S-transferase M1 (GST M1) is a member of the GST family of proteins, which protect cellular DNA against oxidative damage. This study tested the association of a common GST M1 gene polymorphism [GST M1(−)], known to produce a dysfunctional enzyme, with levels of 8-OHdG in peripheral blood leukocytes and all-cause mortality among M...

  7. Polymorphic microsatellite DNA markers for the Florida manatee (Trichechus manatus latirostris)

    Science.gov (United States)

    Pause, K.C.; Nourisson, C.; Clark, A.; Kellogg, M.E.; Bonde, R.K.; McGuire, P.M.

    2007-01-01

    Florida manatees (Trichechus manatus latirostris) are marine mammals that inhabit the coastal waters and rivers of the southeastern USA, primarily Florida. Previous studies have shown that Florida manatees have low mitochondrial DNA variability, suggesting that nuclear DNA loci are necessary for discriminatory analyses. Here we report 10 polymorphic microsatellite loci with an average of 4.2 alleles per locus, and average heterozygosity of 50.1%. These loci have been developed for use in population studies, parentage assignment, and individual identification. ?? 2007 Blackwell Publishing Ltd.

  8. 4P: fast computing of population genetics statistics from large DNA polymorphism panels.

    Science.gov (United States)

    Benazzo, Andrea; Panziera, Alex; Bertorelle, Giorgio

    2015-01-01

    Massive DNA sequencing has significantly increased the amount of data available for population genetics and molecular ecology studies. However, the parallel computation of simple statistics within and between populations from large panels of polymorphic sites is not yet available, making the exploratory analyses of a set or subset of data a very laborious task. Here, we present 4P (parallel processing of polymorphism panels), a stand-alone software program for the rapid computation of genetic variation statistics (including the joint frequency spectrum) from millions of DNA variants in multiple individuals and multiple populations. It handles a standard input file format commonly used to store DNA variation from empirical or simulation experiments. The computational performance of 4P was evaluated using large SNP (single nucleotide polymorphism) datasets from human genomes or obtained by simulations. 4P was faster or much faster than other comparable programs, and the impact of parallel computing using multicore computers or servers was evident. 4P is a useful tool for biologists who need a simple and rapid computer program to run exploratory population genetics analyses in large panels of genomic data. It is also particularly suitable to analyze multiple data sets produced in simulation studies. Unix, Windows, and MacOs versions are provided, as well as the source code for easier pipeline implementations. PMID:25628874

  9. Polymorphisms in DNA Repair Genes and MDR1 and the Risk for Non-Hodgkin Lymphoma

    Directory of Open Access Journals (Sweden)

    Hee Nam Kim

    2014-04-01

    Full Text Available The damage caused by oxidative stress and exposure to cigarette smoke and alcohol necessitate DNA damage repair and transport by multidrug resistance-1 (MDR1. To explore the association between polymorphisms in these genes and non-Hodgkin lymphoma risk, we analyzed 15 polymorphisms of 12 genes in a population-based study in Korea (694 cases and 1700 controls. Four genotypes of DNA repair pathway genes (XRCC1 399 GA, OGG1 326 GG, BRCA1 871 TT, and WRN 787 TT were associated with a decreased risk for NHL [odds ratio (ORXRCC1 GA = 0.80, p = 0.02; OROGG1 GG = 0.70, p = 0.008; ORBRCA1 TT = 0.71, p = 0.048; ORWRN TT = 0.68, p = 0.01]. Conversely, the MGMT 115 CT genotype was associated with an increased risk for NHL (OR = 1.25, p = 0.04. In the MDR1 gene, the 1236 CC genotype was associated with a decreased risk for NHL (OR = 0.74, p = 0.04, and the 3435 CT and TT genotypes were associated with an increased risk (OR3435CT = 1.50, p < 0.0001; OR3435TT = 1.43, p = 0.02. These results suggest that polymorphisms in the DNA repair genes XRCC1, OGG1, BRCA1, WRN1, and MGMT and in the MDR1 gene may affect the risk for NHL in Korean patients.

  10. Carriage of a Tumor Necrosis Factor Polymorphism Amplifies the Cytotoxic T-Lymphocyte Antigen 4 Attributed Risk of Primary Biliary Cirrhosis: Evidence for a Gene–Gene Interaction

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Liu, Xiangdong; Heathcote, E. Jenny; Hirschfield, Gideon M.; Siminovitch, Katherine A.; Lazaridis, Konstantinos N.

    2010-01-01

    Common genetic variants significantly influence complex diseases such as primary biliary cirrhosis (PBC). We recently reported an association between PBC and a single nucleotide polymorphism (rs231725) of the immunoreceptor gene cytotoxic T-lymphocyte antigen 4 (CTLA4). We hypothesized that PBC risk attributed to this polymorphism might be increased by propensity to an overly robust inflammatory response. Thus, we examined its potential interaction with the commonly studied −308AG promoter polymorphism (rs1800629) of the tumor necrosis factor (TNF) gene for which the variant TNF2A allele causes increased TNF production. The polymorphisms were genotyped in 866 PBC patients and 761 controls from independent US and Canadian registries; the effects of individual single nucleotide polymorphisms (SNPs) and their interaction on PBC risk was assessed by logistic regression. The reported association of PBC with the CTLA4 “A/A” genotype was replicated in the Canadian cohort and significant for PBC risk in the combined data (odds ratio [OR], 1.68; P = 0.0005). TNF2A allele frequency was elevated in PBC patients, but only reached borderline significance using the combined data (OR, 1.21; P = 0.042). Analysis showed that TNF2A carriage was significantly increased in CTLA4 “A/A” PBC patients compared with CTLA4 “A/A” controls (39.7% versus 16.5%, P = 0.0004); no apparent increase of TNF2A carriage was noted in CTLA4 “A/G” or “G/G” individuals. Finally, interaction under a logistic model was highly significant, as TNF2A carriage in combination with the CTLA4 “A/A” genotype was present in 6.5% of PBC patients, compared with 1.7% of controls (OR, 3.98; P < 0.0001). Conclusion TNF2A amplifies the CTLA4 rs231725 “A/A” genotype risk for PBC. Although the mechanisms remain unclear, the premise that deficiency in T-cell regulation resulting in an increased risk of PBC is amplified by overexpression of an important proinflammatory cytokine provides a basis

  11. Dynamic Local Polymorphisms in the Gbx1 Homeodomain Induced by DNA Binding.

    Science.gov (United States)

    Proudfoot, Andrew; Geralt, Michael; Elsliger, Marc-Andre; Wilson, Ian A; Wüthrich, Kurt; Serrano, Pedro

    2016-08-01

    The Gastrulation Brain Homeobox 1 (Gbx1) gene encodes the Gbx1 homeodomain that targets TAATTA motifs in double-stranded DNA (dsDNA). Residues Glu17 and Arg52 in Gbx1 form a salt bridge, which is preserved in crystal structures and molecular dynamics simulations of homologous homeodomain-DNA complexes. In contrast, our nuclear magnetic resonance (NMR) studies show that DNA binding to Gbx1 induces dynamic local polymorphisms, which include breaking of the Glu17-Arg52 salt bridge. To study this interaction, we produced a variant with Glu17Arg and Arg52Glu mutations, which exhibited the same fold as the wild-type protein, but a 2-fold reduction in affinity for dsDNA. Analysis of the NMR structures of the Gbx1 homeodomain in the free form, the Gbx1[E17R,R52E] variant, and a Gbx1 homeodomain-DNA complex showed that stabilizing interactions of the Arg52 side chain with the DNA backbone are facilitated by transient breakage of the Glu17-Arg52 salt bridge in the DNA-bound Gbx1. PMID:27396829

  12. Assessing the fidelity of ancient DNA sequences amplified from nuclear genes

    DEFF Research Database (Denmark)

    Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.;

    2006-01-01

    To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved in...... phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... environments ranging from permafrost to desert, we demonstrate the presence of miscoding lesion damage in both the mtDNA and nuDNA, resulting in insertion of erroneous bases during amplification. Interestingly, no significant differences in the frequency of miscoding lesion damage are recorded between mtDNA...

  13. PAH-DNA adducts in environmentally exposed population in relation to metabolic and DNA repair genes polymorphisms

    Czech Academy of Sciences Publication Activity Database

    Binková, Blanka; Chvátalová, Irena; Lněničková, Zdena; Milcová, Alena; Tulupová, Elena; Farmer, P. B.; Šrám, Radim

    2007-01-01

    Roč. 620, - (2007), s. 49-61. ISSN 0027-5107 R&D Projects: GA MŽP SI/340/2/00; GA MŽP SL/740/5/03 Grant ostatní: EU(GB) 2000-00091 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : DNA adducts * genetic polymorphisms * metabolic genes Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.159, year: 2007

  14. Initial determination of DNA polymorphism of some Primula veris L. populations from Kosovo and Austria.

    Science.gov (United States)

    Berisha, Naim; Millaku, Fadil; Gashi, Bekim; Krasniqi, Elez; Novak, Johannes

    2015-01-01

    Primula veris L. (Primulaceae) is a long lived perennial and well known pharmaceutical plant, widely collected for these reasons in almost all SE Europe and particularly in Kosovo. The aim of the study is to determine molecular polymorphism of cowslip (P. veris L.) populations from Kosovo. DNA extracted from leaves were  investigated in details for presence of polymorphism. RAPD analyses were conducted using 20 different short primers. Genomic DNA amplification profiles were analyzed and processed using data labelling. Comparison between cowslip populations in genetic composition revealed that samples from Bogaj were too distinct on their own. Molecular variation was observed to be more within populations (73 %) as compared to among populations (27 %). On the other hand, genetic distance of populations revealed that the highest genetic distance is between Leqinat and Maja e Madhe. Mean values of expected heterozygosity were highest in Bogaj population, while lowest in Maja e Madhe population. The obtained results indicated that Bogaj population are more polymorphic. From the obtained data it can be concluded that RAPD markers provided a useful technique to study genetic diversity in P. veris L. populations. This technology allows identification and assessment of the genetic similarities and differences among plant populations. PMID:25650329

  15. DNA repair gene ERCC2 polymorphisms and associations with breast and ovarian cancer risk

    Directory of Open Access Journals (Sweden)

    Rabiau Nadège

    2008-05-01

    Full Text Available Abstract Breast and ovarian cancers increased in the last decades. Except rare cases with a genetic predisposition and high penetrance, these pathologies are viewed as a polygenic disease. In this concept, association studies look for genetic variations such as polymorphisms in low penetrance genes, i.e. genes in interaction with environmental factors. DNA repair systems that protect the genome from deleterious endogenous and exogenous damages have been shown to have significantly reduced. In particular, enzymes of the nucleotide excision repair pathway are suspected to be implicated in cancer. In this study, 2 functional polymorphisms in a DNA repair gene ERCC2 were analyzed. The population included 911 breast cancer cases, 51 ovarian cancer cases and 1000 controls. The genotyping of 2 SNP (Single Nucleotide Polymorphism was carried out on the population with the MGB (Minor Groove Binder probe technique which consists of the use of the allelic discrimination with the Taqman® method. This study enabled us to show an increase in risk of breast cancer with no oral contraceptive users and with women exhibiting a waist-to-hip ratio (WHR > 0.85 for Asn homozygous for ERCC2 312.

  16. Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility

    International Nuclear Information System (INIS)

    Genetic variations in DNA double-strand break repair genes can influence the ability of a cell to repair damaged DNA and alter an individual’s susceptibility to cancer. We studied whether polymorphisms in DNA double-strand break repair genes are associated with an increased risk of glioma development. We genotyped 10 potentially functional single nucleotide polymorphisms (SNPs) in 7 DNA double-strand break repair pathway genes (XRCC3, BRCA2, RAG1, XRCC5, LIG4, XRCC4 and ATM) in a case–control study including 384 glioma patients and 384 cancer-free controls in a Chinese Han population. Genotypes were determined using the OpenArray platform. In the single-locus analysis there was a significant association between gliomas and the LIG4 rs1805388 (Ex2 +54C>T, Thr9Ile) TT genotype (adjusted OR, 3.27; 95% CI, 1.87-5.71), as well as the TC genotype (adjusted OR, 1.62; 95% CI, 1.20-2.18). We also found that the homozygous variant genotype (GG) of XRCC4 rs1805377 (IVS7-1A>G, splice-site) was associated with a significantly increased risk of gliomas (OR, 1.77; 95% CI, 1.12-2.80). Interestingly, we detected a significant additive and multiplicative interaction effect between the LIG4 rs1805388 and XRCC4 rs1805377 polymorphisms with an increasing risk of gliomas. When we stratified our analysis by smoking status, LIG4 rs1805388 was associated with an increased glioma risk among smokers. These results indicate for the first time that LIG4 rs1805388 and XRCC4 rs1805377, alone or in combination, are associated with a risk of gliomas

  17. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  18. Sequence polymorphism of mitochondrial DNA in Japanese individuals from Gifu Prefecture.

    Science.gov (United States)

    Nagai, Atsushi; Nakamura, Isao; Shiraki, Futoru; Bunai, Yasuo; Ohya, Isao

    2003-03-01

    Sequence polymorphisms of the hypervariable region HV1 in mitochondrial DNA (mtDNA) were analyzed in a sample of 137 unrelated Japanese individuals living in Gifu Prefecture (central region of Japan) using polymerase chain reaction amplification and direct sequencing. Eighty-two different haplotypes resulting from 81 variable sites were found in the mtDNA HV1 region between positions 16061 and 16450. The most frequent haplotype (16223T, 16362C) was shared by ten individuals. The genetic diversity and the genetic identity were 0.985 and 0.022, respectively. The C-stretch region located around position 16189 was observed in 23.4% of this population sample. Sequence heteroplasmy at the position 16103 (A/G) was found in one individual. PMID:12935592

  19. 微卫星DNA多态性分析在常用近交系小鼠遗传监测中的应用研究%Microsatellite DNA Polymorphisms in Inbred Strain Mice and Selection as Genetic Monitoring Markers

    Institute of Scientific and Technical Information of China (English)

    欧阳兆和; 陈振文; 李瑞生; 战大伟

    2003-01-01

    The aim of genetic monitoring is to checking the genetic contamination within inbred starains, which insures that the strains according with the require of colony . At present the methods based on allozyme biochemistry are the National Standard instructed. methods that using microsatellite DNA would be more useful for genetic monitoring than methods based on allozyme biochemistry because the genome itself is being tested rather than a protein product and a larger portion of the genome can be sampled, and easy to distinguish. methods that using microsatellite DNA had abundant microsatellite loci(over 7300, before 1999) can be identified. Applying enough microsatellite loci will present abundant straps and well polymorphism, which can reflection inherit and variation of roundly genene. In addition, this novel approach allows the rapid, sensitive, convenientand accuracy, even individual identificaton. So we should select microsatellite DNA which is polymorphisms as genetic monitoring markers to determining the strains' origin and genetic background of inbred mice.Untill now Only feasibility has been reported, and in which microsatellite DNA loci have not enough polymorphisms to distinguish genetic differences. Articles on standards and practicality have not been founded in our country. With the optimization of components of reaction buffer and amplificaton parameter, PCR for amplification microsatellite DNA was finally set up. Using the techniques microsatellite DNA can amplified efficaciously. The final concentrations of Mg2+ was 1 . 5-3.0 mmol/L, annealing temperature was 50 ℃-65 ℃. The condition for the PCR amplify were , 94 ℃ for 3min, 30cycles of 94℃ for 30s, 50℃-65℃ for 30s,72℃ for 1min,finally at 72℃ for 1min,then store at 4℃.

  20. Sequence polymorphism of the mitochondrial DNA hypervariable regions I and II in 205 Singapore Malays.

    Science.gov (United States)

    Wong, Hang Yee; Tang, June S W; Budowle, Bruce; Allard, Marc W; Syn, Christopher K C; Tan-Siew, Wai Fun; Chow, Shui Tse

    2007-01-01

    Mitochondrial DNA sequences of the hypervariable regions HV1 and HV2 were analyzed in 205 unrelated ethnic Malays residing in Singapore as an initial effort to generate a database for forensic identification purposes. Sequence polymorphism was detected using PCR and direct sequencing analysis. A total of 152 haplotypes was found containing 152 polymorphisms. Out of the 152 haplotypes, 115 were observed only once and 37 types were seen in multiple individuals. The most common haplotype (16223T, 16295T, 16362C, 73G, 146C, 199C, 263G, and 315.1C) was shared by 7 (3.41%) individuals, two haplotypes were shared by 4 individuals, seven haplotypes were shared by 3 individuals, and 27 haplotypes by 2 individuals. Haplotype diversity and random match probability were estimated to be 0.9961% and 0.87%, respectively. PMID:17150401

  1. Dramatic changes in DNA Conductance with stretching: Structural Polymorphism at a critical extension

    CERN Document Server

    Bag, Saientan; Goddard, William A; Maiti, Prabal K

    2016-01-01

    In order to interpret recent experimental studies of the dependence of conductance of ds-DNA as the DNA is pulled from the 3'end1-3'end2 ends, which find a sharp conductance jump for a very short (4.5 %) stretching length, we carried out multiscale modeling, to predict the conductance of dsDNA as it is mechanically stretched to promote various structural polymorphisms. We calculate the current along the stretched DNA using a combination of molecular dynamics simulations, non-equilibrium pulling simulations, quantum mechanics calculations, and kinetic Monte Carlo simulations. For 5'end1-5'end2 attachments we find an abrupt jump in the current within a very short stretching length (6 $ \\AA $ or 17 %) leading to a melted DNA state. In contrast, for 3'end1-3'end2 pulling it takes almost 32$ \\AA $ (84 %) of stretching to cause a similar jump in the current. Thus, we demonstrate that charge transport in DNA can occur over stretching lengths of several nanometers. We find that this unexpected behaviour in the B to S...

  2. Ultrasensitive detection of single nucleotide polymorphism in human mitochondrial DNA utilizing ion-mediated cascade surface-enhanced Raman spectroscopy amplification.

    Science.gov (United States)

    Shi, Muling; Zheng, Jing; Tan, Yongjun; Tan, Guixiang; Li, Jishan; Li, Yinhui; Li, Xia; Zhou, Zhiguang; Yang, Ronghua

    2015-03-01

    Although surface-enhanced Raman spectroscopy (SERS) has been featured by high sensitivity, additional signal enhancement is still necessary for trace amount of biomolecules detection. In this paper, a SERS amplified approach, featuring "ions-mediated cascade amplification (IMCA)", was proposed by utilizing the dissolved silver ions (Ag(+)) from silver nanoparticles (AgNPs). We found that using Ag(+) as linkage agent can effectively control the gaps between neighboring 4-aminobenzenethiol (4-ABT) encoded gold nanoparticles (AuNPs@4-ABT) to form "hot spots" and thus produce SERS signal output, in which the SERS intensity was proportional to the concentration of Ag(+). Inspired by this finding, the IMCA was utilized for ultrasensitive detection of single nucleotide polymorphism in human mitochondrial DNA (16189T → C). Combining with the DNA ligase reaction, each target DNA binding event could successfully cause one AgNP introduction. By detecting the dissolved Ag(+) from AgNPs using IMCA, low to 3.0 × 10(-5) fm/μL targeted DNA can be detected, which corresponds to extractions from 200 nL cell suspension containing carcinoma pancreatic β-cell lines from diabetes patients. This IMCA approach is expected to be a universal strategy for ultrasensitive detection of analytes and supply valuable information for biomedical research and clinical early diagnosis. PMID:25622288

  3. MULTINDELS-BOV: Zebu traceback method based on DNA insertion-deletion polymorphisms.

    Science.gov (United States)

    Groenner-Penna, M; Croce, E F D; Pimenta, C G; Bicalho, H M S; Pena, S D J

    2014-01-01

    Brazil is a major producer and exporter of beef, with a herd of approximately 210 million animals. For the meat industry, a reliable animal traceback from its origin to the consumer market is paramount. Of all available identification systems, DNA is the only one that survives the slaughterhouse and reaches the dish of the consumer. DNA polymorphisms are already used for cattle traceback, but primarily for the subspecies Bos taurus taurus. However, in Brazil, another subspecies, B. taurus indicus predominates. We describe here the development of a DNA traceback method designed primarily for B. taurus indicus (Zebu), without leaving B. taurus taurus aside. We used insertion/deletion (indel) polymorphisms, which have the advantage of being simple and easily automatable, since in most cases, the variable loci are biallelic. We studied 94 indels, with a difference of two or more base pairs, in DNA pools of 60 Zebu and 60 taurine animals. A set of 22 indels with heterozygosity greater than 0.3 were selected and used to construct two multiplex PCRs. On the basis of the allelic frequency of these indels, the probability of random match was calculated to be 1.12 x 10(-8) for B. taurus indicus and 1.60 x 10(-6) for B. taurus taurus. Moreover, we estimated that an analysis would cost less than US$15.00 per animal. Thus, this system (MULTINDELS-BOV) is perfectly suited for building large genetic databases and offering viable prospects of a national system for cattle traceback DNA in Brazil. PMID:25501139

  4. Detection of Tannery Effluents Induced DNA Damage in Mung Bean by Use of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Abhay Raj; Sharad Kumar; Izharul Haq; Mahadeo Kumar

    2014-01-01

    Common effluent treatment plant (CETP) is employed for treatment of tannery effluent. However, the performance of CETP for reducing the genotoxic substances from the raw effluent is not known. In this study, phytotoxic and genotoxic effects of tannery effluents were investigated in mung bean (Vigna radiata (L.) Wilczek). For this purpose, untreated and treated tannery effluents were collected from CETP Unnao (UP), India. Seeds of mung bean were grown in soil irrigated with various concentrati...

  5. Analysis of the origin of Turner's syndrome using polymorphic DNA probes.

    OpenAIRE

    Loughlin, S A; Redha, A; McIver, J.; Boyd, E; Carothers, A.; Connor, J M

    1991-01-01

    Thirty-four families with a child or fetus with Turner's syndrome were studied using a series of polymorphic DNA probes. Analysis of the origin of the normal X chromosome was possible in all cases. In 16 families with 45,X (four fetuses and 12 livebirths), the observed X was maternal in each case, indicating a preferential loss of the paternal sex chromosome at, or before, conception. In the remaining 18 families with a variety of karyotypes, but especially in those where the child had an iso...

  6. Assessing genetic divergence in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, F; Ge, Y Y; Wang, W Y; Shen, X L; Yu, X Y

    2012-01-01

    Conventional hybridization and selection techniques have aided the development of new ornamental crop cultivars. However, little information is available on the genetic divergence of bromeliad hybrids. In the present study, we investigated the genetic variability in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism (SRAP) markers. The morphological analysis showed that the putative hybrids were intermediate between both parental species with respect to inflorescence characteristics. The 16 SRAP primer combinations yield 265 bands, among which 154 (57.72%) were polymorphic. The genetic similarity was an average of 0.59 and ranged from 0.21 to 0.87, indicating moderate genetic divergence among the hybrids. The unweighted pair group method with arithmetic average (UPGMA)-based cluster analysis distinguished the hybrids from their parents with a genetic distance coefficient of 0.54. The cophenetic correlation was 0.93, indicating a good fit between the dendrogram and the original distance matrix. The two-dimensional plot from the principal coordinate analysis showed that the hybrids were intermediately dispersed between both parents, corresponding to the results of the UPGMA cluster and the morphological analysis. These results suggest that SRAP markers could help to identify breeders, characterize F(1) hybrids of bromeliads at an early stage, and expedite genetic improvement of bromeliad cultivars. PMID:23079994

  7. Physical and genetic mapping of amplified fragment length polymorphisms and the leaf rust resistance Lr3 gene on chromosome 6BL of wheat.

    Science.gov (United States)

    Diéguez, M J; Altieri, E; Ingala, L R; Perera, E; Sacco, F; Naranjo, T

    2006-01-01

    The Argentinian wheat cultivar Sinvalocho MA carries the Lr3 gene for leaf rust resistance on distal chromosome 6BL. In this cultivar, 33 spontaneous susceptible lines were isolated and cytogenetically characterized by C-banding. The analysis revealed deletions on chromosome 6BL in most lines. One line was nulli-6B, two lines were ditelo 6BS, two, three, and ten lines had long terminal deletions of 40, 30, and 20%, respectively, three lines showed very small terminal deletions, and one line had an intercalary deletion of 11%. Physical mapping of 55 amplified fragment length polymorphism (AFLP) markers detected differences between deletions and led to the division of 6BL into seven bins delimited by deletion breakpoints. The most distal bin, with a length smaller than 5% of 6BL, contained 22 AFLP markers and the Lr3 gene. Polymorphism for nine AFLPs between Sinvalocho MA and the rust leaf susceptible cultivar Gamma 6 was used to construct a linkage map of Lr3. This gene is at a genetic distance of 0.9 cM from a group of seven closely linked AFLPs. The location of the gene in a high recombinogenic region indicated a physical distance of approximately 1 Mb to the markers. PMID:16215730

  8. GSTM1 and XRCC3 Polymorphisms: Effects on Levels of Aflatoxin B1-DNA Adducts

    Institute of Scientific and Technical Information of China (English)

    Xi-dai Long; Yun Ma; Zhou-lin Deng

    2009-01-01

    Objective: Aflatoxin B1 (AFB1), which can cause the formation of AFB1-DNA adducts, is a known human carcinogen. AFB1-exposure individuals with inherited susceptible carcinogen-metabolizing or repairing genotypes may experience an increased risk of genotoxicity. This study was designed to investigate whether the polymorphisms of two genes, the metabolic gene Glutathione S-transferase M1 (GSTM1) and DNA repair gene x-ray repair cross-complementing group 3 (XRCC3), can affect the levels of AFB1-DNA adducts in Guangxi Population (n= 966) from an AFB1-exposure area.Methods: AFB1-DNA adducts were measured by ELISA, and GSTM1 and XRCC3 codon 241 genotypes were identified by PCR-RFLP.Results: The GSTM1-null genotype [adjusted odds ratio (OR) = 2.09; 95% confidence interval (CI) = 1.61(2.71] and XRCC3 genotypes with 241 Met alleles [i.e., XRCC3-TM and -MM, adjusted ORs (95% CI) were 1.43 (1.08(1.89) and 2.42 (1.13(5.22), respectively] were significantly associated with higher levels of AFB1-DNA adducts. Compared with those individuals who did not express any putative risk genotypes as reference (OR = 1), individuals featuring all of the putative risk genotypes did experience a significantly higher DNA-adduct levels (adjusted ORs were 2.87 for GSTM1-null and XRCC3-TM; 5.83 for GSTM1-null and XRCC3-MM). Additionally, there was a positive joint effect between XRCC3 genotypes and long-term AFB1 exposure in the formation of AFB1-DNA adducts.Conclusion: These results suggest that individuals with susceptible genotypes GSTM1-null, XRCC3-TM, or XRCC3-MM may experience an increased risk of DNA damage elicited by AFB1 exposure.

  9. Is there evidence of involvement of DNA repair polymorphisms in human cancer?

    Science.gov (United States)

    Ricceri, Fulvio; Matullo, Giuseppe; Vineis, Paolo

    2012-08-01

    DNA suffers from a wide range of damage, both from extracellular agents and via endogenous mechanisms. Damage of DNA can lead to cancer and other diseases. Therefore, it is plausible that sequence variants in DNA repair genes are involved in cancer development. A recent systematic review and meta-analysis, based on the "Venice criteria", showed that out of 241 associations investigated, only three resulted to have a strong grade of cumulative evidence. These associations were: two SNPs rs1799793 and rs13181 in the ERCC2 gene and lung cancer (recessive model) and rs1805794 in the NBN gene and bladder cancer (dominant model). An update of this meta-analysis has been performed in the present paper, and we found partially inconsistent results. Inconsistencies in the literature are thus far not easy to explain. In addition, none of the cancer genome-wide association studies (GWAs) published so far showed highly statistically significant associations for any of the common DNA repair gene variants, in such a way as to place DNA repair genes among the top 10-20 hits identified in GWAs. Though this suggests that it is unlikely that DNA repair gene polymorphisms per se play a major role, a clarification of the discrepancies in the literature is needed. Also, gene/environment and gene/lifestyle interactions for the carcinogenic mechanisms involving DNA repair should be investigated more systematically and with less classification error. Finally, the combined effect of multiple SNPs in several genes in one or more relevant DNA repair pathways could have a greater impact on pathological phenotypes than SNPs in single genes, but this has been investigated only occasionally. PMID:21864546

  10. The human insulin gene linked polymorphic region exhibits an altered DNA structure

    Energy Technology Data Exchange (ETDEWEB)

    Hammond-Kosack, M.C.U.; Docherty, K.; Kilpatrick, M.W. (Univ. of Birmingham (United Kingdom)); Dobrinski, B.; Lurz, R. (Max-Planck-Inst., Berlin (West Germany))

    1992-01-25

    Regulation of transcription of the human insulin gene appears to involve a series of DNA sequences in the 5{prime} region. Hypersensitivity to DNA structural probes has previously been demonstrated in regulatory regions of cloned genomic DNA fragments, and been correlated with gene activity. To investigate the structure of the DNA in the human insulin gene, bromoacetaldehyde and S1 nuclease were reacted with a supercoiled plasmid containing a 5kb genomic insulin fragment. Both probes revealed the human insulin gene linked polymorphic region (ILPR), a region ({minus}363) upstream of the transcriptional start site which contains multiple repeats of a 14-15mer oligonucleotide with the consensus sequence ACAGGGGT(G/C)(T/C)GGGG, as the major hypersensitive site. Fine mapping and electron microscopic analysis both show a very different behavior of the two DNA strands in the region of the ILPR and suggest the G-rich strand may be adopting a highly structured conformation with the complementary strand remaining largely single stranded.

  11. N-6-Adenine-Specific DNA Methyltransferase 1 (N6AMT1) Polymorphisms and Arsenic Methylation in Andean Women

    OpenAIRE

    Harari, Florencia; Engström, Karin; Concha, Gabriela; Colque, Graciela; Vahter, Marie; Broberg, Karin

    2013-01-01

    BACKGROUND: In humans, inorganic arsenic is metabolized to methylated metabolites mainly by arsenic (+3 oxidation state) methyltransferase (AS3MT). AS3MT polymorphisms are associated with arsenic metabolism efficiency. Recently, a putative N-6-adenine-specific DNA methyltransferase 1 (N6AMT1) was found to methylate arsenic in vitro. OBJECTIVE: We evaluated the role of N6AMT1 polymorphisms in arsenic methylation efficiency in humans. METHODS: We assessed arsenic methylation efficiency in 188 w...

  12. Redox polymer and probe DNA tethered to gold electrodes for enzyme-amplified amperometric detection of DNA hybridization.

