Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

2002-01-01

, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

Science.gov (United States)

Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

2003-07-01

ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

2002-01-01

Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

Science.gov (United States)

Brouat, C; McKey, D; Douzery, E J P

2004-05-01

Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

OpenAIRE

Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

2006-01-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

Science.gov (United States)

Johnsen, G; Kruse, H; Hofshagen, M

2006-12-01

We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

OpenAIRE

Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

2002-01-01

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

Science.gov (United States)

Elsheikha, H M; Schott, H C; Mansfield, L S

2006-06-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

International Nuclear Information System (INIS)

Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

2012-12-01

Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

OpenAIRE

Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

2001-01-01

Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

Science.gov (United States)

Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

2015-12-02

Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

International Nuclear Information System (INIS)

Zhao, B.; Zheng, X.Z.

2015-01-01

Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

Science.gov (United States)

Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

2011-01-01

A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

Science.gov (United States)

Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

2008-04-01

The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Fry, N K; Bangsborg, Jette Marie; Bernander, S

2000-01-01

The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

Science.gov (United States)

Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

1999-09-01

Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

Directory of Open Access Journals (Sweden)

Lieschen De Vos

Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

Fragment Length of Circulating Tumor DNA.

Science.gov (United States)

Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

2016-07-01

Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

Science.gov (United States)

Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

2005-01-01

An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

Amplifier channel for a fission fragment semiconductor detector

International Nuclear Information System (INIS)

Tyurin, G.P.

1981-01-01

To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

Directory of Open Access Journals (Sweden)

Kotoka Masuyama

Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

Application of amplified fragment length polymorphism (AFLPs) for ...

African Journals Online (AJOL)

Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

Science.gov (United States)

Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

2017-01-01

Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanyo, A.; Majiwa, P.W.

2006-01-01

Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

DEFF Research Database (Denmark)

Fry, N K; Bangsborg, Jette Marie; Bergmans, A

2002-01-01

The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....

Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

Science.gov (United States)

Nie, H-T; Li, Q; Kong, L-F

2014-06-01

Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

Directory of Open Access Journals (Sweden)

Emma Suryati

2013-03-01

Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

Science.gov (United States)

García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

2012-05-01

Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

Energy Technology Data Exchange (ETDEWEB)

Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

1999-09-01

Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

Genetic and epigenetic diversity and structure of Phragmites australis from local habitats of the Songnen Prairie using amplified fragment length polymorphism markers.

Science.gov (United States)

Qiu, T; Jiang, L L; Yang, Y F

2016-08-19

The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.

Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

Science.gov (United States)

Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

2017-01-01

Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

Science.gov (United States)

Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

2006-07-01

The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

Directory of Open Access Journals (Sweden)

Muylaert An

2002-07-01

Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

International Nuclear Information System (INIS)

Robinson, M.A.

1989-01-01

Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

Science.gov (United States)

Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

2003-02-01

ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

Directory of Open Access Journals (Sweden)

Leterrier Christine

2010-07-01

Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments

Science.gov (United States)

Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.

2015-01-01

The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.

Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

Science.gov (United States)

Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

2002-04-01

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

Directory of Open Access Journals (Sweden)

Hasnain Seyed E

2006-01-01

Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

Science.gov (United States)

Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

2012-05-01

MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

Directory of Open Access Journals (Sweden)

Karlovsky Petr

2006-02-01

Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

Testing independence of fragment lengths within VNTR loci

Energy Technology Data Exchange (ETDEWEB)

Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))

1993-11-01

Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

Science.gov (United States)

Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

2015-12-14

Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study

Directory of Open Access Journals (Sweden)

Dalia Mohamed Ali

2016-06-01

Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.

Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

Science.gov (United States)

Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

2000-01-01

Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

Science.gov (United States)

Al-Khalifah, Nasser S; Shanavaskhan, A E

2017-01-01

Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

Science.gov (United States)

Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

2006-01-01

Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

High-current relativistic klystron amplifier development for microsecond pulse lengths

International Nuclear Information System (INIS)

Fazio, M.V.; Carlsten, B.E.; Faehl, R.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.

1991-01-01

Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To data the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modeling are presented

High-current relativistic klystron amplifier development for microsecond pulse lengths

International Nuclear Information System (INIS)

Fazio, M.V.; Carlsten, B.E.; Faehl, R.J.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.

1991-01-01

Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To date the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modelling are presented. 5 refs., 5 figs

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism.

Science.gov (United States)

Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B

2006-03-01

Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.

Complementary DNA-amplified fragment length polymorphism ...

African Journals Online (AJOL)

owner

2011-05-09

May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

Science.gov (United States)

Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

2011-07-15

presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2014-10-01

Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

Science.gov (United States)

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

International Nuclear Information System (INIS)

Ali, M. S.; Latif, Z.

2016-01-01

Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

Science.gov (United States)

Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

2016-02-02

Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

Science.gov (United States)

Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

2016-01-01

Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

Directory of Open Access Journals (Sweden)

Xiaomei Xu

Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

Science.gov (United States)

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

Science.gov (United States)

Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

2016-06-01

To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

Energy Technology Data Exchange (ETDEWEB)

Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

2012-09-15

Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

Science.gov (United States)

Qu, Xinshun; Christ, Barbara J

2006-10-01

ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

R Mirnejad

2011-01-01

Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

Amplified fragment length polymorphism (AFLP) and genealogy ...

African Journals Online (AJOL)

STORAGESEVER

2010-06-07

Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

Science.gov (United States)

Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

2001-01-01

Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

Modeling FWM and impairments aware amplifiers placement technique for an optical MAN/WAN: Inline amplifiers case

Science.gov (United States)

Singh, Gurpreet; Singh, Maninder Lal

2015-08-01

A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

Science.gov (United States)

García-Vilchis, David; Aranda-Anzaldo, Armando

2017-12-01

Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Chemoattractive capacity of different lengths of nerve fragments bridging regeneration chambers for the repair of sciatic nerve defects

Institute of Scientific and Technical Information of China (English)

Jiren Zhang; Yubo Wang; Jincheng Zhang

2012-01-01

A preliminary study by our research group showed that 6-mm-long regeneration chamber bridging is equivalent to autologous nerve transplantation for the repair of 12-mm nerve defects.In this study,we compared the efficacy of different lengths (6,8,10 mm) of nerve fragments bridging 6-mm regeneration chambers for the repair of 12-mm-long nerve defects.At 16 weeks after the regeneration chamber was implanted,the number,diameter and myelin sheath thickness of the regenerated nerve fibers,as well as the conduction velocity of the sciatic nerve and gastrocnemius muscle wet weight ratio,were similar to that observed with autologous nerve transplantation.Our results demonstrate that 6-,8-and 10-mm-long nerve fragments bridging 6-mm regeneration chambers effectively repair 12-mm-long nerve defects.Because the chemoattractive capacity is not affected by the length of the nerve fragment,we suggest adopting 6-mm-long nerve fragments for the repair of peripheral nerve defects.

Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

DEFF Research Database (Denmark)

Priemé, Anders; Wolsing, Martin

2004-01-01

Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

Science.gov (United States)

Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

2017-08-01

Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

Science.gov (United States)

Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

2015-01-01

Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

Amplified fragment length polymorphism (AFLP) studies on Indian ...

African Journals Online (AJOL)

Jane

2011-07-11

Jul 11, 2011 ... 2University School of Environment Management, Guru Gobind Singh Indraprastha University, New Delhi-100 075, India. Accepted 15 April .... Technologies following principle developed by Zabeau and Vos. (1993). Genomic ...

TARC: Carlo Rubbia's Energy Amplifier

CERN Multimedia

Laurent Guiraud

1997-01-01

Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

DEFF Research Database (Denmark)

Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B

2000-01-01

are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

African Journals Online (AJOL)

Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

Science.gov (United States)

Barbara, D J; Morton, A; Spence, N J; Miller, A

1995-09-01

Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

OpenAIRE

Li, Gao-De

2015-01-01

It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

Amplified Fragment Length Polymorphism of Puccinia graminis f. sp ...

African Journals Online (AJOL)

Keywords: AFLP, wheat, stem rust, genetic diversity, population differentiation ... the method described by Vos et al (1995), with little modification, i.e., 1 µl genomic ..... Agriculture, Veterinary Science, Nutrition and Natural Resources, 1, 1- 13.

Amplified fragment length polymorphism of Puccinia graminis f. sp ...

African Journals Online (AJOL)

The developed AFLP fingerprints for the Ethiopian Pgt isolates reported herein could support the breeding program to develop strategies for the deployment of resistance genes in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, genetic diversity, population ...

A high-power two stage traveling-wave tube amplifier

International Nuclear Information System (INIS)

Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.

1991-01-01

Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

Diversity analysis of bacterial community compositions in sediments of urban lakes by terminal restriction fragment length polymorphism (T-RFLP).

Science.gov (United States)

Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L

2012-11-01

Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

Science.gov (United States)

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

Construction of a high-density genetic map using specific length amplified fragment markers and identification of a quantitative trait locus for anthracnose resistance in walnut (Juglans regia L.).

Science.gov (United States)

Zhu, Yufeng; Yin, Yanfei; Yang, Keqiang; Li, Jihong; Sang, Yalin; Huang, Long; Fan, Shu

2015-08-18

Walnut (Juglans regia, 2n = 32, approximately 606 Mb per 1C genome) is an economically important tree crop. Resistance to anthracnose, caused by Colletotrichum gloeosporioides, is a major objective of walnut genetic improvement in China. The recently developed specific length amplified fragment sequencing (SLAF-seq) is an efficient strategy that can obtain large numbers of markers with sufficient sequence information to construct high-density genetic maps and permits detection of quantitative trait loci (QTLs) for molecular breeding. SLAF-seq generated 161.64 M paired-end reads. 153,820 SLAF markers were obtained, of which 49,174 were polymorphic. 13,635 polymorphic markers were sorted into five segregation types and 2,577 markers of them were used to construct genetic linkage maps: 2,395 of these fell into 16 linkage groups (LGs) for the female map, 448 markers for the male map, and 2,577 markers for the integrated map. Taking into account the size of all LGs, the marker coverage was 2,664.36 cM for the female map, 1,305.58 cM for the male map, and 2,457.82 cM for the integrated map. The average intervals between two adjacent mapped markers were 1.11 cM, 2.91 cM and 0.95 cM for three maps, respectively. 'SNP_only' markers accounted for 89.25% of the markers on the integrated map. Mapping markers contained 5,043 single nucleotide polymorphisms (SNPs) loci, which corresponded to two SNP loci per SLAF marker. According to the integrated map, we used interval mapping (Logarithm of odds, LOD > 3.0) to detect our quantitative trait. One QTL was detected for anthracnose resistance. The interval of this QTL ranged from 165.51 cM to 176.33 cM on LG14, and ten markers in this interval that were above the threshold value were considered to be linked markers to the anthracnose resistance trait. The phenotypic variance explained by each marker ranged from 16.2 to 19.9%, and their LOD scores varied from 3.22 to 4.04. High-density genetic maps for walnut containing 16

Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

Science.gov (United States)

Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

2012-01-01

Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

Science.gov (United States)

Prakash, Celine; Haeseler, Arndt Von

2017-03-01

RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

Science.gov (United States)

Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

2015-05-01

DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1989-01-01

The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

Science.gov (United States)

Cao, Hu; Lu, Yonggang

2017-01-01

With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

Restriction Fragment Length Polymorphism Analysis Reveals High Levels of Genetic Divergence Among the Light Organ Symbionts of Flashlight Fish.

Science.gov (United States)

Wolfe, C J; Haygood, M G

1991-08-01

Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.

Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

Directory of Open Access Journals (Sweden)

Kush Shrivastava

2015-10-01

Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

Directory of Open Access Journals (Sweden)

Arihiro Shiozaki

Full Text Available Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP, we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group (n = 20, those who had preterm labor but delivered term babies (PTL group (n = 11, and those who had preterm birth (PTB group (n = 10. Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

Science.gov (United States)

Shiozaki, Arihiro; Yoneda, Satoshi; Yoneda, Noriko; Yonezawa, Rika; Matsubayashi, Takamichi; Seo, Genichiro; Saito, Shigeru

2014-01-01

Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP), we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group) (n = 20), those who had preterm labor but delivered term babies (PTL group) (n = 11), and those who had preterm birth (PTB group) (n = 10). Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

NARCIS (Netherlands)

Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

1996-01-01

We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

International Nuclear Information System (INIS)

Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

1987-01-01

The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Science.gov (United States)

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

SPS RF System Amplifier plant

CERN Multimedia

1977-01-01

The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

Amplified spontaneous emission in solar-pumped iodine laser

Science.gov (United States)

Cho, Yong S.; Hwang, In H.; Han, Kwang S.; Lee, Ja H.

1992-01-01

The amplified spontaneous emission (ASE) from a long pulse, solar-simulating radiation pumped iodine laser amplifier is studied. The ASE threshold pump intensity is almost proportional to the inverse of the laser gain length when the gas pressure is constant in the laser tube.

Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

Directory of Open Access Journals (Sweden)

Daniel W. H. Robarts

2014-07-01

Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

1992-01-01

We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

Science.gov (United States)

Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

2012-01-01

The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

DEFF Research Database (Denmark)

Colding, H; Hartzen, S H; Mohammadi, M

2003-01-01

Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1991-01-01

The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

NARCIS (Netherlands)

ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

Typing of Human Mycobacterium avium Isolates in Italy by IS1245-Based Restriction Fragment Length Polymorphism Analysis

Science.gov (United States)

Lari, Nicoletta; Cavallini, Michela; Rindi, Laura; Iona, Elisabetta; Fattorini, Lanfranco; Garzelli, Carlo

1998-01-01

All but 2 of 63 Mycobacterium avium isolates from distinct geographic areas of Italy exhibited markedly polymorphic, multibanded IS1245 restriction fragment length polymorphism (RFLP) patterns; 2 isolates showed the low-number banding pattern typical of bird isolates. By computer analysis, 41 distinct IS1245 patterns and 10 clusters of essentially identical strains were detected; 40% of the 63 isolates showed genetic relatedness, suggesting the existence of a predominant AIDS-associated IS1245 RFLP pattern. PMID:9817900

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

Science.gov (United States)

Robarts, Daniel W. H.; Wolfe, Andrea D.

2014-01-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

Science.gov (United States)

Robarts, Daniel W H; Wolfe, Andrea D

2014-07-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

Science.gov (United States)

Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

1990-01-01

The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

Science.gov (United States)

Sarmiento, U M; Storb, R F

1988-01-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

Mass distribution of fission fragments using SSNTDs based image analysis system

International Nuclear Information System (INIS)

Kolekar, R.V.; Sharma, D.N.

2006-01-01

Lexan polycarbonate track detector was used to obtain mass distribution of fission fragments from 252 Cf planchette source, Normally, if the fission fragments are incident perpendicular to the lexan surface, the diameter of heavy fragment is greater than that of lighter fragment. In practical problems fission fragments are incident on the detector at all angles. So, in the present experiment, lexan detector was exposed to 252 Cf planchette source in 2π geometry. Fission fragments were incident on the detector with various angles. So the projected fission track length for fission fragment of same energy is different because of different angle of incidence. Image analysis software was used to measure the projected track length. But the problem is that for fission fragment having greater angle of incidence the entire track length is not focused on the surface. So reduced track length is measured. This problem is solved by taking two images, one at the surface and one at the tip of track and then overlapping both the images using image analysis software. The projected track length and the depth of the track were used to get the angle of incidence. Fission track lengths were measured for same angle of incidence. In all 500 track lengths were measured and plot for mass distribution for fission fragment was obtained.(author)

DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

African Journals Online (AJOL)

We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome

DEFF Research Database (Denmark)

Kveiborg, Marie; Gravholt, Claus Højbjerg; Kassem, M

2001-01-01

Clinical and epidemiological studies suggest that premature ageing and increased morbidity and mortality is present in Ullrich-Turner syndrome. We studied telomere restriction fragment length (TRFL) in 30 women with Ullrich-Turner syndrome and 30 age-matched control women. All Turner women had...... the 45,X karyotype verified by karyotyping. We found no difference in the mean TRFL in the young age group (TS: 7011+/-521 vs C: 7285+/-917 bp, P = 0.3), or in the older age group (TS: 7357+/-573 vs C: 7221+/-621 bp, P = 0.6). In conclusion, our data suggest that Ullrich-Turner syndrome is not associated...... with excessive telomere loss, at least when studied in peripheral blood leucocytes, and thus quite different from other premature ageing syndromes....