    Science.gov (United States)

    Kavanagh, Paul; Leech, Dónal

    2006-04-15

    The detection of nucleic acids based upon recognition surfaces formed by co-immobilization of a redox polymer mediator and DNA probe sequences on gold electrodes is described. The recognition surface consists of a redox polymer, [Os(2,2'-bipyridine)2(polyvinylimidazole)(10)Cl](+/2+), and a model single DNA strand cross-linked and tethered to a gold electrode via an anchoring self-assembled monolayer (SAM) of cysteamine. Hybridization between the immobilized probe DNA of the recognition surface and a biotin-conjugated target DNA sequence (designed from the ssrA gene of Listeria monocytogenes), followed by addition of an enzyme (glucose oxidase)-avidin conjugate, results in electrical contact between the enzyme and the mediating redox polymer. In the presence of glucose, the current generated due to the catalytic oxidation of glucose to gluconolactone is measured, and a response is obtained that is binding-dependent. The tethering of the probe DNA and redox polymer to the SAM improves the stability of the surface to assay conditions of rigorous washing and high salt concentration (1 M). These conditions eliminate nonspecific interaction of both the target DNA and the enzyme-avidin conjugate with the recognition surfaces. The sensor response increases linearly with increasing concentration of target DNA in the range of 1 x 10(-9) to 2 x 10(-6) M. The detection limit is approximately 1.4 fmol, (corresponding to 0.2 nM of target DNA). Regeneration of the recognition surface is possible by treatment with 0.25 M NaOH solution. After rehybridization of the regenerated surface with the target DNA sequence, >95% of the current is recovered, indicating that the redox polymer and probe DNA are strongly bound to the surface. These results demonstrate the utility of the proposed approach. PMID:16615783

  13. Genetic polymorphisms of DNA double strand break gene Ku70 and gastric cancer in Taiwan

    Directory of Open Access Journals (Sweden)

    Chang Wen-Shin

    2011-05-01

    Full Text Available Abstract Background and aim The DNA repair gene Ku70, an important member of non-homologous end-joining repair system, is thought to play an important role in the repairing of DNA double strand breaks. It is known that defects in double strand break repair capacity can lead to irreversible genomic instability. However, the polymorphic variants of Ku70, have never been reported about their association with gastric cancer susceptibility. Methods In this hospital-based case-control study, the associations of Ku70 promoter T-991C (rs5751129, promoter G-57C (rs2267437, promoter A-31G (rs132770, and intron 3 (rs132774 polymorphisms with gastric cancer risk in a Taiwanese population were investigated. In total, 136 patients with gastric cancer and 560 age- and gender-matched healthy controls recruited from the China Medical Hospital in Taiwan were genotyped. Results As for Ku70 promoter T-991C, the ORs after adjusted by age and gender of the people carrying TC and CC genotypes were 2.41 (95% CI = 1.53-3.88 and 3.21 (95% CI = 0.96-9.41 respectively, compared to those carrying TT wild-type genotype. The P for trend was significant (P Ku70 promoter T-991C polymorphism and the risk for gastric cancer was also significant (adjusted OR = 2.48, 95% CI = 1.74-3.92. When stratified by age and gender, the association was restricted to those at the age of 55 or elder of age (TC vs TT: adjusted OR = 2.52, 95% CI = 1.37-4.68, P = 0.0139 and male (TC vs TT: adjusted OR = 2.58, 95% CI = 1.33-4.47, P = 0.0085. As for the other three polymorphisms, there was no difference between both groups in the distributions of their genotype frequencies. Conclusion In conclusion, the Ku70 promoter T-991C (rs5751129, but not the Ku70 promoter C-57G (rs2267437, promoter A-31G (rs132770 or intron 3 (rs132774, is associated with gastric cancer susceptibility. This polymorphism may be a novel useful marker for gastric carcinogenesis.

  14. Evidence of genotypic diversity among Candida auris isolates by multilocus sequence typing, matrix-assisted laser desorption ionization time-of-flight mass spectrometry and amplified fragment length polymorphism.

    Science.gov (United States)

    Prakash, A; Sharma, C; Singh, A; Kumar Singh, P; Kumar, A; Hagen, F; Govender, N P; Colombo, A L; Meis, J F; Chowdhary, A

    2016-03-01

    Candida auris is a multidrug-resistant nosocomial bloodstream pathogen that has been reported from Asian countries and South Africa. Herein, we studied the population structure and genetic relatedness among 104 global C. auris isolates from India, South Africa and Brazil using multilocus sequence typing (MLST), amplified fragment length polymorphism (AFLP) fingerprinting and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). RPB1, RPB2 and internal transcribed spacer (ITS) and D1/D2 regions of the ribosomal DNA were sequenced for MLST. Further, genetic variation and proteomic assessment was carried out using AFLP and MALDI-TOF MS, respectively. Both MLST and AFLP typing clearly demarcated two major clusters comprising Indian and Brazilian isolates. However, the South African isolates were randomly distributed, suggesting different genotypes. MALDI-TOF MS spectral profiling also revealed evidence of geographical clustering but did not correlate fully with the genotyping methods. Notably, overall the population structure of C. auris showed evidence of geographical clustering by all the three techniques analysed. Antifungal susceptibility testing by the CLSI microbroth dilution method revealed that fluconazole had limited activity against 87% of isolates (MIC90, 64 mg/L). Also, MIC90 of AMB was 4 mg/L. Candida auris is emerging as an important yeast pathogen globally and requires reproducible laboratory methods for identification and typing. Evaluation of MALDI-TOF MS as a typing method for this yeast is warranted. PMID:26548511

  15. Promising genomic transfectant into Xeroderma pigmentosum group A with highly amplified mouse DNA and intermediate UV resistance turns revertant

    International Nuclear Information System (INIS)

    Following transfection of genomic mouse DNA into an SV40 transformed fibroblast cell line from a patient with Xeroderma pigmentosum (complementation group A, XPA), a single UV resistant cell clone was isolated out of a total of 10(4) independent transfectants. The recipient XPA cell line has as yet not produced spontaneous revertants among 2.2 x 10(8) cells. The isolated cell clone contains 50-70 kb of mouse sequences which are heavily amplified (500-fold), and has acquired both intermediate resistance to UV killing and intermediate unscheduled DNA synthesis (UDS) capacity. By continued passage without selective pressure, cells were generated, which had lost both the dominant marker gene and repetitive mouse sequences. Single colonies of these cells were still intermediately resistant to UV suggesting that either undetected unique mouse DNA had segregated from the bulk of repetitive DNA, or, more likely, that the initially isolated transfectant was a spontaneous revertant. This documents that a persuasive clone isolated can still be a false positive (spontaneous revertant) and that an extremely laborious approach may lead into a dead end

  16. Evaluation of DNA polymorphisms involving growth hormone relative to growth and carcass characteristics in Brahman steers.

    Science.gov (United States)

    Beauchemin, V R; Thomas, M G; Franke, D E; Silver, G A

    2006-01-01

    Associations of DNA polymorphisms in growth hormone (GH) relative to growth and carcass characteristics in growing Brahman steers (N = 324 from 68 sires) were evaluated. Polymorphisms were an Msp-I RFLP and a leucine/valine SNP in the GH gene as well as a Hinf-I RFLP and a histidine/arginine SNP in transcriptional regulators of the GH gene, Pit-1 and Prop-1. Genotypic frequencies of the GH SNP, Pit-1 RFLP, and Prop-1 SNP were greater than 88% for one of the bi-allelic homozygous genotypes. Genotypic frequencies for the GH Msp-I RFLP genotypes were more evenly distributed with frequencies of 0.43, 0.42, and 0.15 for the genotypes of +/+, +/-, and -/-, respectively. Mixed model analyses of growth and carcass traits with genotype and contemporary group serving as fixed effects and sire fitted as a random effect suggested that sire was a significant source of variation (P carcass yield, and marbling score. However, measures of growth and carcass traits were similar across GH Msp-I genotypes as steers were slaughtered when fat thickness was estimated to be approximately 1.0 cm. These polymorphisms within the GH gene and/or its transcriptional regulators do not appear to be informative predictors of growth and carcass characteristics in Brahman steers. This is partly due to the high level of homozygosity of genotypes. These findings do not eliminate the potential importance of these polymorphisms as predictors of growth and carcass traits in Bos taurus or Bos taurus x Bos indicus composite cattle. PMID:17117358

  17. Quantitative genotyping of single-nucleotide polymorphisms by allele-specific oligonucleotide hybridization on DNA microarrays.

    Science.gov (United States)

    Rickert, Andreas M; Ballvora, Agim; Matzner, Ulrich; Klemm, Manfred; Gebhardt, Christiane

    2005-08-01

    Genotyping of SNPs (single-nucleotide polymorphisms) has challenged the development of several novel techniques. Most of these methods have been introduced to discriminate binary SNPs in diploid species. In the present study, the quantitative genotyping of SNPs in natural DNA pools of a polyploid organism via DNA microarrays was analysed. Three randomly selected SNP loci were genotyped in the tetraploid species potato (Solanum tuberosum). For each SNP, 24 oligomers were designed, 12 with forward and 12 with reverse orientation. They contained the polymorphic site at one of the positions 11, 14 and 17. Several steps of optimizations were performed, including the 'materials' used and the establishment of hybridization conditions. Glass surfaces were either epoxy- or aldehyde-modified, and allele-specific oligonucleotides contained either SH or NH2 groups. Hybridization stringency conditions were established by varying the concentration of formamide in the hybridization buffer. For SNP BA213c14t7/403, the quantitative discrimination between all four different naturally occurring genotypes could be demonstrated. PMID:15847606

  18. [ Mitochondrial DNA polymorphism association with myocardial infarction and prognostic signs for atherosclerosis].

    Science.gov (United States)

    Golubenko, M V; Salakhov, R R; Makeeva, O A; Goncharova, I A; Kashtalap, V V; Barbarash, O L; Puzyrev, V P

    2015-01-01

    We have performed association analysis for mtDNA most common variants and haplogroups with myocardial infarction and some prognostic characteristics in patients. Comparison of patients (N=406) and controls (N=183) has shown higher frequency of HV0 haplogroup in patients (6.9% vs. 2.2%; p=0.033). Patients with early infarction (before age 55), comparing to patiens older than 55 and the first infarction, had higher frequency of 16189C variant (24.1 vs. 12.5%; p=0.008); also, haplogroup U2e was registered only in the subgroup with early infarction (4.4%; p=0.004). On the other side, haplogroup U5 was less frequent in the patients with early infarction (5.1% vs. 15.4%; p=0.002). The patients with recurring cardiovascular incidents during one year follow-up had higher frequency of haplogroup H1 (20% versus 4.5% in the patients without complications, p=0.002) and variant 16189C (30% versus 13.5%; p=0.018). Haplogroup U5 was more frequent in the group of patients with left ventricular ejection fraction less than 40%: 17.1% comparing to 8.2% in the group with ejection fraction>40%; p=0.034. The results suggest that mtDNA polymorphism contributes to coronary atherosclerosis. The associations could be explained by the polymorphism effect on oxidative phosphorylation and reactive oxygen production in mitochondria. PMID:26710777

  19. Discovery of human inversion polymorphisms by comparative analysis of human and chimpanzee DNA sequence assemblies.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available With a draft genome-sequence assembly for the chimpanzee available, it is now possible to perform genome-wide analyses to identify, at a submicroscopic level, structural rearrangements that have occurred between chimpanzees and humans. The goal of this study was to investigate chromosomal regions that are inverted between the chimpanzee and human genomes. Using the net alignments for the builds of the human and chimpanzee genome assemblies, we identified a total of 1,576 putative regions of inverted orientation, covering more than 154 mega-bases of DNA. The DNA segments are distributed throughout the genome and range from 23 base pairs to 62 mega-bases in length. For the 66 inversions more than 25 kilobases (kb in length, 75% were flanked on one or both sides by (often unrelated segmental duplications. Using PCR and fluorescence in situ hybridization we experimentally validated 23 of 27 (85% semi-randomly chosen regions; the largest novel inversion confirmed was 4.3 mega-bases at human Chromosome 7p14. Gorilla was used as an out-group to assign ancestral status to the variants. All experimentally validated inversion regions were then assayed against a panel of human samples and three of the 23 (13% regions were found to be polymorphic in the human genome. These polymorphic inversions include 730 kb (at 7p22, 13 kb (at 7q11, and 1 kb (at 16q24 fragments with a 5%, 30%, and 48% minor allele frequency, respectively. Our results suggest that inversions are an important source of variation in primate genome evolution. The finding of at least three novel inversion polymorphisms in humans indicates this type of structural variation may be a more common feature of our genome than previously realized.

  20. 'Hide-then-hit' to explain the importance of genotypic polymorphism of DNA repair genes in determining susceptibility to cancer

    Institute of Scientific and Technical Information of China (English)

    Pei-Ei Wu; Chen-Yang Shen

    2011-01-01

    Interindividual variations in DNA repair capacity/efficiency linked to the presence of polymorphisms in DNA repair-related genes have been suggested to account for different risk of developing cancers. In this review article, on the basis of breast cancer formation as a model, we propose a 'hide-then-hit' hypothesis indicating the importance of escaping checkpoint surveillance for sub-optimal DNA repair variants to cause cancer. Therefore, only cells with subtle defects in repair capacity arising from low-penetrance variants of DNA repair genes would have the opportunity to grow and accumulate the genetic changes needed for cancer formation, without triggering cell-cycle checkpoint surveillance. Furthermore, distinct from high-penetrance alleles, these polymorphic alleles of DNA repair genes would predispose carriers to a higher risk of developing cancer but would not necessarily cause cancer. To examine this,we simultaneously genotyped multiple SNPs of cell-cycle checkpoint genes and the DNA repair genes. Support for the hypothesis came from observations that breast cancer risk associated with variant genotypes of DNA repair genes became more significant in be confirmed by biological evidence in which a cause-effect relationship has to be established. However, based on this, possible gene-gene interaction is considered to play an important role in modifying the cancer risk associated with genotypic polymorphism of DNA repair gene in different study populations.

  1. Peripheral blood mitochondrial DNA content, A10398G polymorphism, and risk of breast cancer in a Han Chinese population.

    Science.gov (United States)

    Jiang, Huangang; Zhao, Hong; Xu, Hui; Hu, Liu; Wang, Wenbo; Wei, Yuehua; Wang, You; Peng, Xiaohong; Zhou, Fuxiang

    2014-06-01

    It has been reported that quantitative alterations and sequence variations of mtDNA are associated with the onset and progression of particular types of tumor. However, the relationship between mtDNA content, certain mtDNA polymorphisms in peripheral blood leukocytes and breast cancer risk remain obscure. This study was undertaken to investigate whether mtDNA content and the A10398G polymorphism in peripheral blood leukocytes could be used as risk predictors for breast cancer in Han Chinese women. Blood samples were obtained from a total of 506 breast cancer patients and 520 matched healthy controls. The mtDNA content was measured by using quantitative real-time PCR assay; A10398G polymorphism was determined by PCR-RFLP assay. There was no statistically significant difference between cases and controls in terms of peripheral blood mtDNA content or A10398G polymorphism. However, further analysis suggested that the risk of breast cancer was associated with decreased mtDNA content in premenopausal women (P = 0.001; odds ratio = 0.54; 95% confidence interval, 0.38-0.77), with increased mtDNA content in postmenopausal women (P = 0.027; odds ratio = 1.49; 95% confidence interval, 1.05-2.11). In addition, the associations between mtDNA content and several clinicopathological parameters of cases such as age, menopausal status, and number of pregnancies and live births were observed. This case-control study indicated that the peripheral blood mtDNA content might be a potential biomarker to evaluate the risk of breast cancer for selected Chinese women. PMID:24703408

  2. Genetic linkage between Becker muscular dystrophy and a polymorphic DNA sequence on the short arm of the X chromosome.

    OpenAIRE

    Kingston, H. M.; Thomas, N S; Pearson, P.L.; Sarfarazi, M; Harper, P S

    1983-01-01

    A study of DNA restriction fragment polymorphisms and Becker muscular dystrophy has shown eight families informative for the cloned sequence L1.28, which is located on the short arm of the X chromosome between Xp110 and Xp113. Analysis of these families reveals linkage between the two loci, with the maximum likelihood estimate of the genetic distance being 16 centiMorgans (95% confidence limits between 7 and 32 centiMorgans). Since a study of DNA polymorphisms in Duchenne muscular dystrophy h...

  3. Modeling genetic imprinting effects of DNA sequences with multilocus polymorphism data

    Directory of Open Access Journals (Sweden)

    Staud Roland

    2009-08-01

    Full Text Available Abstract Single nucleotide polymorphisms (SNPs represent the most widespread type of DNA sequence variation in the human genome and they have recently emerged as valuable genetic markers for revealing the genetic architecture of complex traits in terms of nucleotide combination and sequence. Here, we extend an algorithmic model for the haplotype analysis of SNPs to estimate the effects of genetic imprinting expressed at the DNA sequence level. The model provides a general procedure for identifying the number and types of optimal DNA sequence variants that are expressed differently due to their parental origin. The model is used to analyze a genetic data set collected from a pain genetics project. We find that DNA haplotype GAC from three SNPs, OPRKG36T (with two alleles G and T, OPRKA843G (with alleles A and G, and OPRKC846T (with alleles C and T, at the kappa-opioid receptor, triggers a significant effect on pain sensitivity, but with expression significantly depending on the parent from which it is inherited (p = 0.008. With a tremendous advance in SNP identification and automated screening, the model founded on haplotype discovery and statistical inference may provide a useful tool for genetic analysis of any quantitative trait with complex inheritance.

  4. Paraoxonase-1 genetic polymorphisms and susceptibility to DNA damage in workers occupationally exposed to organophosphate pesticides

    International Nuclear Information System (INIS)

    Human paraoxonase 1 (PON1) is a lipoprotein-associated enzyme involved in the detoxification of organophosphate pesticides (OPs) by hydrolyzing the bioactive oxons. Polymorphisms of the PON1 gene are responsible for variation in the expression and catalytic activity of PON1 enzyme. In the present study, we have determined (a) the prevalence of two common PON1 polymorphisms, (b) the activity of PON1 and acetylcholinesterase enzymes, and (c) the influence of PON1 genotypes and phenotypes variation on DNA damage in workers exposed to OPs. We examined 230 subjects including 115 workers exposed to OPs and an equal number of normal healthy controls. The results revealed that PON1 activity toward paraoxon (179.19 ± 39.36 vs. 241.52 ± 42.32 nmol/min/ml in controls) and phenylacetate (112.74 ± 17.37 vs. 134.28 ± 25.49 μmol/min/ml in controls) was significantly lower in workers than in control subjects (p 192QR (Gln/Arg) and PON155LM (Leu/Met) in workers and control subjects (p > 0.05). The PON1 activity toward paraoxonase was found to be significantly higher in the R/R (Arg/Arg) genotypes than Q/R (Gln/Arg) and lowest in Q/Q (Gln/Gln) genotypes in both workers and control subjects (p 55LM (Leu/Met), PON1 activity toward paraoxonase was observed to be higher in individuals with L/L (Leu/Leu) genotypes and lowest in individuals with M/M (Met/Met) genotypes in both groups (p < 0.001). No influence of PON1 genotypes and phenotypes was seen on the activity of acetylcholinesterase and arylesterase. The DNA damage was observed to be significantly higher in workers than in control subjects (p < 0.05). Further, the individuals who showed least paraoxonase activity i.e., those with (Q/Q [Gln/Gln] and M/M [Met/Met]) genotypes showed significantly higher DNA damage compared to other isoforms in workers exposed to OPs (p < 0.05). The results indicate that the individuals with PON1 Q/Q and M/M genotypes are more susceptible toward genotoxicity. In conclusion, the study suggests wide

  5. Molecular beacon-based enzyme-free strategy for amplified DNA detection.

    Science.gov (United States)

    Huang, Jiahao; Wu, Jueqi; Li, Zhigang

    2016-05-15

    We report an enzyme-free, sensitive strategy for DNA detections through fluorescence amplification. The sensing method employs molecular beacons (MBs) and two single-stranded helper DNA probes. In the presence of a DNA target, it binds and opens an MB. This triggers the hybridizations between the MB and helper probes, and consequently releases the DNA target, which becomes available to react with another MB and enhances the fluorescence emission of the MBs. The detection limit of the proposed strategy is 0.58 pM, which is about 3 orders of magnitude better than the conventional MB-based method. This method is also fast and exhibits good selectivity. It is superior to previous MB-based amplification approaches employing enzymes or nanomaterials. PMID:26774091

  6. Human glutamate pyruvate transaminase (GPT): Localization to 8q24.3, cDNA and genomic sequences, and polymorphic sites

    Energy Technology Data Exchange (ETDEWEB)

    Sohocki, M.M.; Sullivan, L.S.; Daiger, S.P. [Univ. of Texas Health Science Center, Houston, TX (United States)] [and others

    1997-03-01

    Two frequent protein variants of glutamate pyruvate transaminase (GPT) (E.C.2.6.1.2) have been used as genetic markers in humans for more than two decades, although chromosomal mapping of the GPT locus in the 1980s produced conflicting results. To resolve this conflict and develop useful DNA markers for this gene, we isolated and characterized cDNA and genomic clones of GPT. We have definitively mapped human GPT to the terminus of 8q using several methods. First, two cosmids shown to contain the GPT sequence were derived from a chromosome 8-specific library. Second, by fluorescence in situ hybridization, we mapped the cosmid containing the human GPT gene to chromosome band 8q24.3. Third, we mapped the rat gpt cDNA to the syntenic region of rat chromosome 7. Finally, PCR primers specific to human GPT amplify sequences contained within a {open_quotes}half-YAC{close_quotes} from the long arm of chromosome 8, that is, a YAC containing the 8q telomere. The human GPT genomic sequence spans 2.7 kb and consists of 11 exons, ranging in size from 79 to 243 bp. The exonic sequence encodes a protein of 495 amino acids that is nearly identical to the previously reported protein sequence of human GPT-1. The two polymorphic GPT isozymes are the result of a nucleotide substitution in codon 14. In addition, a cosmid containing the GPT sequence also contains a previously unmapped, polymorphic microsatellite sequence, D8S421. The cloned GPT gene and associated polymorphisms will be useful for linkage and physical mapping of disease loci that map to the terminus of 8q, including atypical vitelliform macular dystrophy (VMD1) and epidermolysis bullosa simplex, type Ogna (EBS1). In addition, this will be a useful system for characterizing the telomeric region of 8q. Finally, determination of the molecular basis of the GPT isozyme variants will permit PCR-based detection of this world-wide polymorphism. 22 refs., 3 figs.

  7. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    Science.gov (United States)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

  8. Kelvin probe force microscopy of DNA-capped nanoparticles for single-nucleotide polymorphism detection

    Science.gov (United States)

    Lee, Hyungbeen; Lee, Sang Won; Lee, Gyudo; Lee, Wonseok; Lee, Jeong Hoon; Hwang, Kyo Seon; Yang, Jaemoon; Lee, Sang Woo; Yoon, Dae Sung

    2016-07-01

    Kelvin probe force microscopy (KPFM) is a robust toolkit for profiling the surface potential (SP) of biomolecular interactions between DNAs and/or proteins at the single molecule level. However, it has often suffered from background noise and low throughput due to instrumental or environmental constraints, which is regarded as limiting KPFM applications for detection of minute changes in the molecular structures such as single-nucleotide polymorphism (SNP). Here, we show KPFM imaging of DNA-capped nanoparticles (DCNP) that enables SNP detection of the BRCA1 gene owing to sterically well-adjusted DNA-DNA interactions that take place within the confined spaces of DCNP. The average SP values of DCNP interacting with BRCA1 SNP were found to be lower than the DCNP reacting with normal (non-mutant) BRCA1 gene. We also demonstrate that SP characteristics of DCNP with different substrates (e.g., Au, Si, SiO2, and Fe) provide us with a chance to attenuate or augment the SP signal of DCNP without additional enhancement of instrumentation capabilities.Kelvin probe force microscopy (KPFM) is a robust toolkit for profiling the surface potential (SP) of biomolecular interactions between DNAs and/or proteins at the single molecule level. However, it has often suffered from background noise and low throughput due to instrumental or environmental constraints, which is regarded as limiting KPFM applications for detection of minute changes in the molecular structures such as single-nucleotide polymorphism (SNP). Here, we show KPFM imaging of DNA-capped nanoparticles (DCNP) that enables SNP detection of the BRCA1 gene owing to sterically well-adjusted DNA-DNA interactions that take place within the confined spaces of DCNP. The average SP values of DCNP interacting with BRCA1 SNP were found to be lower than the DCNP reacting with normal (non-mutant) BRCA1 gene. We also demonstrate that SP characteristics of DCNP with different substrates (e.g., Au, Si, SiO2, and Fe) provide us with a

  9. Association of DNA repair polymorphisms with DNA repair functional outcomes in healthy human subjects

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Poláková, Veronika; Tulupová, Elena; Naccarati, Alessio; Vodičková, Ludmila; Kumar, R.; Hánová, Monika; Pardini, Barbara; Slyšková, Jana; Musak, L.; De Palma, G.; Souček, P.; Hemminki, K.

    2007-01-01

    Roč. 28, č. 3 (2007), s. 657-664. ISSN 0143-3334 R&D Projects: GA MZd NR8563; GA ČR GA310/05/2626 Institutional research plan: CEZ:AV0Z50390512 Keywords : Base excision DNA * Single-strand breaks * Peripheral blood lymphocytes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.406, year: 2007

  10. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators.

    Science.gov (United States)

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui

    2016-05-14

    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples. PMID:27119550

  11. Sequence-Related Amplified Polymorphism-PCR Analysis for Genetic Diversity in Rhizoctonia solani Populations Infecting Pulse Crops in Different Agro-Ecological Regions of India

    Directory of Open Access Journals (Sweden)

    Aradhika Tripathi

    2015-01-01

    Full Text Available Rhizoctonia solani is a destructive fungal pathogen infecting wide range of crop plants including pulses causing wet root rot or web blight disease. The present study was aimed to determine the genetic diversity of R. solani populations using Sequence-Related Amplified Polymorphism (SRAP markers. The SRAP markers were used for genetic diversity analysis of 89 isolates of R. solani belonging to 7 Anastomosis Groups (AGs isolated from different pulse crops representing 21 states from 16 agro-ecological regions of India. Out of 30 SRAP primer combinations evaluated, 16 combinations provided amplification with 100% polymorphism and the primer combinations Me1/Em1and Me1/Em4 provided the highest number of bands (14. The isolates of R. solani showed high level of genetic variability and grouped into 7 major clusters at 35% genetic similarity by using unweighted pair group method with an arithmetic average analysis. Bootstrap analysis grouped the isolates into five major clusters at 28% genetic similarity and about 95% isolates shared common sub-grouping patterns in both the analysis. The majority of the isolates representing various AGs were grouped together into different sub-clusters. The molecular clusters did not correspond to agro-ecological regions and crops of the origin of the isolates because of the diversity in the hosts and adopt ability of the pathogen under different environmental conditions prevalent in various parts of the country. First time an attempt was made in the present study to determine the genetic variability of the R. solani populations isolated from different pulse crops representing various AGs using SRAP markers.

  12. Human placental Na+, K+-ATPase α subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    International Nuclear Information System (INIS)

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na+, K+-ATPase α subunit was cloned from human placenta and its sequence was identical to that encoding the α subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na+, K+-ATPase gene from various human tissues and cell lines revealed only one band (≅ 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) λgt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the α subunit is on the short is on the short arm (band p11-p13) of chromosome 1

  13. A simple and efficient method for extraction of PCR-amplifiable DNA from chicken eggshells.

    Science.gov (United States)

    Rikimaru, Kazuhiro; Takahashi, Hideaki

    2009-04-01

    Recently, we reported a method for discriminating a Japanese brand of chicken, the Hinai-jidori. As an application of this method for discriminating Hinai-jidori eggs, we here report an efficient method for extracting maternal DNA from eggshells. Eggshell powder was completely decalcified with EDTA solution, and then DNA was isolated by conventional phenol-chloroform extraction and ethanol precipitation. The efficiency of DNA recovery from eggshells was 50-fold higher than that of a previously reported method. The recovered DNA could be used for PCR, and 10 markers for identifying the Hinai-jidori chicken were detected. The genotypes of the Hinai-jidori exactly matched those of the Hinai-dori breed. Using this method, Hinai-jidori and Hinai-dori eggs could be distinguished from the eggs of Rhode Island Reds. This is the first report of a technique that can be used to discriminate the eggs of Hinai-jidori from those of other chickens, and it can also be utilized to validate the labeling of Hinai-jidori eggs in the market. PMID:20163594

  14. High-Quality Exome Sequencing of Whole-Genome Amplified Neonatal Dried Blood Spot DNA

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Lescai, Francesco; Grove, Jakob; Bækvad-Hansen, Marie; Christiansen, Michael; Hagen, Christian Munch; Maller, Julian; Stevens, Christine; Li, Shenting; Li, Qibin; Sun, Jihua; Wang, Jun; Nordentoft, Merete; Werge, Thomas Mears; Mortensen, Preben Bo; Børglum, Anders Dupont; Daly, Mark; Hougaard, David Michael; Bybjerg-Grauholm, Jonas; Hollegaard, Mads Vilhelm

    2016-01-01

    Stored neonatal dried blood spot (DBS) samples from neonatal screening programmes are a valuable diagnostic and research resource. Combined with information from national health registries they can be used in population-based studies of genetic diseases. DNA extracted from neonatal DBSs can be...

  15. A germline polymorphism of thymine DNA glycosylase induces genomic instability and cellular transformation.

    Directory of Open Access Journals (Sweden)

    Ashley Sjolund

    2014-11-01

    Full Text Available Thymine DNA glycosylase (TDG functions in base excision repair, a DNA repair pathway that acts in a lesion-specific manner to correct individual damaged or altered bases. TDG preferentially catalyzes the removal of thymine and uracil paired with guanine, and is also active on 5-fluorouracil (5-FU paired with adenine or guanine. The rs4135113 single nucleotide polymorphism (SNP of TDG is found in 10% of the global population. This coding SNP results in the alteration of Gly199 to Ser. Gly199 is part of a loop responsible for stabilizing the flipped abasic nucleotide in the active site pocket. Biochemical analyses indicate that G199S exhibits tighter binding to both its substrate and abasic product. The persistent accumulation of abasic sites in cells expressing G199S leads to the induction of double-strand breaks (DSBs. Cells expressing the G199S variant also activate a DNA damage response. When expressed in cells, G199S induces genomic instability and cellular transformation. Together, these results suggest that individuals harboring the G199S variant may have increased risk for developing cancer.

  16. A germline polymorphism of DNA polymerase beta induces genomic instability and cellular transformation.

    Directory of Open Access Journals (Sweden)

    Jennifer Yamtich

    Full Text Available Several germline single nucleotide polymorphisms (SNPs have been identified in the POLB gene, but little is known about their cellular and biochemical impact. DNA Polymerase β (Pol β, encoded by the POLB gene, is the main gap-filling polymerase involved in base excision repair (BER, a pathway that protects the genome from the consequences of oxidative DNA damage. In this study we tested the hypothesis that expression of the POLB germline coding SNP (rs3136797 in mammalian cells could induce a cancerous phenotype. Expression of this SNP in both human and mouse cells induced double-strand breaks, chromosomal aberrations, and cellular transformation. Following treatment with an alkylating agent, cells expressing this coding SNP accumulated BER intermediate substrates, including single-strand and double-strand breaks. The rs3136797 SNP encodes the P242R variant Pol β protein and biochemical analysis showed that P242R protein had a slower catalytic rate than WT, although P242R binds DNA similarly to WT. Our results suggest that people who carry the rs3136797 germline SNP may be at an increased risk for cancer susceptibility.

  17. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M. J.; Lewis, M. A.; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  18. Microsatellite DNA polymorphism in selectively controlled Apis mellifera carnica and Apis mellifera caucasica populations from Poland

    Directory of Open Access Journals (Sweden)

    Nikolova Stanimila R.

    2015-01-01

    Full Text Available Genetic polymorphism in selectively controlled honeybee populations of A. m. carnica and A. m. caucasica in Poland, was characterized by microsatellite DNA analysis. All honeybee samples were analyzed for nine microsatellite loci: Ac011; A024; A043; A088; Ap226; Ap238; Ap243; Ap249 and Ap256, which were found to be polymorphic in both populations. The mean number of alleles per locus was 6.222 for A. m. carnica and 4.556 for A. m. caucasica. Average observed and expected heterozygosity values were calculated as 0.976 and 0.734 in A. m. carnica and as 0.933 and 0.603 in A. m. caucasica, respectively. For the nine microsatellite loci, a total of 76 alleles were found in both populations. Thirty-five private alleles were observed in A. m. carnica and 20 in A. m. caucasica. Information about allele frequencies, FST values and genotypic differentiation is given. Nei’s genetic distance between studied populations of A. m. carnica and A. m. caucasica was calculated as 0.384.