Transmission characteristics of acoustic amplifier in thermoacoustic engine

International Nuclear Information System (INIS)

Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

2008-01-01

Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

Dielectric waveguide amplifiers and lasers

NARCIS (Netherlands)

Pollnau, Markus

The performance of semiconductor amplifiers and lasers has made them the preferred choice for optical gain on a micro-chip. In the past few years, we have demonstrated that also rare-earth-ion-doped dielectric waveguides show remarkable performance, ranging from a small-signal gain per unit length

Studies of nontarget-mediated distribution of human full-length IgG1 antibody and its FAb fragment in cardiovascular and metabolic-related tissues.

Science.gov (United States)

Davidsson, Pia; Söderling, Ann-Sofi; Svensson, Lena; Ahnmark, Andrea; Flodin, Christine; Wanag, Ewa; Screpanti-Sundqvist, Valentina; Gennemark, Peter

2015-05-01

Tissue distribution and pharmacokinetics (PK) of full-length nontargeted antibody and its antigen-binding fragment (FAb) were evaluated for a range of tissues primarily of interest for cardiovascular and metabolic diseases. Mice were intravenously injected with a dose of 10 mg/kg of either human IgG1or its FAb fragment; perfused tissues were collected at a range of time points over 3 weeks for the human IgG1 antibody and 1 week for the human FAb antibody. Tissues were homogenized and antibody concentrations were measured by specific immunoassays on the Gyros system. Exposure in terms of maximum concentration (Cmax ) and area under the curve was assessed for all nine tissues. Tissue exposure of full-length antibody relative to plasma exposure was found to be between 1% and 10%, except for brain (0.2%). Relative concentrations of FAb antibody were the same, except for kidney tissue, where the antibody concentration was found to be ten times higher than in plasma. However, the absolute tissue uptake of full-length IgG was significantly higher than the absolute tissue uptake of the FAb antibody. This study provides a reference PK state for full-length whole and FAb antibodies in tissues related to cardiovascular and metabolic diseases that do not include antigen or antibody binding. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

Science.gov (United States)

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Analysis and simulation of nonlinearity and effects of spontaneous emission in Schottky-junction-based plasmonic amplifiers.

Science.gov (United States)

Livani, Abdolber Mallah; Kaatuzian, Hassan

2015-07-01

An amplifier that operates on surface plasmon polaritons has been analyzed and simulated. Nonlinearity behavior and the spontaneous emission effects of the plasmonic amplifier are investigated in this paper. A rate equations approach has been used in which parameters are derived from simulation results of the plasmonic amplifier (Silvaco/ATLAS). Details on the method of this derivation are included, which were not previously reported. Rate equations are solved numerically by MATLAB codes. These codes verify the Silvaco results. The plasmonic amplifier operates on surface plasmons with a free-space wavelength of 1550 nm. Results show that, even without the effect of spontaneous emission, gain of the plasmonic amplifier saturates in high input levels. Saturation power, which can be used for comparing nonlinearity of different amplifiers, is 2.1 dBm for this amplifier. Amplified spontaneous emission reduces the gain of the amplifiers, which is long. There is an optimum value for the length of the amplifier. For the amplifier of this work, the optimum length for the small signal condition is 265 μm.

The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

International Nuclear Information System (INIS)

Conn, V.

1987-01-01

The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

NARCIS (Netherlands)

Coolen, MJL; Post, E; Davis, CC; Forney, LJ

2005-01-01

To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

DEFF Research Database (Denmark)

Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

2000-01-01

A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

High sensitivity amplifier/discriminator for PWC's

International Nuclear Information System (INIS)

Hansen, S.

1983-01-01

The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design

CARM and harmonic gyro-amplifier experiments at 17 GHz

International Nuclear Information System (INIS)

Menninger, W.L.; Danly, B.G.; Alberti, S.; Chen, C.; Rullier, J.L.; Temkin, R.J.

1993-01-01

Cyclotron resonance maser amplifiers are possible sources for applications such as electron cyclotron resonance heating of fusion plasmas and driving high-gradient rf linear accelerators. For accelerator drivers, amplifiers or phase locked-oscillators are required. A 17 GHz cyclotron autoresonance maser (CARM) amplifier experiment and a 17 GHz third harmonic gyro-amplifier experiment are presently underway at the MIT Plasma Fusion Center. Using the SRL/MIT SNOMAD II introduction accelerator to provide a 380 kV, 180 A, 30 ns flat top electron beam, the gyro-amplifier experiment has produced 5 MW of rf power with over 50 dB of gain at 17 GHz. The gyro-amplifier operates in the TE 31 mode using a third harmonic interaction. Because of its high power output, the gyro-amplifier will be used as the rf source for a photocathode rf electron gun experiment also taking place at MIT. Preliminary gyro-amplifier results are presented, including measurement of rf power, gain versus interaction length, and the far-field pattern. A CARM experiment designed to operate in the TE 11 mode is also discussed

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

Science.gov (United States)

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

Energy Technology Data Exchange (ETDEWEB)

Williams, S.D.

1989-01-01

Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

International Nuclear Information System (INIS)

Williams, S.D.

1989-01-01

Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

Science.gov (United States)

Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

2006-05-01

The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

Science.gov (United States)

Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

2007-01-01

PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

Science.gov (United States)

Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

2016-10-01

Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

Photonic-band-gap gyrotron amplifier with picosecond pulses

Science.gov (United States)

Nanni, Emilio A.; Jawla, Sudheer; Lewis, Samantha M.; Shapiro, Michael A.; Temkin, Richard J.

2017-12-01

We report the amplification of 250 GHz pulses as short as 260 ps without observation of pulse broadening using a photonic-band-gap circuit gyrotron traveling-wave-amplifier. The gyrotron amplifier operates with a device gain of 38 dB and an instantaneous bandwidth of 8 GHz. The operational bandwidth of the amplifier can be tuned over 16 GHz by adjusting the operating voltage of the electron beam and the magnetic field. The amplifier uses a 30 cm long photonic-band-gap interaction circuit to confine the desired TE03-like operating mode while suppressing lower order modes which can result in undesired oscillations. The circuit gain is >55 dB for a beam voltage of 23 kV and a current of 700 mA. These results demonstrate the wide bandwidths and a high gain achievable with gyrotron amplifiers. The amplification of picosecond pulses of variable lengths, 260-800 ps, shows good agreement with the theory using the coupled dispersion relation and the gain-spectrum of the amplifier as measured with quasi-CW input pulses.

A broadband high-efficiency Doherty power amplifier using symmetrical devices

Science.gov (United States)

Cheng, Zhiqun; Zhang, Ming; Li, Jiangzhou; Liu, Guohua

2018-04-01

This paper proposes a method for broadband and high-efficiency amplification of Doherty power amplifier (DPA) using symmetric devices. In order to achieve the perfect load modulation, the carrier amplifier output circuit total power length is designed to odd multiple of 90°, and the peak amplifier output total power length is designed to even multiple of 180°. The proposed method is demonstrated by designing a broadband high-efficiency DPA using identical 10-W packaged GaN HEMT devices. Measurement results show that over 51% drain efficiency is achieved at 6-dB back-off power, over the frequency band of 1.9–2.4 GHz. Project supported by the National Natural Science Foundation of China (No. 60123456), the Zhejiang Provincial Natural Science Foundation of China (No. LZ16F010001), and the Zhejiang Provincial Public Technology Research Project (No. 2016C31070).

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

Science.gov (United States)

Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

1999-12-01

A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

Molecular research on the genetic diversity of Tunisian date palm ...

African Journals Online (AJOL)

Molecular research on the genetic diversity of Tunisian date palm ( Phoenix dactylifera L.) using the random amplified microsatellite polymorphism (RAMPO) and amplified fragment length polymorphism (AFLP) methods.

A high degree of genetic diversity is revealed in Isatis spp. (dyer's woad) by amplified fragment length polymorphism (AFLP).

Science.gov (United States)

Gilbert (nee Stoker), G.; Garton, S.; Karam, A.; Arnold, M.; Karp, A.; Edwards, J.; Cooke, T.; Barker, A.

2002-05-01

Genetic diversity in 38 genotypes, representing 28 individual genotypes from five landraces of Isatis tinctoria (three German: Tubingen, Potsdam and Erfurt, one Swiss and one English), five genotypes of Isatis indigotica (Chinese woad) and five genotypes of Isatis glauca, were investigated using AFLP analysis. Five primer combinations detected a total of 502 fragments of which 436 (86.9%) were polymorphic. The level of polymorphism recorded within each species was 29.8, 86.9 and 35.8% for I. indigotica, I. tinctoria and I. glauca, respectively. Clearly, genetic diversity within I. tinctoria was greater than that observed in I. indigotica or I. glauca. Cluster analyses of the AFLP data using UPGMA and PCO revealed the complete separation of the genotypes of each species into distinct groups. I. indigotica separated as an entirely independent group, whereas I. glauca formed a separate cluster within the I. tinctoria group. Indeed, I. tinctoria and I. glauca are more closely related to each other than either is to I. indigotica. In addition, the genotypes of each landrace, apart from one from the English group, were clearly discriminated. However, the anomalous genotype did associate with the rest of its group when it was linked with the Erfurt group. These results provide new and useful information about the make-up of the Isatis genome, which has not previously been evaluated. They will be useful in the selection of plant material for variety development and conservation of the gene-pool.

Dispersion-Engineered Traveling Wave Kinetic Inductance Parametric Amplifier

Science.gov (United States)

Zmuidzinas, Jonas (Inventor); Day, Peter K. (Inventor)

2014-01-01

A traveling wave kinetic inductance parametric amplifier comprises a superconducting transmission line and a dispersion control element. The transmission line can include periodic variations of its dimension along its length. The superconducting material can include a high normal state resistivity material. In some instances the high normal state resistivity material includes nitrogen and a metal selected from the group consisting of titanium, niobium and vanadium. The traveling wave kinetic inductance parametric amplifier is expected to exhibit a noise temperature below 100 mK/GHz.

A preliminary amplified fragment length polymorphism (AFLP) primers selection for spathoglottis species

NARCIS (Netherlands)

Ginibun, F.C.; Bhassu, S.; Khalid, N.; Arens, P.; Vosman, B.; Othman, R.Y.

2015-01-01

Spathoglottis is a native terrestrial orchid that attracting horticultural interest as a landscaping plant. Distinguishing orchid at species level based on morphological characteristics is unconvincing as some characteristic may sensitive to environmental. Therefore, molecular characterization

Fragmentation of SIV-gag vaccine induces broader T cell responses.

Directory of Open Access Journals (Sweden)

Adel Benlahrech

Full Text Available High mutation rates of human immunodeficiency virus (HIV allows escape from T cell recognition preventing development of effective T cell vaccines. Vaccines that induce diverse T cell immune responses would help overcome this problem. Using SIV gag as a model vaccine, we investigated two approaches to increase the breadth of the CD8 T cell response. Namely, fusion of vaccine genes to ubiquitin to target the proteasome and increase levels of MHC class I peptide complexes and gene fragmentation to overcome competition between epitopes for presentation and recognition.three vaccines were compared: full-length unmodified SIV-mac239 gag, full-length gag fused at the N-terminus to ubiquitin and 7 gag fragments of equal size spanning the whole of gag with ubiquitin-fused to the N-terminus of each fragment. Genes were cloned into a replication defective adenovirus vector and immunogenicity assessed in an in vitro human priming system. The breadth of the CD8 T cell response, defined by the number of distinct epitopes, was assessed by IFN-γ-ELISPOT and memory phenotype and cytokine production evaluated by flow cytometry. We observed an increase of two- to six-fold in the number of epitopes recognised in the ubiquitin-fused fragments compared to the ubiquitin-fused full-length gag. In contrast, although proteasomal targeting was achieved, there was a marked reduction in the number of epitopes recognised in the ubiquitin-fused full-length gag compared to the full-length unmodified gene, but there were no differences in the number of epitope responses induced by non-ubiquitinated full-length gag and the ubiquitin-fused mini genes. Fragmentation and ubiquitination did not affect T cell memory differentiation and polyfunctionality, though most responses were directed against the Ad5 vector.Fragmentation but not fusion with ubiquitin increases the breadth of the CD8 T vaccine response against SIV-mac239 gag. Thus gene fragmentation of HIV vaccines may maximise

High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

Science.gov (United States)

Andeer, Peter; Strand, Stuart E; Stahl, David A

2012-01-01

Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

Science.gov (United States)

Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

1999-01-01

Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

Science.gov (United States)

Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

1992-01-01

A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

Saturating representation of loop conformational fragments in structure databanks

Directory of Open Access Journals (Sweden)

Fiser András

2006-07-01

Full Text Available Abstract Background Short fragments of proteins are fundamental starting points in various structure prediction applications, such as in fragment based loop modeling methods but also in various full structure build-up procedures. The applicability and performance of these approaches depend on the availability of short fragments in structure databanks. Results We studied the representation of protein loop fragments up to 14 residues in length. All possible query fragments found in sequence databases (Sequence Space were clustered and cross referenced with available structural fragments in Protein Data Bank (Structure Space. We found that the expansion of PDB in the last few years resulted in a dense coverage of loop conformational fragments. For each loops of length 8 in the current Sequence Space there is at least one loop in Structure Space with 50% or higher sequence identity. By correlating sequence and structure clusters of loops we found that a 50% sequence identity generally guarantees structural similarity. These percentages of coverage at 50% sequence cutoff drop to 96, 94, 68, 53, 33 and 13% for loops of length 9, 10, 11, 12, 13, and 14, respectively. There is not a single loop in the current Sequence Space at any length up to 14 residues that is not matched with a conformational segment that shares at least 20% sequence identity. This minimum observed identity is 40% for loops of 12 residues or shorter and is as high as 50% for 10 residue or shorter loops. We also assessed the impact of rapidly growing sequence databanks on the estimated number of new loop conformations and found that while the number of sequentially unique sequence segments increased about six folds during the last five years there are almost no unique conformational segments among these up to 12 residues long fragments. Conclusion The results suggest that fragment based prediction approaches are not limited any more by the completeness of fragments in databanks but

Fiber Amplifiers

DEFF Research Database (Denmark)

Rottwitt, Karsten

2017-01-01

The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

Fragmentation under the Scaling Symmetry and Turbulent Cascade with Intermittency

Science.gov (United States)

Gorokhovski, M.

2003-01-01

Fragmentation plays an important role in a variety of physical, chemical, and geological processes. Examples include atomization in sprays, crushing of rocks, explosion and impact of solids, polymer degradation, etc. Although each individual action of fragmentation is a complex process, the number of these elementary actions is large. It is natural to abstract a simple 'effective' scenario of fragmentation and to represent its essential features. One of the models is the fragmentation under the scaling symmetry: each breakup action reduces the typical length of fragments, r (right arrow) alpha r, by an independent random multiplier alpha (0 Saveliev, the fragmentation under the scaling symmetry has been reviewed as a continuous evolution process with new features established. The objective of this paper is twofold. First, the paper synthesizes and completes theoretical part of Gorokhovski & Saveliev. Second, the paper shows a new application of the fragmentation theory under the scale invariance. This application concerns the turbulent cascade with intermittency. We formulate here a model describing the evolution of the velocity increment distribution along the progressively decreasing length scale. The model shows that when the turbulent length scale gets smaller, the velocity increment distribution has central growing peak and develops stretched tails. The intermittency in turbulence is manifested in the same way: large fluctuations of velocity provoke highest strain in narrow (dissipative) regions of flow.

Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

NARCIS (Netherlands)

Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

2013-01-01

BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

Assignment tests for variety identification compared to genetic similarity-based methods using experimental datasets from different marker systems in sugar beet

NARCIS (Netherlands)

Riek, de J.; Everaert, I.; Esselink, D.; Calsyn, E.; Smulders, M.J.M.; Vosman, B.

2007-01-01

High genetic variation within sugar beet (Beta vulgaris L.) varieties hampers reliable classification procedures independent of the type of marker technique applied. Datasets on amplified fragment length polymorphisms, sequence tagged microsatellite sites, and cleaved amplified polymorphic sites

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

Science.gov (United States)

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

NARCIS (Netherlands)

Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

2013-01-01

In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

Radiation hardening techniques for rare-earth based optical fibers and amplifiers

International Nuclear Information System (INIS)

Girard, Sylvain; Marcandella, Claude; Vivona, Marilena; Prudenzano, Luciano Mescia F.; Laurent, Arnaud; Robin, Thierry; Cadier, Benoit; Pinsard, Emmanuel; Ouerdane, Youcef; Boukenter, Aziz; Cannas, Marco; Boscaino, Roberto

2012-01-01

Er/Yb doped fibers and amplifiers have been shown to be very radiation sensitive, limiting their integration in space. We present an approach including successive hardening techniques to enhance their radiation tolerance. The efficiency of our approach is demonstrated by comparing the radiation responses of optical amplifiers made with same lengths of different rare-earth doped fibers and exposed to gamma-rays. Previous studies indicated that such amplifiers suffered significant degradation for doses exceeding 10 krad. Applying our techniques significantly enhances the amplifier radiation resistance, resulting in a very limited degradation up to 50 krad. Our optimization techniques concern the fiber composition, some possible pre-treatments and the interest of simulation tools used to harden by design the amplifiers. We showed that adding cerium inside the fiber phospho-silicate-based core strongly decreases the fiber radiation sensitivity compared to the standard fiber. For both fibers, a pre-treatment with hydrogen permits to enhance again the fiber resistance. Furthermore, simulations tools can also be used to improve the tolerance of the fiber amplifier by helping identifying the best amplifier configuration for operation in the radiative environment. (authors)

Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

Science.gov (United States)

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-10-21

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

Compact fibre-laser-pumped Ho:YLF oscillator–amplifier system

CSIR Research Space (South Africa)

Koen, W

2010-04-01

Full Text Available of the amplifier crystal L and the pump spot radius wp ( Ω = 2pi · (1 − cosβ), with β = tan−1(wpL )). Calculating the local population in (3) and iterating (6) and (11) along the length of the amplifier crystal, we obtain the extracted photon densities...-pumped tunable Tm: silica- fibre laser. Appl. Phys. B 79, 559 (2004) 6. E. Lippert, S. Nicolas, G. Arisholm, K. Stenersen, G. Rustad, Mid- infrared laser source with high power and beam quality. Appl. Opt. 45, 3839 (2006) 7. S.A. Payne, L.L. Chase, L...

Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

NARCIS (Netherlands)

de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

2013-01-01

In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

NARCIS (Netherlands)

Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

2013-01-01

In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

Criterion of transverse coherence of self-amplified spontaneous emission in high gain free electron laser amplifiers

International Nuclear Information System (INIS)

Xie, M.; Kim, K.J.

1995-01-01

In a high gain free electron laser amplifier based on Self-Amplified Spontaneous Emission (SASE) the spontaneous radiation generated by an electron beam near the undulator entrance is amplified many orders of magnitude along the undulator. The transverse coherence properties of the amplified radiation depends on both the amplification process and the coherence of the seed radiation (the undulator radiation generated in the first gain length or so). The evolution of the transverse coherence in the amplification process is studied based on the solution of the coupled Maxwell-Vlasov equations including higher order transverse modes. The coherence of the seed radiation is determined by the number of coherent modes in the phase space area of the undulator radiation. We discuss the criterion of transverse coherence and identify governing parameters over a broad range of parameters. In particular we re-examine the well known emittance criterion for the undulator radiation, which states that full transverse coherence is guaranteed if the rms emittance is smaller than the wavelength divided by 4π. It is found that this criterion is modified for SASE because of the different optimization conditions required for the electron beam. Our analysis is a generalization of the previous study by Yu and Krinsky for the case of vanishing emittance with parallel electron beam. Understanding the transverse coherence of SASE is important for the X-ray free electron laser projects now under consideration at SLAC and DESY

Essentials of Conservation Biotechnology: A mini review

Science.gov (United States)

Merlyn Keziah, S.; Subathra Devi, C.

2017-11-01

Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Caldeira Roberta Lima

1998-01-01

Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

Hydrodynamic evolution of plasma waveguides for soft-x-ray amplifiers

Science.gov (United States)

Oliva, Eduardo; Depresseux, Adrien; Cotelo, Manuel; Lifschitz, Agustín; Tissandier, Fabien; Gautier, Julien; Maynard, Gilles; Velarde, Pedro; Sebban, Stéphane

2018-02-01

High-density, collisionally pumped plasma-based soft-x-ray lasers have recently delivered hundreds of femtosecond pulses, breaking the longstanding barrier of one picosecond. To pump these amplifiers an intense infrared pulse must propagate focused throughout all the length of the amplifier, which spans several Rayleigh lengths. However, strong nonlinear effects hinder the propagation of the laser beam. The use of a plasma waveguide allows us to overcome these drawbacks provided the hydrodynamic processes that dominate the creation and posterior evolution of the waveguide are controlled and optimized. In this paper we present experimental measurements of the radial density profile and transmittance of such waveguide, and we compare them with numerical calculations using hydrodynamic and particle-in-cell codes. Controlling the properties (electron density value and radial gradient) of the waveguide with the help of numerical codes promises the delivery of ultrashort (tens of femtoseconds), coherent soft-x-ray pulses.

Genetic Characterization Of Syrian Erwinia Amylovora Strains By Amplified Fragment Length Polymorphism Technique

International Nuclear Information System (INIS)

Ammouneh, H.; Arabi, M.; Shoaib, A.

2011-01-01

Thirty Erwinia amylovora strains, collected from the main rosaceous crop-growing regions in Syria, were chosen as representatives of all major pathogenicity groups and were genetically studied by AFLP. Eight primer combinations were utilized and approximately 300 scorable bands in total were generated. Based on similarity coefficient, E. amylovora strains were placed into a main cluster containing two sub clusters, indicating very low genetic variations among the studied pathogen. The existence of two plasmids, pEA29 (present in nearly all E. amylovora isolates) and pEL60 (present mainly in Lebanese strains), was confirmed using multiplex PCR in all tested Syrian E. amylovora strains, indicating that Lebanese and Syrian isolates may share a common origin.(author)

Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

NARCIS (Netherlands)

Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

Directory of Open Access Journals (Sweden)

Caldeira Roberta L

2000-01-01

Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

Overview of bunch length measurements

International Nuclear Information System (INIS)

Lumpkin, A. H.

1999-01-01

An overview of particle and photon beam bunch length measurements is presented in the context of free-electron laser (FEL) challenges. Particle-beam peak current is a critical factor in obtaining adequate FEL gain for both oscillators and self-amplified spontaneous emission (SASE) devices. Since measurement of charge is a standard measurement, the bunch length becomes the key issue for ultrashort bunches. Both time-domain and frequency-domain techniques are presented in the context of using electromagnetic radiation over eight orders of magnitude in wavelength. In addition, the measurement of microbunching in a micropulse is addressed

Chemical Production using Fission Fragments

International Nuclear Information System (INIS)

Dawson, J. K.; Moseley, F.

1960-01-01

Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

Effect of fragmentation on the Costa Rican dry forest avifauna

OpenAIRE

Barrantes, Gilbert; Ocampo, Diego; Ram?rez-Fern?ndez, Jos? D.; Fuchs, Eric J.

2016-01-01

Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird comm...

Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

Science.gov (United States)

Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

1991-01-01

Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

International Nuclear Information System (INIS)

Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

1990-01-01

The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

Operation amplifier

NARCIS (Netherlands)

Tetsuya, Saito; Nauta, Bram

2008-01-01

To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

Science.gov (United States)

Tan, Ming-pu

2010-01-01

Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

Flying between sky islands: the effect of naturally fragmented habitat on butterfly population structure.

Science.gov (United States)

Sekar, Sandhya; Karanth, Praveen

2013-01-01

High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.

Screening and characterization a RAPD marker of tobacco brown ...

African Journals Online (AJOL)

STORAGESEVER

2008-08-04

Aug 4, 2008 ... Random amplified DNA polymorphism of Nicotiana tabacum L. cultivars. Biologia Plantarum. 49: 605-607. Zhang HY, Liu XZ, Li TS, Yang YM (2006). Genetic diversity among flue- cured tobacco (Nicotiana tabacum L.) revealed by amplified fragment length polymorphism. Botanical Studies. 47: 223-229.

Fragger: a protein fragment picker for structural queries.

Science.gov (United States)

Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

2017-01-01

Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Use of single-enzyme amplified fragment length polymorphism for typing Clostridium perfringens isolated from diarrheic piglets Uso do polimorfismo do comprimento de fragmentos amplificados para tipagem de Clostridium perfringens isolados de suínos com diarréia

Directory of Open Access Journals (Sweden)

Luciane Tieko Shinya

2006-09-01

Full Text Available Clostridium perfringens is an important pathogen in human and veterinary medicine. In swine, the agent is responsible for necrotic enteritis and enterotoxemia characterized by diarrhea, weight loss, delayed development and, in some cases, death. In the present study amplified fragment length polymorphism analyses (AFLP was used to characterize 54 C. perfringens strains isolated from swine presenting diarrhea. Analysis of the results showed 29 distinct profiles with discriminatory index equal to 0.97. Partial correlation between the origin of the isolates and groups was drawn, and correlation was possible in only 18.5% of the samples. Characterization of the strains in biotypes (A, B, C, D and E, production of beta-2 toxin and enterotoxin were performed by means of the polymerase chain reaction (PCR. Biotypes A, C and D were observed among the strains analyzed. All samples were positive for presence of the gene encoding beta-2 toxin and negative for the gene encoding enterotoxin. AFLP have shown to be a simple, fast, low cost method with high discriminative power and good reproducibility, presenting a great potential in epidemiological studies involving C. perfringens strains of animal origin.Clostridium perfringens é um importante agente infeccioso em medicina veterinária e humana. Em suínos, o agente é responsável pela enterite necrótica e enterotoxemia, caracterizadas por diarréia, perda de peso, atraso no desenvolvimento e morte. No presente estudo foi utilizado o polimorfismo do comprimento de fragmentos amplificados (AFLP, para caracterizar 54 isolados de C. perfringens obtidos de suínos com diarréia. A análise dos resultados do AFLP demonstrou 29 perfis distintos com índice discriminatório igual a 0,97. A correlação entre a origem dos isolados e os agrupamentos obtidos foi parcial, sendo apenas possível a correlação total de 18,5% das amostras estudadas. A caracterização das cepas em biotipos (A, B, C, D e E, produ

Large area electron beam pumped krypton fluoride laser amplifier

International Nuclear Information System (INIS)

Sethian, J.D.; Obenschain, S.P.; Gerber, K.A.; Pawley, C.J.; Serlin, V.; Sullivan, C.A.; Webster, W.; Deniz, A.V.; Lehecka, T.; McGeoch, M.W.; Altes, R.A.; Corcoran, P.A.; Smith, I.D.; Barr, O.C.

1997-01-01

Nike is a recently completed multi-kilojoule krypton fluoride (KrF) laser that has been built to study the physics of direct drive inertial confinement fusion. This paper describes in detail both the pulsed power and optical performance of the largest amplifier in the Nike laser, the 60 cm amplifier. This is a double pass, double sided, electron beam-pumped system that amplifies the laser beam from an input of 50 J to an output of up to 5 kJ. It has an optical aperture of 60 cm x 60 cm and a gain length of 200 cm. The two electron beams are 60 cm high x 200 cm wide, have a voltage of 640 kV, a current of 540 kA, and a flat top power pulse duration of 250 ns. A 2 kG magnetic field is used to guide the beams and prevent self-pinching. Each electron beam is produced by its own Marx/pulse forming line system. The amplifier has been fully integrated into the Nike system and is used on a daily basis for laser-target experiments. copyright 1997 American Institute of Physics

Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis.

Science.gov (United States)

Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele

2009-11-01

A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

Science.gov (United States)

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Compact fibre-laser-pumped Ho:YLF oscillator-amplifier system

CSIR Research Space (South Africa)

Bollig, C

2009-06-01

Full Text Available -amplifier system. 0 5 10 15 20 25 0 1 2 3 4 5 Repetition Rate [kHz] Pu lse En er gy [m J] 0 50 100 150 200 250 Pu lse Le n gt h [ns ] Simulation Results Amp Pulse Energy Osc Pulse Energy Amp Pulse Length Fig. 2 Output energy...

Optimization of Multiple Active Ion Doped Fiber Amplifiers for Three Communication Windows

Directory of Open Access Journals (Sweden)

Chun Jiang

2009-01-01

Full Text Available We present for the first time a theoretical model of Er3+-Tm3+-Pr3+ codoped fiber pumped with both 800 nm and 980 nm lasers to explore possibility of this co-doped system as all-wave fiber amplifier. The rate and power propagation equations of the model are solved numerically and the dependence of the gains at 1310, 1470, 1530, 1600, 1650 nm windows on fiber length is calculated. The results show that with pump power of 200 mW/200 mW, when the concentrations of Pr3+, Tm3+, Er3+ are around 1.7×1024, 3.9×1024, 1.2×1024 (ions/m3, respectively, the signals at 1310, 1470, 1530, 1600, 1650 nm may be nearly equally amplified with gain of 13–16.0 dB in the active fiber with length of 23.5 m; the co-doping concentrations and fiber length and pump powers may be further optimized to reduce the ripple.

A megajoule class krypton fluoride amplifier for single shot, high gain ICF application

International Nuclear Information System (INIS)

Rose, E.; Hanson, D.; Krohn, B.; McLeod, J.; Kang, M.

1988-01-01

A design study is underway to define the optimal architecture for a KrF laser system which will deliver 10 MJ of 248-nm light to an ICF target. We present one approach which incorporates final power amplifiers in the megajoule class, achieving 10 MJ with four final amplifiers. Each double-pass laser amplifier employs two-sided electron-beam pumping of the laser gas medium. Details of the design are based on a Monte-Carlo electron-beam deposition code, a one-dimensional, time-dependent kinetics code, and pulsed power circuit modeling. Linear dimensions of the amplifier's extracted gain volume are 6.25 m in height and length and 5.12 m in width. Each amplifier handles 160 angularly multiplexed laser channels. The one-amagat, krypton-rich laser medium is e-beam pumped at 60-kW cm/sup /minus/3/ (4-MA at3.3-MV) over the 2-microsecond duration of the laser beam pulse train. 5 refs., 4 figs

Amplifier Distortion

Science.gov (United States)

Keeports, David

2006-12-01

By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

FRAGSION: ultra-fast protein fragment library generation by IOHMM sampling.