  19. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Directory of Open Access Journals (Sweden)

    Puji Rianti

    2015-10-01

    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  20. Investigation of five polymorphic DNA markers associated with late onset Alzheimer disease

    Directory of Open Access Journals (Sweden)

    Gharesouran Jalal

    2013-01-01

    Full Text Available Alzheimer's disease is a complex neurodegenerative disorder characterized by memory and cognitive impairment and is the leading cause of dementia in the elderly. The aim of our study was to examine the polymorphic DNA markers CCR2 (+190 G/A, CCR5Δ32, TNF-α (-308 G/A, TNF-α (-863 C/A and CALHM1 (+394 C/T to determine the relationship between these polymorphisms and the risk of late onset Alzheimer's disease in the population of Eastern Azerbaijan of Iran. A total of 160 patient samples and 163 healthy controls were genotyped by PCR-RFLP and the results confirmed using bidirectional sequencing. Statistical analysis of obtained data revealed non-significant difference between frequency of CCR5Δ32 in case and control groups. The same result was observed for TNF-α (-863 C/A genotype and allele frequencies. Contrary to above results, significant differences were detected in frequency of TNF-α (-308 G/A and CCR2-64I genotypes between the cases and healthy controls. A weak significant difference observed between allele and genotype frequencies of rs2986017 in CALHM1 (+394 C/T; P86L in patient and control samples. It can be concluded that the T allele of P86L variant in CALHM1 & +190 G/A allele of CCR2 have a protective role against abnormal clinical features of Alzheimer's disease.

  1. A study of genetic polymorphisms in mitochondrial DNA hypervariable regions I and II of the five major ethnic groups and Vedda population in Sri Lanka.

    Science.gov (United States)

    Ranasinghe, Ruwandi; Tennekoon, Kamani H; Karunanayake, Eric H; Lembring, Maria; Allen, Marie

    2015-11-01

    Diversity of the hypervariable regions (HV) I and II of the mitochondrial genome was studied in maternally unrelated Sri Lankans (N=202) from six ethnic groups (i.e.: Sinhalese, Sri Lankan Tamil, Muslim, Malay, Indian Tamil and Vedda). DNA was extracted from blood and buccal swabs and HVI and HVII regions were PCR amplified and sequenced. Resulting sequences were aligned and edited between 16024-16365 and 73-340 regions and compared with revised Cambridge reference sequences (rCRS). One hundred and thirty-five unique haplotypes and 22 shared haplotypes were observed. A total of 145 polymorphic sites and 158 polymorphisms were observed. Hypervariable region I showed a higher polymorphic variation than hypervariable region II. Nucleotide diversities were quite low and similar for all ethnicities apart from a slightly higher value for Indian Tamils and a much lower value for the Vedda population compared to the other groups. When the total population was considered South Asian (Indian) haplogroups were predominant, but there were differences in the distribution of phylo-geographical haplogroups between ethnic groups. Sinhalese, Sri Lankan Tamil and Vedda populations had a considerable presence of West Eurasian haplogroups. About 2/3rd of the Vedda population comprised of macro-haplogroup N or its subclades R and U, whereas macro-haplogroup M was predominant in all other populations. The Vedda population clustered separately from other groups and Sri Lankan Tamils showed a closer genetic affiliation to Sinhalese than to Indian Tamils. Thus this study provides useful information for forensic analysis and anthropological studies of Sri Lankans. PMID:26065620

  2. Polymorphic DNA sequences of the fungal honey bee pathogen Ascosphaera apis

    DEFF Research Database (Denmark)

    Jensen, Annette B; Welker, Dennis L; Kryger, Per;

    2012-01-01

    The pathogenic fungus Ascosphaera apis is ubiquitous in honey bee populations. We used the draft genome assembly of this pathogen to search for polymorphic intergenic loci that could be used to differentiate haplotypes. Primers were developed for five such loci, and the species specificities were...... verified using DNA from nine closely related species. The sequence variation was compared among 12 A. apis isolates at each of these loci, and two additional loci, the internal transcribed spacer of the ribosomal RNA (ITS) and a variable part of the elongation factor 1α (Ef1α). The degree of variation was...... then compared among the different loci, and three were found to have the greatest detection power for identifying A. apis haplotypes. The described loci can help to resolve strain differences and population genetic structures, to elucidate host–pathogen interaction and to test evolutionary hypotheses...

  3. Polymorphic distribution of Y-chromosome haplotype and mitochondrial DNA in the Bouyei people in China

    Institute of Scientific and Technical Information of China (English)

    李永念; 左丽; 文波; 柯越海; 黄薇; 金力

    2004-01-01

    @@ In the evolution of humans, many kinds of mutations in the human genome have been accumulated, providing credible genetic evidence for the study of human origins and migrations. The "out-of-Africa" hypothesis of modern human evolution and the genetic origin of the Japanese has come about by studying mitochondrial DNA.l,2 Recently, researchers have recognized the power of Y-chromosome markers in resolving migratory patterns of modern humans as more and more Y-chromosome single nucleotide polymorphism markers have been found. The markers on the nonrecombinant part of the Y-chromosome allows for the reconstruction of intact haplotypes which are probably the best genetic tools to study human migrations. We can analyze the paternal history of some people in different areas by Y-chromosome haplotypes.

  4. Identification of Amplified Fragment Length Polymorphism (AFLP Markers Tightly Associated with Drought Stress Gene in Male Sterile and Fertile Salvia miltiorrhiza Bunge

    Directory of Open Access Journals (Sweden)

    Hongbo Guo

    2013-03-01

    Full Text Available Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006–2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA and amplified fragment length polymorphism (AFLP with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246 was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357 was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10−93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1–5.

  5. Examining the genetic variation of reference microbial cultures used within food and environmental laboratories using fluorescent amplified fragment length polymorphism analysis.

    Science.gov (United States)

    Cross, Lisa Jane; Russell, Julie Elizabeth; Desai, Meeta

    2011-08-01

    Fluorescent amplified fragment length polymorphism (FAFLP) analysis was applied to genetically fingerprint 'working culture control strains' used by accredited food microbiology laboratories. A working culture control strain is defined as a subculture from a strain initially obtained from an authenticated source [such as the National Collection of Type Cultures (NCTC)] that is maintained for use with routine testing within the laboratory. Working culture control strains from eight food examination laboratories, representing four bacterial species, were analysed by FAFLP; these were Salmonella Nottingham, Staphylococcus aureus, Listeria monocytogenes and Bacillus cereus. The resultant FAFLP profiles of the eight working culture control strains for each of these species were compared against the appropriate freeze-dried ampoules obtained directly from NCTC. FAFLP results demonstrated that within 50% of working cultures analysed, several laboratories were routinely using working cultures that were genetically different from the original reference NCTC strains. This study highlights the need for laboratories to review the protocols used to process and maintain control strains and working cultures, with a potential view to utilize single-use quality control materials. PMID:21623896

  6. A simple and efficient method for PCR amplifiable DNA extraction from ancient bones

    OpenAIRE

    Kalmár, Tibor; Bachrati, Csanád Z.; Marcsik, Antónia; Raskó, István

    2000-01-01

    A simple and effective modified ethanol precipitation-based protocol is described for the preparation of DNA from ancient human bones. This method is fast and requires neither hazardous chemicals nor special devices. After the powdering and incubating of the bone samples Dextran Blue was added as a carrier for removing the PCR inhibitors with selective ethanol precipitation. This method could eliminate the time-consuming separate decalcification step, dialysis, application of centrifugation-d...

  7. Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

    Czech Academy of Sciences Publication Activity Database

    Šimková, Hana; Svensson, J.T.; Condamine, P.; Hřibová, Eva; Suchánková, Pavla; Bhat, P.R.; Bartoš, Jan; Šafář, Jan; Close, T.J.; Doležel, Jaroslav

    2008-01-01

    Roč. 9, č. 294 (2008), s. 1-9. ISSN 1471-2164 R&D Projects: GA ČR GD521/05/H013; GA MŠk ME 884; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Keywords : Flow cytometry * DNA amplification * Hordeum vulgare L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.926, year: 2008

  8. The enzyme-amplified amperometric DNA sensor using an electrodeposited polymer redox mediator

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    A highly sensitive method for the detection of a breast cancer-associated BRCA-1 gene is reported. The detection is based on a classical sandwich-type assay using horseradish peroxidase (HRP) as a catalytic label and electrodeposited Os2+/3+ conducting polymer (PAA-PVI-Os) as a redox mediator. Target DNA could be detected by the HRP-catalyzed reduction of H2O2, leading to a limit of detection as low as 10 fM.

  9. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer

    OpenAIRE

    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard

    1996-01-01

    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  10. Construction and use of lambda PL promoter vectors for direct cloning and high level expression of PCR amplified DNA coding sequences.

    OpenAIRE

    Cheng, X.; Patterson, T A

    1992-01-01

    A set of plasmid vectors which allow single-step cloning and expression of PCR-amplified DNA coding sequences has been constructed. The vectors contain the phage lambda PL promoter, a synthetic translation initiation region (TIR), and convenient cloning sites. The cloning sites provide all or part of an AUG translation initiation codon and facilitate the precise fusion of target DNA sequences to vector transcriptional and translational signals. The vectors were constructed with synthetic TIRs...

  11. Amplifying the SERS signal of DNA bases via the chemical resonance

    Science.gov (United States)

    Freeman, Lindsay M.; Pang, Lin; Fainman, Yeshaiahu

    2015-03-01

    Label-free detection methods of DNA bases using surface-enhanced Raman spectroscopy (SERS) have yet to be successfully utilized due to inconsistent signal readouts. We have identified the primary reason for the discrepancies in the SERS signals of nucleic acids as being caused by the charge-transfer chemical resonance of the base silver system which is dependent on excitation wavelength. Time-dependent density functional theory (TD-DFT) methods to calculate the electronic transitions and resonance Raman spectra of base silver complexes are performed, and the optimal excitation wavelength for the charge-transfer electronic transition is found for each base silver complex. The enhancement caused by the chemical resonance is then experimentally measured for adenine, cytosine, guanine and thymine at multiple excitation wavelengths. The dependence of the Raman intensity on excitation wavelength shows good agreement with the TD-DFT calculations. In order to fully achieve the maximum Raman intensity, both the electromagnetic and chemical resonance must be enhanced by the appropriate wavelength selection. Based on the optimal chemical resonance Raman wavelength, we design a SERS substrate which has an electromagnetic maximum wavelength that matches the chemical resonance wavelength. By aligning both resonances, the highest Raman intensity can be found for each base silver system. We have proven that the variance in DNA bases' Raman intensities are caused by chemical enhancement. By incorporating the chemical resonance and optimizing both the chemical and electromagnetic resonance, we believe a label-free DNA SERS based detection method can be realized.

  12. Polymorphic DNA haplotypes at the phenlalanine hydroxylase (PAH) locus in Asian families with phenylketonuria (PKU)

    Science.gov (United States)

    Daiger, Stephen P.; Reed, Lori; Huang, Shu-Shen; Zeng, Yi-Tao; Wang, Tao; Lo, Wilson H. Y.; Okano, Yoshiyuki; Hase, Yutaka; Fukuda, Y.; Oura, Toshiaki; Tada, Keiya; Woo, Savio L. C.

    1989-01-01

    DNA polymorphisms at the phenylalanine hydroxylase (PAH) locus have proved highly efiective in linkage diagnosis of phenylketonuria (PKU) in Caucasian families. More than 10 RFLP sites have been reported within the PAH structural locus in Caucasians. With information from affected and unaffected offspring in PKU families it is often possible to reconstruct complete RFLP haplotypes in parents and to use these haplotypes to follow the segregation of PKU within families and to determine the distribution of PKU chromosomes within populations. To establish the utility of these RFLPs in charaterizing Asian families with PKU, we typed eight DNA sites in 21 Chinese families and 12 Japanese families with classical PKU. The eight RFLPs were chosen for their informativeness in Caucasians. From these families we reconstructed a total of 91 complete PAH haplotypes, 44 from non-PKU chromosomes and 47 from PKU-bearing chromosomes. Although all eight marker sites are polymorphic in both Chinese and Japanese, there is much less haplotypic variation in Asians than in Caucasians. In particular, one haplotype alone, haplotype 4, accounts for more than 77% of non-PKU chromosomes and for more than 80% of PKU-bearing chromosomes. Haplotype 4 is also relatively common in Caucasians. The next most common Asian haplotype is 10 times less frequent than haplotype 4. By contrast, in many Caucasian populations the sum of the frequencies of the five most common haplotypes is still less than 80%, and several of the most common haplotypes are equally frequent. Even though the extent of haplotypic variation in Asians is severely limited, the few haplotypes that are found often differ at a number of RFLP sites. This accounts for the observation that haplotypes show little variation in Chinese and Japanese but that the individual RFLP sites are all polymorphic in both populations. It appears that these RFLPs predate the separation of Asians and Caucasians but that the haplotypic variation has either

  13. Polymorphisms in DNA repair genes, traffic-related polycyclic aromatic hydrocarbon exposure and breast cancer incidence.

    Science.gov (United States)

    Mordukhovich, Irina; Beyea, Jan; Herring, Amy H; Hatch, Maureen; Stellman, Steven D; Teitelbaum, Susan L; Richardson, David B; Millikan, Robert C; Engel, Lawrence S; Shantakumar, Sumitra; Steck, Susan E; Neugut, Alfred I; Rossner, Pavel; Santella, Regina M; Gammon, Marilie D

    2016-07-15

    Vehicular traffic polycyclic aromatic hydrocarbons (PAHs) have been associated with breast cancer incidence in epidemiologic studies, including our own. Because PAHs damage DNA by forming adducts and oxidative lesions, genetic polymorphisms that alter DNA repair capacity may modify associations between PAH-related exposures and breast cancer risk. Our goal was to examine the association between vehicular traffic exposure and breast cancer incidence within strata of a panel of nine biologically plausible nucleotide excision repair (NER) and base excision repair (BER) genotypes. Residential histories of 1,508 cases and 1,556 controls were assessed in the Long Island Breast Cancer Study Project between 1996 and 1997 and used to reconstruct residential traffic exposures to benzo[a]pyrene, as a proxy for traffic-related PAHs. Likelihood ratio tests from adjusted unconditional logistic regression models were used to assess multiplicative interactions. A gene-traffic interaction was evident (p = 0.04) for ERCC2 (Lys751); when comparing the upper and lower tertiles of 1995 traffic exposure estimates, the odds ratio (95% confidence interval) was 2.09 (1.13, 3.90) among women with homozygous variant alleles. Corresponding odds ratios for 1960-1990 traffic were also elevated nearly 2-3-fold for XRCC1(Arg194Trp), XRCC1(Arg399Gln) and OGG1(Ser326Cys), but formal multiplicative interaction was not evident. When DNA repair variants for ERCC2, XRCC1 and OGG1 were combined, among women with 4-6 variants, the odds ratios were 2.32 (1.22, 4.49) for 1995 traffic and 2.96 (1.06, 8.21) for 1960-1990 traffic. Our study is first to report positive associations between traffic-related PAH exposure and breast cancer incidence among women with select biologically plausible DNA repair genotypes. PMID:26946191

  14. Fluorescence-based Multiplex PCR-Single Strand Conformation Polymorphism (SSCP) Analysis of 16S Ribosomal DNA Using Capillary Electrophoresis

    Institute of Scientific and Technical Information of China (English)

    高鹏; 韩英; 许国旺; 赵春霞; 戴兵; 李萍; 王运铎; 温杰; 徐维家

    2004-01-01

    The rRNA genetic locus is found in all prokaryotic organisms, and is highly conservative, although its relatively stable variations are found frequently in different bacteria. The utility of this locus as a taxonomic and phylogenetic tool has been reported widely. This study, aimed at 16S rRNA gene ( 16S rDNA) and with the help of biomolecular methods, attempted to achieve the goal of rapid identification of common pathogens In this study, 333 clinical isolated pathogenic bacteria were collected。 Two pairs of primers were chosen and labeled with different fluorescent dyes and then used to amplify the genomic DNA extracted from bacteria. The PCR products were then detected by capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) . In order to pursue higher resolution and peak-separation effect, a high efficient separating medium, liner polyacrylamidedel (LPA), was put to use in this study. Finally, every bacteria colony generated distinct patterns from each other, which were easily to be used for identification.These results indicated that PCR-CE-SSCP was a rapid identification method for bacterial identification, with the aspects of high efficiency and high precision. Compared with traditional method, this technology is of great utility for clinical use especially for its high sensitivity.

  15. Association analyses of DNA polymorphisms in bovine SREBP-1, LXRα,FADS1 genes with fatty acid composition in Canadian commercial crossbred beef steers

    OpenAIRE

    Han, C.; Vinsky, M.; Aldai Elkoro-Iribe, Noelia; Dugan, M. E. R.; McAllister, T. A.; Li, C.

    2013-01-01

    Two previously reported DNA polymorphisms of sterol regulatory element binding transcription factor 1 (SREBP1) and liver X receptor alpha (LXRα) and two DNA polymorphisms of fatty acid desaturase 1 (FADS1) were evaluated for associations with fatty acids in brisket adipose tissue of Canadian cross-bred beef steers. The polymorphism of 84 bp insert/deletion in intron 5 of SREBP1 was significantly associated with the concentration of 9c C17:1 (P=0.013). The G>A single nucleotide polymorph...

  16. Molecular Polymorphisms in Tunisian Pomegranate (Punica granatum L.) as Revealed by RAPD Fingerprints

    OpenAIRE

    Jemni Chibani; Mokhtar Trifi; Messaoud Mars; Néjib Hasnaoui

    2010-01-01

    The genetic diversity among Tunisian pomegranate cultivars has been investigated. Using universal primers, the random amplified polymorphic DNA (RAPD) method was used to generate banding profiles from a set of twelve cultivars. Data was then computed with appropriate programs to construct a dendrogram illustrating the relationships between the studied cultivars. Our data proved the efficiency of the designed method to examine the DNA polymorphism in this crop since the tested primers are char...

  17. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators

    Science.gov (United States)

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui

    2016-05-01

    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples.An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the

  18. Molecular detection of genomic dna variation induced by space environment in sweet pepper (Capsicum annuum L.)

    International Nuclear Information System (INIS)

    To study effects of space environment on genomic DNA variation in the offsprings of sweet pepper, the 4th offspring and its ground control were used as materials. The genomic DNA variation was detected by random amplified polymprphic DNA (RAPD), parts of the different fragments were sequenced. The results showed that the genomic DNA of SP4 after space mutation changed compared to the ground control. Eight polymorphic bands were detected. Four polymorphic bands were amplified in the ground control and variant separately. Two special fragments were sequenced and sequence homology was 97%. So space environment could induce the changes of the genomic DNA in the offsprings of sweet pepper. (authors)

  19. Searching for association of the CAG repeat polymorphism in the mitochondrial DNA polymerase gamma gene (POLG) with colorectal cancer.

    Science.gov (United States)

    Linkowska, Katarzyna; Jawień, Arkadiusz; Marszałek, Andrzej; Skonieczna, Katarzyna; Grzybowski, Tomasz

    2015-01-01

    Mitochondrial DNA polymerase gamma (POLG) is the only DNA polymerase involved in maintaining the mitochondrial genome. Recent studies demonstrated an association of CAG repeat polymorphism in the second exon of POLG gene with the risk of cancer. We investigated the CAG repeat variability in the POLG gene in tumor and non-tumor tissues from colorectal cancer patients and in DNA samples isolated from blood obtained from age-matched healthy persons. Somatically occuring CAG-repeat alterations in cancer tissues have been observed in 10% of patients, but no association has been found between the CAG repeat variants in the POLG gene and colorectal cancer risk. PMID:26317126

  20. Evaluation of amplified rDNA restriction analysis (ARDRA for the identification of cultured mycobacteria in a diagnostic laboratory

    Directory of Open Access Journals (Sweden)

    Rottiers Sylvianne

    2002-03-01

    Full Text Available Abstract Background The development of DNA amplification for the direct detection of M. tuberculosis from clinical samples has been a major goal of clinical microbiology during the last ten years. However, the limited sensitivity of most DNA amplification techniques restricts their use to smear positive samples. On the other hand, the development of automated liquid culture has increased the speed and sensitivity of cultivation of mycobacteria. We have opted to combine automated culture with rapid genotypic identification (ARDRA: amplified rDNA restriction analysis for the detection resp. identification of all mycobacterial species at once, instead of attempting direct PCR based detection from clinical samples of M. tuberculosis only. Results During 1998–2000 a total of approx. 3500 clinical samples was screened for the presence of M. tuberculosis. Of the 151 culture positive samples, 61 were M. tuberculosis culture positive. Of the 30 smear positive samples, 26 were M. tuberculosis positive. All but three of these 151 mycobacterial isolates could be identified with ARDRA within on average 36 hours. The three isolates that could not be identified belonged to rare species not yet included in our ARDRA fingerprint library or were isolates with an aberrant pattern. Conclusions In our hands, automated culture in combination with ARDRA provides with accurate, practically applicable, wide range identification of mycobacterial species. The existing identification library covers most species, and can be easily updated when new species are studied or described. The drawback is that ARDRA is culture-dependent, since automated culture of M. tuberculosis takes on average 16.7 days (range 6 to 29 days. However, culture is needed after all to assess the antibiotic susceptibility of the strains.

  1. Association between polymorphisms in DNA repair genes and survival of non-smoking female patients with lung adenocarcinoma

    International Nuclear Information System (INIS)

    Excision repair cross-complementing group 1 (ERCC1) and group 2 (ERCC2), and X-ray repair cross-complementing group 1 (XRCC1) proteins play important roles in the repair of DNA damage and adducts. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence treatment effect and survival of cancer patients. This study aimed to investigate the relationship between polymorphisms in ERCC2, ERCC1 and XRCC1 genes and survival of non-smoking female patients with lung adenocarcinoma. We used polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to evaluate SNPs in ERCC2, ERCC1 and XRCC1 genes among 257 patients. The overall median survival time (MST) was 13.07 months. Increasing numbers of either ERCC1 118 or XRCC1 399 variant alleles were associated with shorter survival of non-smoking female lung adenocarcinoma patients (Log-rank P < 0.001). The adjusted hazard ratios (HRs) for individuals with CT or TT genotype at ERCC1 Asn118Asn were 1.48 and 2.67 compared with those with CC genotype. For polymorphism of XRCC1 399, the HRs were 1.28 and 2.68 for GA and AA genotype. When variant alleles across both polymorphisms were combined to analysis, the increasing number of variant alleles was associated with decreasing overall survival. Using the stepwise Cox regression analysis, we found that the polymorphisms in ERCC1 and XRCC1, tumor stage and chemotherapy or radiotherapy status independently predicted overall survival of non-smoking female patients with lung adenocarcinoma. Genetic polymorphisms in ERCC1 and XRCC1 genes might be prognostic factors in non-smoking female patients with lung adenocarcinoma

  2. Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE

    Directory of Open Access Journals (Sweden)

    Ile Kristina E

    2003-07-01

    Full Text Available Abstract Background The ADGE technique is a method designed to magnify the ratios of gene expression before detection. It improves the detection sensitivity to small change of gene expression and requires small amount of starting material. However, the throughput of ADGE is low. We integrated ADGE with DNA microarray (ADGE microarray and compared it with regular microarray. Results When ADGE was integrated with DNA microarray, a quantitative relationship of a power function between detected and input ratios was found. Because of ratio magnification, ADGE microarray was better able to detect small changes in gene expression in a drug resistant model cell line system. The PCR amplification of templates and efficient labeling reduced the requirement of starting material to as little as 125 ng of total RNA for one slide hybridization and enhanced the signal intensity. Integration of ratio magnification, template amplification and efficient labeling in ADGE microarray reduced artifacts in microarray data and improved detection fidelity. The results of ADGE microarray were less variable and more reproducible than those of regular microarray. A gene expression profile generated with ADGE microarray characterized the drug resistant phenotype, particularly with reference to glutathione, proliferation and kinase pathways. Conclusion ADGE microarray magnified the ratios of differential gene expression in a power function, improved the detection sensitivity and fidelity and reduced the requirement for starting material while maintaining high throughput. ADGE microarray generated a more informative expression pattern than regular microarray.

  3. Identification of a new human mtDNA polymorphism (A14290G in the NADH dehydrogenase subunit 6 gene

    Directory of Open Access Journals (Sweden)

    M. Houshmand

    2006-06-01

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited form of retinal ganglion cell degeneration leading to optic atrophy in young adults. Several mutations in different genes can cause LHON (heterogeneity. The ND6 gene is one of the mitochondrial genes that encodes subunit 6 of complex I of the respiratory chain. This gene is a hot spot gene. Fourteen Persian LHON patients were analyzed with single-strand conformational polymorphism and DNA sequencing techniques. None of these patients had four primary mutations, G3460A, G11788A, T14484C, and G14459A, related to this disease. We identified twelve nucleotide substitutions, G13702C, T13879C, T14110C, C14167T, G14199T, A14233G, G14272C, A14290G, G14365C, G14368C, T14766C, and T14798C. Eleven of twelve nucleotide substitutions had already been reported as polymorphism. One of the nucleotide substitutions (A14290G has not been reported. The A14290G nucleotide substitution does not change its amino acid (glutamic acid. We looked for base conservation using DNA star software (MEGALIGN program as a criterion for pathogenic or nonpathogenic nucleotide substitution in A14290G. The results of ND6 gene alignment in humans and in other species (mouse, cow, elegans worm, and Neurospora crassa mold revealed that the 14290th base was not conserved. Fifty normal controls were also investigated for this polymorphism in the Iranian population and two had A14290G polymorphism (4%. This study provides evidence that the mtDNA A14290G allele is a new nonpathogenic polymorphism. We suggest follow-up studies regarding this polymorphism in different populations.

  4. DNA polymorphism of HLA class II genes in systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Cowland, J B; Andersen, V; Halberg, P;

    1994-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3......- and DRw6-associated 7.00 kb DRB TaqI DNA fragment was found in SLE patients compared to normal controls (83.3% vs 35.5%; RR = 9.1, p < 10(-4). The frequencies of the DQA1*0501-associated 4.56 kb DQA TaqI fragment and the DRB3*01/03-associated 9.79 kb TaqI fragment were also found to be significantly...... increased in SLE patients (70.8% vs 29.7%; RR = 5.8, p < 10(-2) for the DQA fragment and 70.8% vs 36.1%; RR = 4.3, p < 0.05 for the DRB3 fragment). Less extensive and insignificant increases of the frequencies of the DR3-associated DQB and DPB fragments were observed. The frequencies of the DR2-associated...

  5. Detection of pathogens using on-chip electrochemical analysis of PCR amplified DNA molecules

    Science.gov (United States)

    Hodko, Dalibor; Raymer, Lindsay; Herbst, Stephanie M.; Magnuson, James W.; Gaskin, David

    2001-05-01

    The sensitivity and speed of methods for the detection of microorganisms and/or cells need to be constantly improved to provide timely and accurate analysis in large number of important applications. Such applications range from detection of pathogens in drinking water, biological warfare agents, biomedical diagnostics and food industry. The trends toward miniaturization of sensors using microfluidic and nanofluidic on-chip devices will push current detection limits to lower concentrations than what is offered by the present analytical equipment and/or detection kids. Microfluidic devices have been used to perform DNA analysis, polymerase chain reaction analysis, capillary electrophoresis and hybridization to oligonucleotide probes. This paper describes a new approach for the detection of pathogens on contaminated surfaces, which will integrated sampling, concentration and detection of targeted microorganisms.

  6. DNA Polymorphism Among Yewei B, V20B, and Oryza minuta J. S. Presl. ex C. B. Presl.

    Institute of Scientific and Technical Information of China (English)

    Bing-Ran ZHAO; Quan-Hua XING; Hong-Ai XIA; He-Hua YANG; De-Min JIN; Xia LIU; Song-Wen WANG; Bin WANG; Long-Ping YUAN

    2005-01-01

    The new cytoplasmic male sterile (CMS) line YeweiA and its maintainer line Yewei B, with better agronomic characteristics, have been developed from a mutant of V20B (a rice maintainer line) through transformation of genomic DNA of wild rice (Oryza minuta J. S. Presl. ex C. B. Presl.). Analysis of molecular markers, DNA sequences, and Southern blot revealed that high DNA polymorphism exists between the mutant and its receptor, indicating that the special DNA fragment from O. minuta may be integrated into the genome of Yewei B. Therefore, transformation of genomic DNA from distant relatives to the plant of a target receptor may open an avenue for creating a new rice germplasm.

  7. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    International Nuclear Information System (INIS)

    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  8. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  9. Decreased expression of the amplified mdr1 gene in revertants of multidrug-resistant human myelogenous leukemia K562 occurs without loss of amplified DNA.

    OpenAIRE

    Sugimoto, Y.; Roninson, I B; Tsuruo, T.

    1987-01-01

    Amplification and increased expression of the mdr1 gene associated with multidrug resistance in human tumors were found in multidrug-resistant sublines of human myelogenous leukemia K562 selected with vincristine (K562/VCR) or adriamycin (K562/ADM). In two revertant cell lines of K562/ADM, amplification of the mdr1 gene was maintained at the same level as in K562/ADM, but expression of the 4.5-kilobase mdr1 mRNA was greatly decreased, indicating that amplified genes may be inactivated at the ...

  10. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Directory of Open Access Journals (Sweden)

    Carina Ladeira

    2015-09-01

    Full Text Available Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG enzyme, it specifically detects DNA oxidative damage. The aim of this study was to investigate genotoxic effects in workers occupationally exposed to cytostatics (n = 46, as compared to a control group with no exposure (n = 46 at two Portuguese hospitals, by means of the alkaline comet assay. The potential of the OGG1 Ser326Cys polymorphism as a susceptibility biomarker was also investigated. Exposure was evaluated by investigating the contamination of surfaces and genotoxic assessment was done by alkaline comet assay in peripheral blood lymphocytes. OGG1 Ser326Cys (rs1052133 polymorphism was studied by Real Time PCR. As for exposure assessment, there were 121 (37% positive samples out of a total of 327 samples analysed from both hospitals. No statistically significant differences (Mann-Whitney test, p > 0.05 were found between subjects with and without exposure, regarding DNA damage and oxidative DNA damage, nevertheless the exposed group exhibited higher values. Moreover, there was no consistent trend regarding the variation of both biomarkers as assessed by comet assay with OGG1 polymorphism. Our study was not statistically significant regarding occupational exposure to antineoplastic drugs and genetic damage assessed by comet assay. However, health professionals should be monitored for risk behaviour, in order to ensure that safety measures are applied and protection devices are used correctly.

  11. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Directory of Open Access Journals (Sweden)

    Carina Ladeira

    2015-09-01

    Full Text Available Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG enzyme, it specifically detects DNA oxidative damage.The aim of this study was to investigate genotoxic effects in workers occupationally exposed to cytostatics (n = 46, as compared to a control group with no exposure (n = 46 at two Portuguese hospitals, by means of the alkaline comet assay. The potential of the OGG1 Ser326Cys polymorphism as a susceptibility biomarker was also investigated. Exposure was evaluated by investigating the contamination of surfaces and genotoxic assessment was done by alkaline comet assay in peripheral blood lymphocytes. OGG1 Ser326Cys (rs1052133 polymorphism was studied by Real Time PCR.As for exposure assessment, there were 121 (37% positive samples out of a total of 327 samples analysed from both hospitals. No statistically significant differences (Mann-Whitney test, p > 0.05 were found between subjects with and without exposure, regarding DNA damage and oxidative DNA damage, nevertheless the exposed group exhibited higher values. Moreover, there was no consistent trend regarding the variation of both biomarkers as assessed by comet assay with OGG1 polymorphism.Our study was not statistically significant regarding occupational exposure to antineoplastic drugs and genetic damage assessed by comet assay. However, health professionals should be monitored for risk behaviour, in order to ensure that safety measures are applied and protection devices are used correctly.