Science.gov (United States)

Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin

2016-07-01

Speed, accuracy and robustness of building protein fragment library have important implications in de novo protein structure prediction since fragment-based methods are one of the most successful approaches in template-free modeling (FM). Majority of the existing fragment detection methods rely on database-driven search strategies to identify candidate fragments, which are inherently time-consuming and often hinder the possibility to locate longer fragments due to the limited sizes of databases. Also, it is difficult to alleviate the effect of noisy sequence-based predicted features such as secondary structures on the quality of fragment. Here, we present FRAGSION, a database-free method to efficiently generate protein fragment library by sampling from an Input-Output Hidden Markov Model. FRAGSION offers some unique features compared to existing approaches in that it (i) is lightning-fast, consuming only few seconds of CPU time to generate fragment library for a protein of typical length (300 residues); (ii) can generate dynamic-size fragments of any length (even for the whole protein sequence) and (iii) offers ways to handle noise in predicted secondary structure during fragment sampling. On a FM dataset from the most recent Critical Assessment of Structure Prediction, we demonstrate that FGRAGSION provides advantages over the state-of-the-art fragment picking protocol of ROSETTA suite by speeding up computation by several orders of magnitude while achieving comparable performance in fragment quality. Source code and executable versions of FRAGSION for Linux and MacOS is freely available to non-commercial users at http://sysbio.rnet.missouri.edu/FRAGSION/ It is bundled with a manual and example data. chengji@missouri.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Polymorphic sequence-characterized codominant loci in the chestnut blight fungus, Cryphonectria parasitica

Science.gov (United States)

J. E. Davis; Thomas L. Kubisiak; M. G. Milgroom

2005-01-01

Studies on the population biology of the chestnut blight fungus, Cryphonectria parasitica, have previously been carried out with dominant restriction fragment length polymorphism (RFLP) fingerprinting markers. In this study, we described the development of 11 condominant markers from randomly amplified polymorphic DNAs (RAPDs). RAPD fragments were...

Investigation of the fate and effects of acetyl cedrene on Capitella teleta and sediment bacterial community

DEFF Research Database (Denmark)

Ellegaard-Jensen, Lea; Selck, Henriette; Priemé, Anders

2010-01-01

/without Capitella teleta (formerly Capitella sp. I)). Furthermore effects of AC on microbial respiration in the system were determined by examining CO(2) flux. T-RFLP (terminal restriction fragment length polymorphism) was used to analyze PCR (polymerase chain reaction) amplified 16S DNA gene fragments from...

CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

Science.gov (United States)

Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

2018-01-01

Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

DEFF Research Database (Denmark)

Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

2004-01-01

. Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

A high-average power tapered FEL amplifier at submillimeter frequencies using sheet electron beams and short-period wigglers

International Nuclear Information System (INIS)

Bidwell, S.W.; Radack, D.J.; Antonsen, T.M. Jr.; Booske, J.H.; Carmel, Y.; Destler, W.W.; Granatstein, V.L.; Levush, B.; Latham, P.E.; Zhang, Z.X.

1990-01-01

A high-average-power FEL amplifier operating at submillimeter frequencies is under development at the University of Maryland. Program goals are to produce a CW, ∼1 MW, FEL amplifier source at frequencies between 280 GHz and 560 GHz. To this end, a high-gain, high-efficiency, tapered FEL amplifier using a sheet electron beam and a short-period (superconducting) wiggler has been chosen. Development of this amplifier is progressing in three stages: (1) beam propagation through a long length (∼1 m) of short period (λ ω = 1 cm) wiggler, (2) demonstration of a proof-of-principle amplifier experiment at 98 GHz, and (3) designs of a superconducting tapered FEL amplifier meeting the ultimate design goal specifications. 17 refs., 1 fig., 1 tab

Use of Full-Length Recombinant Calflagin and Its C Fragment for Improvement of Diagnosis of Trypanosoma cruzi Infection†

Science.gov (United States)

Marcipar, Iván S.; Roodveldt, Cintia; Corradi, Gerardo; Cabeza, María L.; Brito, Maria Edileuza F.; Winter, Lucile M. Floeter; Marcipar, Alberto J.; Silber, Ariel M.

2005-01-01

Serological diagnosis of Trypanosoma cruzi infection is hampered by issues related to test specificity due to the cross-reactivity of most antigens with proteins of related parasites such as Leishmania spp. The recombinant calflagins are considered relevant antigens for the diagnosis of infection by Trypanosoma cruzi. In the present work, we describe two genes coding for putative calflagins in Leishmania major with the N-terminal moieties presenting high similarity with T. cruzi genes. This fact raised questions about their role in some cross-recognition of this antigen by sera from Leishmania spp.-infected individuals. The complete T. cruzi calflagin and two fragments of the protein, consisting of 146 amino acids of the N-terminal and 65 amino acids of the C-terminal regions, were expressed and evaluated against a panel of sera, which included well-characterized samples from T. cruzi, and Leishmania-infected patients. We were able to show that sera from Leishmania (Viannia) braziliensis-infected individuals recognized the recombinant full-length calflagin. Both the N-terminal and the complete protein presented the same high sensitivity (98.5% of sera from T. cruzi-infected patients was detected) but different specificities (94% and 98%, respectively, when evaluated against sera from people not infected by T. cruzi, including 15 sera from people infected with L. braziliensis). The C-terminal fragment presented low sensitivity (70%) but 100% specificity. We propose the use of these antigens in two sequential assays to optimize the serological diagnosis of T. cruzi infection in humans in geographic areas where Leishmania spp. infection is coendemic. PMID:16272476

Participation of ATM in cellular response to DNA damage induced by ionizing radiation

International Nuclear Information System (INIS)

Meng Xiangbing; Song Yi; Mao Jianping; Gong Bo; Dong Yan; Liu Bin; Sun Zhixian

2000-01-01

Objective: To clone ATM full length cDNA and cDNA fragments containing some functional domains and to identify proteins that interact with ATM and mediate DNA damage signal transduction in cellular response to DNA damage. Methods: ATM cDNA was amplified from MarthomTM-Ready cDNA kit of human leukocytes by LD-PCR. ATM-interacting proteins were screened by yeast two hybrid system. Results: ATM full-length cDNA and cDNA fragments containing PI3K kinase domain, leucine zipper and proline rich region were amplified from human cDNAs. Several candidate clones that interacted with ATM PI3K domain were identified. Conclusion: ATM mediates DNA damage signal transduction by interacting with many proteins

Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

International Nuclear Information System (INIS)

Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

1988-01-01

The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

Comparison of different wavelength pump sources for Tm subnanosecond amplifier

Science.gov (United States)

Cserteg, Andras; Guillemet, Sébastien; Hernandez, Yves; Giannone, Domenico

2012-06-01

We report here a comparison of different pumping wavelengths for short pulse Thulium fibre amplifiers. We compare the results in terms of efficiency and required fibre length. As we operate the laser in the sub-nanosecond regime, the fibre length is a critical parameter regarding non linear effects. With 793 nm clad-pumping, a 4 m long active fibre was necessary, leading to strong spectral deformation through Self Phase Modulation (SPM). Core-pumping scheme was then more in-depth investigated with several wavelengths tested. Good results with Erbium and Raman shifted pumping sources were obtained, with very short fibre length, aiming to reach a few micro-joules per pulse without (or with limited) SPM.

Influences of finite gain bandwidth on pulse propagation in parabolic fiber amplifiers with distributed gain profiles

International Nuclear Information System (INIS)

Zhao Jia-Sheng; Li Pan; Chen Xiao-Dong; Feng Su-Juan; Mao Qing-He

2012-01-01

The evolutions of the pulses propagating in decreasing and increasing gain distributed fiber amplifiers with finite gain bandwidths are investigated by simulations with the nonlinear Schrödinger equation. The results show that the parabolic pulse propagations in both the decreasing and the increasing gain amplifiers are restricted by the finite gain bandwidth. For a given input pulse, by choosing a small initial gain coefficient and gain variation rate, the whole gain for the pulse amplification limited by the gain bandwidth may be higher, which is helpful for the enhancement of the output linearly chirped pulse energy. Compared to the decreasing gain distributed fiber amplifier, the increasing gain distributed amplifier may be more conducive to suppress the pulse spectral broadening and increase the critical amplifier length for achieving a larger output linearly chirped pulse energy

Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1990-01-01

The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Azzedine Bounamous

2014-07-01

Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

Development of high sensitivity transimpedance amplifier module for self powered neutron detectors

International Nuclear Information System (INIS)

Khan, T.K.; Tamboli, P.K.; Antony, J.; Balasubramanian, R.; Agilandaeswari, K.; Pramanik, M.

2010-01-01

This paper describes design and development of a Transimpedance Amplifier for amplification of very low current from in core Self Powered Neutron Detectors (SPND). Measurement of neutron flux is very important for operation, control and protection of Nuclear Power Plant (NPP). SPND is used to measure Reactor incore flux/power. Based on sensitivity of emitter material used in SPND, pitch length and neutron flux (power level); the current output from SPND varies from few pA to few μA. The described amplifier is suitable to use for this current range. The amplifier provides a very high gain using a resistive T network feedback topology. The amplifier is designed in two stages using ultra low bias current FET OPAMPs. Design of Transimpedance amplifier is carefully done to include ultra low input bias current, low offset voltage and noise. The amplifier has in built test facility for calibration and on line test facility for measurement of insulation resistance (IR). The amplifier module has on board isolated DC-DC converter circuit complying MIL/STD/461C/D which generate isolated +/-15V and +12V supply to provide parameter to parameter ground isolation and independence among each module/signal.The output from the amplifier is 0V to 6V for 0 to 150%FP. The design is simulated in computer and amplifier used at TAPS-3 was modified as per new design and has been tested at TAPS-3 site. The amplifier performed satisfactorily. The results showed that the IR measurement technique adopted in the design can tolerate lower IR of SPND in existing design. (author)

Gene Prediction in Metagenomic Fragments with Deep Learning

Directory of Open Access Journals (Sweden)

Shao-Wu Zhang

2017-01-01

Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

Optical architecture for a multi-megajoule ICF driver incorporating megajoule class KrF amplifiers

International Nuclear Information System (INIS)

McLeod, J.

1989-01-01

A gaseous amplifying medium should be scalable to any arbitrary size. A system architecture is reported which will produce 10 MJ with only four amplifiers in the last stage by making use of this scalability. The system described uses optical angular multiplexing for efficient utilization of such large KrF amplifiers. For such large amplifiers, each multiplex beamline carries 16 kJ toward the target chamber. This is because the pump duration need only be increased as the cube root of the output energy and is only 2050 ns. While the use of angular multiplexing does not increase the total count of beamlines, it does increase their length since space has to be provided for the temporal decoder; a possible site plan is shown. Optical beam tubes are filled with He to avoid propagation problems and to promote cleanliness. Single shot sacrificial windows are proposed for large amplifiers. Relatively large multiplexing angles reduce crosstalk to a manageable level

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

Assessment of genetic diversity for some Iraqi date palms ( Phoenix ...

African Journals Online (AJOL)

Amplified fragment length polymorphisms (AFLP) were used to evaluate the genetic diversity between 18 date palm (Phoenix dactylifera L.) varieties (11 females and 7 males) collected from the center of Iraq. Six primer pairs were applied to detect polymorphism between varieties. A total of 83 polymorphic AFLP fragments ...

HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

International Nuclear Information System (INIS)

Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

2013-01-01

We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities.

Science.gov (United States)

Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S

2007-08-01

Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.

Amplified spontaneous emission measurements on the Aurora large aperture module

International Nuclear Information System (INIS)

Oertel, J.A.; Czuchlewski, S.J.; Leland, W.T.; Turner, T.P.

1990-01-01

The large aperture module (LAM) of the Aurora KrF laser can be used to address a number of issues that relate to the scaling of KrF amplifiers to larger ICF systems. Perhaps foremost among these are the possible effects of amplified spontaneous emission (ASE) on laser performance. To assess this problem a 3-D computer code has been developed to model these ASE effects. The code uses an iterative procedure to arrive at a self-consistent steady state solution to the 3-D distribution of coherent and incoherent fluxes within the amplifier. Two-pass energy extraction, wall reflectivity, and nonuniform excitation are included in the model. The authors previously reported the effects of ASE on the small signal gains measured in the 1- x 1- x 2-m 3 LAM. The code also makes quantitative predictions of the ASE that should be generated in the amplifier. This paper indicates the radiance expected for a medium of uniform gain in terms of the (g - ν)L product and the parameter g/a. The quantity (g - ν)L is the product of the net gain and the path length along the direction of observation. The present experiments compare values of ASE measured at various locations around the LAM with the code predictions. The impact of ASE on amplifier output, is also discussed

Effect of Stemming to Burden Ratio and Powder Factor on Blast Induced Rock Fragmentation- A Case Study

Science.gov (United States)

Prasad, Sandeep; Choudhary, B. S.; Mishra, A. K.

2017-08-01

Rock fragmentation size is very important parameters for economical point of view in any surface mining. Rock fragment size direct effects on the costs of drilling, blasting, loading, secondary blasting and crushing. The main purpose of this study is to investigate effect of blast design parameters such as burden, blast hole length, stemming length, and powder factor on rock fragmentation. The fragment sizes (MFS, K50, m), and maximum fragment size (K95, m) of rock were determined by using the computer software. For every blast, after blasting operation, the images of whole muck pile are captured and there images were used for fragmentation analysis by using the Fragalyst software. It was observed that the optimal fragment size (MFS, K50, m and maximum fragment size, K95, m) of rock depends strongly on the blast design parameters and explosive parameters.

Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

Science.gov (United States)

Wood, S; Starr, T V; Shukin, R J

1986-01-01

We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

Auto-Zero Differential Amplifier

Science.gov (United States)

Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

2017-01-01

An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

Telomere length in normal and neoplastic canine tissues.

Science.gov (United States)

Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R

2007-12-01

To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.

The vulnerability of electric equipment to carbon fibers of mixed lengths: An analysis

Science.gov (United States)

Elber, W.

1980-01-01

The susceptibility of a stereo amplifier to damage from a spectrum of lengths of graphite fibers was calculated. A simple analysis was developed by which such calculations can be based on test results with fibers of uniform lengths. A statistical analysis was applied for the conversation of data for various logical failure criteria.

Portable musical instrument amplifier

Science.gov (United States)

Christian, David E.

1990-07-24

The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

Auto-locking waveguide amplifier system for lidar and magnetometric applications

Science.gov (United States)

Pouliot, A.; Beica, H. C.; Carew, A.; Vorozcovs, A.; Carlse, G.; Kumarakrishnan, A.

2018-02-01

We describe a compact waveguide amplifier system that is suitable for optically pumping rubidium magnetometers. The system consists of an auto-locking vacuum-sealed external cavity diode laser, a semiconductor tapered amplifier and a pulsing unit based on an acousto-optic modulator. The diode laser utilises optical feedback from an interference filter to narrow the linewidth of an inexpensive laser diode to 500 kHz. This output is scannable over an 8 GHz range (at 780 nm) and can be locked without human intervention to any spectral marker in an expandable library of reference spectra, using the autolocking controller. The tapered amplifier amplifies the output from 50 mW up to 2 W with negligible distortions in the spectral quality. The system can operate at visible and near infrared wavelengths with MHz repetition rates. We demonstrate optical pumping of rubidium vapour with this system for magnetometric applications. The magnetometer detects the differential absorption of two orthogonally polarized components of a linearly polarized probe laser following optical pumping by a circularly polarized pump laser. The differential absorption signal is studied for a range of pulse lengths, pulse amplitudes and DC magnetic fields. Our results suggest that this laser system is suitable for optically pumping spin-exchange free magnetometers.

Identification of Human T-lymphotropic Virus Type I (HTLV-I Subtypes Using Restrited Fragment Length Polymorphism in a Cohort of Asymptomatic Carriers and Patients with HTLV-I-associated Myelopathy/tropical Spastic Paraparesis from São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Segurado Aluisio AC

2002-01-01

Full Text Available Although human T-lymphotropic virus type I (HTLV-I exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV, genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, using restricted fragment length polymorphism (RFLP analysis of long terminal repeat (LTR HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%, cosmopolitan C (7.1% and cosmopolitan E (3.6% subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.

Operation Amplifier

NARCIS (Netherlands)

Tetsuya, Saito; Nauta, Bram

2011-01-01

PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

Operation Amplifier

NARCIS (Netherlands)

Tetsuya, S.; Nauta, Bram

2007-01-01

PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

Nanoscale electromechanical parametric amplifier

Science.gov (United States)

Aleman, Benjamin Jose; Zettl, Alexander

2016-09-20

This disclosure provides systems, methods, and apparatus related to a parametric amplifier. In one aspect, a device includes an electron source electrode, a counter electrode, and a pumping electrode. The electron source electrode may include a conductive base and a flexible conductor. The flexible conductor may have a first end and a second end, with the second end of the flexible conductor being coupled to the conductive base. A cross-sectional dimension of the flexible conductor may be less than about 100 nanometers. The counter electrode may be disposed proximate the first end of the flexible conductor and spaced a first distance from the first end of the flexible conductor. The pumping electrode may be disposed proximate a length of the flexible conductor and spaced a second distance from the flexible conductor.

Calpastatin ( CAST ) gene polymorphism in Kajli, Lohi and Thalli ...

African Journals Online (AJOL)

Restriction fragment length polymorphisms (RFLPs) in the amplified fragments were studied using Msp1 restriction enzyme. Frequencies of MM, MN and NN genotypes were found to be 77, 20 and 3% in Lohi breed and 68, 26 and 6% in Kajli breed respectively. In Thalli sheep, only the MM (80%) and MN (20%) genotypes ...

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

Science.gov (United States)

Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

2015-10-01

Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

Gain measurement in a CW medium-power diode pumped Nd:YAG laser amplifier by ASE analysis

International Nuclear Information System (INIS)

Razzaghi, D; Hajiesmaeilbaigi, F; Ruzbehani, M

2014-01-01

Using the relation between amplified spontaneous emission intensity and gain, a set of formulas is derived for gain evaluation by comparing fluorescence yield in two different lengths of the active medium. Experimental measurements are carried out and gain is calculated by solving the derived formula. For comparison, measurements are also carried out using the probe beam method, which shows good agreement between the two methods in a typical CW medium-power diode pumped Nd:YAG amplifier. (paper)

Gallium nitride based transistors for high-efficiency microwave switch-mode amplifiers

Energy Technology Data Exchange (ETDEWEB)

Maroldt, Stephan

2012-07-01

Highly-efficient switch-mode power amplifiers form key elements in future fully-digital base stations for mobile communication. This novel digital base station concept reduces system energy consumption, complexity, size and costs, while the flexibility in terms of multi-band operation and signal modulation improves. In this work, innovative core circuits for digital high-efficiency class-D and class-S power amplifiers based on gallium nitride (GaN) technology were developed for the application in digital base stations. A combination of optimized GaN devices and improvements in circuit design allow a highly-efficient switch-mode operation at mobile communication frequencies between 0.45 GHz and 2 GHz. Transistor device modeling for switch-mode operation, the simulation environment, and a broadband measurement system were established for the design and evaluation of digital switchmode power amplifiers. The design of broadband core circuits for switch-mode amplifier concepts was analyzed for dual-stage amplifier circuits, using an initial GaN technology with a gate length of 0.25 {mu}m. A speed-enhanced driver stage improved the circuit switching speed sufficiently above 1 GHz. Speed and efficiency of the amplifier core circuits were studied related to transistor parameters like cut-off frequency or gate capacitance. A reduced gate length was found to improve the switching speed, while a lower on-resistance allows the reduction of the inherent static losses of the GaN-based switches. Apart from this, the restriction of a 50 Ohm environment was found to be a major output power and switching speed limitation, due to a poor switching drive capability of the input capacitance of the GaN circuit. Finally, the optimized transistor and circuit design with an output gate width of 1.2 mm were effectively implemented in the given environment for an operation up to 2 GHz with a high drain efficiency of >65% and a digital output power of 5 W. A maximum output power of 9.7 W and a

Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

DEFF Research Database (Denmark)

Wang, Z.; Durhuus, T.; Mikkelsen, Benny

1994-01-01

A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

Genetic structure and seed-mediated dispersal rates of an endangered shrub in a fragmented landscape: a case study for Juniperus communis in northwestern Europe

Directory of Open Access Journals (Sweden)

Adriaenssens Sandy

2011-08-01

Full Text Available Abstract Background Population extinction risk in a fragmented landscape is related to the differential ability of the species to spread its genes across the landscape. The impact of landscape fragmentation on plant population dynamics will therefore vary across different spatial scales. We quantified successful seed-mediated dispersal of the dioecious shrub Juniperus communis in a fragmented landscape across northwestern Europe by using amplified fragment length polymorphism (AFLP markers. Furthermore we investigated the genetic diversity and structure on two spatial scales: across northwestern Europe and across Flanders (northern Belgium. We also studied whether seed viability and populations size were correlated with genetic diversity. Results Unexpectedly, estimated seed-mediated dispersal rates were quite high and ranged between 3% and 14%. No population differentiation and no spatial genetic structure were detected on the local, Flemish scale. A significant low to moderate genetic differentiation between populations was detected at the regional, northwest European scale (PhiPT = 0.10. In general, geographically nearby populations were also genetically related. High levels of within-population genetic diversity were detected but no correlation was found between any genetic diversity parameter and population size or seed viability. Conclusions In northwestern Europe, landscape fragmentation has lead to a weak isolation-by-distance pattern but not to genetic impoverishment of common juniper. Substantial rates of successful migration by seed-mediated gene flow indicate a high dispersal ability which could enable Juniperus communis to naturally colonize suitable habitats. However, it is not clear whether the observed levels of migration will suffice to counterbalance the effects of genetic drift in small populations on the long run.

Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

Science.gov (United States)

Lott, M J; Hose, G C; Power, M L

2014-09-01

Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

Science.gov (United States)

Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

2014-12-15

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Medium Power 352 MHZ solid state pulsed RF amplifiers for the CERN LINAC4 Project

CERN Document Server

Broere, J; Gómez Martínez, Y; Rossi, M

2011-01-01

Economic, modular and highly linear pulsed RF amplifiers have recently been developed to be used for the three buncher cavities in the CERN Linac4. The amplifiers are water-cooled and can provide up to 33 kW pulsed RF Power, 1.5 ms pulse length and 50 Hz repetition rate. Furthermore a 60 kW unit is under construction to provide the required RF Power for the debuncher cavity. The concept is based on 1.2 kW RF power modules using the latest 6th generation LDMOS technology. For integration into the CERN control environment the amplifiers have an internal industrial controller, which will provide easy control and extended diagnostic functions. This paper describes the construction, performance, including linearity, phase stability and EMC compliance tests

Low-order-mode harmonic multiplying gyrotron traveling-wave amplifier in W band

International Nuclear Information System (INIS)

Yeh, Y. S.; Chen, C. H.; Yang, S. J.; Lai, C. H.; Lin, T. Y.; Lo, Y. C.; Hong, J. W.; Hung, C. L.; Chang, T. H.

2012-01-01

Harmonic multiplying gyrotron traveling-wave amplifiers (gyro-TWAs) allow for magnetic field reduction and frequency multiplication. To avoid absolute instabilities, this work proposes a W-band harmonic multiplying gyro-TWA operating at low-order modes. By amplifying a fundamental harmonic TE 11 drive wave, the second harmonic component of the beam current initiates a TE 21 wave to be amplified. Absolute instabilities in the gyro-TWA are suppressed by shortening the interaction circuit and increasing wall losses. Simulation results reveal that compared with Ka-band gyro-TWTs, the lower wall losses effectively suppress absolute instabilities in the W-band gyro-TWA. However, a global reflective oscillation occurs as the wall losses decrease. Increasing the length or resistivity of the lossy section can reduce the feedback of the oscillation to stabilize the amplifier. The W-band harmonic multiplying gyro-TWA is predicted to yield a peak output power of 111 kW at 98 GHz with an efficiency of 25%, a saturated gain of 26 dB, and a bandwidth of 1.6 GHz for a 60 kV, 7.5 A electron beam with an axial velocity spread of 8%.

Antares laser power amplifier

International Nuclear Information System (INIS)

Stine, R.D.; Ross, G.F.; Silvernail, C.

1979-01-01

The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Amplification factor variable amplifier

NARCIS (Netherlands)

Akitsugu, Oshita; Nauta, Bram

2007-01-01

PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

Science.gov (United States)

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

Broadband spectral shaping in regenerative amplifier based on modified polarization-encoded chirped pulse amplification

Science.gov (United States)

Wang, Xinliang; Lu, Xiaoming; Liu, Yanqi; Xu, Yi; Wang, Cheng; Li, Shuai; Yu, Linpeng; Liu, Xingyan; Liu, Keyang; Xu, Rongjie; Leng, Yuxin

2018-06-01

We present an intra-cavity spectral shaping method to suppress the spectral narrowing in a Ti:sapphire (Ti:Sa) regenerative amplifier. The spectral shaping is realized by manipulating the stored energies of two Ti:Sa crystals with orthogonal c-axes, changing the length of a quartz plate, and rotating a broadband achromatic half-wave plate. Using this method, in our proof-of-concept experiment, an 84-nm-(FWHM)-broadband amplified pulse with an energy gain larger than 106 is obtained, which supports a 17.8 fs Fourier-transform-limited pulse duration. The pulse is compressed to 18.9 fs.

Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

Science.gov (United States)

Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

2016-07-29

A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

Science.gov (United States)

Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

1998-02-01

A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

Amplification factor variable amplifier

NARCIS (Netherlands)

Akitsugu, Oshita; Nauta, Bram

2010-01-01

PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

Directory of Open Access Journals (Sweden)

Diaz R

2001-01-01

Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

Nutrients, technological properties and genetic relationships among twenty cowpea landraces cultivated in West Africa

NARCIS (Netherlands)

Madode, Y.E.E.; Linnemann, A.R.; Nout, M.J.R.; Vosman, B.J.; Hounhouigan, D.J.; Boekel, van T.

2012-01-01

The genetic relationships among twenty phenotypically different cowpea landraces were unravelled regarding their suitability for preparing West African dishes. Amplified fragment length polymorphism classified unpigmented landraces (UPs) as highly similar (65%, one cluster), contrary to pigmented

Explosion-evaporation model for fragment production in intermediate-energy nuclear collisions

International Nuclear Information System (INIS)

Fai, G.; Randrup, J.

1981-01-01

Nuclear collisions at intermediate energies may create transient systems of hot nuclear matter that decay into many nuclear fragments. The disassembly of such a nuclear fireball is described as a two-stage process. In the primary explosion stage the system quickly fragments into nucleons and composite nuclei according to the available phase space. The explosion produces excited nuclei with half-lives longer than the time associated with the breakup. In the secondary evaporation stage, these nuclei decay, first by sequential emission of light particles (neutrons, protons, alphas), later by electromagnetic radiation. The secondary stage in general changes the relative abundancies of the various fragment species. This general feature makes it essential to take account of the composite fragments before using d/p as a measure of the entropy of the initial source. The formation of unbound nuclei at the explosion stage also has the desirable effect of enhancing the final abundancies of particularly stable nuclei, e.g., 4 He. For neutron-excessive sources the presence of composite nuclei amplifies the ratio of observed neutrons and protons; this effect persists for heavier mirror systems. Predictions of the model are qualitatively compared to available experimental data. The model offers a convenient way to augment existing dynamical models, such as intra-nuclear cascade and nuclear fluid dynamics, to yield actual nuclear fragments rather than merely matter distributions

CMOS Current-mode Operational Amplifier

DEFF Research Database (Denmark)

Kaulberg, Thomas

1992-01-01

current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

Molecular diversity and genetic relationships in Secale

Indian Academy of Sciences (India)

2001); and molecular methods such as amplified fragment length polymorphism ... to the maintenance and rational use of germplasm resources in the improvement of ... study of diversity of ScMATE1 gene in different species of. Secale genus.

Molecular and genetic study of wheat rusts

African Journals Online (AJOL)

Nicholas Le Maitre

Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

AFLP analysis shows high incongruence between genetic differentiation and morphology-based taxonomy in a widely distributed tortoise

Czech Academy of Sciences Publication Activity Database

Mikulíček, Peter; Jandzik, D.; Fritz, U.; Schneider, C.; Široký, P.

2013-01-01

Roč. 108, č. 1 (2013), s. 151-160 ISSN 0024-4066 Institutional support: RVO:68081766 Keywords : Amplified fragment length polymorphism * morphological plasticity * reptiles * stabilizing selection * Testudines Subject RIV: EG - Zoology Impact factor: 2.535, year: 2013

Operational amplifiers

CERN Document Server

Dostal, Jiri

1993-01-01

This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

Amplified fragment length polymorphism analysis of human clinical isolates of Mycobacterium haemophilum from different continents

NARCIS (Netherlands)

Bruijnesteijn van Coppenraet, L. E. S.; Savelkoul, P. H. M.; Buffing, N.; van der Bijl, M. W.; Woudenberg, J.; Lindeboom, J. A.; Kiehn, T. E.; Haverkort, F.; Samra, Z.; Kuijper, E. J.

2009-01-01

The role of the species Mycobacterium haemophilum as a pathogenic non-tuberculous microorganism is becoming better defined with the use of specific detection methods. However, epidemiological investigations of this species are still scarce. We analysed the genetic diversity of M. haemophilum by

Critical Features of Fragment Libraries for Protein Structure Prediction.

Science.gov (United States)

Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

2017-01-01

The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

The invasive ergot Claviceps purpurea var. spartinae recently established in the European Wadden Sea on common cord grass is genetically homogeneous and the sclerotia contain high amounts of ergot alkaloids

Czech Academy of Sciences Publication Activity Database

Boestfleisch, Ch.; Drotleff, A.M.; Ternes, W.; Nehring, S.; Pažoutová, Sylvie; Papenbrock, J.

2015-01-01

Roč. 141, č. 3 (2015), s. 445-461 ISSN 0929-1873 Institutional support: RVO:61388971 Keywords : Amplified fragment length polymorphism (AFLP) * Claviceps purpurea var. spartinae * Epimers Subject RIV: EE - Microbiology, Virology Impact factor: 1.494, year: 2015

Host- and tissue-specific pathogenic traits of Staphylococcus aureus.

NARCIS (Netherlands)

W.B. van Leeuwen (Willem); D.C. Melles (Damian); A. Alaidan (Alwaleed); M. Al-Ahdal (Mohammed); H.A.M. Boelens (Hélène); S.V. Snijders (Susan); H.F.L. Wertheim (Heiman); E. van Duijkeren (Engeline); J.K. Peeters (Justine); P.J. van der Spek (Peter); R.F.J. Gorkink (Raymond); G. Simons (Guus); H.A. Verbrugh (Henri); A.F. van Belkum (Alex)

2005-01-01

textabstractComparative genomics were used to assess genetic differences between Staphylococcus aureus strains derived from infected animals versus colonized or infected humans. A total of 77 veterinary isolates were genetically characterized by high-throughput amplified fragment length polymorphism

CMOS Current-mode Operational Amplifier

OpenAIRE

Kaulberg, Thomas

1992-01-01

A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

Multipath interference test method for distributed amplifiers

Science.gov (United States)

Okada, Takahiro; Aida, Kazuo

2005-12-01

A method for testing distributed amplifiers is presented; the multipath interference (MPI) is detected as a beat spectrum between the multipath signal and the direct signal using a binary frequency shifted keying (FSK) test signal. The lightwave source is composed of a DFB-LD that is directly modulated by a pulse stream passing through an equalizer, and emits the FSK signal of the frequency deviation of about 430MHz at repetition rate of 80-100 kHz. The receiver consists of a photo-diode and an electrical spectrum analyzer (ESA). The base-band power spectrum peak appeared at the frequency of the FSK frequency deviation can be converted to amount of MPI using a calibration chart. The test method has improved the minimum detectable MPI as low as -70 dB, compared to that of -50 dB of the conventional test method. The detailed design and performance of the proposed method are discussed, including the MPI simulator for calibration procedure, computer simulations for evaluating the error caused by the FSK repetition rate and the fiber length under test and experiments on singlemode fibers and distributed Raman amplifier.