  12. Genetic polymorphisms in homologous recombination repair genes in healthy Slovenian population and their influence on DNA damage

    International Nuclear Information System (INIS)

    Homologous recombination (HR) repair is an important mechanism involved in repairing double-strand breaks in DNA and for maintaining genomic stability. Polymorphisms in genes coding for enzymes involved in this pathway may influence the capacity for DNA repair. The aim of this study was to select tag single nucleotide polymorphisms (SNPs) in specific genes involved in HR repair, to determine their allele frequencies in a healthy Slovenian population and their influence on DNA damage detected with comet assay. In total 373 individuals were genotyped for nine tag SNPs in three genes: XRCC3 722C>T, XRCC3 -316A>G, RAD51 -98G>C, RAD51 -61G>T, RAD51 1522T>G, NBS1 553G>C, NBS1 1197A>G, NBS1 37117C>T and NBS1 3474A>C using competitive allele-specific amplification (KASPar assay). Comet assay was performed in a subgroup of 26 individuals to determine the influence of selected SNPs on DNA damage. We observed that age significantly affected genotype frequencies distribution of XRCC3 -316A>G (P = 0.039) in healthy male blood donors. XRCC3 722C>T (P = 0.005), RAD51 -61G>T (P = 0.023) and NBS1 553G>C (P = 0.008) had a statistically significant influence on DNA damage. XRCC3 722C>T, RAD51 -61G>T and NBS1 553G>C polymorphisms significantly affect the repair of damaged DNA and may be of clinical importance as they are common in Slovenian population

  13. Genetic variation and species identification of Thai Boesenbergia (Zingiberaceae) analyzed by chloroplast DNA polymorphism.

    Science.gov (United States)

    Techaprasan, Jiranan; Ngamriabsakul, Chatchai; Klinbunga, Sirawut; Chusacultanachai, Sudsanguan; Jenjittikul, Thaya

    2006-07-31

    Genetic variation and molecular phylogeny of 22 taxa representing 14 extant species and 3 unidentified taxa of Boesenbergia in Thailand and four outgroup species (Cornukaempferia aurantiflora, Hedychium biflorum, Kaempferia parviflora, and Scaphochlamys rubescens) were examined by sequencing of 3 chloroplast (cp) DNA regions (matK, psbA-trnH and petA-psbJ). Low interspecific genetic divergence (0.25-1.74%) were observed in these investigated taxa. The 50% majority-rule consensus tree constructed from combined chloroplast DNA sequences allocated Boesenbergia in this study into 3 different groups. Using psbA-1F/psbA-3R primers, an insertion of 491 bp was observed in B. petiolata. Restriction analysis of the amplicon (380-410 bp) from the remaining species with Rsa I further differentiated Boesenbergia to 2 groupings; I (B. basispicata, B. longiflora, B. longipes, B. plicata, B.pulcherrima, B. tenuispicata, B. thorelii, B. xiphostachya, Boesenbergia sp.1 and Boesenbergia sp.3; phylogenetic clade A) that possesses a Rsa I restriction site and II (B.curtisii, B. regalis, B. rotunda and Boesenbergia sp.2; phylogenetic clade B and B. siamensis; phylogenetic clade C) that lacks a restriction site of Rsa I. Single nucleotide polymorphism (SNP) and indels found can be unambiguously applied to authenticate specie-origin of all investigated samples and revealed that Boesenbergia sp.1, Boesenbergia sp.2 and B. pulcherrima (Mahidol University, Kanchanaburi), B. cf. pulcherrima1 (Prachuap Khiri Khan) and B. cf. pulcherrima2 (Thong Pha Phum, Kanchanaburi) are B. plicata, B. rotunda and B. pulcherrima, respectively. In addition, molecular data also suggested that Boesenbergia sp.3 should be further differentiated from B. longiflora and regarded as a newly unidentified Boesenbergia species. PMID:16889678

  14. Polymorphisms in DNA Repair Gene XRCC3 and Susceptibility to Breast Cancer in Saudi Females

    Directory of Open Access Journals (Sweden)

    Alaa Mohammed Ali

    2016-01-01

    Full Text Available We investigated three common polymorphisms (SNPs in the XRCC3 gene (rs861539, rs1799794, and rs1799796 in 143 Saudi females suffering from breast cancer (median age = 51.4 years and 145 age matched normal healthy controls. DNA was extracted from whole blood and genotyping was conducted using PCR-RFLP. rs1799794 showed significant association, where AA and AA+AG occurred at a significantly higher frequency in the cancer patients compared to the control group (OR: 28.1; 95% CI: 3.76–21.12; χ2: 22.82; pT and rs1799796 A>G did not show a significant difference when the results in the patients and controls were compared. However, the frequency of rs1799796 differed significantly in patients with different age of diagnosis, tumor grade, and ER and HER2 status. The wild type A allele occurred at a higher frequency in the ER− and HER2− group. Our results among Saudis suggest that some variations in XRCC3 may contribute to breast cancer susceptibility. In conclusion, the results obtained during this study suggest that rs1799794 in XRCC3 shows strong association with breast cancer development in Saudi females.

  15. Characterization of porcine ENO3: genomic and cDNA structure, polymorphism and expression

    Directory of Open Access Journals (Sweden)

    Xiong Yuanzhu

    2008-09-01

    Full Text Available Abstract In this study, a full-length cDNA of the porcine ENO3 gene encoding a 434 amino acid protein was isolated. It contains 12 exons over approximately 5.4 kb. Differential splicing in the 5'-untranslated sequence generates two forms of mRNA that differ from each other in the presence or absence of a 142-nucleotide fragment. Expression analysis showed that transcript 1 of ENO3 is highly expressed in liver and lung, while transcript 2 is highly expressed in skeletal muscle and heart. We provide the first evidence that in skeletal muscle expression of ENO3 is different between Yorkshire and Meishan pig breeds. Furthermore, real-time polymerase chain reaction revealed that, in Yorkshire pigs, skeletal muscle expression of transcript 1 is identical at postnatal day-1 and at other stages while that of transcript 2 is higher. Moreover, expression of transcript 1 is lower in skeletal muscle and all other tissue samples than that of transcript 2, with the exception of liver and kidney. Statistical analysis showed the existence of a polymorphism in the ENO3 gene between Chinese indigenous and introduced commercial western pig breeds and that it is associated with fat percentage, average backfat thickness, meat marbling and intramuscular fat in two different populations.

  16. The L84F polymorphic variant of human O6-methylguanine-DNA methyltransferase alters stability in U87MG glioma cells but not temozolomide sensitivity

    OpenAIRE

    Remington, Maya; Chtchetinin, Jana; Ancheta, Karen; Nghiemphu, Phioanh Leia; Cloughesy, Timothy; Lai, Albert

    2009-01-01

    First-line therapy for patients with glioblastoma multiforme includes treatment with radiation and temozolomide (TMZ), an oral DNA alkylating chemotherapy. Sensitivity of glioma cells to TMZ is dependent on the level of cellular O6-methylguanine-DNA methyltransferase (MGMT) repair activity. Several common coding- region polymorphisms in the MGMT gene (L84F and the linked pair I143V/K178R) modify functional characteristics of MGMT and cancer risk. To determine whether these polymorphic changes...

  17. DNA polymorphism and risk of esophageal squamous cell carcinoma in a population of North Xinjiang,China

    Institute of Scientific and Technical Information of China (English)

    Ilyar; Sheyhidin

    2010-01-01

    AIM:To investigate the role of metabolic enzyme and DNA repair genes in susceptibility of esophageal squamous cell carcinoma(ESCC). METHODS:A case-control study was designed with 454 samples from 128 ESCC patients and 326 gender, age and ethnicity-matched control subjects.Genotypes of 69 single nucleotide polymorphisms(SNPs)of metabolic enzyme(aldehyde dehydrogenase-2,ALDH2; alcohol dehydrogenase-1 B,ADHB1;Cytochrome P450 2A6,CYP2A6)and DNA repair capacity genes(excision repair cross complementing group 1,E...

  18. The R46Q, R131Q and R154H Polymorphs of Human DNA Glycosylase/β-Lyase hOgg1 Severely Distort the Active Site and DNA Recognition Site but do not Cause Unfolding†

    OpenAIRE

    Anderson, Peter C.; Daggett, Valerie

    2009-01-01

    Reactive oxygen species can cause widespread cellular damage, including base alterations and strand breaks in DNA. An array of DNA-repair enzymes constitutes an essential part of the line of defense that cells use against oxidative damage to the genome. A DNA glycosylase/β-lyase enzyme, Ogg1, scavenges the genome for 8-oxoguanine, a major mutagenic DNA adduct induced by reactive oxygen species, and catalyzes its excision and subsequent cleavage of the DNA phosphate backbone. Several polymorph...

  19. Homocysteine metabolism and the associations of global DNA methylation with selected gene polymorphisms and nutritional factors in patients with dementia.

    Science.gov (United States)

    Bednarska-Makaruk, Małgorzata; Graban, Ałła; Sobczyńska-Malefora, Agata; Harrington, Dominic J; Mitchell, Michael; Voong, Kieran; Dai, Letian; Łojkowska, Wanda; Bochyńska, Anna; Ryglewicz, Danuta; Wiśniewska, Anna; Wehr, Hanna

    2016-08-01

    Epigenetics (particularly DNA methylation) together with environmental and genetic factors, are key to understanding the pathogenesis of many diseases including dementia. Disturbances in DNA methylation have already been implicated in dementia. Homocysteine metabolism, with folate and vitamin B12 as essential cofactors, is integral to methylation processes. We evaluated in a case-control study the association of global DNA methylation, homocysteine, folate and vitamin B12 status with dementia. Selected polymorphisms of genes previously associated with dementia development and the influence of various factors on DNA methylation were also investigated. 102 patients with dementia (53 with Alzheimer's disease, 17 with vascular dementia and 32 with mixed dementia) were recruited. The non-demented controls consisted of 45 age-matched subjects without dementia and 47 individuals with mild cognitive impairment. Global DNA methylation was determined by Imprint Methylated DNA Quantification Kit MDQ1 (Sigma-Aldrich, Gillingham, Dorset, UK). Plasma homocysteine, serum folate and vitamin B12 were determined by chemiluminescence. Plasma and erythrocyte 5-methyltetrahydrofolate and plasma methylmalonic acid (markers of folate and vitamin B12 status) were measured by HPLC. APOE, PON1 p.Q192R, MTHFR 677C>T (c.665C>T) and IL1B-511C>T polymorphisms were identified using PCR-RFLP methods. Patients with dementia had significantly higher concentrations of homocysteine (p=0.012) and methylmalonic acid (p=0.016) and lower folate (p=0.002) and plasma 5-methyltetrahydrofolate (p=0.005) than non-demented subjects. There was no difference in DNA methylation between patients and controls. A non-significant tendency to higher DNA methylation in patients with vascular dementia (p=0.061) was observed. Multivariate regression analysis of all recruited individuals demonstrated a significant positive association between DNA methylation and folate (p=0.013), creatinine (p=0.003) concentrations and IL

  20. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH)

    Institute of Scientific and Technical Information of China (English)

    Ke BI; James P.BOGART; Jinzhong FU

    2009-01-01

    The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA). Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution [Current Zoology 55(2):145-149,2009].

  1. Development of Amplified 16S Ribosomal DNA Restriction Analysis for Identification of Actinomyces Species and Comparison with Pyrolysis-Mass Spectrometry and Conventional Biochemical Tests

    OpenAIRE

    Hall, Val; O’Neill, G. L.; Magee, J T; Duerden, B I

    1999-01-01

    Identification of Actinomyces spp. by conventional phenotypic methods is notoriously difficult and unreliable. Recently, the application of chemotaxonomic and molecular methods has clarified the taxonomy of the group and has led to the recognition of several new species. A practical and discriminatory identification method is now needed for routine identification of clinical isolates. Amplified 16S ribosomal DNA restriction analysis (ARDRA) was applied to reference strains (n = 27) and clinic...

  2. Frequency distribution of DNA repair genes ERCC1 and ERCC2 polymorphisms in South Indian healthy population.

    Science.gov (United States)

    Rao, Katiboina Srinivasa; SureshKumar, Srinivasamurthy; Umamaheswaran, Gurusamy; Paul, Abialbon; Dubashi, Biswajit; Gunaseelan, Karunanithi; Dkhar, Steven Aibor

    2014-09-01

    DNA repair genes are crucial in maintaining the integrity of the whole genome. Single nucleotide polymorphisms (SNPs) in DNA repair genes have been attributed to the development of various cancers. SNPs of DNA repair genes (ERCC1 and ERCC2) have been implicated in the causation of various cancers as well as inter-individual variability in the therapeutic outcomes of platinum based therapy. Thus establishing the frequency of these functional SNPs in the healthy population is of significance. The present study was aimed to establish the allele and genotype frequencies of ERCC1 (19007C>T, rs11615; 8092C>A, rs3212986) and ERCC2 (Asp312Asn, rs1799793) genes in South Indian healthy population and to compare the data from HapMap populations. The study population consisted of 128 healthy South Indian unrelated individuals of either sex aged between 18 and 60 years. Standard phenol-chloroform method was used to extract DNA from peripheral leukocytes. The genotype of DNA repair gene polymorphisms was determined by quantitative real-time polymerase chain reaction using TaqMan genotyping assay. The observed frequency of the studied polymorphisms followed Hardy-Weinberg equilibrium (p>0.05). The frequencies of the minor alleles of the SNPs rs11615 (T), rs3212986 (A) and rs1799793 (A) were 43.8%, 29.3% and 35.6%, respectively. Gender-based analysis showed no significant difference in the frequency pattern. The observed allele and genotype frequencies showed significant ethnic difference between South Indians and other HapMap populations. This is the first study to provide the normative frequency data of allele and genotype distribution of three SNPs of ERCC1 and ERCC2 in South Indian healthy population. It might be useful in future genotype-phenotype association studies, especially for predicting the efficacy and adverse events of platinum based drugs. PMID:25155628

  3. Practical identification of human originated Lactobacillus species by amplified ribosomal DNA restriction analysis (ARDRA) for probiotic use.

    Science.gov (United States)

    Öztürk, Mehmet; Meterelliyöz, Merve

    2015-08-01

    Probiotics are gaining popularity and increasing the importance of their accurate speciation. Lactobacillus species are commonly used as probiotic strains mostly of clinical importance. Present knowledge indicates that at least 14 Lactobacillus species are associated with the human intestinal tract. Currently, researchers are interested in developing efficient techniques for screening and selecting probiotics bacteria, but unfortunately most of these methods are time-consuming, labor-intensive and costly. The aim of this study is to develop reliable, rapid and accurate method to identify 14 references Lactobacillus species that could have been found in the human alimentary tract by 16S ribosomal DNA restriction analysis. In this study, to develop an effective method for the genotype-based identification of the reference Lactobacillus species, 1.5 kb of 16S rRNA nucleotide sequences of 14 Lactobacillus were collected from the Gene Bank aligned, in silico restricted and analyzed in respect to their 16S-rRNA restriction fragment polymorphism. In silico restriction profiles of 16S-rRNA indicated that FspBI, HinfI and DraI restriction enzymes (RE) are convenient for differentiation of 14 Lactobacillus species in human intestinal tract except Lb. casei and Lb. paracasei. The patterns of our experimental findings obtained from 16S PCR-ARDRA completely confirmed our in silico patterns. The present work demonstrated that 16S PCR-ARDRA method with FspBI, HinfI and DraI RE is a rapid, accurate and reliable method for the identification of Lactobacillus species from human alimentary tract, especially during the identification of large numbers of isolates and any laboratory equipped with a thermo cycler for probiotic use. PMID:25860079

  4. Junk DNA. Not so junky after all

    International Nuclear Information System (INIS)

    Microsatellites, or simple sequence repeats, are considered to be junk DNA. Yet their exploitation in DNA profiling techniques has expanded the repertoire of useful sequences for plant biologists. Some old and new techniques involving microsatellites are portrayed, such as microsatellite fingerprinting, microsatellite primed polymerase chain reaction (PCR), anchored microsatellite primed PCR, random amplified (microsatellite) polymorphic DNA (RAPD) analysis, the generation of microsatellite fingerprints in RAPDs and the production of sequence tagged microsatellite sites. (author). 8 refs

  5. Epigenetic structure and the role of polymorphism in the shaping of DNA methylation patterns of equine OAS1 locus.

    Science.gov (United States)

    Ząbek, T; Semik, E; Wnuk, M; Fornal, A; Gurgul, A; Bugno-Poniewierska, M

    2015-05-01

    DNA methylation patterns and their relation with genetic polymorphisms were determined in the equine OAS1 locus. Genetic variants of OAS1 were previously found to be associated with susceptibility to West Nile virus infections in horses. The subject of the study were white blood cells of 13 juvenile and 13 old horses from AA and HC breed and a set of solid tissues from a single adult horse. The aim was to determine the degree of variation of CpG methylation profiles with concern for tissue type, horse breed and age. Results of direct BSPCR and cloned BSPCR sequencing revealed that all of determined CpG islands (CGIs) were hypermethylated in exception to CGI covering OAS1 promoter and exon 1. One of intragenic CGIs displayed variability of methylation patterns across eight tissue types. The variability of particular sub-types of white blood cells between AA and HC horses were considered as the possible cause of interbreed differences of methylation levels. Comparison of sequence variability between converted and unconverted DNAs of both horse breeds showed polymorphisms of CpG sites to be the source of monoallelic methylation in exception to the polymorphic CpGs located in the OAS1 promoter. Two of them are new polymorphic variants in the OAS1 promoter region. Application of methylation data in conjunction with genetic variation detected at the OAS1 locus might be useful to deepen the knowledge about mechanisms underlying immunity to viral infections in the horse. PMID:25195205

  6. Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data.

    Science.gov (United States)

    Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu

    2016-03-01

    Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon. PMID:27162496

  7. Direct RAPD evaluation of bacteria without conventional DNA extraction

    OpenAIRE

    Welington Luiz Araújo; Derlene Attili de Angellis; João Lúcio de Azevedo

    2004-01-01

    The present work reports successful DNA amplification of Pantoea agglomerans and Bacillus pumilus through Random Amplified Polymorphic DNA (RAPD). For this, template DNA was obtained without conventional DNA extraction. The procedure was as follows: cultures grown for 20 hours in 5 mL LB medium were centrifuged and the resulting preparation was suspended in TE buffer. After boiling, the cell suspension was diluted and 2.0 µl were used in reactions of 15 µl. The results showed no significant d...

  8. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    Science.gov (United States)

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  9. Partial digestion with restriction enzymes of ultraviolet-irradiated human genomic DNA: a method for identifying restriction site polymorphisms

    International Nuclear Information System (INIS)

    A method for partial digestion of total human DNA with restriction enzymes has been developed on the basis of a principle already utilized by P.A. Whittaker and E. Southern for the analysis of phage lambda recombinants. Total human DNA irradiated with uv light of 254 nm is partially digested by restriction enzymes that recognize sequences containing adjacent thymidines because of TT dimer formation. The products resulting from partial digestion of specific genomic regions are detected in Southern blots by genomic-unique DNA probes with high reproducibility. This procedure is rapid and simple to perform because the same conditions of uv irradiation are used for different enzymes and probes. It is shown that restriction site polymorphisms occurring in the genomic regions analyzed are recognized by the allelic partial digest patterns they determine

  10. Molecular discrimination of six species of Bagrid catfishes from Indus river system using randomly amplified polymorphic DNA markers.

    Science.gov (United States)

    Saini, Archana; Dua, Anish; Mohindra, Vindhya; Lakra, W S

    2011-06-01

    Bagrid catfishes constitute a very important group of fishes having immense commercial importance in south-east countries. The phylogenetic relationships and genome specificity among six species of Bagrid catfishes (Mystus bleekeri, M. cavasius, M. vittatus, M. tengara, M. aor and M. seenghala) were investigated using RAPD markers as discriminating characters for the first time. 511 RAPD fragments were generated using ten decamer primers of arbitrary nucleotide sequences. Amplification reactions resulted in fragments ranging in length between 92 and 2,863 bp, which were assigned to 155 RAPD loci. Clearly resolved and repeatable bands were scored for their presence or absence in a binary matrix. Different RAPD profiles were observed for all the six Mystus species. In the present study three group diagnostic, eleven group exclusive and 18 species-specific markers were generated. Thus six Mystus species can be successfully differentiated on the basis of these 18 species-specific RAPD markers. UPGMA dendrogram constructed on the basis of genetic distance formed two distinct clusters, M. seenghala and M. aor form one separate cluster from other four species i.e., M. tengara, M. cavasius, M. bleekeri and M. vittatus. The inferences drawn from the above study clearly showed their genetic distinctness from the other four Mystus species and supported their inclusion into a separate genus, Sperata. PMID:20127179

  11. Association Between Single Nucleotide Polymorphisms in DNA Polymerase Kappa Gene and Breast Cancer Risk in Chinese Han Population: A STROBE-Compliant Observational Study.

    Science.gov (United States)

    Dai, Zhi-Jun; Liu, Xing-Han; Ma, Yun-Feng; Kang, Hua-Feng; Jin, Tian-Bo; Dai, Zhi-Ming; Guan, Hai-Tao; Wang, Meng; Liu, Kang; Dai, Cong; Yang, Xue-Wen; Wang, Xi-Jing

    2016-01-01

    DNA polymerases are responsible for ensuring stability of the genome and avoiding genotoxicity caused by a variety of factors during DNA replication. Consequently, these proteins have been associated with an increased cancer risk. DNA polymerase kappa (POLK) is a specialized DNA polymerase involved in translesion DNA synthesis (TLS) that allows DNA synthesis over the damaged DNA. Recently, some studies investigated relationships between POLK polymorphisms and cancer risk, but the role of POLK genetic variants in breast cancer (BC) remains to be defined. In this study, we aimed to evaluate the effects of POLK polymorphisms on BC risk.We used the Sequenom MassARRAY method to genotype 3 single nucleotide polymorphisms (SNPs) in POLK (rs3213801, rs10077427, and rs5744533), in order to determine the genotypes of 560 BC patients and 583 controls. The association of genotypes and BC was assessed by computing the odds ratio (OR) and 95% confidence intervals (95% CIs) from logistic regression analyses.We found a statistically significant difference between patient and control groups in the POLK rs10077427 genotypic groups, excluding the recessive model. A positive correlation was also found between positive progesterone receptor (PR) status, higher Ki67 index, and rs10077427 polymorphism. For rs5744533 polymorphism, the codominant, dominant, and allele models frequencies were significantly higher in BC patients compared to healthy controls. Furthermore, our results indicated that rs5744533 SNP has a protective role in the postmenopausal women. However, we failed to find any associations between rs3213801 polymorphism and susceptibility to BC.Our results indicate that POLK polymorphisms may influence the risk of developing BC, and, because of this, may serve as a prognostic biomarker among Chinese women. PMID:26765445

  12. High-throughput discovery of chloroplast and mitochondrial DNA polymorphisms in Brassicaceae species by ORG-EcoTILLING.

    Directory of Open Access Journals (Sweden)

    Chang-Li Zeng

    Full Text Available BACKGROUND: Information on polymorphic DNA in organelle genomes is essential for evolutionary and ecological studies. However, it is challenging to perform high-throughput investigations of chloroplast and mitochondrial DNA polymorphisms. In recent years, EcoTILLING stands out as one of the most universal, low-cost, and high-throughput reverse genetic methods, and the identification of natural genetic variants can provide much information about gene function, association mapping and linkage disequilibrium analysis and species evolution. Until now, no report exists on whether this method is applicable to organelle genomes and to what extent it can be used. METHODOLOGY/PRINCIPAL FINDINGS: To address this problem, we adapted the CEL I-based heteroduplex cleavage strategy used in Targeting Induced Local Lesions in Genomes (TILLING for the discovery of nucleotide polymorphisms in organelle genomes. To assess the applicability and accuracy of this technology, designated ORG-EcoTILLING, at different taxonomic levels, we sampled two sets of taxa representing accessions from the Brassicaceae with three chloroplast genes (accD, matK and rbcL and one mitochondrial gene (atp6. The method successfully detected nine, six and one mutation sites in the accD, matK and rbcL genes, respectively, in 96 Brassica accessions. These mutations were confirmed by DNA sequencing, with 100% accuracy at both inter- and intraspecific levels. We also detected 44 putative mutations in accD in 91 accessions from 45 species and 29 genera of seven tribes. Compared with DNA sequencing results, the false negative rate was 36%. However, 17 SNPs detected in atp6 were completely identical to the sequencing results. CONCLUSIONS/SIGNIFICANCE: These results suggest that ORG-EcoTILLING is a powerful and cost-effective alternative method for high-throughput genome-wide assessment of inter- and intraspecific chloroplast and mitochondrial DNA polymorphisms. It will play an important role in

  13. Influence of SNP Polymorphisms in DNA Repair Genes on the Level of Persistent Damage in Human Lymphocytes After Exposure to 2 Gy of Ionising Radiation

    International Nuclear Information System (INIS)

    Variation in cell response to ionising radiation could be result of changes in gene expression and/or polymorphisms of DNA repair genes. The aim of the study was to estimate the DNA damage level in human lymphocytes after exposure to 2 Gy of ionising radiation. Medical workers occupationally exposed to low doses of ionising radiation (N = 20) and matched controls (N 20) were genotyped for polymorphic hOGG1, XRCC1, APE1, XPD10, XPD23, XRCC3, PARP1 and MGMT genes. Micronucleus (MN) test was used for the estimation of DNA damage before and after radiation. Incidence of MN in irradiated samples positively correlated with age and negatively with polymorphic variants of XPD23. Significant difference was observed between irradiated homozygotes (HO) and heterozygotes (HE). HO and HE APE1 differed in MN before exposure. HO and polymorphic variants of XPD10 differed in MN after exposure. Gender showed different MN in the exposed group after exposure. Age correlated positively with MN after exposure, working probation and received dose. Multiple regression analysis revealed connection between polymorphic variants of APE1 and XRCC3 with MN before exposure. These results confirm the value of micronucleus assay in DNA damage estimation and suggest possible use of polymorphic genes in monitoring of individuals professionaly exposed to ionising radiation. (author)

  14. Genetic Analysis of Diversity within a Chinese Local Sugarcane Germplasm Based on Start Codon Targeted Polymorphism

    OpenAIRE

    Youxiong Que; Yongbao Pan; Yunhai Lu; Cui Yang; Yuting Yang; Ning Huang; Liping Xu

    2014-01-01

    In-depth information on sugarcane germplasm is the basis for its conservation and utilization. Data on sugarcane molecular markers are limited for the Chinese sugarcane germplasm collections. In the present study, 20 start codon targeted (SCoT) marker primers were designed to assess the genetic diversity among 107 sugarcane accessions within a local sugarcane germplasm collection. These primers amplified 176 DNA fragments, of which 163 were polymorphic (92.85%). Polymorphic information conten...

  15. Genetic polymorphisms and possible gene-gene interactions in metabolic and DNA repair genes: Effects on DNA damage

    Czech Academy of Sciences Publication Activity Database

    Naccarati, Alessio; Souček, P.; Štětina, R.; Haufroid, V.; Kumar, R.; Vodičková, Ludmila; Trtková, K.; Dušinská, M.; Hemminki, K.; Vodička, Pavel

    2006-01-01

    Roč. 593, 1-2 (2006), s. 22-31. ISSN 0027-5107 R&D Projects: GA ČR GA310/03/0437 Institutional research plan: CEZ:AV0Z5039906 Keywords : Single-strand breaks * Genetic polymorphisms * Metabolism Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.111, year: 2006

  16. Can the occurrence of rare insertion/deletion polymor-phisms in human mtDNA beverified from phylogeny?

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Due to its specific characteristics, such as maternal inheritance and absence of recombination, each mtDNA belongs to certain monophyletic clade in the rooted mtDNA tree (haplogroup) according to the mutations it harbors. Rare mutation (excluding parallel mutation) occurring at multiple times in different haplogroups could thus be a potential reading error according to the mtDNA phylogeny. This experience has been widely used in double-checking the credibility of the rare mutations in human mtDNA sequences. However, no test has been performed so far for the feasibility of applying this strategy to the rare insertion/deletion (indel) events in mtDNA sequences. In this study, we attempted to relate the rare indels in mtDNAs to their haplogroup status in a total of 2352 individuals from 50 populations in China. Our results show that the insertion of A at position 16259 is restricted to a subclade of haplogroup C and can be verified. The other indel polymorphisms, which occur in the repeat of the deleted or inserted nucleotide(s), may not be distinguished from phantom mutations from a phylogenetic point of view. Independently and multiply sequencing the fragment with the indel is the best and the most reliable way for confirmation.

  17. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    Science.gov (United States)

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  18. Analysis of the rDNA internal transcribed spacer region of the Fusarium species by polymerase chain reaction-restriction fragment length polymorphism

    OpenAIRE

    Zarrin, Majid; GANJ, FARZANEH; FARAMARZI, SAMA

    2016-01-01

    The Fusarium species are a widely spread phytopathogen identified in an extensive variety of hosts. The Fusarium genus is one of the most heterogeneous fungi and is difficult to classify. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis is a useful method in detection of DNA polymorphism in objective sequences. The aim of the present study was to identify the phylogenetic associations and usefulness of the internal transcribed spacer (ITS) region as a gen...

  19. [Tissue-specific Changes in the Polymorphism of Simple Repeats in DNA of the Offspring of Different Sex Born from Irradiated Male or Female Mice].

    Science.gov (United States)

    Lomaeva, M G; Fomenko, L A; Vasil'eva, G V; Bezlepkin, V G

    2016-01-01

    Evidence is presented indicating the differences in the polymorphism of microsatellite (MCS) repeats in DNA of somatic tissues in the offspring of BALB/c mice of different sex born from preconceptionally irradiated males or females. Brother-sister groups of the offspring born by non-irradiated parental pairs were compared with the offspring obtained after the irradiation of one parent in the same pairs. The number of MCS repeats in DNA of somatic tissues of the offspring from irradiated males or females was compared by a polymerase chain reaction using an arbitrary primer. It was found that changes in the polymorphism of the number of MCS repeats in the offspring from the males irradiated at a dose of 2 Gy was insignificant as compared with the offspring from control animals. In the offspring born by the females irradiated at a dose of 2 Gy (which does not impair the reproductive capacity), a statistically significant increase in the polymorphism was observed. Changes in the polymorphism were different in the offspring of different sex. A higher level of polymorphism was revealed in the female offspring born from the females of the F0 generation after their irradiation at a dose of 2 Gy. The increase in the polymorphism of the number of MCS repeats in DNA was more pronounced in postmitotic tissues compared with proliferating tissues. PMID:27534065

  20. The ERCC2/XPD Lys751Gln polymorphism affects DNA repair of benzo[a]pyrene induced damage, tested in an in vitro model.