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

Simplified design of IC amplifiers

CERN Document Server

Lenk, John

1996-01-01

Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)

Energy Technology Data Exchange (ETDEWEB)

McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))

1991-09-25

Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.

Molecular analysis of field strains of Mycoplasma capricolum subspecies capripneumoniae and Mycoplasma mycoides subspecies mycoides, small colony type isolated from goats in Tanzania

DEFF Research Database (Denmark)

Kusiluka, L.J.M.; Ojeniyi, B.; Friis, N.F.

2001-01-01

A molecular analysis of strains of Mycoplasma capricolum subsp, capripneumoniae (M. capripneumoniae) and Mycoplasma mycoides subsp. mycoides, small colony type (M. mycoides SQ isolated from goats was performed using the amplified fragment length polymorphism (AFLP) and pulsed-field gel...

Microarray-based method for the parallel analysis of genotypes and expression profiles of wood-forming tissues in Eucalyptus grandis

CSIR Research Space (South Africa)

Barros, E

2009-05-01

Full Text Available of Eucalyptus grandis planting stock that exhibit preferred wood qualities is thus a priority of the South African forestry industry. The researchers used microarray-based DNA-amplified fragment length polymorphism (AFLP) analysis in combination with expression...

Tooth fragment reattachment techniques-A systematic review.

Science.gov (United States)

Garcia, Fernanda Cristina P; Poubel, Déborah L N; Almeida, Júlio César F; Toledo, Isabela P; Poi, Wilson R; Guerra, Eliete N S; Rezende, Liliana V M L

2018-03-07

Several strategies have been developed for tooth fragment reattachment following fracture. Although many techniques have been reported, there is no consensus on which one has the best results in terms of the bond strength between the fragment and the dentin over time. The aim of this study was to assess the currently reported tooth fragment reattachment techniques for fractured crowns of anterior teeth. The PubMed, LILACS, Web of Science, Cochrane, and Scopus databases were searched in October 2016, and the search was updated in February 2017. A search of the gray literature was performed in Google Scholar and OpenGrey. Reference lists of eligible studies were cross-checked to identify additional studies; gray literature and ongoing trials were investigated. Two authors assessed studies to determine inclusion and undertook data extraction. Case reports/series of three or more cases, cross-sectional studies, cohort studies, and in vivo clinical trials in all languages were included. Five articles remained after screening. These studies predominantly reported on fragment reattachment with composite resin and resin cement. There was little consistency among the studies in regard to the technique used for tooth fragment reattachment and length of the follow-up period. According to the evidence found in the studies included in this review, simple tooth fragment reattachment was the preferred reattachment technique. An increase in the bond strength between tooth fragment and dentin was observed when an intermediate material was used. Further investigation is needed, using standard follow-up periods and larger samples. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Three-Stage InP Submillimeter-Wave MMIC Amplifier

Science.gov (United States)

Pukala, David; Samoska, Lorene; Man, King; Gaier, Todd; Deal, William; Lai, Richard; Mei, Gerry; Makishi, Stella

2008-01-01

A submillimeter-wave monolithic integrated- circuit (S-MMIC) amplifier has been designed and fabricated using an indium phosphide (InP) 35-nm gate-length high electron mobility transistor (HEMT) device, developed at Northrop Grumman Corporation. The HEMT device employs two fingers each 15 micrometers wide. The HEMT wafers are grown by molecular beam epitaxy (MBE) and make use of a pseudomorphic In0.75Ga0.25As channel, a silicon delta-doping layer as the electron supply, an In0.52Al0.48As buffer layer, and an InP substrate. The three-stage design uses coplanar waveguide topology with a very narrow ground-to-ground spacing of 14 micrometers. Quarter-wave matching transmission lines, on-chip metal-insulator-metal shunt capacitors, series thin-film resistors, and matching stubs were used in the design. Series resistors in the shunt branch arm provide the basic circuit stabilization. The S-MMIC amplifier was measured for S-parameters and found to be centered at 320 GHz with 13-15-dB gain from 300-345 GHz. This chip was developed as part of the DARPA Submillimeter Wave Imaging Focal Plane Technology (SWIFT) program (see figure). Submillimeter-wave amplifiers could enable more sensitive receivers for earth science, planetary remote sensing, and astrophysics telescopes, particularly in radio astronomy, both from the ground and in space. A small atmospheric window at 340 GHz exists and could enable ground-based observations. However, the submillimeter-wave regime (above 300 GHz) is best used for space telescopes as Earth s atmosphere attenuates most of the signal through water and oxygen absorption. Future radio telescopes could make use of S-MMIC amplifiers for wideband, low noise, instantaneous frequency coverage, particularly in the case of heterodyne array receivers.

Improved-Bandwidth Transimpedance Amplifier

Science.gov (United States)

Chapsky, Jacob

2009-01-01

The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

Regulation of presynaptic Ca2+, synaptic plasticity and contextual fear conditioning by a N-terminal β-amyloid fragment.

Science.gov (United States)

Lawrence, James L M; Tong, Mei; Alfulaij, Naghum; Sherrin, Tessi; Contarino, Mark; White, Michael M; Bellinger, Frederick P; Todorovic, Cedomir; Nichols, Robert A

2014-10-22

Soluble β-amyloid has been shown to regulate presynaptic Ca(2+) and synaptic plasticity. In particular, picomolar β-amyloid was found to have an agonist-like action on presynaptic nicotinic receptors and to augment long-term potentiation (LTP) in a manner dependent upon nicotinic receptors. Here, we report that a functional N-terminal domain exists within β-amyloid for its agonist-like activity. This sequence corresponds to a N-terminal fragment generated by the combined action of α- and β-secretases, and resident carboxypeptidase. The N-terminal β-amyloid fragment is present in the brains and CSF of healthy adults as well as in Alzheimer's patients. Unlike full-length β-amyloid, the N-terminal β-amyloid fragment is monomeric and nontoxic. In Ca(2+) imaging studies using a model reconstituted rodent neuroblastoma cell line and isolated mouse nerve terminals, the N-terminal β-amyloid fragment proved to be highly potent and more effective than full-length β-amyloid in its agonist-like action on nicotinic receptors. In addition, the N-terminal β-amyloid fragment augmented theta burst-induced post-tetanic potentiation and LTP in mouse hippocampal slices. The N-terminal fragment also rescued LTP inhibited by elevated levels of full-length β-amyloid. Contextual fear conditioning was also strongly augmented following bilateral injection of N-terminal β-amyloid fragment into the dorsal hippocampi of intact mice. The fragment-induced augmentation of fear conditioning was attenuated by coadministration of nicotinic antagonist. The activity of the N-terminal β-amyloid fragment appears to reside largely in a sequence surrounding a putative metal binding site, YEVHHQ. These findings suggest that the N-terminal β-amyloid fragment may serve as a potent and effective endogenous neuromodulator. Copyright © 2014 the authors 0270-6474/14/3414210-09$15.00/0.

Muscle trade-offs in a power-amplified prey capture system.

Science.gov (United States)

Blanco, M Mendoza; Patek, S N

2014-05-01

Should animals operating at great speeds and accelerations use fast or slow muscles? The answer hinges on a fundamental trade-off: muscles can be maximally fast or forceful, but not both. Direct lever systems offer a straightforward manifestation of this trade-off, yet the fastest organisms use power amplification, not direct lever action. Power-amplified systems typically use slow, forceful muscles to preload springs, which then rapidly release elastic potential energy to generate high speeds and accelerations. However, a fast response to a stimulus may necessitate fast spring-loading. Across 22 mantis shrimp species (Stomatopoda), this study examined how muscle anatomy correlates with spring mechanics and appendage type. We found that muscle force is maximized through physiological cross-sectional area, but not through sarcomere length. Sit-and-wait predators (spearers) had the shortest sarcomere lengths (fastest contractions) and the slowest strike speeds. The species that crush shells (smashers) had the fastest speeds, most forceful springs, and longest sarcomeres. The origin of the smasher clade yielded dazzlingly high accelerations, perhaps due to the release from fast spring-loading for evasive prey capture. This study offers a new window into the dynamics of force-speed trade-offs in muscles in the biomechanical, comparative evolutionary framework of power-amplified systems. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

Molecular variation of Trypanosoma brucei subspecies as revealed by AFLP fingerprinting

NARCIS (Netherlands)

Agbo, E.E.C.; Majiwa, P.A.O.; Claassen, H.J.H.M.; Pas, te M.F.W.

2002-01-01

Genetic analysis of Trypanosoma spp. depends on the detection of variation between strains. We have used the amplified fragment length polymorphism (AFLP) technique to develop a convenient and reliable method for genetic characterization of Trypanosome (sub)species. AFLP accesses multiple

AFLP genetic polymorphism in wild barley (Hordeum spontaneum) populations in Israel

NARCIS (Netherlands)

Turpeinen, T.; Vanhala, T.; Nevo, E.; Nissila, E.

2003-01-01

The genetic diversity produced by the amplified fragment length polymorphism (AFLP) method was studied in 94 genotypes of wild barley, Hordeum spontaneum (C. Koch) Thell., originating from ten ecologically and geographically different locations in Israel. Eight primer pairs produced 204 discernible

Genetic diversity and relationships among cabbage ( Brassica ...

African Journals Online (AJOL)

The integration of our data with historical documents confirmed that traditional cabbage landraces cultivated in North of China were first introduced from Russia. Key words: Amplified fragment length polymorphism (AFLP), genetic diversity, cabbage (Brassica oleracea var. capitata), landraces, population structure.

Class 1 integrons in ciprofloxacin-resistant Escherichia coli strains from two Dutch hospitals

NARCIS (Netherlands)

Mooij, M. J.; Schouten, I.; Vos, G.; van Belkum, A.; Vandenbroucke-Grauls, C. M. J. E.; Savelkoul, P. H. M.; Schultsz, C.

2005-01-01

A significant increase in the isolation frequency of ciprofloxacin-resistant Escherichia coli was observed in the haematology departments of two university hospitals in The Netherlands. Amplified fragment length polymorphism analysis revealed that this increase was not caused by the emergence of

IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

Directory of Open Access Journals (Sweden)

A.C. Panunto

2003-10-01

Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

Millimeter-wave power amplifiers

CERN Document Server

du Preez, Jaco

2017-01-01

This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

Functional PAK-2 knockout and replacement with a caspase cleavage-deficient mutant in mice reveals differential requirements of full-length PAK-2 and caspase-activated PAK-2p34.

Science.gov (United States)

Marlin, Jerry W; Chang, Yu-Wen E; Ober, Margaret; Handy, Amy; Xu, Wenhao; Jakobi, Rolf

2011-06-01

p21-Activated protein kinase 2 (PAK-2) has both anti- and pro-apoptotic functions depending on its mechanism of activation. Activation of full-length PAK-2 by the monomeric GTPases Cdc42 or Rac stimulates cell survival, whereas caspase activation of PAK-2 to the PAK-2p34 fragment is involved in the apoptotic response. In this study we use functional knockout of PAK-2 and gene replacement with the caspase cleavage-deficient PAK-2D212N mutant to differentiate the biological functions of full-length PAK-2 and caspase-activated PAK-2p34. Knockout of PAK-2 results in embryonic lethality at early stages before organ development, whereas replacement with the caspase cleavage-deficient PAK-2D212N results in viable and healthy mice, indicating that early embryonic lethality is caused by deficiency of full-length PAK-2 rather than lack of caspase activation to the PAK-2p34 fragment. However, deficiency of caspase activation of PAK-2 decreased spontaneous cell death of primary mouse embryonic fibroblasts and increased cell growth at high cell density. In contrast, stress-induced cell death by treatment with the anti-cancer drug cisplatin was not reduced by deficiency of caspase activation of PAK-2, but switched from an apoptotic to a nonapoptotic, caspase-independent mechanism. Homozygous PAK-2D212N primary mouse embryonic fibroblasts that lack the ability to generate the proapoptotic PAK-2p34 show less activation of the effector caspase 3, 6, and 7, indicating that caspase activation of PAK-2 amplifies the apoptotic response through a positive feedback loop resulting in more activation of effector caspases.

Oscillators and operational amplifiers

OpenAIRE

Lindberg, Erik

2005-01-01

A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

FLUIDIC AC AMPLIFIERS.

Science.gov (United States)

Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

Fragger: a protein fragment picker for structural queries [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Francois Berenger

2018-04-01

Full Text Available Protein modeling and design activities often require querying the Protein Data Bank (PDB with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

DNA fragments assembly based on nicking enzyme system.

Directory of Open Access Journals (Sweden)

Rui-Yan Wang

Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

Energy Technology Data Exchange (ETDEWEB)

Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

1999-09-01

In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

Design and analysis of optically pumped submillimeter waveguide maser amplifiers and oscillators

Science.gov (United States)

Galantowicz, T. A.

1975-01-01

The design and experimental measurements are described of an optically pumped far-infrared (FIR) waveguide maser; preliminary measurements on a FIR waveguide amplifier are presented. The FIR maser was found to operate satisfactorily in a chopped CW mode using either methanol (CH3OH) or acetonitrile (CH3CN) as the active molecule. Two other gases, difluoroethane and difluoroethylene, produced an unstable output with high threshold and low output power when operated in the chopped CW mode. Experimental measurements include FIR output versus cavity length, output beam pattern, output power versus pressure, and input power. The FIR output was the input to an amplifier which was constructed similar to the oscillator. An increase of 10% in output power was noted on the 118.8 microns line of methanol.

Analysis of Immunogenicity of Intracellular CTAR Fragments of Epstein-Barr Virus Latent Phase Protein LMP1.

Science.gov (United States)

Lomakin, Ya A; Shmidt, A A; Bobik, T V; Chernov, A S; Pyrkov, A Yu; Aleksandrova, N M; Okunola, D O; Vaskina, M I; Ponomarenko, N A; Telegin, G B; Dubina, M V; Belogurov, A A

2017-10-01

Intracellular fragments of latent phase protein LMP1 of Epstein-Barr virus, denoted as CTAR1/2/3, can trigger a variety of cell cascades and contribute to the transforming potential of the virus. Generation of recombinant proteins CTAR1/2/3 is expected to yield more ample data on functional and immunogenic characteristics of LMP1. We created genetic constructs for prokaryotic expression of LMP1 CTAR fragments and selected optimal conditions for their production and purification. Using a new library of LMP1 CTAR fragments, we carried out epitope mapping of a diagnostic anti-LMP1 antibody S12. Analysis of polyclonal serum antibodies from mice immunized with full-length LMP1 confirmed immunogenicity of CTAR elements comparable with that of full-length protein.