    Science.gov (United States)

    Xiao, Sha; Cui, Su; Lu, Xiaobo; Guan, Yangyang; Li, Dandan; Liu, Qiufang; Cai, Yuan; Jin, Cuihong; Yang, Jinghua; Wu, Shengwen; van der Straaten, Tahar

    2016-08-01

    Nucleotide excision repair (NER) is an important defense mechanism of the body to exogenous carcinogens and mutagens, such as benzo[a]pyrene (B[a]P). Genetic polymorphisms in ERCC2/XPD, a critical element in NER, are thought to be associated with individual's cancer susceptibility. Although ERCC2/XPD Lys751Gln (rs13181) is the most studied polymorphism, the impact of this polymorphism on DNA repair capacity to carcinogen remains unclear. In the present study, cDNA clones carrying different genotypes of ERCC2/XPD (Lys751Gln) were introduced into an ERCC2/XPD deficient cell line (UV5) in a well-controlled biological system. After B[a]P treatment, cell growth inhibition rates and DNA damage levels in all cells were detected respectively. As expected, we found that the DNA repair capacity in UV5 cells was restored to levels similar to wildtype parent AA8 cells upon introduction of the cDNA clone of ERCC2/XPD (Lys751). Interestingly, after B[a]P treatment, transfected cells expressing variant ERCC2/XPD (751Gln) showed an enhanced cellular sensitivity and a diminished DNA repair capacity. The wildtype genotype AA (Lys) was found to be associated with a higher DNA repair capacity as compared to its polymorphic genotype CC (Gln). These data indicate that ERCC2/XPD Lys751Gln polymorphism affects DNA repair capacity after exposure to environmental carcinogens such as B[a]P in this well-controlled in vitro system and could act as a biomarker to increase the predictive value to develop cancer. PMID:27139774

  1. Microsatellite DNA polymorphisms and the relation with body weight in sea cucumber Apostichopus japonicus

    Institute of Scientific and Technical Information of China (English)

    WANG Xiuli; SHAN Xue; QIU Xuemei; MENG Xiangying; CHANG Yaqing

    2009-01-01

    The relationship between microsatellite polymorphism and body weight of captive bred Chinese sea cucumber Apostichopus japonicus was investigated in two local populations in Dalian.Among ten loci discovered, nine show changes except for A J07 loci. Seven loci were found highly polymorphic in both populations. For each locus in two populations, the average number of alleles is 6.428 6 and 6.285 7, the average observed heterozygosity at 0.225 7 and 0.245 9, the expected heterozygosity at 0.776 8 and 0.748 8, the polymorphism information content (PIC) at 0.709 2 and 0.674 6, respectively. Further analysis show significant correlation between A. japonicus body weight and occurrence markers AJ02 and AJ04. The findings of the relation may be helpful for molecular breeding,as well as the marker-assisted selection of sea cucumbers.

  2. Microsatellite DNA polymorphisms and the relation with body weight in sea cucumber Apostichopus japonicus

    Science.gov (United States)

    Wang, Xiuli; Shan, Xue; Qiu, Xuemei; Meng, Xiangying; Chang, Yaqing

    2009-05-01

    The relationship between microsatellite polymorphism and body weight of captive bred Chinese sea cucumber Apostichopus japonicus was investigated in two local populations in Dalian. Among ten loci discovered, nine show changes except for AJ07 loci. Seven loci were found highly polymorphic in both populations. For each locus in two populations, the average number of alleles is 6.428 6 and 6.285 7, the average observed heterozygosity at 0.225 7 and 0.245 9, the expected heterozygosity at 0.776 8 and 0.748 8, the polymorphism information content (PIC) at 0.709 2 and 0.674 6, respectively. Further analysis show significant correlation between A. japonicus body weight and occurrence markers AJ02 and AJ04. The findings of the relation may be helpful for molecular breeding, as well as the marker-assisted selection of sea cucumbers.

  3. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  4. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    Science.gov (United States)

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  5. Effect of the XRCC1 codon 399 polymorphism on the repair of vinyl chloride metabolite-induced DNA damage

    Directory of Open Access Journals (Sweden)

    Li Yongliang

    2009-01-01

    Full Text Available Background: Recent epidemiologic evidence suggests that the common polymorphism at amino acid residue 399 of the x-ray cross complementing-1 (XRCC1 protein, a key component of the base excision repair (BER pathway for DNA damage, plays a significant role in the genetic variability of individuals in terms of the mutagenic damage they experience following exposure to the carcinogen vinyl chloride (VC. The aim of this study was to provide support for the biological plausibility of these epidemiologic observations with experimental data derived from cell lines in culture from individuals who were either homozygous wild-type or homozygous variant for this XRCC1 polymorphism following exposure to chloroethylene oxide (CEO, the active metabolite of VC, with measurement of the induced etheno-DNA adducts before and after repair. Materials and Methods: Immortalized lymphoblast cell lines from seven VC workers (four homozygous wild-type and three homozygous variant for the 399 XRCC1 polymorphism were exposed to CEO, and etheno-adenosine (εA adduct levels were determined by enzyme-linked immunosorbent assay (ELISA pre-exposure and at 0, 4, 8 and 24 h following exposure. Results: The average εA adduct levels were statistically significantly higher in the variant cells compared to the wild-type cells at 8 and 24 h following exposure (P< 0.05 with an overall average repair efficiency of 32% in the variant cells compared to 82% in the wild-type cells. Conclusion: These results are consistent with the epidemiologic findings of the types of VC-induced biomarkers observed in exposed individuals and the mutational spectra found in the resultant tumors as well as the key role that BER, especially XRCC1, plays in this carcinogenic pathway.

  6. Mitochondrial bioenergetics and drug-induced toxicity in a panel of mouse embryonic fibroblasts with mitochondrial DNA single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Claudia V.; Oliveira, Paulo J. [CNC—Center for Neuroscience and Cell Biology, University of Coimbra (Portugal); Will, Yvonne [Compound Safety Prediction, Pfizer Global Research and Development, Groton, CT (United States); Nadanaciva, Sashi, E-mail: sashi.nadanaciva@pfizer.com [Compound Safety Prediction, Pfizer Global Research and Development, Groton, CT (United States)

    2012-10-15

    Mitochondrial DNA (mtDNA) variations including single nucleotide polymorphisms (SNPs) have been proposed to be involved in idiosyncratic drug reactions. However, current in vitro and in vivo models lack the genetic diversity seen in the human population. Our hypothesis is that different cell strains with distinct mtDNA SNPs may have different mitochondrial bioenergetic profiles and may therefore vary in their response to drug-induced toxicity. Therefore, we used an in vitro system composed of four strains of mouse embryonic fibroblasts (MEFs) with mtDNA polymorphisms. We sequenced mtDNA from embryonic fibroblasts isolated from four mouse strains, C57BL/6J, MOLF/EiJ, CZECHII/EiJ and PERA/EiJ, with the latter two being sequenced for the first time. The bioenergetic profile of the four strains of MEFs was investigated at both passages 3 and 10. Our results showed that there were clear differences among the four strains of MEFs at both passages, with CZECHII/EiJ having a lower mitochondrial robustness when compared to C57BL/6J, followed by MOLF/EiJ and PERA/EiJ. Seven drugs known to impair mitochondrial function were tested for their effect on the ATP content of the four strains of MEFs in both glucose- and galactose-containing media. Our results showed that there were strain-dependent differences in the response to some of the drugs. We propose that this model is a useful starting point to study compounds that may cause mitochondrial off-target toxicity in early stages of drug development, thus decreasing the number of experimental animals used. -- Highlights: ► mtDNA SNPs may be linked to individual predisposition to drug-induced toxicity. ► CZECHII/EiJ and PERA/EiJ mtDNA was sequenced for the first time in this study. ► Strain-dependent mitochondrial capacity differences were measured. ► Strain-dependent differences in response to mitochondrial toxicants were observed.

  7. Mitochondrial bioenergetics and drug-induced toxicity in a panel of mouse embryonic fibroblasts with mitochondrial DNA single nucleotide polymorphisms

    International Nuclear Information System (INIS)

    Mitochondrial DNA (mtDNA) variations including single nucleotide polymorphisms (SNPs) have been proposed to be involved in idiosyncratic drug reactions. However, current in vitro and in vivo models lack the genetic diversity seen in the human population. Our hypothesis is that different cell strains with distinct mtDNA SNPs may have different mitochondrial bioenergetic profiles and may therefore vary in their response to drug-induced toxicity. Therefore, we used an in vitro system composed of four strains of mouse embryonic fibroblasts (MEFs) with mtDNA polymorphisms. We sequenced mtDNA from embryonic fibroblasts isolated from four mouse strains, C57BL/6J, MOLF/EiJ, CZECHII/EiJ and PERA/EiJ, with the latter two being sequenced for the first time. The bioenergetic profile of the four strains of MEFs was investigated at both passages 3 and 10. Our results showed that there were clear differences among the four strains of MEFs at both passages, with CZECHII/EiJ having a lower mitochondrial robustness when compared to C57BL/6J, followed by MOLF/EiJ and PERA/EiJ. Seven drugs known to impair mitochondrial function were tested for their effect on the ATP content of the four strains of MEFs in both glucose- and galactose-containing media. Our results showed that there were strain-dependent differences in the response to some of the drugs. We propose that this model is a useful starting point to study compounds that may cause mitochondrial off-target toxicity in early stages of drug development, thus decreasing the number of experimental animals used. -- Highlights: ► mtDNA SNPs may be linked to individual predisposition to drug-induced toxicity. ► CZECHII/EiJ and PERA/EiJ mtDNA was sequenced for the first time in this study. ► Strain-dependent mitochondrial capacity differences were measured. ► Strain-dependent differences in response to mitochondrial toxicants were observed.

  8. Use PCR and a Single Hair To Produce a "DNA Fingerprint."

    Science.gov (United States)

    Campbell, A. Malcolm; And Others

    1997-01-01

    Presents a laboratory procedure that involves students extracting their own DNA from a single hair follicle, using the polymerase chain reaction (PCR) to amplify a polymorphic locus, performing electrophoresis on the PCR products on an agarose gel, and visualizing the alleles to generate a "DNA fingerprint." Discusses theoretical background,…

  9. An association analysis between mitochondrial DNA content, G10398A polymorphism, HPV infection, and the prognosis of cervical cancer in the Chinese Han population.

    Science.gov (United States)

    Feng, Dali; Xu, Hui; Li, Xin; Wei, Yuehua; Jiang, Huangang; Xu, Hong; Luo, Aihua; Zhou, Fuxiang

    2016-04-01

    The aim was to analyze quantitative (mitochondrial DNA (mtDNA) content) and qualitative (G10398A polymorphism) mtDNA alterations as well as human papillomavirus (HPV) infection in cervical cancer prognosis. One hundred and twenty-two cases of formalin-fixed paraffin-embedded cervical carcinoma specimens were collected from the Yichang Tumor Hospital and Zhongnan Hospital of Wuhan University in the recent 10 years together with medical records. A quantitative real-time PCR (RT-PCR) was used to determine the copy number of the mitochondrial DNA and HPV expression levels. G10398A polymorphism was determined by PCR-RFLP assay. The overall survival of patients with higher mtDNA content was significantly reduced compared with lower mtDNA content patients (P = 0.029). But there was no difference of prognosis between the mtDNA 10398 A allele and G allele. However, the Kaplan-Meier survival curve illustrated a significantly reduced overall survival in the patients with 10398A plus high mtDNA copy number compared with the other groups (P cancer prognosis was observed, 10398A got increased mtDNA content compared with 10398G (P cancer prognosis. High mitochondrial DNA content plus 10398 A may be a marker of poor prognosis in cervical cancer. And mtDNA variation may potentially influence the predisposition to HPV infection and cervical carcinogenesis. PMID:26577855

  10. A label-free and enzyme-free ultra-sensitive transcription factors biosensor using DNA-templated copper nanoparticles as fluorescent indicator and hairpin DNA cascade reaction as signal amplifier.

    Science.gov (United States)

    Sha, Liang; Zhang, Xiaojun; Wang, Guangfeng

    2016-08-15

    Detection and quantification of specific protein with ultralow concentration play a crucial role in biotechnological applications and biomedical diagnostics. In this paper, a label-free and enzyme-free amplified fluorescent biosensor has been developed for transcription factors detection based on AT-rich double-stranded DNA-templated copper nanoparticles (ds DNA/Cu NPs) and hairpin DNA cascade reaction. This strategy was demonstrated by using nuclear factor-kappa B p50 (NF-κB p50) and specific recognition sequences as a model case. In this assay, a triplex consists of double-stranded DNA containing NF-κB p50 specifically binding sequences and a special design single-stranded DNA (Trigger) which is able to activate the hairpin DNA cascade amplifier (HDCA). In the presence of NF-κB p50, the triplex became unstable since the target bound to the recognition sequences with strong affinity. The selective binding event confirmed that the Trigger was successfully released from the triplex and initiated HDCA to yield the product which could effectively template the formation of fluorescent Cu NPs. The experimental results revealed that the advanced strategy was ultra-sensitive for detecting NF-κB p50 in the concentration range from 0.1 to 1000 pM with a detection limit of 0.096 pM. In addition, the relative standard deviation was 4.08% in 3 repetitive assays of 500 pM NF-κB p50, which indicated that the reproducibility of this strategy was acceptable. Besides desirable sensitivity, the developed biosensor also showed high selectivity, cost-effective, and simplified operations. In addition, the proposed biosensing platform is versatile. By conjugating with various specific recognition units, it could hold considerable potential to sensitive and selective detect various DNA-binding proteins and might find wide applications in biomedical fields. PMID:27045526

  11. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey; Rådstrøm, Peter; Malorny, Burkhard; Rudi, Knut

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technology...

  12. Influence of the OGG1 Ser326Cys polymorphism on oxidatively damaged DNA and repair activity

    DEFF Research Database (Denmark)

    Jensen, Annie Aarup; Løhr, Mille; Eriksen, Louise;

    2012-01-01

    comet assay. We collected blood samples from 1,019 healthy subjects and genotyped for the OGG1 Ser326Cys polymorphism. We found 49 subjects homozygous for the variant genotype (Cys/Cys) and selected same numbers of age-matched subjects with the heterozygous (Ser/Cys) and homozygous wild-type genotype...

  13. Differences in Nuclear DNA Between Male-Sterile and Male-Fertile Lines of Sorghum bicolor

    Institute of Scientific and Technical Information of China (English)

    FAN Chang-fa; SUN Chun-yun; GUO Xiao-cai; NIU Tian-tang; ZHANG Fu-yao

    2003-01-01

    Cytoplasmic male sterility (cms) is determined by nuclear-cytoplasmic interactions. Up tonow, most studies are focused on the comparison of cytoplasmic DNAs of male-sterile lines and male-fertilelines, and analysis of nuclear DNA has not been documented yet. In order to find out the possible difference innuclear genome of male-sterile line A1 Tx623 and corresponding male-fertile line Tx623 of sorghum, randomamplified polymorphic DNA (RAPD) approach was used to analyze their cytoplasmic and nuclear genomes.Total DNAs of them were amplified at first to screen primers, which were able to generate reproducible bandsspecific to male-sterile line or male-fertile line. Then the selected primers were used to amplify their mitochon-drial DNA (mtDNA) and chloroplast DNA (cpDNA). The origins of all the polymorphic fragments were ana-lyzed. After ruling out those amplified from cytoplasmic DNA, seventeen polymorphic fragments were deter-mined to be amplified from nuclear DNA. These fragments originated from nuclear DNA indicate that diffe-rences in sequence exist between the nuclear DNA of male-sterile line and male-fertile line of sorghum, whichdo not agree with the traditional standpoint that they have identical nucleus.

  14. Unusual sequence length-dependent gold nanoparticles aggregation of the ssDNA sticky end and its application for enzyme-free and signal amplified colorimetric DNA detection

    Science.gov (United States)

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Zheng, Baozhan; Meng, Yan; Guo, Yong; Dan Xiao

    2016-08-01

    It is known that the adsorption of short single-stranded DNA (ssDNA) on unmodified gold nanoparticles (AuNPs) is much faster than that for long ssDNA, and thus leads to length-dependent AuNPs aggregation after addition of salt, the color of the solutions sequentially changed from red to blue in accordance with the increase of ssDNA length. However, we found herein that the ssDNA sticky end of hairpin DNA exhibited a completely different adsorption behavior compared to ssDNA, an inverse blue-to-red color variation was observed in the colloid solution with the increase of sticky end length when the length is within a certain range. This unusual sequence length-dependent AuNPs aggregation might be ascribed to the effect of the stem of hairpin DNA. On the basis of this unique phenomenon and catalytic hairpin assembly (CHA) based signal amplification, a novel AuNPs-based colorimetric DNA assay with picomolar sensitivity and specificity was developed. This unusual sequence length-dependent AuNPs aggregation of the ssDNA sticky end introduces a new direction for the AuNPs-based colorimetric assays.

  15. Unusual sequence length-dependent gold nanoparticles aggregation of the ssDNA sticky end and its application for enzyme-free and signal amplified colorimetric DNA detection

    Science.gov (United States)

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Zheng, Baozhan; Meng, Yan; Guo, Yong; Dan Xiao

    2016-01-01

    It is known that the adsorption of short single-stranded DNA (ssDNA) on unmodified gold nanoparticles (AuNPs) is much faster than that for long ssDNA, and thus leads to length-dependent AuNPs aggregation after addition of salt, the color of the solutions sequentially changed from red to blue in accordance with the increase of ssDNA length. However, we found herein that the ssDNA sticky end of hairpin DNA exhibited a completely different adsorption behavior compared to ssDNA, an inverse blue-to-red color variation was observed in the colloid solution with the increase of sticky end length when the length is within a certain range. This unusual sequence length-dependent AuNPs aggregation might be ascribed to the effect of the stem of hairpin DNA. On the basis of this unique phenomenon and catalytic hairpin assembly (CHA) based signal amplification, a novel AuNPs-based colorimetric DNA assay with picomolar sensitivity and specificity was developed. This unusual sequence length-dependent AuNPs aggregation of the ssDNA sticky end introduces a new direction for the AuNPs-based colorimetric assays. PMID:27477392

  16. Detecting high-resolution polymorphisms in human coding loci by combining PCR and single-strand conformation polymorphism (SSCP) analysis.

    Science.gov (United States)

    Poduslo, S E; Dean, M; Kolch, U; O'Brien, S J

    1991-07-01

    A strategy is described that allows the development of polymorphic genetic markers to be characterized in individual genes. Segments of the 3' untranslated regions are amplified, and polymorphisms are detected by digestion with frequently cutting enzymes and with the detection of single-stranded conformation polymorphisms. This allows these genes, or DNA segments, to be placed on the linkage maps of human chromosomes. Polymorphisms in two genes have been identified using this approach. A HaeIII polymorphism was detected in the KIT proto-oncogene, physically assigned to chromosome 4q11-12. This polymorphism is linked to other chromosome 4p markers and is in linkage disequilibrium with a HindIII polymorphism previously described at this locus. We have also identified in the insulin-like growth factor1 receptor gene (IGF1R) a 2-bp deletion that is present at a frequency of .25 in the Caucasian population. Pedigree analysis with this insertion/deletion polymorphism placed the IGF1R gene at the end of the current linkage map of chromosome 15q, consistent with the physical assignment of 15q2526. Thus, polymorphisms in specific genes can be used to related the physical, genetic, and comparative maps of mammalian genomes and to simplify the testing of candidate genes for human diseases. PMID:1676559

  17. Tripartite Motif-containing 33 (TRIM33) protein functions in the poly(ADP-ribose) polymerase (PARP)-dependent DNA damage response through interaction with Amplified in Liver Cancer 1 (ALC1) protein.

    Science.gov (United States)

    Kulkarni, Atul; Oza, Jay; Yao, Ming; Sohail, Honeah; Ginjala, Vasudeva; Tomas-Loba, Antonia; Horejsi, Zuzana; Tan, Antoinette R; Boulton, Simon J; Ganesan, Shridar

    2013-11-01

    Activation of poly(ADP-ribose) polymerase (PARP) near sites of DNA breaks facilitates recruitment of DNA repair proteins and promotes chromatin relaxation in part through the action of chromatin-remodeling enzyme Amplified in Liver Cancer 1 (ALC1). Through proteomic analysis we find that ALC1 interacts after DNA damage with Tripartite Motif-containing 33 (TRIM33), a multifunctional protein implicated in transcriptional regulation, TGF-β signaling, and tumorigenesis. We demonstrate that TRIM33 is dynamically recruited to DNA damage sites in a PARP1- and ALC1-dependent manner. TRIM33-deficient cells show enhanced sensitivity to DNA damage and prolonged retention of ALC1 at sites of DNA breaks. Conversely, overexpression of TRIM33 alleviates the DNA repair defects conferred by ALC1 overexpression. Thus, TRIM33 plays a role in PARP-dependent DNA damage response and regulates ALC1 activity by promoting its timely removal from sites of DNA damage. PMID:23926104

  18. Tripartite Motif-containing 33 (TRIM33) Protein Functions in the Poly(ADP-ribose) Polymerase (PARP)-dependent DNA Damage Response through Interaction with Amplified in Liver Cancer 1 (ALC1) Protein*

    Science.gov (United States)

    Kulkarni, Atul; Oza, Jay; Yao, Ming; Sohail, Honeah; Ginjala, Vasudeva; Tomas-Loba, Antonia; Horejsi, Zuzana; Tan, Antoinette R.; Boulton, Simon J.; Ganesan, Shridar

    2013-01-01

    Activation of poly(ADP-ribose) polymerase (PARP) near sites of DNA breaks facilitates recruitment of DNA repair proteins and promotes chromatin relaxation in part through the action of chromatin-remodeling enzyme Amplified in Liver Cancer 1 (ALC1). Through proteomic analysis we find that ALC1 interacts after DNA damage with Tripartite Motif-containing 33 (TRIM33), a multifunctional protein implicated in transcriptional regulation, TGF-β signaling, and tumorigenesis. We demonstrate that TRIM33 is dynamically recruited to DNA damage sites in a PARP1- and ALC1-dependent manner. TRIM33-deficient cells show enhanced sensitivity to DNA damage and prolonged retention of ALC1 at sites of DNA breaks. Conversely, overexpression of TRIM33 alleviates the DNA repair defects conferred by ALC1 overexpression. Thus, TRIM33 plays a role in PARP-dependent DNA damage response and regulates ALC1 activity by promoting its timely removal from sites of DNA damage. PMID:23926104

  19. Genotypic Characterization of UL23 Thymidine Kinase and UL30 DNA Polymerase of Clinical Isolates of Herpes Simplex Virus: Natural Polymorphism and Mutations Associated with Resistance to Antivirals▿

    OpenAIRE

    Burrel, Sonia; Deback, Claire; Agut, Henri; Boutolleau, David

    2010-01-01

    The molecular mechanisms of herpes simplex virus (HSV) resistance to antiviral drugs interfering with viral DNA synthesis reported so far rely on the presence of mutations within UL23 (thymidine kinase [TK]) and UL30 (DNA polymerase) genes. The interpretation of genotypic antiviral resistance assay results requires the clear distinction between resistance mutations and natural interstrain sequence variations. The objectives of this work were to describe extensively the natural polymorphism of...

  20. Isolation and multiplex genotyping of polymorphic microsatellite DNA markers in the snakehead murrel, Channa striata

    OpenAIRE

    Amirul Firdaus Jamaluddin Jamsari; Tan Min-Pau; Mohd Nor Siti-Azizah

    2011-01-01

    Seven polymorphic microsatellite loci were isolated and characterized for the snakehead murrel, Channa striata (Channidae), a valuable tropical freshwater fish species. Among 25 specimens collected from Kedah state in Malaysia, the number of alleles per locus ranged from 2 to 7. Observed and expected heterozygosities ranged from 0.120 to 0.880 and 0.117 to 0.698, respectively. A single locus (CS1-C07) was significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction. Thes...

  1. Gene admixture in ethnic populations in upper part of Silk Road revealed by mtDNA polymorphism

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To evaluate the gene admixture on the current genetic landscape in Gansu Corridor (GC) in China, the upper part of the ancient Silk Road which connects the Eastern and Central Asia, we examined mitochondrial DNA (mtDNA) polymorphisms of five ethnic populations in this study. Using PCR-RFLP and sequencing, we analyzed mtDNA haplotypes in 242 unrelated samples in three ethnic populations from the GC region and two ethnic populations from the adjacent Xinjiang Uygur Autonomous Region of China. We analyzed the data in comparison with the previously reported data from Eastern, Central and Western Asia and Europe. We found that both European-specific haplogroups and Eastern Asian-specific haplogroups exist in the Gansu Corridor populations, while a modest matrilineal gene flow from Europeans to this region was revealed. The Gansu Corridor populations are genetically located between Eastern Asians and Central Asians, both of who contributed significantly to the maternal lineages of the GC populations. This study made the landscape of the gene flow and admixture along the Silk Road from Europe, through Central Asia, to the upper part of the Silk Road more complete.

  2. Polymorphisms of the DNA repair genes XRCC1, XRCC3, XPD, interaction with environmental exposures, and bladder cancer risk in a case-control study in northern Italy.

    Science.gov (United States)

    Shen, Min; Hung, Rayjean J; Brennan, Paul; Malaveille, Christian; Donato, Francesco; Placidi, Donatella; Carta, Angela; Hautefeuille, Agnes; Boffetta, Paolo; Porru, Stefano

    2003-11-01

    Tobacco smoking and occupational exposures are the main known risk factors for bladder cancer, causing direct and indirect damage to DNA. Repair of DNA damage is under genetic control, and DNA repair genes may play a key role in maintaining genome integrity and preventing cancer development. Polymorphisms in DNA repair genes resulting in variation of DNA repair efficiency may therefore be associated with bladder cancer risk. A hospital-based case-control study was conducted in Brescia, Italy, to assess the relationship between polymorphisms in DNA repair genes XRCC1 (Arg(399)Gln), XRCC3 (Thr(241)Met), and XPD (Lys(751)Gln) and bladder cancer risk. A total of 201 male incident bladder cancer cases and 214 male controls with urological nonneoplastic diseases were recruited and frequency-matched on age, period, and hospital of recruitment. Detailed information was collected using a semistructured questionnaire on demographic, dietary, environmental, and occupational factors. Genotypes were determined by PCR-RFLP analysis. The XRCC3 codon 241 variant genotype exhibited a protective effect against bladder cancer [odds ratio (OR), 0.63; 95% confidence interval (CI), 0.42-0.93], which was prominent among heavy smokers (OR, 0.49; 95% CI, 0.28-0.88) but not among never and light smokers. No overall impact of the XRCC1 codon 399 polymorphism was found (OR, 0.86; 95% CI, 0.59-1.28), but a protective influence of the homozygous variant was suggested among heavy smokers (OR, 0.38; 95% CI, 0.14-1.02). XPD polymorphisms did not show an association with bladder cancer (OR, 0.92; 95% CI, 0.62-1.37). There was no statistical evidence of an interaction between these three genetic polymorphisms and either tobacco smoking or occupational exposure to polycyclic aromatic hydrocarbons and aromatic amines. The XRCC3 codon 241 polymorphism had an overall protective effect against bladder cancer that was most apparent among heavy smokers. Similarly, the XRCC1 codon 399 polymorphism also had

  3. Amplifiable DNA from Gram-negative and Gram-positive bacteria by a low strength pulsed electric field method

    OpenAIRE

    Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen

    2000-01-01

    An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of

  4. Allelic polymorphism of GSTM1 and NAT2 genes modifies dietary-induced DNA damage in colorectal mucosa.

    Science.gov (United States)

    Kiss, I; Sándor, J; Ember, I

    2000-12-01

    Typically, cancer is caused by the interaction of genetic and environmental factors. In colorectal carcinogenesis, diet and nutritional habits are the most important external risk determinants. Allelic polymorphisms of certain metabolizing enzymes may have an influence on cancer risk by modifying the concentration of active carcinogenic compounds in the body. In the present study we investigated the interaction between nutritional and genetic susceptibility factors in human colon carcinogenesis. Healthy volunteers were divided into four groups, based on allelic polymorphisms of N-acetyltransferase 2 and glutathione-S-transferase M1 enzymes. Comet assay was used to determine the level of DNA strand breaks in exfoliated colorectal mucosal cells, following a 2-day vegetarian diet, and after switching to a 2-day 'high-meat' diet. The 'high-meat' diet statistically significantly increased the amount of single-strand breaks in rapid acetylators and among individuals with a GSMT1 + genotype, while it caused only a slight and not significant increase in the other groups. Our study emphasizes the importance of using susceptibility markers in cancer epidemiology, since environmental effects are strongly modified by these genetic factors. PMID:11201682

  5. Identification of sequence polymorphisms in the D-loop region of mitochondrial DNA as risk biomarker for liposarcoma.

    Science.gov (United States)

    Xun, Jianjun; Song, Xiaolei; Gao, Shejun; Yang, Huichai; Li, Zhenxing; Li, Linxing

    2016-09-01

    Single nucleotide polymorphisms (SNPs) in the Displacement-loop (D-loop) region of mitochondrial DNA have been reported to be associated with cancer risk in various types of cancer. To assess the frequency of D-loop SNPs in a large series of liposarcoma and establish correlations with cancer risk, we sequenced the D-loop of 82 liposarcoma patients and analyzed their use as predictive biomarkers for liposarcoma risk. The minor alleles of nucleotides 73G, 523-524del, 16,290T, 16,319A, 16,356C were associated with an increased risk for liposarcoma patients, whereas the insertion of C at the site 315 (located within the D310) were associated with a decreased risk for liposarcoma patients. These results suggest that SNPs in the mitochondrial D-loop should be considered as a biomarker which may be useful for the early detection of liposarcoma in individuals at risk of this cancer. PMID:25812053

  6. Transcriptome response of the Pacific oyster (Crassostrea gigas) to infection with Vibrio tubiashii using cDNA AFLP differential display

    Science.gov (United States)

    We used qualitative complementary DNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) differential display analysis and real-time, quantitative PCR (RT-qPCR) to identify genes in the Pacific oyster Crassostrea gigas whose transcription either changes in response to exposure to a pathogenic bacter...

  7. No major effect of estrogen receptor gene polymorphisms on bone mineral density or bone loss in postmenopausal Danish women

    DEFF Research Database (Denmark)

    Bagger, Y Z; Jørgensen, H L; Heegaard, Anne-Marie;

    2000-01-01

    years). Genotyping was performed through the restriction cleavage of polymerase chain reaction-amplified genomic DNA with the two restriction enzymes, PvuII and XbaI. Restriction fragment-length polymorphisms were represented as P or p (PvuII) and X or x (XbaI), with the lower case letters signifying...

  8. DIFFERENT RESULTS BY DIFFERENT COMMERCIAL TAQ DNA POLYMERASE IN RAPD

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    @@ RAPD (Random Amplified Polymorphic DNA) technique has been widely used in animal, plant, human and microorganism research since it was first established by Williams in 1990[1-3]. But, because of low annealed temperature and short 10-nt primers, the resolution and repetition is low in RAPD. The stability of RAPD is influenced by many factors such as the concentration of template, primers, dNTP, Mg++,and Taq DNA polymerase[4-6]. The influence on amplified products of different commercial Taq DNA polymerase in RAPD was studied in this paper.

  9. Isolation and multiplex genotyping of polymorphic microsatellite DNA markers in the snakehead murrel, Channa striata.

    Science.gov (United States)

    Jamsari, Amirul Firdaus Jamaluddin; Min-Pau, Tan; Siti-Azizah, Mohd Nor

    2011-04-01

    Seven polymorphic microsatellite loci were isolated and characterized for the snakehead murrel, Channa striata (Channidae), a valuable tropical freshwater fish species. Among 25 specimens collected from Kedah state in Malaysia, the number of alleles per locus ranged from 2 to 7. Observed and expected heterozygosities ranged from 0.120 to 0.880 and 0.117 to 0.698, respectively. A single locus (CS1-C07) was significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction. These novel markers would be useful for population genetic studies of the C. striata. PMID:21734840

  10. Isolation and multiplex genotyping of polymorphic microsatellite DNA markers in the snakehead murrel, Channa striata

    Directory of Open Access Journals (Sweden)

    Amirul Firdaus Jamaluddin Jamsari

    2011-01-01

    Full Text Available Seven polymorphic microsatellite loci were isolated and characterized for the snakehead murrel, Channa striata (Channidae, a valuable tropical freshwater fish species. Among 25 specimens collected from Kedah state in Malaysia, the number of alleles per locus ranged from 2 to 7. Observed and expected heterozygosities ranged from 0.120 to 0.880 and 0.117 to 0.698, respectively. A single locus (CS1-C07 was significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction. These novel markers would be useful for population genetic studies of the C. striata.