Investigation of pump-to-seed beam matching on output features of Rb and Cs vapor laser amplifiers

Science.gov (United States)

Shen, Binglin; Huang, Jinghua; Xu, Xingqi; Xia, Chunsheng; Pan, Bailiang

2018-05-01

Taking into account the beam radii of pump light and seed laser along the entire length of the cell and their intensities in the cross section, a physical model with ordinary differential equation methods for alkali vapor amplifiers is established. Applied to the reported optically pumped Rb and diode-pumped Cs vapor amplifiers, the model shows good agreement between the calculated and measured dependence of amplified power on the seed power. A larger width of the spontaneous emission region as compared to the widths of pump absorption and laser emission regions, which will result in very high energy losses, is observed in the cell. Influence of pump and seed beam waists on output performance is calculated, showing that the pump and seed beam should match each other not only in shape but also in size, thus an optimal combination of beam radii is very important for efficient operation of alkali vapor amplifiers.

Dynameomics: Data-driven methods and models for utilizing large-scale protein structure repositories for improving fragment-based loop prediction

Science.gov (United States)

Rysavy, Steven J; Beck, David AC; Daggett, Valerie

2014-01-01

Protein function is intimately linked to protein structure and dynamics yet experimentally determined structures frequently omit regions within a protein due to indeterminate data, which is often due protein dynamics. We propose that atomistic molecular dynamics simulations provide a diverse sampling of biologically relevant structures for these missing segments (and beyond) to improve structural modeling and structure prediction. Here we make use of the Dynameomics data warehouse, which contains simulations of representatives of essentially all known protein folds. We developed novel computational methods to efficiently identify, rank and retrieve small peptide structures, or fragments, from this database. We also created a novel data model to analyze and compare large repositories of structural data, such as contained within the Protein Data Bank and the Dynameomics data warehouse. Our evaluation compares these structural repositories for improving loop predictions and analyzes the utility of our methods and models. Using a standard set of loop structures, containing 510 loops, 30 for each loop length from 4 to 20 residues, we find that the inclusion of Dynameomics structures in fragment-based methods improves the quality of the loop predictions without being dependent on sequence homology. Depending on loop length, ∼25–75% of the best predictions came from the Dynameomics set, resulting in lower main chain root-mean-square deviations for all fragment lengths using the combined fragment library. We also provide specific cases where Dynameomics fragments provide better predictions for NMR loop structures than fragments from crystal structures. Online access to these fragment libraries is available at http://www.dynameomics.org/fragments. PMID:25142412

Dynameomics: data-driven methods and models for utilizing large-scale protein structure repositories for improving fragment-based loop prediction.

Science.gov (United States)

Rysavy, Steven J; Beck, David A C; Daggett, Valerie

2014-11-01

Protein function is intimately linked to protein structure and dynamics yet experimentally determined structures frequently omit regions within a protein due to indeterminate data, which is often due protein dynamics. We propose that atomistic molecular dynamics simulations provide a diverse sampling of biologically relevant structures for these missing segments (and beyond) to improve structural modeling and structure prediction. Here we make use of the Dynameomics data warehouse, which contains simulations of representatives of essentially all known protein folds. We developed novel computational methods to efficiently identify, rank and retrieve small peptide structures, or fragments, from this database. We also created a novel data model to analyze and compare large repositories of structural data, such as contained within the Protein Data Bank and the Dynameomics data warehouse. Our evaluation compares these structural repositories for improving loop predictions and analyzes the utility of our methods and models. Using a standard set of loop structures, containing 510 loops, 30 for each loop length from 4 to 20 residues, we find that the inclusion of Dynameomics structures in fragment-based methods improves the quality of the loop predictions without being dependent on sequence homology. Depending on loop length, ∼ 25-75% of the best predictions came from the Dynameomics set, resulting in lower main chain root-mean-square deviations for all fragment lengths using the combined fragment library. We also provide specific cases where Dynameomics fragments provide better predictions for NMR loop structures than fragments from crystal structures. Online access to these fragment libraries is available at http://www.dynameomics.org/fragments. © 2014 The Protein Society.

Genetic diversity, classification and comparative study on the larval ...

African Journals Online (AJOL)

use

2011-12-14

Dec 14, 2011 ... Lanka, Philippines, Bangladesh, Nepal, Myanmar, Turkey,. Papua New Guinea, Mexico, Uzbekistan and some of the. *Corresponding author. E-mail: ...... Characterization of Iranian Native Bombyx mori Strains Using. Amplified Fragment Length Polymorphism Markers. J. Econ. Entomol. 100(3): 939-945.

The east-west-north colonization history of the Mediterranean and Europe by the coastal plant Carex extensa (Cyperaceae)

NARCIS (Netherlands)

Escudero, M.; Vargas, P.; Arens, P.; Ouborg, N.J.; Luceno, M.

2010-01-01

Coastal plants are ideal models for studying the colonization routes of species because of the simple linear distributions of these species. Carex extensa occurs mainly in salt marshes along the Mediterranean and European coasts. Variation in cpDNA sequences, amplified fragment length polymorphisms

New hybrids between Saccharomyces sensu stricto yeast species found among wine and cider production strains

DEFF Research Database (Denmark)

Masneuf, I; Hansen, J.; Groth, C

1998-01-01

Two yeast isolates, a wine-making yeast first identified as a Mel(+) strain (ex. S. uvarum) and a cider-making yeast, were characterized for their nuclear and mitochondrial genomes, Electrophoretic karyotyping analyses, restriction fragment length polymorphism maps of PCR-amplified MET2 gene...

Genetic linkage maps of Japanese and European pears aligned to the apple consensus map

NARCIS (Netherlands)

Yamamoto, T.; Kimura, T.; Saito, T.; Kotobuki, K.; Matsuta, N.; Liebhard, R.; Gessler, C.; Weg, van de W.E.; Hayashi, T.

2004-01-01

Genetic linkage maps of the Japanese pear (Pyrus pyrifolia Nakai) cultivar `Housui¿ and the European pear (Pyrus communis L.) cultivar `Bartlett¿ were constructed based on Amplified Fragment Length Polymorphism markers (AFLPs), Simple Sequence Repeat markers (SSRs) (from pear, apple and Prunus),

Genetic structure in cultivated and wild carrots (¤Daucus carota¤ L.) revealed by AFLP analysis

DEFF Research Database (Denmark)

Shim, S.I.; Bagger Jørgensen, Rikke

2000-01-01

Genetic variation within and among five Danish populations of wild carrot and five cultivated varieties was investigated using amplified fragment length polymorphism (AFLP). Ten AFLP primer combinations produced 116 polymorphic bands. Based on the marker data an UPGMA-cluster analysis and principal...

Genetic and Environmental Impact on Iron, Zinc, and Phytate in Food Sorghum Grown in Benin

NARCIS (Netherlands)

Kayodé, A.P.P.; Linnemann, A.R.; Hounhouigan, J.D.; Nout, M.J.R.; Boekel, van M.A.J.S.

2006-01-01

Seventy-six farmers' varieties of sorghum from Benin were distinguished by amplified fragment length polymorphism (AFLP) and clustered into 45 distinct genotypes. The genotype clusters were evaluated for their Fe, Zn, and phytate concentrations to assess the impact of genetic and environmental

Genetic diversity of Actinobacillus lignieresii isolates from different hosts

DEFF Research Database (Denmark)

Kokotovic, Branko; Angen, Øystein; Bisgaard, Magne

2011-01-01

Genetic diversity detected by analysis of amplified fragment length polymorphisms (AFLPs) of 54 Actinobacilus lignieresii isolates from different hosts and geographic localities is described. On the basis of variances in AFLP profiles, the strains were grouped in two major clusters; one comprisin...

Identification of bacteria in drinking water with Raman spectroscopy

NARCIS (Netherlands)

van de Vossenberg, J.; Tervahauta, H.; Maquelin, K.; Blokker-Koopmans, C.H.W.; Uytewaal-Aaarts, M.; Kooij, D.; van Wezel, A.P.; van der Gaag, B.

2013-01-01

Raman spectroscopy was used to discriminate between Legionella strains and between E. coli and coliform strains. The relationship between triplicate Raman spectra derived from Legionella bacteria was compared with that derived from a blind set of samples and amplified fragment length polymorphism

Isolation of Cryptococcus gattii from a Castanopsis argyrophylla tree hollow (Mai-Kaw), Chiang Mai, Thailand

NARCIS (Netherlands)

Khayhan, Kantarawee; Hagen, Ferry; Norkaew, Treepradab; Puengchan, Tanpalang; Boekhout, Teun; Sriburee, Pojana

2017-01-01

The pathogenic yeast Cryptococcus gattii was isolated from a tree hollow of a Castanopsis argyrophylla King ex Hook.f. (Fagaceae) in Chiang Mai, Thailand. Molecular characterization with amplified fragment length polymorphism analysis and multi-locus sequence typing showed that this isolate belonged

Molecular marker analysis to differentiate a clonal selection of ...

African Journals Online (AJOL)

Lalit Kumar

2013-04-03

Apr 3, 2013 ... Microsatellite and amplified fragment length polymorphism (AFLP) markers were used to differentiate. Manjari Naveen, a clonal selection of Centennial Seedless variety of grape. Twenty one (21) microsatellite primers could not detect variation between parent variety and its clone. AFLP analysis.

Analysis of genetic diversity in pigeon pea germplasm using ...

Indian Academy of Sciences (India)

MANEESHA

2017-08-16

Aug 16, 2017 ... fied polymorphic DNA (RAPD), simple sequence repeats. (SSR), amplified fragment length polymorphism (AFLP), single-nucleotide polymorphisms (SNPs), diversity array technology (DArT), genic-simple sequence repeats (genic-. SSR) etc. (see review by Varshney et al. 2013). Since retrotransposons are ...

Genetic diversity of Pogonatherum paniceum (Lam.) Hack. in ...

African Journals Online (AJOL)

Amplified fragment length polymorphism (AFLP) markers were used to estimate the genetic diversity of Pogonatherum paniceum (Lam.) Hack. from Sichuan Province, Yunnan Province, Chongqing City and. Guangxi Zhuang autonomous Region in China. 10 primer combinations were carried out on 180 different individuals ...

Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction

International Nuclear Information System (INIS)

Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang

2002-01-01

The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor

Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction

Science.gov (United States)

Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang

2002-12-01

The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.

Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

Science.gov (United States)

Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

2015-11-01

The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

In Vitro Magnetic Resonance Imaging Evaluation of Fragmented, Open-Coil, Percutaneous Peripheral Nerve Stimulation Leads.

Science.gov (United States)

Shellock, Frank G; Zare, Armaan; Ilfeld, Brian M; Chae, John; Strother, Robert B

2018-04-01

Percutaneous peripheral nerve stimulation (PNS) is an FDA-cleared pain treatment. Occasionally, fragments of the lead (MicroLead, SPR Therapeutics, LLC, Cleveland, OH, USA) may be retained following lead removal. Since the lead is metallic, there are associated magnetic resonance imaging (MRI) risks. Therefore, the objective of this investigation was to evaluate MRI-related issues (i.e., magnetic field interactions, heating, and artifacts) for various lead fragments. Testing was conducted using standardized techniques on lead fragments of different lengths (i.e., 50, 75, and 100% of maximum possible fragment length of 12.7 cm) to determine MRI-related problems. Magnetic field interactions (i.e., translational attraction and torque) and artifacts were tested for the longest lead fragment at 3 Tesla. MRI-related heating was evaluated at 1.5 Tesla/64 MHz and 3 Tesla/128 MHz with each lead fragment placed in a gelled-saline filled phantom. Temperatures were recorded on the lead fragments while using relatively high RF power levels. Artifacts were evaluated using T1-weighted, spin echo, and gradient echo (GRE) pulse sequences. The longest lead fragment produced only minor magnetic field interactions. For the lead fragments evaluated, physiologically inconsequential MRI-related heating occurred at 1.5 Tesla/64 MHz while under certain 3 Tesla/128 MHz conditions, excessive temperature elevations may occur. Artifacts extended approximately 7 mm from the lead fragment on the GRE pulse sequence, suggesting that anatomy located at a position greater than this distance may be visualized on MRI. MRI may be performed safely in patients with retained lead fragments at 1.5 Tesla using the specific conditions of this study (i.e., MR Conditional). Due to possible excessive temperature rises at 3 Tesla, performing MRI at that field strength is currently inadvisable. © 2017 International Neuromodulation Society.

A CMOS current-mode operational amplifier

DEFF Research Database (Denmark)

Kaulberg, Thomas

1993-01-01

current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

Modeling of semiconductor optical amplifiers

DEFF Research Database (Denmark)

Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

Modified stochastic fragmentation of an interval as an ageing process

Science.gov (United States)

Fortin, Jean-Yves

2018-02-01

We study a stochastic model based on modified fragmentation of a finite interval. The mechanism consists of cutting the interval at a random location and substituting a unique fragment on the right of the cut to regenerate and preserve the interval length. This leads to a set of segments of random sizes, with the accumulation of small fragments near the origin. This model is an example of record dynamics, with the presence of ‘quakes’ and slow dynamics. The fragment size distribution is a universal inverse power law with logarithmic corrections. The exact distribution for the fragment number as function of time is simply related to the unsigned Stirling numbers of the first kind. Two-time correlation functions are defined, and computed exactly. They satisfy scaling relations, and exhibit aging phenomena. In particular, the probability that the same number of fragments is found at two different times t>s is asymptotically equal to [4πlog(s)]-1/2 when s\\gg 1 and the ratio t/s is fixed, in agreement with the numerical simulations. The same process with a reset impedes the aging phenomenon-beyond a typical time scale defined by the reset parameter.

NASA developments in solid state power amplifiers

Science.gov (United States)

Leonard, Regis F.

1990-01-01

Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

International Nuclear Information System (INIS)

2005-01-01

Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

Microbials for the production of monoclonal antibodies and antibody fragments.

Science.gov (United States)

Spadiut, Oliver; Capone, Simona; Krainer, Florian; Glieder, Anton; Herwig, Christoph

2014-01-01

Monoclonal antibodies (mAbs) and antibody fragments represent the most important biopharmaceutical products today. Because full length antibodies are glycosylated, mammalian cells, which allow human-like N-glycosylation, are currently used for their production. However, mammalian cells have several drawbacks when it comes to bioprocessing and scale-up, resulting in long processing times and elevated costs. By contrast, antibody fragments, that are not glycosylated but still exhibit antigen binding properties, can be produced in microbial organisms, which are easy to manipulate and cultivate. In this review, we summarize recent advances in the expression systems, strain engineering, and production processes for the three main microbials used in antibody and antibody fragment production, namely Saccharomyces cerevisiae, Pichia pastoris, and Escherichia coli. Copyright © 2013 Elsevier Ltd. All rights reserved.

Analytical Core Mass Function (CMF) from Filaments: Under Which Circumstances Can Filament Fragmentation Reproduce the CMF?

Energy Technology Data Exchange (ETDEWEB)

Lee, Yueh-Ning; Hennebelle, Patrick [IRFU, CEA, Université Paris-Saclay, F-91191 Gif-sur-Yvette (France); Chabrier, Gilles, E-mail: yueh-ning.lee@cea.fr [École normale supérieure de Lyon, CRAL, UMR CNRS 5574, Université de Lyon, F-69364 Lyon Cedex 07 (France)

2017-10-01

Observations suggest that star formation in filamentary molecular clouds occurs in a two-step process, with the formation of filaments preceding that of prestellar cores and stars. Here, we apply the gravoturbulent fragmentation theory of Hennebelle and Chabrier to a filamentary environment, taking into account magnetic support. We discuss the induced geometrical effect on the cores, with a transition from 3D geometry at small scales to 1D at large ones. The model predicts the fragmentation behavior of a filament for a given mass per unit length (MpL) and level of magnetization. This core mass function (CMF) for individual filaments is then convolved with the distribution of filaments to obtain the final system CMF. The model yields two major results. (i) The filamentary geometry naturally induces a hierarchical fragmentation process, first into groups of cores, separated by a length equal to a few filament Jeans lengths, i.e., a few times the filament width. These groups then fragment into individual cores. (ii) Non-magnetized filaments with high MpL are found to fragment excessively, at odds with observations. This is resolved by taking into account the magnetic field (treated simply as additional pressure support). The present theory suggests two complementary modes of star formation: although small (spherical or filamentary) structures will collapse directly into prestellar cores, according to the standard Hennebelle–Chabrier theory, the large (filamentary) ones, the dominant population according to observations, will follow the aforedescribed two-step process.