  11. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  12. Mitochondrial DNA control region polymorphism in the population of Alagoas state, north-eastern Brazil.

    Science.gov (United States)

    Barbosa, Adriana B G; da Silva, Luiz Antonio F; Azevedo, Dalmo A; Balbino, Valdir Q; Mauricio-da-Silva, Luiz

    2008-01-01

    The sequences of the two hypervariable (HV) segments of the mitochondrial DNA (mtDNA) control region were determined in 167 randomly selected, unrelated individuals living in the state of Alagoas, north-eastern Brazil. One hundred and forty-five different haplotypes, associated with 139 variable positions, were determined. More than 95% of the mtDNA sequences could be allocated to specific mtDNA haplogroups according to the mutational motifs. Length heteroplasmy in the C-stretch HV1 and HV2 regions was observed in 22 and 11%, respectively, of the population sample. The genetic diversity was estimated to be 0.9975 and the probability of two random individuals presenting identical mtDNA haplotypes was 0.0084. The most frequent haplotype was shared by six individuals. All sequences showed high-quality values and phantom mutations were not detected. The diversity revealed in the mitochondrial control region indicates the importance of this locus for forensic casework and population studies within Alagoas, Brazil. PMID:18279250

  13. Detection of genetic polymorphism in the populations of brinjal shoot and fruit borer, Leucinodes orbonalis (Guenee).

    Science.gov (United States)

    Karthikeyan, K A M; Vijayakumar, I; Murali, P; Suresh, P; Janarthanan, S

    2005-06-01

    In the present study six different populations of L. orbonalis were collected and subjected to analysis of genetic variability in terms of carboxylesterase isozyme pattern and DNA polymorphism using RAPD-PCR. Pattern of carboxylesterase revealed a similar isozyme cluster in the populations namely, sivaganga (population-3), dindigal (population-4), virudhunagar (population-5) and coimbatore (population-6). Similarly, the populations of L. orbonalis recorded 3 distinct randomly amplified polymorphic DNA markers in all populations grouped above. This pattern of genetic variability in the populations was also supported by the analysis of the similarity indices and UPGMA dendrogram. PMID:15991581

  14. Gene polymorphisms against DNA damage induced by hydrogen peroxide in leukocytes of healthy humans through comet assay: a quasi-experimental study

    Directory of Open Access Journals (Sweden)

    Klautau-Guimarães Maria N

    2010-05-01

    Full Text Available Abstract Background Normal cellular metabolism is well established as the source of endogenous reactive oxygen species which account for the background levels of oxidative DNA damage detected in normal tissue. Hydrogen peroxide imposes an oxidative stress condition on cells that can result in DNA damage, leading to mutagenesis and cell death. Several potentially significant genetic variants related to oxidative stress have already been identified, and angiotensin I-converting enzyme (ACE inhibitors have been reported as possible antioxidant agents that can reduce vascular oxidative stress in cardiovascular events. Methods We investigate the influences of haptoglobin, manganese superoxide dismutase (MnSOD Val9Ala, catalase (CAT -21A/T, glutathione peroxidase 1 (GPx-1 Pro198Leu, ACE (I/D and gluthatione S-transferases GSTM1 and GSTT1 gene polymorphisms against DNA damage and oxidative stress. These were induced by exposing leukocytes from peripheral blood of healthy humans (N = 135 to hydrogen peroxide (H2O2, and the effects were tested by comet assay. Blood samples were submitted to genotyping and comet assay (before and after treatment with H2O2 at 250 μM and 1 mM. Results After treatment with H2O2 at 250 μM, the GPx-1 polymorphism significantly influenced results of comet assay and a possible association of the Pro/Leu genotype with higher DNA damage was found. The highest or lowest DNA damage also depended on interaction between GPX-1/ACE and Hp/GSTM1T1 polymorphisms when hydrogen peroxide treatment increased oxidative stress. Conclusions The GPx-1 polymorphism and the interactions between GPX-1/ACE and Hp/GSTM1T1 can be determining factors for DNA oxidation provoked by hydrogen peroxide, and thus for higher susceptibility to or protection against oxidative stress suffered by healthy individuals.

  15. Genetic polymorphism of mitochondrial DNA HVS-I and HVS-Ⅱ of Chinese Tu ethnic minority group

    Institute of Scientific and Technical Information of China (English)

    Feng Chen; Yajun Deng; Yonghui Dang; BO Zhang; Haofang Mu; Xiaoguang Yu; Lin Li; Chunxia Yan; Teng Chen

    2008-01-01

    We analyzed the two hypervariable segments HVS-Ⅰ and HVS-Ⅱ of 108 Chinese Tu ethnic minority group samples for forensic and population genetics purposes.Comparing with Anderson sequence,79 polymorphic loci in HVS-Ⅰ and 40 in HVS-Ⅱ were found in Chi-nese Tu ethnic minority group mtDNA sequences,and 90 and 64 haplotypes were then defined.Haplotype diversity and the mean pair-wise differences were 0.9903:±0.0013 and 5.7785 in HVS-Ⅰ,and 0.9777±0.0013 and 3.5819 in HVS-Ⅱ,respectively.By analyzing the hypervariable domain from nucleotide 1,6180 to 1,6193 in HVS-Ⅰ,we defined some new types of sequence variations.We also compared the relationship between Tu population and other populations using mtDNA HVS-Ⅰ sequences.According to Rst genetic distances,the phylogenetic tree showed that the Tu population,the Xi'an Han population,the Chinese Korean,and the Mongol ethnic group were in a clade.This indicated a close genetic relationship between them.There were far relations between the Tu population and other Chinese southern Han populations,Siberian,European,African,and other foreign populations.The results suggest that Tu population has a multi-origin and has also merged with other local populations.

  16. 霍乱弧菌及其它致病弧菌分子遗传特征和DNA多态性研究%The inherent characteristics and DNA polymorphism of Vibrio cholerae and other vibrios

    Institute of Scientific and Technical Information of China (English)

    王军; 李跃旗; 石建时; 李立新; 白文林; 虞爱华; 姜素椿

    2002-01-01

    Objective To investigate the inherent characteristics of Vibrio cholerae (V. cholerae) and other vibrios and their relationship. Methods Polymerase chain reaction (PCR), DNA sequence analysis, randomly amplified polymorphic DNA (RAPD) analysis and average linkage cluster analysis were used to study 3 isolates of V. cholerae strains O139, three isolates O1 biotype El Tor, four isolates O1 biotype classical and 3 other vibrios.Conclusion V. cholerae and other vibrios are polymorphic in inherent characteristics. The inherent characteristics of V. cholerae O139 are the same as El Tor biotype. O139 may have evolved from the El Tor biotype. The inherent characteristics of vibrio paraheamolyticus are the same as vibrio vulnificus.%目的探讨霍乱弧菌和其它致病弧菌分子遗传特征及相互关系.方法用聚合酶链反应(Polymerase chain reaction; PCR)、DNA 序列分析、随机扩增多态性 DNA (Randomly amplified polymorphic DNA; RAPD)和平均链锁聚类分析,对3株O139群霍乱弧菌、3株O1群 El Tor型、4株古典型和3株副溶血等致病弧菌进行检测.结果 O139群霍乱弧菌和O1群含有相同的霍乱肠毒素(CTX)A2-B亚单位基因, 核苷酸序列同源性为97.1%-98.9%.RAPD 将不同弧菌分成4类;即①O139群和El Tor型、②古典型、③副溶血和创伤弧菌及④河弧菌.O139群与O1群El Tor型DNA指纹图谱几乎完全一致,平均链锁距离为0,与古典型相似,平均链锁距离为2.07. 与副溶血等致病弧菌差别较大,平均链锁距离为6.76-8.54.结论 O139群霍乱弧菌与O1群El Tor型遗传特征相同,前者很可能由El Tor型进化而来.副溶血与创伤弧菌也具有相同遗传特征.霍乱弧菌和其它致病弧菌遗传特征表现出多态性.

  17. Dose-dependent influence of genetic polymorphisms on DNA damage induced by styrene oxide, ethylene oxide and gamma-radiation

    International Nuclear Information System (INIS)

    Styrene oxide (SO), ethylene oxide (EO) and gamma-radiation (G) are agents with a well-described metabolism and genotoxicity. EPHX1 and GSTs play an important role in the detoxification of electrophiles and oxidative stress. Enzymes involved in base excision repair (hOGG1, XRCC1), in rejoining single strand breaks (XRCC1) and in repair of cross-links and chromosomal double strand breaks (XRCC3) might have an impact on genotoxicity as well. In this study we assessed the dose-dependent effect of genetic polymorphisms in biotransforming (EPHX (Tyr113/His113 and His139/Arg139), GSTP1 (Ile105/Val105), GSTM1 and GSTT1) and DNA repair enzymes (hOGG1 (Ser326/Cys326), XRCC1 (Arg194/Trp194, Arg28/His28, Arg399/Gln399), XRCC3 (Thr241/Met241)) on the induced genotoxicity. Peripheral blood mononuclear cells from 20 individuals were exposed to 3 doses per agent (+control). Genotoxicity was evaluated by measuring comet tail length (TL) and micronucleus frequencies in binucleated cells (MNCB). Dose-dependent DNA damage was found for all agents and end-points, with the exception of MNCB induced by EO. Repeated measure ANOVA revealed a significant contribution of hOGG1 and XRCC3 genotypes to the inter-individual variability of TL and MNCB in cells exposed to EO and G. Homozygous hOGG1 326 wild cells showed significantly lower EO-induced TL than the heterozygous cells. Significantly higher TL and MNCB were found in EO-exposed cells carrying the XRCC3 241Met variant and the influence on TL was more pronounced at higher dose. In G-irradiated cells, TL was significantly higher in the hOGG1 326 homozygous wild types compared with mutated genotypes. The influence of hOGG1 326 on TL was borderline dose-dependent. We conclude that the influence of genetic polymorphisms of enzymes involved in DNA repair on induced genotoxicity depends on exposure dose

  18. Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes

    Energy Technology Data Exchange (ETDEWEB)

    Lyamichev, V.; Mast, A.L.; Hall, J.G. [Third Wave Technologies, Madison, WI (United States)] [and others

    1999-03-01

    Flap endonucleases (FENs) isolated from archaea are shown to recognize and cleave a structure formed when two overlapping oligonucleotides hybridize to a target DNA strand. The downstream oligonucleotide probe is cleaved, and the precise site of cleavage is dependent on the amount of overlap with the upstream oligonucleotide. The authors have demonstrated that use of thermostable archaeal FENs allows the reaction to be performed at temperatures that promote probe turnover without the need for temperature cycling. The resulting amplification of the cleavage signal enables the detection of specific DNA targets at sub-attomole levels within complex mixtures. Moreover, the authors provide evidence that this cleavage is sufficiently specific to enable discrimination of single-base differences and can differentiate homozygotes from heterozygotes in single-copy genes in genomic DNA.

  19. Random amplification of polymorphic DNA (RAPD), pulsed-field gel electrophoresis (PFGE) and phage-typing in the analysis of a hospital outbreak of Salmonella enteritidis

    DEFF Research Database (Denmark)

    Skibsted, U.; Baggesen, Dorte Lau; Dessau, R.;

    1998-01-01

    Isolates of Salmonella Enteritidis from 81 patients from Herlev Hospital or from Copenhagen County were analysed by random amplification of polymorphic DNA (RAPD), pulsed-field gel electrophoresis (PFGE) and phage-typing. Fourteen polymorphic markers from five decamer primers unambiguously placed...... (both PFGE type I) formed the fifth group. The sixth group of four isolates was not phage typeable and was PFGE type III. Forty outbreak-related isolates of phage-type 6 were resolved into three strains. No diversity of phage-type 6 was found among isolates unrelated to the outbreak. It is concluded...

  20. Detection of a single base exchange in PCR-amplified DNA fragments using agarose gel electrophoresis containing bisbenzimide-PEG.

    OpenAIRE

    Müller, M; Kruse, L; Tabrett, A M; Barbara, D.J.

    1997-01-01

    Using PCR fragments of known sequences derived from isolates of two related fungal species, simple submarine electrophoresis in agarose gels containing a bisbenzimide-PEG conjugate (H.A.-Yellow) has been shown to be capable of distinguishing DNA fragments 567 bp long which differ by as little as a single base change. However, only changes affecting bisbenzimide binding sites (which consist of at least four consecutive A/T bases) alter mobility; other changes are ineffective. A second ligand (...

  1. DNA polymorphism in crystals: three stable conformations for the decadeoxynucleotide d(GCATGCATGC).

    Science.gov (United States)

    Thirugnanasambandam, Arunachalam; Karthik, Selvam; Artheswari, Gunanithi; Gautham, Namasivayam

    2016-06-01

    High-resolution structures of DNA fragments determined using X-ray crystallography or NMR have provided descriptions of a veritable alphabet of conformations. They have also shown that DNA is a flexible molecule, with some sequences capable of adopting two different structures. Here, the first example is presented of a DNA fragment that can assume three different and distinct conformations in crystals. The decanucleotide d(GCATGCATGC) was previously reported to assume a single-stranded double-fold structure. In one of the two crystal structures described here the decamer assumes both the double-fold conformation and, simultaneously, the more conventional B-type double-helical structure. In the other crystal the sequence assumes the A-type double-helical conformation. These results, taken together with CD spectra, which were recorded as the decamer was titrated against four metal ions and spermine, indicate that the molecule may exist as a mixed population of structures in solution. Small differences in the environmental conditions, such as the concentration of metal ion, may decide which of these crystallizes out. The results also support the idea that it may be possible for DNA to change its structure to suit the binding requirements of proteins or drugs. PMID:27303798

  2. Colorimetric detection of PCR products of DNA from pathogenic bacterial targets based on a simultaneously amplified DNAzyme

    International Nuclear Information System (INIS)

    A novel strategy was devised for colorimetric analysis of the products of the polymerase chain reaction (PCR). The method takes advantage of simultaneous amplification of a horseradish peroxidase-mimicking DNAzyme (HRPzyme) during the PCR process. It is performed using a DNA specific forward primer and a universal reverse primer containing a complementary HRPzyme sequence. The double-strand PCR products, which include the HRPzyme sequence, are treated with a mixture of hemin and TMB (3,3′,5,5′–tetramethylbenzidine) in the presence of hydrogen peroxide. The resulting HRPzyme/hemin complex then promotes a peroxidase mimicking reaction, which produces the blue colored oxidized TMB. This colorimetric method can be more easily performed than previously developed gel based detection procedures and, as a result, can be conveniently applied to the specific and sensitive colorimetric analysis of DNA sequences arising from pathogenic bacteria. The potentially broad applicability of the new method has been demonstrated by its use in the identification of the 16s rDNA of Salmonella Typhimurium. (author)

  3. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  4. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    International Nuclear Information System (INIS)

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies

  5. DNA restriction fragment length polymorphism of HLA-DR2 haplotypes in normal individuals and in patients with rheumatoid arthritis.

    Science.gov (United States)

    Singal, D P; Reid, B; Green, D; Bensen, W G; D'Souza, M

    1990-01-01

    A strong association between HLA-DR4 and rheumatoid arthritis (RA) has been found in a number of populations. In contrast, the incidence of DR2 is decreased in patients with RA, suggesting that this specificity may confer some protection against the disease. A number of subtypes of DR2 have been defined by serology, by responses in mixed lymphocyte culture reaction, and, more recently, by restriction fragment length polymorphism. These subtypes of DR2 are in linkage disequilibrium with different subspecificities of DQw1. It is thus likely that the distribution of these subtypic DR,DQ haplotypes in DR2 positive patients with RA may be important in understanding the genetic basis of susceptibility/resistance to RA. In this paper a study of the subtypes of DR2,DQw1 haplotypes in 18 patients with RA, who required sodium aurothiomalate as a disease remitting drug, and unrelated healthy individuals is reported. Three subtypes of DR2 haplotypes, DRw15 (Dw2),DQw1.2(DQw6), DRw15(Dw12),DQw1.12(DQw6), and DRw16(Dw21),DQw1, AZH (DQw5), were analysed with a cDNA probe for the DQ beta gene. The data show that DR2 positive patients with RA carried either the DRw15(Dw2),DQw6 or DRw15(Dw12),DQw6 haplotype. No patient with RA was positive for the DRw16(Dw21),DQw5 subspecificity. In contrast, six of 29 (21%) normal healthy DR2,DQw1 positive individuals carried the DRw16(Dw21),DQw5 haplotype. These data together with earlier results on the distribution of the DR4,DQw7 haplotype in patients with RA support the hypothesis that DQB1 chain polymorphism may be important in determining susceptibility to severe RA. Images PMID:1969727

  6. Single nucleotide polymorphism in DNA methyltransferase 3B promoter and its association with gastric cardiac adenocarcinoma in North China

    Institute of Scientific and Technical Information of China (English)

    Yi-Min Wang; Xiu-Feng Zhang; Jian-Hui Zhang; Rui Wang; Deng-Gui Wen; Yan Li; Wei Guo; Na Wang; Li-Zhen Wei; Yu-Tong He; Zhi-Feng Chen

    2005-01-01

    AIM: To investigate the association between single nucleotide polymorphism (SNP)in promoter of the DNA methyltransferase 3B (DNNT3B) gene and risk for development and lymphatic metastasis of gastric cardiac adenocarcinoma (GCA).METHODS: The hospital based case-control study included 212 GCA patients and 294 control subjects without overt cancer. The DNMT3B SNP was genotyped by PCR and restriction fragment length polymorphism (RFLP) analysis. RESULTS: The C/C genotype was not detected in both GCA patients and controls. In control subjects, the frequency of T/T and C/T genotypes was 94.9% and 5.1% respectively,and that of T and C alleles was 97.4% and 2.6%, respectively.The genotype and allelotype distribution in the GCA patients was not significantly different from that in controls (P = 0.34 and 0.33, respectively). When stratified by smoking status and family history of upper gastrointestinal cancer, significant difference in the genotype distribution was not observed between GCA patients and controls. The distribution of DNMT3Bgenotypes in GCA patients with or without lymphatic metastasis did not show significant difference (P = 0.42). CONCLUSION: The distribution of DNMT3BSNP in North China is distinct from that in Caucasians. Although this SNP has been associated with susceptibility to lung, head, neck and breast cancer, it may not be used as a stratification marker to predict susceptibility and lymphatic metastasis of GCA, at least in the population of North China.

  7. Patterns of chloroplast DNA polymorphism in the endangered polyploid Centaurea borjae (Asteraceae): Implications for preserving genetic diversity

    Institute of Scientific and Technical Information of China (English)

    Lua LOPEZ; Rodolfo BARREIRO

    2013-01-01

    A previous study with amplified fragment length polymorphism (AFLP) fingerprints found no evidence of genetic impoverishment in the endangered Centaurea borjae and recommended that four management units (MUs) should be designated.Nevertheless,the high ploidy (6x) of this narrow endemic plant suggested that these conclusions should be validated by independent evidence derived from non-nuclear markers.Here,the variable trnT-F region of the plastid genome was sequenced to obtain this new evidence and to provide an historical background for the current genetic structure.Plastid sequences revealed little genetic variation; calling into question the previous conclusion that C.borjae does not undergo genetic impoverishment.By contrast,the conclusion that gene flow must be low was reinforced by the strong genetic differentiation detected among populations using plastid sequences (global FST =0.419).The spatial arrangement of haplotypes and diversity indicate that the populations currently located at the center of the species range are probable sites of long-persistence whereas the remaining sites may have derived from a latter colonization.From a conservation perspective,four populations contributed most to the allelic richness of the plastid genome of the species and should be given priority.Combined with previous AFLP results,these new data recommended that five,instead of four,MUs should be established.Altogether,our study highlights the benefits of combining markers with different modes of inheritance to design accurate conservation guidelines and to obtain clues on the evolutionary processes behind the present-day genetic structures.

  8. AFLP analysis of rice transformed with maize DNA by particle beam

    International Nuclear Information System (INIS)

    Many stable heritable rice lines were obtained via five years agricultural selection, which were derived from rice (oryza stative Japonica) Yujing-6 transgened with large fraction DNA of Zhengdan-14 (zea mays L.) by particle beam method. 18 pairs optimum selective primers were got by screening from 64 pairs AFLP selective primers via experiment on two mutant lines, which could amplify many DNA fingerprints and also could amplify polymorphic bands and target bands, both in this two mutant lines. Then the two mutant lines and two controls were analyzed with AFLP, the results showed that many polymorphic bands (such as novel bands, target bands, missing bands) were found in mutant lines. The discrepancy in DNA level indicated that rice, transgened with large fraction DNA of Zhengdan-14 by particle beam, might be inserted maize DNA and inherited steadily in some degree. It also indicated that it was possible to cultivate novel rice variety transformed with wide DNA by particle beam. (authors)

  9. Primary ovary choriocarcinoma: individual DNA polymorphic analysis as a strategy to confirm diagnosis and treatment

    Directory of Open Access Journals (Sweden)

    Fernando Nalesso

    2013-04-01

    Full Text Available Primary choriocarcinoma of the ovary is rare. Furthermore, this tumor can arise from gestational tissue or pure germ cells of the ovary, with the latter resulting in non-gestational choriocarcinoma. While the clinical characteristics and histology of both tumor types are identical, differentiation of these tumors is necessary for effective treatment. One strategy for the differentiation of these tumors types is to assay for the presence of paternal DNA. Accordingly, in the present case, a patient with primary choriocarcinoma of the ovary with a non-gestational origin was confirmed by DNA analysis. The patient subsequently exhibited an excellent response to chemotherapy, and following surgery, achieved complete remission. A pathological analysis of surgical specimens further confirmed the absence of tumor.

  10. Polymorphic DNA haplotypes at the phenylalanine hydroxylase (PAH) locus in European families with phenylketonuria (PKU)

    OpenAIRE

    Daiger, Stephen P.; Chakraborty, Ranajit; Reed, Lori; Fekete, György; Schuler, Dezso; Berenssi, György; Nasz, Istvan; Brdička, Radim; Kamarýt, Jaromir; Pijáčková, Anna; Moore, Sharon; Sullivan, Susan; Woo, Savio L. C.

    1989-01-01

    DNA haplotype data from the phenylalanine hydroxylase (PAH) locus are available from a number of European populations as a result of RFLP testing for genetic counseling in families with phenylketonuria (PKU). We have analyzed data from Hungary and Czechoslovakia together with published data from five additional countries–Denmark, Switzerland, Scotland, Germany, and France–representing a broad geographic and ethnographic range. The data include 686 complete chromosomal haplotypes for eight RFL...

  11. DNA repair genetic polymorphisms and risk of colorectal cancer in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Pardini, Barbara; Naccarati, Alessio; Novotný, J.; Šmerhovský, Z.; Vodičková, Ludmila; Poláková, Veronika; Hánová, Monika; Slyšková, Jana; Tulupová, Elena; Kumar, R.; Bortlík, M.; Barale, R.; Hemminki, K.; Vodička, Pavel

    2008-01-01

    Roč. 638, 1-2 (2008), s. 146-153. ISSN 0027-5107 R&D Projects: GA ČR GA310/05/2626; GA MZd NR8563 Grant ostatní: EU(SE) 505609 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : Colorectal cancer * Individual susceptibility * DNA repair Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008

  12. Polymorphisms in the mitochondrial DNA control region and frailty in older adults.

    Directory of Open Access Journals (Sweden)

    Ann Z Moore

    Full Text Available BACKGROUND: Mitochondria contribute to the dynamics of cellular metabolism, the production of reactive oxygen species, and apoptotic pathways. Consequently, mitochondrial function has been hypothesized to influence functional decline and vulnerability to disease in later life. Mitochondrial genetic variation may contribute to altered susceptibility to the frailty syndrome in older adults. METHODOLOGY/PRINCIPAL FINDINGS: To assess potential mitochondrial genetic contributions to the likelihood of frailty, mitochondrial DNA (mtDNA variation was compared in frail and non-frail older adults. Associations of selected SNPs with a muscle strength phenotype were also explored. Participants were selected from the Cardiovascular Health Study (CHS, a population-based observational study (1989-1990, 1992-1993. At baseline, frailty was identified as the presence of three or more of five indicators (weakness, slowness, shrinking, low physical activity, and exhaustion. mtDNA variation was assessed in a pilot study, including 315 individuals selected as extremes of the frailty phenotype, using an oligonucleotide sequencing microarray based on the Revised Cambridge Reference Sequence. Three mtDNA SNPs were statistically significantly associated with frailty across all pilot participants or in sex-stratified comparisons: mt146, mt204, and mt228. In addition to pilot participants, 4,459 additional men and women with frailty classifications, and an overlapping subset of 4,453 individuals with grip strength measurements, were included in the study population genotyped at mt204 and mt228. In the study population, the mt204 C allele was associated with greater likelihood of frailty (adjusted odds ratio = 2.04, 95% CI = 1.07-3.60, p = 0.020 and lower grip strength (adjusted coefficient = -2.04, 95% CI = -3.33- -0.74, p = 0.002. CONCLUSIONS: This study supports a role for mitochondrial genetic variation in the frailty syndrome and later life muscle strength

  13. Sequence polymorphism of the mitochondrial DNA control region in the population of Vojvodina Province, Serbia.

    Science.gov (United States)

    Zgonjanin, Dragana; Veselinović, Igor; Kubat, Milovan; Furac, Ivana; Antov, Mirjana; Loncar, Eva; Tasić, Milos; Vuković, Radenko; Omorjan, Radovan

    2010-03-01

    In order to generate and establish the database for forensic identification purposes in Vojvodina Province (Serbia), the sequence of the hypervariable regions 1 (HV1) and 2 (HV2) of the mtDNA control region were determined in a population of 104 unrelated individuals from Vojvodina Province, using a fluorescent-based capillary electrophoresis sequencing method. A total of 93 different haplotypes were found, of these 83 mtDNA types were unique, nine haplotypes were shared by two individuals and one haplotype by three individuals. The variation of mtDNA HV1 and HV2 regions was confined to 116 nucleotide positions, of which 72 were observed in the HV1 and 44 in the HV2. A statistical estimate of the results for this population showed the genetic diversity of 0.9977 and the random match probability of 1.18%. Haplogroup H was the most common haplogroup (43.3%). Haplogroups observed at intermediate levels included clusters U (13.5%), T (10.6%), J (8.6%) and W (5.8%). PMID:19962932

  14. Molecular epidemiology and in-vitro antifungal susceptibility of Aspergillus terreus species complex isolates in Delhi, India: evidence of genetic diversity by amplified fragment length polymorphism and microsatellite typing.

    Directory of Open Access Journals (Sweden)

    Shallu Kathuria

    Full Text Available Aspergillus terreus is emerging as an etiologic agent of invasive aspergillosis in immunocompromised individuals in several medical centers in the world. Infections due to A. terreus are of concern due to its resistance to amphotericin B, in vivo and in vitro, resulting in poor response to antifungal therapy and high mortality. Herein we examined a large collection of molecularly characterized, geographically diverse A. terreus isolates (n = 140 from clinical and environmental sources in India for the occurrence of cryptic A. terreus species. The population structure of the Indian A. terreus isolates and their association with those outside India was determined using microsatellite based typing (STR technique and Amplified Fragment Length Polymorphism analysis (AFLP. Additionally, in vitro antifungal susceptibility of A. terreus isolates was determined against 7 antifungals. Sequence analyses of the calmodulin locus identified the recently described cryptic species A. hortai, comprising 1.4% of Aspergillus section Terrei isolates cultured from cases of aspergilloma and probable invasive aspergillosis not reported previously. All the nine markers used for STR typing of A. terreus species complex proved to be highly polymorphic. The presence of high genetic diversity revealing 75 distinct genotypes among 101 Indian A. terreus isolates was similar to the marked heterogeneity noticed in the 47 global A. terreus population exhibiting 38 unique genotypes mainly among isolates from North America and Europe. Also, AFLP analysis showed distinct banding patterns for genotypically diverse A. terreus isolates. Furthermore, no correlation between a particular genotype and amphotericin B susceptibility was observed. Overall, 8% of the A. terreus isolates exhibited low MICs of amphotericin B. All the echinocandins and azoles (voriconazole, posaconazole and isavuconazole demonstrated high potency against all the isolates. The study emphasizes the need of

  15. DNA-methyltransferase 3B 39179 G > T polymorphism and risk of sporadic colorectal cancer in a subset of Iranian population

    Directory of Open Access Journals (Sweden)

    Abdolreza Daraei

    2011-01-01

    Full Text Available Background: Epigenetic event is a biological regulation that influences the expression of various genes involved in cancer. DNA methylation is established by DNA methyltransferases, particularly DNAmethyltransferase 3B (DNMT3B. It seems to play an oncogenic role in the creation of abnormal methylation during tumorigenesis. The polymorphisms of the DNMT3B gene may influence DNMT3B activity in DNA methylation and increase the susceptibility to several cancers. These genetic polymorphisms have been studied in several cancers in different populations. Methods: In this study, we performed a case-control study with 125 colorectal cancer patients and 135 cancer-free controls to evaluate the association between DNMT3B G39179T polymorphism (rs1569686 in the promoter region and the risk of sporadic colorectal cancer. Up to now, few studies have investigated the role of this gene variant in sporadic colorectal cancer with no familial history. The genotypes of DNMT3B G39179T polymorphism was analyzed by PCR-RFLP. Results: We found that compared with G allele carriers, statistically the DNMT3B TT genotype (%34 was significantly associated with increased risk of colorectal cancer (adjusted OR, 3.993, 95% CI, 1.726-9.238, P = 0.001. Compared with DNMT3B TT genotype, the GT and GG genotypes had lower risk of developing sporadic colorectal cancer (OR = 0.848, 95% CI = 0.436-1.650. Conclusions: Our findings were consistent with that of previously reported case-control studies with colorectal cancer. These results suggest that the DNMT3B G39179T polymorphism influences DNMT3B expression, thus contributing to the genetic susceptibility to colorectal cancer. Further mechanistic studies are needed to unravel the causal molecular mechanisms.

  16. Mitochondrial DNA variants correlate with symptoms in myalgic encephalomyelitis/chronic fatigue syndrome

    OpenAIRE

    Billing-Ross, Paul; Germain, Arnaud; Ye, Kaixiong; Keinan, Alon; Gu, Zhenglong; Hanson, Maureen R.

    2016-01-01

    Background Mitochondrial dysfunction has been hypothesized to occur in Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS), a disease characterized by fatigue, cognitive difficulties, pain, malaise, and exercise intolerance. We investigated whether haplogroup, single nucleotide polymorphisms (SNPs), or heteroplasmy of mitochondrial DNA (mtDNA) were associated with health status and/or symptoms. Methods Illumina sequencing of PCR-amplified mtDNA was performed to analyze sequence and ex...

  17. Random amplification of polymorphic DNA (RAPD), pulsed-field gel electrophoresis (PFGE) and phage-typing in the analysis of a hospital outbreak of Salmonella enteritidis

    DEFF Research Database (Denmark)

    Skibsted, U.; Baggesen, Dorte Lau; Dessau, R.; Lisby, G.

    1998-01-01

    Isolates of Salmonella Enteritidis from 81 patients from Herlev Hospital or from Copenhagen County were analysed by random amplification of polymorphic DNA (RAPD), pulsed-field gel electrophoresis (PFGE) and phage-typing. Fourteen polymorphic markers from five decamer primers unambiguously placed...... that RAPD is useful as a tool in investigations of microbial outbreaks in its own right, or to supplement phage-typing and PFGE of Salmonella Enteritidis.......Isolates of Salmonella Enteritidis from 81 patients from Herlev Hospital or from Copenhagen County were analysed by random amplification of polymorphic DNA (RAPD), pulsed-field gel electrophoresis (PFGE) and phage-typing. Fourteen polymorphic markers from five decamer primers unambiguously placed...... (both PFGE type I) formed the fifth group. The sixth group of four isolates was not phage typeable and was PFGE type III. Forty outbreak-related isolates of phage-type 6 were resolved into three strains. No diversity of phage-type 6 was found among isolates unrelated to the outbreak. It is concluded...

  18. HVSI polymorphism indicates multiple origins of mtDNA in the Hazarewal population of Northern Pakistan.

    Science.gov (United States)

    Akbar, N; Ahmad, H; Nadeem, M S; Hemphill, B E; Muhammad, K; Ahmad, W; Ilyas, M

    2016-01-01

    Mitochondrial DNA (mtDNA) is an important tool used to explore ethnogenetics and the evolutionary history of human populations. In this study, hypervariable segment I (HVSI) from mtDNA was analyzed to establish the genetic lineage of the Hazarewal populations residing in the Mansehra and Abbottabad districts of Northern Pakistan. HVSI was extracted from genetic specimens obtained from 225 unrelated male and female individuals belonging to seven distinct Pakistani ethnic groups (31 Abbassis, 44 Awans, 38 Gujars, 16 Jadoons, 23 Karlals, 33 Syeds, and 40 Tanolis). Eighty-three haplogroups, 39 of which were unique, were identified; haplogroup H was predominantly represented (in 40% of the people), followed by haplogroups M (21.78%), R (16.89%), N (15.56%), L (3.11%), and HV (2.67%). The results revealed a sex-biased genetic contribution from putative West Eurasian, South Asian, and Sub-Saharan populations to the genetic lineage of Hazarewal ancestry, with the effect of Eurasians being predominant. The HVSI nucleotide sequences exhibited some characteristic deletion mutations between 16,022 and 16,193 bp, which is characteristic of specific ethnic groups. HVSI sequence homology showed that Hazarewal populations fall into three major clusters: Syeds and Awans sorted out into cluster I; Tanolis, Gujars, and Karlals segregated in cluster II; and Abbassis and Jadoons in cluster III. Here, we have reported the firsthand genetic information and evolutionary sketch of the selected populations residing alongside the historical Silk Route, which provides a baseline for collating the origin, route of migration, and phylogenetics of the population. PMID:27420957

  19. Polymorphisms in DNA repair genes, recreational physical activity and breast cancer risk

    Czech Academy of Sciences Publication Activity Database

    McCullough, L. E.; Santella, R. M.; Cleveland, R. J.; Millikan, R. C.; Olshan, A. F.; North, K. E.; Bradshaw, P. T.; Eng, S. M.; Terry, M. B.; Shen, J.; Crew, C. D.; Rössner ml., Pavel; Teitelbaum, S. L.; Neugut, A. I.; Grammon, M. D.

    2014-01-01

    Roč. 134, č. 3 (2014), s. 654-663. ISSN 0020-7136 Grant ostatní: National Institute of Environmental Health Sciences(US) P30ES009089; National Institute of Environmental Health Sciences(US) P30ES10126; Department of Defense Breast Cancer Research Program(US) BC093608; National Institute of Environmental Health Sciences(US) UO1CA/ES66572 Institutional support: RVO:68378041 Keywords : breast cacner * epidemiology * DNA repair Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.085, year: 2014

  20. Mitochondrial DNA polymorphism in invasive and native populations of Harmonia axyridis

    Directory of Open Access Journals (Sweden)

    Ilya A. Zakharov

    2011-12-01

    Full Text Available The Asian ladybird beetle, Harmonia axyridis (Pallas (Coleoptera: Coccinellidae, is one of the most invasive insects in the world. Originally introduced into the USA and Europe for the biological control of pest insects, it has recently gained the status of an invasive species. There is little data on the differences between invasive and non-invasive populations at the genetic level. In this research mtDNA sequences of the COI gene from specimens of native and non-native populations were compared. The results indicate that individuals from invasive populations are similar to those from Far Eastern native populations.

  1. Highly polymorphic DNA markers in an Africanized honey bee population in Costa Rica

    Directory of Open Access Journals (Sweden)

    Lobo Segura Jorge Arturo

    2000-01-01

    Full Text Available Two genetic markers (the mtDNA COI-COII intergenic region and the microsatellite A7 with high levels of variability in South African and European honey bees were analyzed in wild swarms of Africanized honey bees (Apis mellifera from Costa Rica. Allelic or haplotypic frequencies revealed high levels of genetic variability at these loci in this population. Most of the alleles were African alleles, although some European-derived alleles were also present. Differences in the frequencies of African alleles between African and Africanized samples were minor, which could be explained by founder effects occurring during the introduction of African honey bee populations into South America.

  2. A zwitterionic 1D/2D polymer co-crystal and its polymorphic sub-components: a highly selective sensing platform for HIV ds-DNA sequences.

    Science.gov (United States)

    Zhao, Hai-Qing; Yang, Shui-Ping; Ding, Ni-Ni; Qin, Liang; Qiu, Gui-Hua; Chen, Jin-Xiang; Zhang, Wen-Hua; Chen, Wen-Hua; Hor, T S Andy

    2016-03-15

    Polymorphic compounds {[Cu(dcbb)2(H2O)2]·10H2O}n (, 1D chain), [Cu(dcbb)2]n (, 2D layer) and their co-crystal {[Cu(dcbb)2(H2O)][Cu(dcbb)2]2}n () have been prepared from the coordination reaction of a 2D polymer [Na(dcbb)(H2O)]n (, H2dcbbBr = 1-(3,5-dicarboxybenzyl)-4,4'-bipyridinium bromide) with Cu(NO3)2·3H2O at different temperatures in water. Compounds have an identical metal-to-ligand stoichiometric ratio of 1 : 2, but absolutely differ in structure. Compound features a 2D layer structure with aromatic rings, positively charged pyridinium and free carboxylates on its surface, promoting electrostatic, π-stacking and/or hydrogen-bonding interactions with the carboxyfluorescein (FAM) labeled probe single-stranded DNA (probe ss-DNA, delineates as P-DNA). The resultant P-DNA@ system facilitated fluorescence quenching of FAM via a photoinduced electron transfer process. The P-DNA@ system functions as an efficient fluorescent sensor selective for HIV double-stranded DNA (HIV ds-DNA) due to the formation of a rigid triplex structure with the recovery of FAM fluorescence. The system reported herein also distinguishes complementary HIV ds-DNA from mismatched target DNA sequences with the detection limit of 1.42 nM. PMID:26883749

  3. Studi Epidemiologi Agen Zoonosis Escherichia coli O157:H7 melalui Analisis Random Amplification of Polymorphic DNA (RAPD

    Directory of Open Access Journals (Sweden)

    I Wayan Suardana

    2012-11-01

    Full Text Available Epidemiological studies of zoonotic agent Escherichia coli O157:H7 have been analyzed pheneticallyand or phylogenetically. In a phenetic classification, micoorganisms are arranged into groups (phena onthe basis of high overall similarity using both phenotypic and genotypic methods without judgementaspect of its ancestry or evolutionary. Due to its importance to epidemiological aspect, the study of geneticvariation of isolates origin from some sources need to be conducted in order to trace the routes of infection.A total of 20 samples obtained from some sources i.e clinically human feces, non-clinically human feces,cattle feces, chicken feces, and beef feces were used in this study. The study was started by confirming allof the isolates using O157 latex agglutination test and H7 antiserum test, followed by genomic DNAanalysis by random amplification of polymorphic DNA /RAPD methods. RAPD results were analyzed using a simple matching coeficient (Ssm and alogorhythm unweighted pair group method using arithmeticaverages (UPGMA programe. Results showed there were range of genetic DNA from local isolates (75.1–99,6% which was almost similar to ATCC 43894 control isolate. The highest similarity (99.6% to ATCC43894 control was showed by SM-7(1 isolate obtained from cattle fecal and KL-68(1, isolate obtainedfrom clinically human fecal. In addition, KL-52(7 obtained from clinically human fecal had high similarity(99.6% to MK-35 isolate obtained from chicken fecal. On the other hand, DS-21(4 and DS-16(2 isolatesthat were obtained from beef had high similarity (84.9% to other isolates including ATCC 43894 controlisolate. The highest similarity of E. coli O157:H7 isolates that were obtained from cattle feces, beef, andchicken feces to human feces isolate indicated that there were both cattle and chicken were potentialreservoirs of the zoonotic agen which can be transmitted to human.

  4. Genomic DNA enrichment using sequence capture microarrays: a novel approach to discover sequence nucleotide polymorphisms (SNP in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Wayne E Clarke

    Full Text Available Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38. The main goal of this project was to combine sequence capture with next generation sequencing (NGS to discover single nucleotide polymorphisms (SNPs in specific areas of the B. napus genome historically associated (via quantitative trait loci -QTL- analysis to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively. Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species.

  5. Variation in PAH-related DNA adduct levels among non-smokers: the role of multiple genetic polymorphisms and nucleotide excision repair phenotype

    OpenAIRE

    Etemadi, Arash; Islami, Farhad; Phillips, David H.; Godschalk, Roger; Golozar, Asieh; Kamangar, Farin; Malekshah, Akbar Fazel-Tabar; Pourshams, Akram; Elahi, Seerat; Ghojaghi, Farhad; Strickland, Paul T.; Taylor, Philip R.; Boffetta, Paolo; Abnet, Christian C.; Dawsey, Sanford M.

    2012-01-01

    Polycyclic aromatic hydrocarbons (PAHs) likely play a role in many cancers even in never-smokers. We tried to find a model to explain the relationship between variation in PAH-related DNA adduct levels among people with similar exposures, multiple genetic polymorphisms in genes related to metabolic and repair pathways, and nucleotide excision repair (NER) capacity. In 111 randomly selected female never-smokers from the Golestan Cohort Study in Iran, we evaluated 21 SNPs in 14 genes related to...

  6. Genetic Diversity of Maternal Lineage in the Endangered Kiso Horse Based on Polymorphism of the Mitochondrial DNA D-Loop Region

    OpenAIRE

    TAKASU, Masaki; ISHIHARA, Namiko; Tozaki, Teruaki; KAKOI, Hironaga; MAEDA, Masami; MUKOYAMA, Harutaka

    2014-01-01

    ABSTRACT To determine genetic characteristics of the maternal lineage of the Kiso horse based on polymorphisms of the mitochondrial DNA D-loop region, we collected blood samples from 136 Kiso horses, 91% of the entire population, and sequenced 411 bp from 15,437 to 15,847 in the region. First of all, we estimated the demographic history; by searching homology between the obtained and known sequences using Basic Local Alignment Search Tool, by mismatch analysis to evaluate the mutation process...

  7. An alternative method to amplify RNA without loss of signal conservation for expression analysis with a proteinase DNA microarray in the ArrayTube® format

    Directory of Open Access Journals (Sweden)

    Wiederanders B

    2006-06-01

    Full Text Available Abstract Background Recent developments in DNA microarray technology led to a variety of open and closed devices and systems including high and low density microarrays for high-throughput screening applications as well as microarrays of lower density for specific diagnostic purposes. Beside predefined microarrays for specific applications manufacturers offer the production of custom-designed microarrays adapted to customers' wishes. Array based assays demand complex procedures including several steps for sample preparation (RNA extraction, amplification and sample labelling, hybridization and detection, thus leading to a high variability between several approaches and resulting in the necessity of extensive standardization and normalization procedures. Results In the present work a custom designed human proteinase DNA microarray of lower density in ArrayTube® format was established. This highly economic open platform only requires standard laboratory equipment and allows the study of the molecular regulation of cell behaviour by proteinases. We established a procedure for sample preparation and hybridization and verified the array based gene expression profile by quantitative real-time PCR (QRT-PCR. Moreover, we compared the results with the well established Affymetrix microarray. By application of standard labelling procedures with e.g. Klenow fragment exo-, single primer amplification (SPA or In Vitro Transcription (IVT we noticed a loss of signal conservation for some genes. To overcome this problem we developed a protocol in accordance with the SPA protocol, in which we included target specific primers designed individually for each spotted oligomer. Here we present a complete array based assay in which only the specific transcripts of interest are amplified in parallel and in a linear manner. The array represents a proof of principle which can be adapted to other species as well. Conclusion As the designed protocol for amplifying m

  8. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Marcelo Ricardo Vicari

    2006-01-01

    Full Text Available We used differential staining techniques (BSG, GTG, AgNO3, DAPI and CMA3 banding and fluorescent in situ hybridization (FISH with 5S and 18S probes to investigated the karyotypic and cytogenetic chracteristics of Prochilodus lineatus specimens from a population in Vila Velha state park (Parque Estadual de Vila Velha, Ponta Grossa, Paraná state, southern Brazil. The specimens studied showed the same karyotype as that found in other P. lineatus populations, i.e. 2n = 54 biarmed chromosomes (40m + 14 sm and c-positive heterochromatin preferentially located pericentromerically in all chromosomes. The presence of partial or totally heterochromatic supernumerary chromosomes with numeric intra-individual variation was confirmed in the analyzed population. The nucleolar organizing regions (NORs were interstitially situated on the long arm of chromosome pair 4 directly beneath the centromere. The differential banding techniques and FISH revealed NOR size polymorphism due to structural events such as breaks and duplication of the larger rDNA site cluster. We also observed syntenic localization of the 5S ribosomal genes in the distal segment of the 45S cluster.

  9. Aberrant DNA Methylation of P16, MGMT, and hMLH1 Genes in Combination with MTHFR C677T Genetic Polymorphism in gastric cancer

    OpenAIRE

    Song, Binbin; Ai, Jiang; Kong, Xianghong; Liu, Dexin; Li, Jun

    2013-01-01

    Objective: We aimed to explore the association of P16, MGMT and HMLH1 with gastric cancer and their relation with Methylenetetrahydrofolate reductase (MTHFR). Methods: 322 gastric patients who were confirmed with pathological diagnosis were included in our study. Aberrant DNA methylation of P16, MGMT and HMLH1 and polymorphisms of MTHFR C677T and A1298C were detected using PCR-RFLP. Results: The proportions of DNA hypermethylation in P16, MGMT and hMLH1 genes in gastric cancer tissues were 75...

  10. DNA repair gene XPD Asp312Asn and XRCC4 G-1394T polymorphisms and the risk of autism spectrum disorder.

    Science.gov (United States)

    Dasdemir, S; Guven, M; Pekkoc, K C; Ulucan, H; Dogangun, B; Kirtas, E; Kadak, M T; Kucur, M; Seven, M

    2016-01-01

    Autism spectrum disorder (ASD) is a complex disorder, and its extreme heterogeneity further complicates our understanding of its biology. Epidemiological evidence from family and twin studies supports a strong genetic component in ASD etiology. Oxidative stress and abnormal DNA methylation have been implicated in the pathophysiology of ASD. Brain tissues from ASD cases showed higher levels of oxidative stress biomarkers than healthy controls in postmortem analysis. Association between oxidative stress and DNA damage has been well-known. Thus, we sought to investigate a potential link between DNA repair genes and ASD and analyze the role of XPD Asp312Asn and XRCC4 G-1394T gene polymorphisms for ASD in the Turkish population. Genotyping was conducted by PCR-RFLP based on 100 patients and 96 unrelated healthy controls. We, for the first time, demonstrated a positive association between XRCC4 gene variants and ASD risk. Frequencies of XRCC4-1394 T/G+G/G genotypes were higher in patients (%34) than the controls (%18.7). The statistical analysis revealed that the individuals who had XRCC4-1394 T/G+G/G genotype had an increased risk for ASD (OR = 2.23, 95% CI = 1.10-4.55). However, no significant association was found for XPD Asp312Asn polymorphism with the risk of ASD. Our findings suggest that XRCC4 G-1394T polymorphism might be associated with ASD pathogenesis. PMID:27064873

  11. A Cost-effective High-resolution Melting Approach using the EvaGreen Dye for DNA Polymorphism Detection and Genotyping in Plants

    Institute of Scientific and Technical Information of China (English)

    Yi-Dan Li; Zhi-Zhan Chu; Xiang-Guo Liu; Hai-Chun Jing; Yao-Guang Liu; Dong-Yun Hao

    2010-01-01

    High-resolution melting (HRM) analysis relies on the use of fluorescent dyes, such as LCGreen,ResoLight, and SYTO9, which bind in a saturated manner to the double-stranded DNAs. These dyes are expensive in use and may not be affordable when dealing with a large quantity of samples. EvaGreen is a much cheaper DNA helix intercalating dye and has been used in quantitative real-time polymerase chain reaction (PCR) and post-PCR DNA melt curve analysis. Here we report on the development of an EvaGreen-based HRM analysis and its performance, in comparison with the popular LCGreen-based HRM analysis, in detection of DNA polymorphism in plants. We found that various polymorphisms ranged from single nucleotide polymorphisms (SNPs) to Indels were equally detected by using EvaGreen- or LCGreen-based HRM. EvaGreen dye was sensitive enough in discovery of SNPs in fivefold pooled samples.Using this economical dye we successfully identified multiple novel mutant alleles of Gln1-3 gene,which produces a cytosolic glutamine synthetase isoenzyme (GS1), in a maize ethyl methanesulfonate (EMS)-mutagenized library, and genotyped rice mapping populations with SNP markers. The current results suggest that EvaGreen is a promising dye for HRM analysis for its ease to use and cost effectiveness.

  12. Intestinal carriage of Campylobacter jejuni and Campylobacter coli among cattle from South-western Norway and comparative genotyping of bovine and human isolates by amplified-fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Vardund T

    2006-06-01

    Full Text Available Abstract In a survey conducted in 1999–2001, the carriage of thermotolerant Campylobacters in cattle was investigated, and the genetic diversity of C. jejuni within one herd was examined and compared with human isolates. C. jejuni, C. coli and other thermotolerant Campylobacter spp. were isolated from intestinal contents from 26%, 3% and 2% of 804 cattle, respectively. The carriage rate was higher in calves (46% than in adults (29%. Twenty-nine C. jejuni isolates from one herd and 31 human isolates from the study area were genotyped with amplified-fragment length polymorphism (AFLP. Eighty-three % of the bovine isolates fell into three distinct clusters with 95–100% similarity, persistent in the herd for 5–10 months. Among human isolates, 58% showed >90% similarity with bovine isolates. The results show that cattle are a significant and stable reservoir for C. jejuni in the study area. Transmission between individuals within the herd may be sufficient to maintain a steady C. jejuni population independent of environmental influx. The results of this study have provided new information on C. jejuni and C. coli transmission, and also on the carriage in cattle, genotypes stability and similarity between bovine and human isolates.

  13. Variable lipoprotein haemagglutinin (vlhA) gene sequence typing of mainly Dutch Mycoplasma synoviae isolates: comparison with vlhA sequences from Genbank and with amplified fragment length polymorphism analysis.

    Science.gov (United States)

    Dijkman, R; Feberwee, A; Landman, W J M

    2014-01-01

    Molecular typing techniques with sufficient discriminatory power are required to better understand the transmission of Mycoplasma synoviae, a poultry pathogen with increasing clinical and economic relevance. A promising molecular technique is polymerase chain reaction and subsequent sequencing based on the conserved 5' region of the M. synoviae variable lipoprotein and haemagglutinin (vlhA) gene. This technique was used for genotyping 27 mainly Dutch M. synoviae isolates from different organs of various categories of poultry housed on different farms and collected during a period of 10 years. The obtained vlhA sequences were compared with those of M. synoviae strains from Genbank and data obtained by amplified fragment length polymorphism (AFLP). Grouping based on 100% similarity revealed nine genotypes. Some isolates had identical vlhA gene sequences although they originated from different geographical areas, different years and organs. AFLP analysis results largely confirmed the results obtained by vlhA sequence typing. Our findings raise concern regarding the discriminatory power of these techniques for its use in molecular epidemiology of Dutch M. synoviae isolates and for the differentiation between M. synoviae vaccine strains and field isolates, and indicate that molecular typing based on additional markers should be considered. PMID:25189763

  14. The Research and Application Development of Human Mitochondrial DNA Polymorphism%人类线粒体DNA多态性及其应用的研究进展

    Institute of Scientific and Technical Information of China (English)

    朱颖婷; 程慧华; 金颖; 徐开轶; 夏之秋; 漆微韡; 骆晓枫

    2009-01-01

    Mitochondrial DNA (mtDNA) is the unique extranuclear genome of human being, and strictly maternally inherited. Mitochondrial DNA has high mutation rate and substantial accumulation of mutation. Therefore, the polymorphism of mtDNA plays an important role in the study of individual identity, population relationship, and consanguinity identification, etc, which will be discussed in details.%线粒体DNA是惟一分布于核外的遗传物质,呈严格母系遗传,突变率高且积累量大,因此人类线粒体DNA的遗传多态性对于个体识别、种族遗传关系分析、亲缘关系鉴定等具有重要意义,本文对人类线粒体DNA多态性应用于以上方面的研究进展以予综述.

  15. Analysis of HLA-DQB and HLA-DPB alleles in Graves' disease by oligonucleotide probing of enzymatically amplified DNA.

    Science.gov (United States)

    Weetman, A P; Zhang, L; Webb, S; Shine, B

    1990-07-01

    We have tested the possible association of HLA-DQB and HLA-DPB alleles with Graves' thyrotoxicosis, with or without severe ophthalmopathy, by polymerase chain amplification of genomic DNA and allele-specific oligonucleotide probing. There was no significantly abnormal distribution of DQB alleles compared to 50 control subjects except for a reduced prevalence of DQw 3.1 in the Graves' patients with severe ophthalmopathy (X2 = 6.23, P less than 0.02). HLA-DPB 2.1/8 was found in only 1 of 40 of these patients compared with 15 of the controls (X2 = 11.49, P less than 0.001). Ten of 48 patients with Graves' disease but without clinically significant eye involvement were HLA-DPB 2.1/8 positive, not significantly different from controls, but significantly different from the ophthalmopathy group (X2 = 6.70, P less than 0.01). The other DPB alleles in both groups of Graves' disease patients were the same as controls. These results suggest that HLA-DPB 2.1/8 may confer a protective effect in Graves' disease with respect to ophthalmopathy. PMID:2401099

  16. Fluorescence detection of single-nucleotide polymorphism with single-strand triplex-forming DNA probes.

    Science.gov (United States)

    Li, Xinpeng; Wang, Yuan; Guo, Jiajie; Tang, Xinjing

    2011-12-16

    Triple-helix-forming oligonucleotides (TFOs) are widespread in the genome and have been found in regulatory regions, especially in promoter zones and recombination hotspots of DNA. To specifically detect these polypurine sequences, we designed and synthesized two dual pyrene-labeled single-strand oligonucleotide probes (TFO-FPs) consisting of recognition, linker, and detection sequences. The hybridization processes of TFO-FPs with target polypurine oligonucleotides involve both Watson-Crick and Hoogsteen base-pairings. Through double sensing of oligonucleotide sequences, single mutations of target oligonucleotides are detected by monitoring changes in pyrene fluorescence. The high specificities of the probes are maintained over a wide temperature range without sacrifice of hybridization kinetics. PMID:22095630

  17. HindIII identifies a two allele DNA polymorphism of the human cannabinoid receptor gene (CNR)

    Energy Technology Data Exchange (ETDEWEB)

    Caenazzo, L.; Hoehe, M.R.; Hsieh, W.T.; Berrettini, W.H.; Bonner, T.I.; Gershon, E.S. (National Inst. of Health, Bethesda, MD (United States))

    1991-09-11

    HCNR p5, a 0.9 kb BamHI/EcoRI fragment from the human cannabinoid receptor gene inserted into pUC19, was used as probe. The fragment is located in an intron approximately 14 kb 5{prime} of the initiation codon. This fragment is a clean single copy sequence by genomic blotting. Hybridization of human genomic DNA digested with HindIII identified a two allele RFLP with bands at 5.5 (A1) and 3.3 kb (A2). The human cannabinoid receptor gene has been genetically mapped in CEPH reference pedigrees to the centromeric/q region of chromosome 6. In situ hybridization localizes it to 6q14-q15. Codominant segregation has been observed in 26 informative two- and three-generation CEPH pedigrees and in 14 medium-sized disease families.

  18. Genetic polymorphisms in DNA repair genes and possible links with DNA repair rates, chromosomal aberrations and single-strand breaks in DNA

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Kumar, R.; Štětina, R.; Sanyal, S.; Souček, P.; Haufroid, V.; Dušinská, M.; Kuricová, M.; Zámečníková, M.; Musak, L.; Buchancová, J.; Norppa, H.; Hirvonen, A.; Vodičková, L.; Naccarati, Alessio; Matoušů, Zora; Hemminki, K.

    2004-01-01

    Roč. 25, č. 5 (2004), s. 757-763. ISSN 0143-3334 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 5.375, year: 2004

  19. Proteome-wide survey of phosphorylation patterns affected by nuclear DNA polymorphisms in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Engelsberger Wolfgang R

    2010-07-01

    Full Text Available Abstract Background Protein phosphorylation is an important post-translational modification influencing many aspects of dynamic cellular behavior. Site-specific phosphorylation of amino acid residues serine, threonine, and tyrosine can have profound effects on protein structure, activity, stability, and interaction with other biomolecules. Phosphorylation sites can be affected in diverse ways in members of any species, one such way is through single nucleotide polymorphisms (SNPs. The availability of large numbers of experimentally identified phosphorylation sites, and of natural variation datasets in Arabidopsis thaliana prompted us to analyze the effect of non-synonymous SNPs (nsSNPs onto phosphorylation sites. Results From the analyses of 7,178 experimentally identified phosphorylation sites we found that: (i Proteins with multiple phosphorylation sites occur more often than expected by chance. (ii Phosphorylation hotspots show a preference to be located outside conserved domains. (iii nsSNPs affected experimental phosphorylation sites as much as the corresponding non-phosphorylated amino acid residues. (iv Losses of experimental phosphorylation sites by nsSNPs were identified in 86 A. thaliana proteins, among them receptor proteins were overrepresented. These results were confirmed by similar analyses of predicted phosphorylation sites in A. thaliana. In addition, predicted threonine phosphorylation sites showed a significant enrichment of nsSNPs towards asparagines and a significant depletion of the synonymous substitution. Proteins in which predicted phosphorylation sites were affected by nsSNPs (loss and gain, were determined to be mainly receptor proteins, stress response proteins and proteins involved in nucleotide and protein binding. Proteins involved in metabolism, catalytic activity and biosynthesis were less affected. Conclusions We analyzed more than 7,100 experimentally identified phosphorylation sites in almost 4,300 protein

  20. Use of single-enzyme amplified fragment length polymorphism for typing Clostridium perfringens isolated from diarrheic piglets Uso do polimorfismo do comprimento de fragmentos amplificados para tipagem de Clostridium perfringens isolados de suínos com diarréia

    OpenAIRE

    Luciane Tieko Shinya; Maria Regina Baccaro; Andrea Micke Moreno

    2006-01-01

    Clostridium perfringens is an important pathogen in human and veterinary medicine. In swine, the agent is responsible for necrotic enteritis and enterotoxemia characterized by diarrhea, weight loss, delayed development and, in some cases, death. In the present study amplified fragment length polymorphism analyses (AFLP) was used to characterize 54 C. perfringens strains isolated from swine presenting diarrhea. Analysis of the results showed 29 distinct profiles with discriminatory index equal...

  1. Development and Clinical Application of a Single-tube Nested PCR Method to Amplify the DNA Polymerase I Gene of Treponema Pallidum

    Institute of Scientific and Technical Information of China (English)

    曾铁兵; 吴移谋; 黄澍杰; 吴志周

    2004-01-01

    Objective: To develop a sensitive, specific and simple method for detection of extremely low numbers of T. pallidum in clinical specimens, as a significant addition to the serologic tests for syphilis diagnosis. Methods: Double-tube nested PCR(DN-PCR) and single-tube nested PCR(SN-PCR) assays were performed to amplify specific fragments of the DNA polymerase I gene(polA) of T. pallidum. Sensitivity and specificity of the two PCR assays were tested. Eightysix whole blood specimens from persons with suspected syphilis were detected by the two nested PCR methods. The TPPA test was used as a comparison for detecting syphilis in sera from corresponding patients. Results: Only specific amplicons could be obtained during amplification of the T. pallidum polA gene and the detection limit was approximately 1 organism when analyzed on gel by the two PCR methods. Of 86 clinical specimens, 62 were positive by TPPA. Of these, 54 and 51 were positive by the DN-PCR and SN-PCR, respectively, which does not represent a statistically significant difference between the two PCR tests. Of 24 TPPA-negative specimens, 5 were positive by both DN-PCR assay and SN-PCR assay. Conclusion: The SN-polA PCR method is extremely sensitive, specific and easy to perform for detecting low numbers of T. pallidum in clinical blood specimens as a complementary to serology for syphilis diagnosis.

  2. Molecular screening of lysyl oxidase G473A polymorphism in oral submucous fibrosis

    Directory of Open Access Journals (Sweden)

    Amit Thorawat

    2014-01-01

    Full Text Available Aim: To investigate the presence of lysyl oxidase (LOX G473A polymorphism in group 1 {Oral submucous fibrosis (OSMF patients}, group 2 (betel quid chewers without OSMF and group 3 (healthy individuals. Materials and Methods: A total of 60 patients were taken for the study, which included 20 OSMF patients (group 1, 20 betel quid chewers without OSMF (group 2 and 20 healthy individuals without OSMF and betel quid chewing habit (group 3. DNA was isolated using Qiagen kit. The isolated DNA was quantified using spectroscopic methods. Polymerase chain reaction (PCR was carried out at annealing temperature of 67 o C. PCR amplification was checked on 2% agarose gel. Further, the amplified PCR products were subjected to automated DNA sequencer, to assess LOX G473A polymorphism. Results: The gene sequence data generated from the automated DNA sequencer was received as colored electropherograms. These gene-sequencing results did not show LOX G473A polymorphism in any of the 3 groups. Conclusion: In our study, gene-sequencing results did not show LOX G473A polymorphism in OSMF patients. Since only one study in the literature has shown the association of LOX gene polymorphism and OSMF patients, we conclude that further studies are required to unveil the role of LOX gene polymorphism in OSMF.

  3. DNA methylation affected by male sterile cytoplasm in rice (Oryza sativa L.)

    Science.gov (United States)

    Male sterile cytoplasm plays an important role in hybrid rice and cytoplasmic effects are sufficiently documented. However, no reports are available on DNA methylation affected by male sterile cytoplasm in hybrid rice. We used a methylation sensitive amplified polymorphism (MSAP) technique to charac...

  4. Association between Genetic Polymorphisms of DNA Repair Genes and Chromosomal Damage for 1,3-Butadiene-Exposed Workers in a Matched Study in China

    Directory of Open Access Journals (Sweden)

    Menglong Xiang

    2015-01-01

    Full Text Available The aim of the study was to examine the association between polymorphisms of DNA repair genes and chromosomal damage of 1,3-butadiene- (BD- exposed workers. The study was conducted in 45 pairs of occupationally exposed workers in a BD product workshop and matched control workers in an administrative office and a circulatory water workshop in China. Newly developed biomarkers (micronuclei, MNi; nucleoplasmic bridges, NPBs; nuclear buds, NBUDs in the cytokinesis-blocked micronucleus (CBMN cytome assay were adopted to detect chromosomal damage. PCR and PCR-restriction fragment length polymorphism (RFLP are adopted to analyze polymorphisms of DNA repair genes, such as X-ray repair cross-complementing Group 1 (XRCC1, O6-methylguanine-DNA methyltransferase (MGMT, poly (adenosine diphosphate-ribose polymerases (ADPRT, and apurinic/apyrimidinic endonucleases (APE1. The BD-exposed workers exhibited increased frequencies of MNi and NPBs when compared to subjects in the control group. The results also show that the BD-exposed workers carrying XRCC1 diplotypes TCGA-CCGG (4.25±2.06‰ (FR=2.10, 95% CI: 1.03–4.28 and TCGG-TCGA (5.80±3.56‰ (FR=2.75, 95% CI: 0.76–2.65 had statistically higher NBUD frequencies than those who carried diplotype TCGG-TCGG (1.89±1.27‰. Our study suggests that polymorphisms of XRCC1 gene may influence chromosomal damage in BD-exposed workers.

  5. cDNA: 36928 [

    Lifescience Database Archive (English)

    Full Text Available M. musculus - Mm.240850 Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enrich ... MA AMPLIFIED SEQUENCE 1 (NOVEL AMPLIFIED IN BREAST CANCER ... 1) (AMPLIFIED AND OVEREXPRESSED IN BREAST CANCER ) ...

  6. cDNA: 36927 [

    Lifescience Database Archive (English)

    Full Text Available M. musculus - Mm.240850 Mus musculus adult male stomach cDNA, RIKEN full-length enriched library ... MA AMPLIFIED SEQUENCE 1 (NOVEL AMPLIFIED IN BREAST CANCER ... 1) (AMPLIFIED AND OVEREXPRESSED IN BREAST CANCER ) ...

  7. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    OpenAIRE

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  8. Investigation of the somaclonal and mutagen induced variability in barley by the application of protein and DNA markers

    International Nuclear Information System (INIS)

    Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis

  9. Polymorphic DNA haplotypes at the phenylalanine hydroxylase (PAH) locus in European families with phenylketonuria (PKU)

    Science.gov (United States)

    Daiger, Stephen P.; Chakraborty, Ranajit; Reed, Lori; Fekete, György; Schuler, Dezso; Berenssi, György; Nasz, Istvan; Brdička, Radim; Kamarýt, Jaromir; Pijáčková, Anna; Moore, Sharon; Sullivan, Susan; Woo, Savio L. C.

    1989-01-01

    DNA haplotype data from the phenylalanine hydroxylase (PAH) locus are available from a number of European populations as a result of RFLP testing for genetic counseling in families with phenylketonuria (PKU). We have analyzed data from Hungary and Czechoslovakia together with published data from five additional countries–Denmark, Switzerland, Scotland, Germany, and France–representing a broad geographic and ethnographic range. The data include 686 complete chromosomal haplotypes for eight RFLP sites assayed in 202 unrelated Caucasian families with PKU. Forty-six distinct RFLP haplotypes have been observed to date, 10 unique to PKU-bearing chromosomes, 12 unique to non-PKU chromosomes, and the remainder found in association with both types. Despite the large number of haplotypes observed (still much less than the theoretical maximum of 384), five haplotypes alone account for more than 76% of normal European chromosomes and four haplotypes alone account for more than 80% of PKU-bearing chromosomes. We evaluated the distribution of haplotypes and alleles within these populations and calculated pairwise disequilibrium values between RFLP sites and between these sites and a hypothetical PKU “locus.” There are statistically significant differences between European populations in the frequencies of non-PKU chromosomal haplotypes (P = .025) and PKU chromosomal haplotypes (P < < .001). Haplotype frequencies of the PKU and non-PKU chromosomes also differ significantly (P < < .001. Disequilibrium values are consistent with the PAH physical map and support the molecular evidence for multiple, independent PKU mutations in Caucasians. However, the data do not support a single geographic origin for these mutations. Within these European populations a parent carrying a PKU mutation has an average probability of greater than 86% of being heterozygous–and hence informative for linkage–at one or more PAH RFLP sites. Thus these RFLP alleles and haplotypes provide an

  10. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  11. Detection of Single-Nucleotide Polymorphism on uidA Gene of Escherichia coli by a Multiplexed Electrochemical DNA Biosensor with Oligonucleotide-Incorporated Nonfouling Surface

    Directory of Open Access Journals (Sweden)

    Shiping Song

    2011-08-01

    Full Text Available We report here a practical application of a multiplexed electrochemical DNA sensor for highly specific single-nucleotide polymorphism (SNP detection. In this work, a 16-electrode array was applied with an oligonucleotide-incorporated nonfouling surfaces (ONS on each electrode for the resistance of unspecific absorption. The fully matched target DNA templated the ligation between the capture probe assembled on gold electrodes and the tandem signal probe with a biotin moiety, which could be transduced to peroxidase-based catalyzed amperometric signals. A mutant site (T93G in uidA gene of E. coli was analyzed in PCR amplicons. 10% percentage of single mismatched mutant gene was detected, which clearly proved the selectivity of the multiplexed electrochemical DNA biosensor when practically applied.

  12. Genotyping human ancient mtDNA control and coding region polymorphisms with a multiplexed Single-Base-Extension assay: the singular maternal history of the Tyrolean Iceman

    Directory of Open Access Journals (Sweden)

    Egarter-Vigl Eduard

    2009-06-01

    Full Text Available Abstract Background Progress in the field of human ancient DNA studies has been severely restricted due to the myriad sources of potential contamination, and because of the pronounced difficulty in identifying authentic results. Improving the robustness of human aDNA results is a necessary pre-requisite to vigorously testing hypotheses about human evolution in Europe, including possible admixture with Neanderthals. This study approaches the problem of distinguishing between authentic and contaminating sequences from common European mtDNA haplogroups by applying a multiplexed Single-Base-Extension assay, containing both control and coding region sites, to DNA extracted from the Tyrolean Iceman. Results The multiplex assay developed for this study was able to confirm that the Iceman's mtDNA belongs to a new European mtDNA clade with a very limited distribution amongst modern data sets. Controlled contamination experiments show that the correct results are returned by the multiplex assay even in the presence of substantial amounts of exogenous DNA. The overall level of discrimination achieved by targeting both control and coding region polymorphisms in a single reaction provides a methodology capable of dealing with most cases of homoplasy prevalent in European haplogroups. Conclusion The new genotyping results for the Iceman confirm the extreme fallibility of human aDNA studies in general, even when authenticated by independent replication. The sensitivity and accuracy of the multiplex Single-Base-Extension methodology forms part of an emerging suite of alternative techniques for the accurate retrieval of ancient DNA sequences from both anatomically modern humans and Neanderthals. The contamination of laboratories remains a pressing concern in aDNA studies, both in the pre and post-PCR environments, and the adoption of a forensic style assessment of a priori risks would significantly improve the credibility of results.

  13. Helicobacter pylori CagA protein polymorphisms and their lack of association with pathogenesis

    Institute of Scientific and Technical Information of China (English)

    Nicole; Acosta; Andrés; Quiroga; Pilar; Delgado; María; Mercedes; Bravo; Carlos; Jaramillo

    2010-01-01

    AIM: To investigate Helicobacter pylori (H. pylori) CagA diversity and to evaluate the association between protein polymorphisms and the occurrence of gastric pathologies. METHODS: One hundred and twenty-two clinical isolates of H. pylori cultured from gastric biopsies obtained from Colombian patients with dyspepsia were included as study material. DNA extracted from isolates was used to determine cagA status, amplifying the C-terminal cagA gene region by polymerase chain reaction. One hundred and six strai...

  14. PON1Q192R genetic polymorphism modifies organophosphorous pesticide effects on semen quality and DNA integrity in agricultural workers from southern Mexico

    International Nuclear Information System (INIS)

    Pesticide exposure, including organophosphorous (OP) insecticides, has been associated with poor semen quality, and paraoxonase (PON1), an enzyme involved in OP deactivation, may have a role on their susceptibility, due to PON1 polymorphisms. Our objective was to evaluate the role of PON1Q192R polymorphism on the susceptibility to OP toxicity on semen quality and DNA integrity in agricultural workers. A cross-sectional study was conducted in farmers with Mayan ascendancy from southeastern Mexico chronically exposed to pesticides; mostly OP. Fifty four agricultural workers (18-55 years old) were included, who provided semen and blood samples. Semen quality was evaluated according to WHO, sperm DNA damage by in situ-nick translation (NT-positive cells), PON1Q192R polymorphism by real-time PCR and serum PON1 activity by using phenylacetate and paraoxon. Two OP exposure indexes were created: at the month of sampling and during 3 months before sampling, representing the exposure to spermatids-spermatozoa and to cells at one spermatogenic cycle, respectively. PON1 192R and 192Q allele frequencies were 0.54 and 0.46, respectively. Significant associations were found between OP exposure at the month of sampling and NT-positive cells and sperm viability in homozygote 192RR subjects, and dose-effect relationships were observed between OP exposure during 3 months before sampling and sperm quality parameters and NT-positive cells in homozygote 192RR farmers. This suggests that cells at all stages of spermatogenesis are target of OP, and that there exists an interaction between OP exposure and PON1Q192R polymorphism on these effects; farmers featuring the 192RR genotype were more susceptible to develop reproductive toxic effects by OP exposure

  15. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    International Nuclear Information System (INIS)

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

  16. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Science.gov (United States)

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  17. IMP PCR primers detect single nucleotide polymorphisms for Anopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin in Anopheles arabiensis

    Directory of Open Access Journals (Sweden)

    Howell Paul I

    2006-12-01

    Full Text Available Abstract Background Polymerase chain reactions to distinguish single-nucleotide polymorphisms are commonly used for mosquito identification and identifying insecticide resistance alleles. However, the existing methods used for primer design often result in analyses that are not robust or require additional steps. Methods Utilizing oligonucleotides that are unique in having an intentional mismatch to both templates three bases from the SNP at the 3-prime end, three new PCR assays that distinguish SNP targets using standard gel electrophoresis of undigested DNA fragments were developed and tested. These were applied to: (1 an alternative ribosomal DNA PCR assay to distinguish five members of the Anopheles gambiae complex; (2 detection of the Mopti and Savanna rDNA types; and (3 an assay to distinguish resistance to dieldrin (Rdl alleles in Anopheles arabiensis. Results Reproducible specific amplification of the target alleles was observed in all three assays. The results were consistent with existing analyses but proved simpler and the results more distinct in our hands. Conclusion The simplicity and effectiveness of the method should be utilized in these and other PCR analyses to increase their specificity and simplicity. These results have the potential to be extended not only to mosquito analyses but also to parasite and human polymorphisms.

  18. Identification of sequence polymorphism in the D-Loop region of mitochondrial DNA as a risk factor for hepatocellular carcinoma with distinct etiology

    Directory of Open Access Journals (Sweden)

    Zhang Ruixing

    2010-09-01

    Full Text Available Abstract Background Hepatocellular carcinoma (HCC is frequently preceded by hepatitis virus infection or alcohol abuse. Genetic backgrounds may increase susceptibility to HCC from these exposures. Methods Mitochondrial DNA (mtDNA of peripheral blood, tumor, and/or adjacent non-tumor tissue from 49 hepatitis B virus-related and 11 alcohol-related HCC patients, and from 38 controls without HCC were examined for single nucleotide polymorphisms (SNPs and mutations in the D-Loop region. Results Single nucleotide polymorphisms (SNPs in the D-loop region of mt DNA were examined in HCC patients. Individual SNPs, namely the 16266C/T, 16293A/G, 16299A/G, 16303G/A, 242C/T, 368A/G, and 462C/T minor alleles, were associated with increased risk for alcohol- HCC, and the 523A/del was associated with increased risks of both HCC types. The mitochondrial haplotypes under the M haplogroup with a defining 489C polymorphism were detected in 27 (55.1% of HBV-HCCand 8 (72.7% of alcohol- HCC patients, and in 15 (39.5% of controls. Frequencies of the 489T/152T, 489T/523A, and 489T/525C haplotypes were significantly reduced in HBV-HCC patients compared with controls. In contrast, the haplotypes of 489C with 152T, 249A, 309C, 523Del, or 525Del associated significantly with increase of alcohol-HCC risk. Mutations in the D-Loop region were detected in 5 adjacent non-tumor tissues and increased in cancer stage (21 of 49 HBV-HCC and 4 of 11 alcohol- HCC, p Conclusions In sum, mitochondrial haplotypes may differentially predispose patients to HBV-HCC and alcohol-HCC. Mutations of the mitochondrial D-Loop sequence may relate to HCC development.

  19. Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction

    International Nuclear Information System (INIS)

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 x 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor

  20. Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-mediated Introduction

    Institute of Scientific and Technical Information of China (English)

    王浩波; 高秀武; 郭金华; 黄群策; 余增亮

    2002-01-01

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 ℃ for 5 hours. By twogenerations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.

  1. Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction

    Science.gov (United States)

    Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang

    2002-12-01

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.

  2. Association of Interleukin-10 Gene Promoter Polymorphisms in Saudi Patients with Vitiligo

    Directory of Open Access Journals (Sweden)

    Abdullah Abanmi

    2008-01-01

    Full Text Available The promoter region of human Interleukin −10 gene is highly polymorphic and has been associated with numerous autoimmune diseases. Recent studies have linked vitiligo with defective autoimmune system. This study is aimed to explore a possible association between IL-10 gene polymorphism and vitiligo in Saudi population. This case control study consisted of 184 Saudi subjects including 83 vitiligo patients (40 males, 43 females mean age 27.85 ± 12.43 years and 101 matched controls. Genomic DNA was extracted from the blood samples of healthy controls and Vitiligo patients visiting out patient clinic of Department of Dermatology, Riyadh Armed Forces Hospital, using QIA ampR DNA mini kit (Qiagen CA, USA. Interleukin-10 gene was amplified by polymerase chain reaction (PCR using Arms primers to detect any polymorphism involved at positions −592, −819 and −1082.

  3. Mutations in the D-loop region of mitochondrial DNA in gastric cancer

    Institute of Scientific and Technical Information of China (English)

    Yibing Zhao; Hongyu Yang; Guoyu Chen

    2005-01-01

    Objective: To investigate the mutations in the D-loop region of mitochondrial DNA (mtDNA) in gastric cancer.Methods: The mtDNA of D-loop region was amplified by PCR and sequenced in 20 samples from gastric cancer tissue and adjacent normal membrane. Results: There were 7/20(35% ) mutations in the mtDNA of D-loop region in gastric cancer patients. There were four microsatellite instabilities among the 18 mutations. Nine new polymorphisms were identified in 20 patients. Conclusion: The mtDNA of Dloop region might be highly polymorphoric and the mutation rate is high in patients with gastric cancer.

  4. Variation in PAH-related DNA adduct levels among non-smokers: the role of multiple genetic polymorphisms and nucleotide excision repair phenotype.

    Science.gov (United States)

    Etemadi, Arash; Islami, Farhad; Phillips, David H; Godschalk, Roger; Golozar, Asieh; Kamangar, Farin; Malekshah, Akbar Fazel-Tabar; Pourshams, Akram; Elahi, Seerat; Ghojaghi, Farhad; Strickland, Paul T; Taylor, Philip R; Boffetta, Paolo; Abnet, Christian C; Dawsey, Sanford M; Malekzadeh, Reza; van Schooten, Frederik J

    2013-06-15

    Polycyclic aromatic hydrocarbons (PAHs) likely play a role in many cancers even in never-smokers. We tried to find a model to explain the relationship between variation in PAH-related DNA adduct levels among people with similar exposures, multiple genetic polymorphisms in genes related to metabolic and repair pathways, and nucleotide excision repair (NER) capacity. In 111 randomly selected female never-smokers from the Golestan Cohort Study in Iran, we evaluated 21 SNPs in 14 genes related to xenobiotic metabolism and 12 SNPs in eight DNA repair genes. NER capacity was evaluated by a modified comet assay, and aromatic DNA adduct levels were measured in blood by32P-postlabeling. Multivariable regression models were compared by Akaike's information criterion (AIC). Aromatic DNA adduct levels ranged between 1.7 and 18.6 per 10(8) nucleotides (mean: 5.8 ± 3.1). DNA adduct level was significantly lower in homozygotes for NAT2 slow alleles and ERCC5 non-risk-allele genotype, and was higher in the MPO homozygote risk-allele genotype. The sum of risk alleles in these genes significantly correlated with the log-adduct level (r = 0.4, p studies, with large inter-individual variation which could best be explained by a combination of Phase I genes and NER capacity. PMID:23175176

  5. Complex relation between triazine-susceptible phenotype and genotype in the weed Senecio vulgaris may be caused by chloroplast DNA polymorphism.

    Science.gov (United States)

    Frey, J E; Müller-Schärer, H; Frey, B; Frei, D

    1999-08-01

    The weed Senecio vulgaris acquired high levels of resistance to triazine herbicides soon after the latter's introduction. As in most weeds, triazine resistance is conferred by a point mutation in the chloroplast psbA gene that negatively affects the fitness of its carrier. To assess levels of triazine resistance in S. vulgaris field populations, we adopted a PCR-RFLP-based molecular diagnostic test recently developed for the triazine resistance-conferring region of the psbA gene of other weeds, including Brassica napus, Chenopodium spp. and Amaranthus spp., and compared these molecular results to the phenotypic response after triazine application. A highly significant linear correlation was found between phytotoxic symptoms and biomass reduction. Variability in phenotypic response was not only found between populations or inbred lines of S. vulgaris but also within replicates of the same inbred line. No clear relationship, however, was found between the DNA restriction pattern and the phenotypic response to triazine application, thereby throwing doubt on the use of such molecular diagnostic tests to track triazine resistance in S. vulgaris. Our results indicate that the chloroplast genome of S. vulgaris is polymorphic and that the level of polymorphism may be variable within single leaves of individual plants. We discuss the possible genetic basis of this polymorphism and its consequence for the acquisition and inheritance of chloroplast-based traits. PMID:22665192

  6. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    ElenaV.Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  7. DNA Book

    OpenAIRE

    Kawai, Jun; Hayashizaki, Yoshihide

    2003-01-01

    We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and deli...

  8. DNA甲基化、单核苷酸多态性与肿瘤%DNA methylation, single nucleotide polymorphism, and tumor

    Institute of Scientific and Technical Information of China (English)

    蒋逸群; 胡多沙; 段芝

    2011-01-01

    DNA甲基化是表观遗传修饰的重要部分,基因异常甲基化在肿瘤发生、发展中扮演重要角色.众多研究结果表明单核苷酸多态性(single nucleotide polymorphism,SNP)与DNA甲基化之间存在密切联系,可能通过改变甲基化位点或对DNA甲基化相关酶类产生影响,继而影响到相关基因的甲基化状态,改变表达水平,导致肿瘤易感性发生变化.DNA甲基化代表的表观遗传与SNP代表的遗传突变能为癌变的分子机制研究提供更多的理论支持.%DNA methylation is one of the most important part in epigenetic modifications, and aberrant gene methylation plays a critical role in tumorigenesis. Many studies have indicated that DNA methylation is related to single nucleotide polymorphism ( SNP) which may modify the methylation sites or influence the biological function of enzymes related to DNA methylation, change the status of genes' methylation, which in turn, contribute to tumorigenesis. The role of epigenetic (such as DNA mehtyla-tion) and mutation (such as SNP) can provide more information for molecular metabolism in the carcin-ogensis.

  9. Polymorphisms in XPC, XPD, XRCC1, and XRCC3 DNA repair genes and lung cancer risk in a population of Northern Spain

    International Nuclear Information System (INIS)

    Polymorphisms in DNA repair genes have been associated to repair DNA lesions, and might contribute to the individual susceptibility to develop different types of cancer. Nucleotide excision repair (NER), base excision repair (BER), and double-strand break repair (DSBR) are the main DNA repair pathways. We investigated the relationship between polymorphisms in two NER genes, XPC (poly (AT) insertion/deletion: PAT-/+) and XPD (Asp312Asn and Lys751Gln), the BER gene XRCC1 (Arg399Gln), and the DSBR gene XRCC3 (Thr241Met) and the risk of developing lung cancer. A hospital-based case-control study was designed with 516 lung cancer patients and 533 control subjects, matched on ethnicity, age, and gender. Genotypes were determined by PCR-RFLP and the results were analysed using multivariate unconditional logistic regression, adjusting for age, gender and pack-years. Borderline association was found for XPC and XPD NER genes polymorphisms, while no association was observed for polymorphisms in BER and DSBR genes. XPC PAT+/+ genotype was associated with no statistically significant increased risk among ever smokers (OR = 1.40; 95%CI = 0.94–2.08), squamous cell carcinoma (OR = 1.44; 95%CI = 0.85–2.44), and adenocarcinoma (OR = 1.72; 95%CI = 0.97–3.04). XPD variant genotypes (312Asn/Asn and 751Gln/Gln) presented a not statistically significant risk of developing lung cancer (OR = 1.52; 95%CI = 0.91–2.51; OR = 1.38; 95%CI = 0.85–2.25, respectively), especially among ever smokers (OR = 1.58; 95%CI = 0.96–2.60), heavy smokers (OR = 2.07; 95%CI = 0.74–5.75), and adenocarcinoma (OR = 1.88; 95%CI = 0.97–3.63). On the other hand, individuals homozygous for the XRCC1 399Gln allele presented no risk of developing lung cancer (OR = 0.87; 95%CI = 0.57–1.31) except for individuals carriers of 399Gln/Gln genotype and without family history of cancer (OR = 0.57; 95%CI = 0.33–0.98) and no association was found between XRCC3 Thr241Met polymorphism and lung cancer risk (OR

  10. Mitochondrial DNA 5178 C/A polymorphism influences the effects of habitual smoking on the risk of dyslipidemia in middle-aged Japanese men

    Directory of Open Access Journals (Sweden)

    Kokaze Akatsuki

    2012-08-01

    Full Text Available Abstract Background Several genetic polymorphisms have been reported to modify the effects of smoking on serum lipid levels. The objective of this study was to investigate whether longevity-associated mitochondrial DNA 5178 (Mt5178 C/A polymorphism modifies the effects of habitual smoking on the risk of dyslipidemia in middle-aged Japanese subjects. Methods A total of 394 male subjects (age, 53.9 ± 7.9 years; mean ± SD were selected from among individuals visiting the hospital for regular medical check-ups. After Mt5178 C/A genotyping, a cross-sectional study assessing the joint effect of Mt5178 C/A polymorphism and cigarette smoking on the risk of hypo-high-density lipoprotein (HDL cholesterolemia, hyper-low-density lipoprotein (LDL cholesterolemia or hypertriglyceridemia was conducted. Results For subjects with Mt5178C, the risk of hypo-HDL cholesterolemia increased with the number of cigarettes smoked daily (P for trend = 0.001. On the other hand, the association between Mt5178A genotype and the risk of hypo-HDL cholesterolemia did not appear to depend on the number of cigarettes smoked daily. For those with Mt5178A, the risk of hyper-LDL cholesterolemia or hypertriglyceridemia increased with cigarettes smoked daily (P for trend = 0.017 and P for trend = 0.002, respectively. However, the association between Mt5178C genotype and the risk of hyper-LDL cholesterolemia or hypertriglyceridemia did not depend on the number of cigarettes smoked daily. Conclusions The present results suggest that Mt5178 C/A polymorphism modulates the effects of habitual smoking on the risk of dyslipidemia in middle-aged Japanese men.

  11. A young Alu subfamily amplified independently in human and African great apes lineages.

    OpenAIRE

    Zietkiewicz, E; Richer, C.; Makalowski, W; Jurka, J; Labuda, D

    1994-01-01

    A variety of Alu subfamilies amplified in primate genomes at different evolutionary time periods. Alu Sb2 belongs to a group of young subfamilies with a characteristic two-nucleotide deletion at positions 65/66. It consists of repeats having a 7-nucleotide duplication of a sequence segment involving positions 246 through 252. The presence of Sb2 inserts was examined in five genomic loci in 120 human DNA samples as well as in DNAs of higher primates. The lack of the insertional polymorphism se...

  12. Modulatory effect of plasma folate and polymorphisms in one-carbon metabolism on catecholamine methyltransferase (COMT) H108L associated oxidative DNA damage and breast cancer risk

    International Nuclear Information System (INIS)

    The present study was aimed to investigate the modulatory role of plasma folate and eight putatively functional polymorphisms of one-carbon metabolism on catecholamine methyltransferase (COMT)-mediated oxidative DNA damage and breast cancer risk. Plasma folate and 8-oxo-2'-deoxyguanosine (8-oxodG) were estimated by commercially available kits, while polymorphisms were screened by PCR-RFLP and PCR-AFLP methods. COMT H108L polymorphism showed independent association with breast cancer (OR: 1.73, 95% CI: 1.31 -2.30). No significant interaction was observed between folate status and COMT genotype. Multifactor dimensionality reduction (MDR) analysis gave evidence for the significant epistatic (gene-gene) interactions (p<0.0001) of COMT H108L with reduced folate carrier 1 (RFC1) G80A, thymidylate synthase (TYMS) 5'-UTR 3R2R, TYMS 3'-UTR ins6/del6. Increased plasma 8-oxodG were observed in cases compared to controls (mean ± SE: 5.59 ± 0.60 vs. 3.50 ± 0.40 ng/ml, p<0.004). Plasma folate deficiency alone was not a significant predictor of 8-oxodG elevation. The genotype combinations namely, RFC1 G80A/methionine synthase reductase (MTRR) A66G, RFC1 G80A/SHMT C1420T/TYMS 3R2R and serine hydroxymethyltransferase (SHMT) C1420T/TYMS 3R2R/methionine synthase (MTR) A2756G/COMT H108L were strong predictors of 8-oxodG elevation in the order of risk. To conclude, the current study provides substantial evidence for a cross talk between one-carbon metabolism and COMT catalysis that might influence oxidative DNA damage and breast cancer risk. (author)

  13. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

    Directory of Open Access Journals (Sweden)

    Coupland George

    2005-08-01

    Full Text Available Abstract Background Many established PCR-based approaches in plant molecular biology rely on lengthy and expensive methods for isolation of nucleic acids. Although several rapid DNA isolation protocols are available, they have not been tested for simultaneous RNA isolation for RT-PCR applications. In addition, traditional map-based cloning technologies often use ill-proportioned marker regions even when working with the model plant Arabidopsis thaliana, where the availability of the full genome sequence can now be exploited for the creation of a high-density marker systems. Results We designed a high-density polymorphic marker set between two frequently used ecotypes. This new polymorphic marker set allows size separation of PCR products on agarose gels and provides an initial resolution of 10 cM in linkage mapping experiments, facilitated by a rapid plant nucleic acid extraction protocol using minimal amounts of A. thaliana tissue. Using this extraction protocol, we have also characterized segregating T-DNA insertion mutations. In addition, we have shown that our rapid nucleic acid extraction protocol can also be used for monitoring transcript levels by RT-PCR amplification. Finally we have demonstrated that our nucleic acid isolation method is also suitable for other plant species, such as tobacco and barley. Conclusion To facilitate high-throughput linkage mapping and other genomic applications, our nucleic acid isolation protocol yields sufficient quality of DNA and RNA templates for PCR and RT-PCR reactions, respectively. This new technique requires considerably less time compared to other purification methods, and in combination with a new polymorphic PCR marker set dramatically reduces the workload required for linkage mapping of mutations in A. thaliana utilizing crosses between Col-0 and Landsberg erecta (Ler ecotypes.

  14. DNA polymorphisms of the human alpha 1 antitrypsin gene in normal subjects and in patients with pulmonary emphysema.

    OpenAIRE

    Hodgson, I; Kalsheker, N

    1987-01-01

    Alpha 1 antitrypsin deficiency predisposes subjects to developing pulmonary emphysema and childhood liver cirrhosis. We have studied restriction fragment length polymorphisms (RFLPs) of the alpha 1 antitrypsin gene in a normal population and a group of patients with pulmonary emphysema. We have identified five RFLPs with eight restriction enzymes. The most frequent polymorphisms have been detected with the enzymes MspI, PstI, and TaqI at frequencies of 46.8%, 6.4%, and 5.0% respectively in th...

  15. Elevated breast cancer risk in irradiated BALB/c mice associates with unique functional polymorphism of the Prkdc (DNA-dependent protein kinase catalytic subunit) gene

    Science.gov (United States)

    Yu, Y.; Okayasu, R.; Weil, M. M.; Silver, A.; McCarthy, M.; Zabriskie, R.; Long, S.; Cox, R.; Ullrich, R. L.

    2001-01-01

    Female BALB/c mice are unusually radiosensitive and more susceptible than C57BL/6 and other tested inbred mice to ionizing radiation (IR)-induced mammary tumors. This breast cancer susceptibility is correlated with elevated susceptibility for mammary cell transformation and genomic instability following irradiation. In this study, we report the identification of two BALB/c strain-specific polymorphisms in the coding region of Prkdc, the gene encoding the DNA-dependent protein kinase catalytic subunit, which is known to be involved in DNA double-stranded break repair and post-IR signal transduction. First, we identified an A --> G transition at base 11530 resulting in a Met --> Val conversion at codon 3844 (M3844V) in the phosphatidylinositol 3-kinase domain upstream of the scid mutation (Y4046X). Second, we identified a C --> T transition at base 6418 resulting in an Arg --> Cys conversion at codon 2140 (R2140C) downstream of the putative leucine zipper domain. This unique PrkdcBALB variant gene is shown to be associated with decreased DNA-dependent protein kinase catalytic subunit activity and with increased susceptibility to IR-induced genomic instability in primary mammary epithelial cells. The data provide the first evidence that naturally arising allelic variation in a mouse DNA damage response gene may associate with IR response and breast cancer risk.

  16. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  17. DNA tagging of blast resistant gene(s) in three Brazilian rice cultivars

    OpenAIRE

    Sandhu S.S.; Colombo Carlos; Bastos Cândido R.; Siqueira Walter J.

    2003-01-01

    Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.). Seven randomly amplified polymorphic DNA (RAPD) markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000), OPA5(1200,) OPG17(700), OPG18(850), OPG19(500), OPG19(600), OP...

  18. Analysis of 5S rDNA Arrays in Arabidopsis thaliana: Physical Mapping and Chromosome-Specific Polymorphisms

    OpenAIRE

    Cloix, C.; Tutois, S; O. Mathieu; Cuvillier, C.; Espagnol, M C; G. Picard; Tourmente, S

    2000-01-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning ∼1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units ex...

  19. DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits

    Directory of Open Access Journals (Sweden)

    Stracke Silke

    2010-01-01

    Full Text Available Abstract Background Association mapping is receiving considerable attention in plant genetics for its potential to fine map quantitative trait loci (QTL, validate candidate genes, and identify alleles of interest. In the present study association mapping in barley (Hordeum vulgare L. is investigated by associating DNA polymorphisms with variation in grain quality traits, plant height, and flowering time to gain further understanding of gene functions involved in the control of these traits. We focused on the four loci BLZ1, BLZ2, BPBF and HvGAMYB that play a role in the regulation of B-hordein expression, the major fraction of the barley storage protein. The association was tested in a collection of 224 spring barley accessions using a two-stage mixed model approach. Results Within the sequenced fragments of four candidate genes we observed different levels of nucleotide diversity. The effect of selection on the candidate genes was tested by Tajima's D which revealed significant values for BLZ1, BLZ2, and BPBF in the subset of two-rowed barleys. Pair-wise LD estimates between the detected SNPs within each candidate gene revealed different intra-genic linkage patterns. On the basis of a more extensive examination of genomic regions surrounding the four candidate genes we found a sharp decrease of LD (r2 Significant marker-trait associations between SNP sites within BLZ1 and flowering time, BPBF and crude protein content and BPBF and starch content were detected. Most haplotypes occurred at frequencies BPBF was associated to crude protein content and starch content, BLZ2 showed association to thousand-grain weight and BLZ1 was found to be associated with flowering time and plant height. Conclusions Differences in nucleotide diversity and LD pattern within the candidate genes BLZ1, BLZ2, BPBF, and HvGAMYB reflect the impact of selection on the nucleotide sequence of the four candidate loci. Despite significant associations, the analysed candidate

  20. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.

    OpenAIRE

    Lau, Q C; Chow, V T; Poh, C. L.

    1995-01-01

    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...