Electrospun amplified fiber optics.

Science.gov (United States)

Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

2015-03-11

All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations

OpenAIRE

MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan

2007-01-01

Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...

Analyses of Dynamics in Dairy Products and Identification of Lactic Acid Bacteria Population by Molecular Methods

Directory of Open Access Journals (Sweden)

Aytül Sofu

2017-01-01

Full Text Available Lactic acid bacteria (LAB with different ecological niches are widely seen in fermented meat, vegetables, dairy products and cereals as well as in fermented beverages. Lactic acid bacteria are the most important group of bacteria in dairy industry due to their probiotic characteristics and fermentation agents as starter culture. In the taxonomy of the lactic acid bacteria; by means of rep-PCR, which is the analysis of repetitive sequences that are based on 16S ribosomal RNA (rRNA gene sequence, it is possible to conduct structural microbial community analyses such as Restriction Fragment Length Polymorphism (RFLP analysis of DNA fragments of different sizes cut with enzymes, Random Amplified Polymorphic DNA (RAPD polymorphic DNA amplified randomly at low temperatures and Amplified Fragment-Length Polymorphism (AFLP-PCR of cut genomic DNA. Besides, in the recent years, non-culture-based molecular methods such as Pulse Field Gel Electrophoresis (PFGE, Denaturing Gradient Gel Electrophoresis (DGGE, Thermal Gradient Gel Electrophoresis (TGGE, and Fluorescence In-situ Hybridization (FISH have replaced classical methods once used for the identification of LAB. Identification of lactic acid bacteria culture independent regardless of the method will be one of the most important methods used in the future pyrosequencing as a Next Generation Sequencing (NGS techniques. This paper reviews molecular-method based studies conducted on the identification of LAB species in dairy products.

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

Science.gov (United States)

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Study of projectile fragmentation in the reaction (158 A GeV) Pb + Pb using CR-39

CERN Document Server

Qureshi, I E; Javed, M T; Manzoor, S; Sher, G; Aleem, F; Khan, H A

2005-01-01

The fragmentation of Pb ions at 158 A GeV energy produced in the interaction with Pb target has been studied using a CR-39 track detector. A stack comprising of 64 detectors was prepared such that a target of 1 cm thickness was sandwiched between the sheets of CR-39. The purpose of this exposure geometry was to calibrate CR-39 with respect to relativistic heavy ions as well as to study the fragmentation of Pb ions at 158 A GeV energy. The exposure was carried out at the SPS beam facility of CERN at normal incidence with a fluence of . Two detectors from the exposed stack have been selected for this study: one before and the other after the target material. After etching, the detectors were scanned using an optical microscope and the etched track lengths and the diameters of the track openings were measured manually. Considering that the lengths of tracks provide the best charge resolution for Z>65, we have measured track lengths for a sufficiently large number of fragments to identify individual charge states...

Phylogenic analysis in Acacia senegal using AFLP molecular ...

African Journals Online (AJOL)

Amplified fragment length polymorphism (AFLP) DNA markers were used to characterize the genetic diversity and relationships in gum Arabic tree (Acacia senegal). Twenty eight samples of Acacia senegal collected from populations distributed throughout the Gum Arabic belt were tested in comparison with samples of ...

Comparison of virulence-associated in vitro properties of typed strains of Campylobacter jejuni from different sources

DEFF Research Database (Denmark)

Coote, J.G.; Stewart-Tull, D.E.S.; Owen, R.J.

2007-01-01

mammalian cells. The results were correlated with source of isolation and genetic makeup by amplified fragment length polymorphism (AFLP) typing. The isolates had variable degrees of haemolytic activity against rabbit erythrocytes and cytotoxicity towards CaCo-2, HeLa and Vero cells. The data indicated...

Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency

NARCIS (Netherlands)

Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.

2009-01-01

Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on

Genetic characterization of three varieties of Astragalus lentiginosus (Fabaceae).

Science.gov (United States)

Brian J. Knaus; Rich C. Cronn; Aaron. Liston

2005-01-01

Astragalus lentiginosus is a polymorphic species that occurs in geologically young habitats and whose varietal circumscription implies active morphological and genetic differentiation. In this preliminary study, we evaluate the potential of amplified fragment length polymorphism (AFLP) markers to resolve infraspecific taxa in three varieties of...

library of genic multiple-allele inherited male-steri

African Journals Online (AJOL)

Administrator

2011-06-15

Jun 15, 2011 ... male sterility; AFLP, amplified fragment length polymorphism;. DDRT-PCR, differential ... production of hybrid seed (Bino, 1985). ... percentage of male-sterile plants in an ideal male-sterile .... and presence or absence of pollen, the flower buds were ..... Diurnal changes of photosynthetic and physiological.

Molecular Epidemiology of Fonsecaea Species

NARCIS (Netherlands)

Najafzadeh, M.J.; Sun, J.; Vicente, V.A.; Klaassen, C.H.W.; Bonifaz, A.; Gerrits van den Ende, A.H.G.; Menken, S.B.J.; de Hoog, G.S.

2011-01-01

To assess population diversities among 81 strains of fungi in the genus Fonsecaea that had been identified down to species level, we applied amplified fragment-length polymorphism (AFLP) technology and sequenced the internal transcribed spacer regions and the partial cell division cycle, β-tubulin,

Molecular responses and expression analysis of genes in a ...

African Journals Online (AJOL)

Haloxylon ammodendron (C.A Mey.) Bunge is a xero-halophytic desert shrub with excellent drought resistance and salt tolerance. To decipher the molecular responses involved in its drought resistance, the cDNA-AFLP (amplified fragment length polymorphism) technique was employed to identify genes expressed ...

Chip shape and secondary fragmentation through TBM excavation

International Nuclear Information System (INIS)

Tsusaka, Kimikazu; Tanimoto, Chikaosa; Ueno, Takaaki; Koizumi, Yu; Nakane, Tatsuto

2008-01-01

The chips through TBM tunneling are well-known for one of useful indices to reflect the geological conditions. The flat and elongated chips whose width are equal to the spacing of cutter trace indicate the cutting face with less joints and good practice of TBM excavation with less secondary fragmentation rate. Through a case history in granitic rock, the authors proposed the new index, which is the ratio of length of major axis to thickness. Also the authors studied the relationship between the index and the excavation efficiencies. In conclusion, it was clarified that chips with the new index over 3.5 were generally observed when a TBM drove with less than 30% the secondary fragmentation rate. (author)

KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

Directory of Open Access Journals (Sweden)

Gusti Ngurah Permana

2016-11-01

The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

International Nuclear Information System (INIS)

Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

2007-01-01

Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

Fast pulse amplifier

International Nuclear Information System (INIS)

Lepetit, J.; Poussier, E.

1984-01-01

This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

International Nuclear Information System (INIS)

Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

1987-01-01

The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

A fluidic/pneumatic interface amplifier

Science.gov (United States)

Limbert, D. E.; Kegel, T. M.

The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

Gene prediction in metagenomic fragments: A large scale machine learning approach

Directory of Open Access Journals (Sweden)

Morgenstern Burkhard

2008-04-01

Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

Amplifier for nuclear spectrometry

International Nuclear Information System (INIS)

Suarez Canner, E.

1996-01-01

The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

Semiconductor quantum-dot lasers and amplifiers

DEFF Research Database (Denmark)

Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

2002-01-01

-power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

NIF/LMJ prototype amplifier mechanical design

International Nuclear Information System (INIS)

Horvath, J.

1996-10-01

Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

Science.gov (United States)

Guo, Jiarong

2017-04-01

A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

From milk to diet: feed recognition for milk authenticity.

Science.gov (United States)

Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D

2009-11-01

The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.

A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

Directory of Open Access Journals (Sweden)

Dolores González

2012-12-01

Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

Assembly and maintenance of full scale NIF amplifiers in the amplifier module prototype laboratory (AMPLAB)

International Nuclear Information System (INIS)

Horvath, J. A.

1998-01-01

Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design

Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

NARCIS (Netherlands)

Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

NARCIS (Netherlands)

Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

2003-01-01

Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

Damage saturation effects on volume and resistivity changes induced by fission-fragment irradiation of copper

International Nuclear Information System (INIS)

Birtcher, R.C.; Blewitt, T.H.

1981-01-01

Damage production and saturation has been monitored in copper by simultaneous electrical resistivity- and length-change measurements. Damage was introduced by 235 U fission fragments at either 7 or 85 K. At both temperatures, the resistivity and length changes were linearly related to each other for resistivity changes less than 80% saturation resistivity. The linear relationship was the same for both irradiation temperatures and was the same as that observed previously for 10 B fission fragment irrations at 4 K. These results are interpreted to show that the resistivity change per defect is unaffected by irradiation under conditions which lead to interstitial clustering. (orig.)

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Analysis of DNA Cytosine Methylation Patterns Using Methylation-Sensitive Amplification Polymorphism (MSAP).

Science.gov (United States)

Guevara, María Ángeles; de María, Nuria; Sáez-Laguna, Enrique; Vélez, María Dolores; Cervera, María Teresa; Cabezas, José Antonio

2017-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is the methylation-sensitive amplified polymorphism technique (MSAP) which is a modification of amplified fragment length polymorphism (AFLP). It has been used to study methylation of anonymous CCGG sequences in different fungi, plants, and animal species. The main variation of this technique resides on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent-cutter restriction enzyme. For each sample, MSAP analysis is performed using both EcoRI/HpaII- and EcoRI/MspI-digested samples. A comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) methylation-insensitive polymorphisms that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples and (2) methylation-sensitive polymorphisms which are associated with the amplified fragments that differ in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses the modifications that can be applied to adjust the technology to different species of interest.

Molecular characterization of olive cultivars grown in Iraq using ...

African Journals Online (AJOL)

The results of this research confirmed AFLP and SSR to be useful tools in genetic relationships among olive cultivars, in creating a molecular database for Iraqi olive cultivars, in breeding strategies and in correct cultivar identification. Keywords: Olea europaea, genetic diversity, amplified fragment length polymorphism ...

Molecular fingerprinting of the Egyptian medicinal plant Cocculus ...

African Journals Online (AJOL)

Since no information about the genome of C. pendulus is available, the current study deals with molecular investigation of C. pendulus expressed by DNA fingerprinting of the young leaves of this plant using amplified fragment length polymorphism (AFLP) technique with four primer combinations. The obtained results ...

Analysis of DNA methylation variation in sibling tobacco ( Nicotiana ...

African Journals Online (AJOL)

Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) analysis were used to investigate the genome of two sibling tobacco cultivars, Yunyan85 and Yunyan87, their parent K326 and the other tobacco cultivar NC89. AFLP analysis indicated that, the genome primary ...

Genetic differentiation in Japanese flounder in the Yellow Sea and ...

African Journals Online (AJOL)

The population structure of Japanese flounder (Paralichthys olivaceus) in the Yellow and East China Seas were analyzed using amplified fragment length polymorphism (AFLP) and cytochrome c oxidase subunit I (COI) gene sequencing. A total of 390 reproducible bands were generated by 10 AFLP primer combinations in ...

Molecular and genetic study of wheat rusts | Le Maitre | African ...

African Journals Online (AJOL)

Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...

Gain claming in single-pass and double-pass L-band erbium-doped fiber amplifiers

International Nuclear Information System (INIS)

Harun, S.W.; Ahmad, H.

2004-01-01

Gain clamping is demonstrated in single-pass and double-pass long wavelength band erbium-doped fiber amplifiers. A C/L-band wavelength division multiplexing coupler is used in single-pass system to generate a laser at 1566 nm. The gain for the amplifier is clamped at 15.5 dB with gain variation of less than 0.2 dB from input signal power of -40 to -14 dBm with almost negligible noise figure penalty. However, the flatness of gain spectrum is slightly degraded due to the un-optimisation of erbium-doped fiber length. The advantage of this configuration is that the oscillating light does not appear at the output of the amplifier. A highly efficient gain-clamped long wavelength band erbium-doped fiber amplifiers with improved noise figure characteristic is demonstrated by simply adding a broadband conventional band fiber Bragg grating in double pass system. The combination of the fiber Bragg grating and optical circulator has created laser in the cavity for gain clamping. By adjusting the power combination of pumps 1 and 2, the clamped gain level can be controlled. The amplifier gain is clamped at 28.1 dB from -40 to -25 dBm with gain variation of less than 0.5 dB by setting the pumps 1 and 2 at 59.5 and 50.6 mW, respectively. The gain is also flat from 1574 nm to 1604 nm with gain variation of less than 3 dB. The corresponding noise figure varies from 5.6 to 7.6 dB, which is 0.8 to 2.6 dB reduced compared to those of unclamped amplifier (Authors)

Bunch Length Measurements using Coherent Radiation

CERN Document Server

Ischebeck, Rasmus; Barnes, Christopher; Blumenfeld, Ian; Clayton, Chris; Decker, Franz Josef; Deng, Suzhi; Hogan, Mark; Huang Cheng Kun; Iverson, Richard; Johnson, Devon K; Krejcik, Patrick; Lu, Wei; Marsh, Kenneth; Oz, Erdem; Siemann, Robert; Walz, Dieter

2005-01-01

The accelerating field that can be obtained in a beam-driven plasma wakefield accelerator depends on the current of the electron beam that excites the wake. In the E-167 experiment, a peak current above 10kA will be delivered at a particle energy of 28GeV. The bunch has a length of a few ten micrometers and several methods are used to measure its longitudinal profile. Among these, autocorrelation of coherent transition radiation (CTR) is employed. The beam passes a thin metallic foil, where it emits transition radiation. For wavelengths greater than the bunch length, this transition radiation is emitted coherently. This amplifies the long-wavelength part of the spectrum. A scanning Michelson interferometer is used to autocorrelate the CTR. However, this method requires the contribution of many bunches to build an autocorrelation trace. The measurement is influenced by the transmission characteristics of the vacuum window and beam splitter. We present here an analysis of materials, as well as possible layouts ...

European Research on THz Vacuum Amplifiers

DEFF Research Database (Denmark)

Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

2010-01-01

The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

Integrated amplifying circuit with MOS transistors

Energy Technology Data Exchange (ETDEWEB)

Baylac, B; Merckel, G; Meunier, P

1974-01-25

The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

An Efficient Genome Fragment Assembling Using GA with Neighborhood Aware Fitness Function

Directory of Open Access Journals (Sweden)

Satoko Kikuchi

2012-01-01

Full Text Available To decode a long genome sequence, shotgun sequencing is the state-of-the-art technique. It needs to properly sequence a very large number, sometimes as large as millions, of short partially readable strings (fragments. Arranging those fragments in correct sequence is known as fragment assembling, which is an NP-problem. Presently used methods require enormous computational cost. In this work, we have shown how our modified genetic algorithm (GA could solve this problem efficiently. In the proposed GA, the length of the chromosome, which represents the volume of the search space, is reduced with advancing generations, and thereby improves search efficiency. We also introduced a greedy mutation, by swapping nearby fragments using some heuristics, to improve the fitness of chromosomes. We compared results with Parsons’ algorithm which is based on GA too. We used fragments with partial reads on both sides, mimicking fragments in real genome assembling process. In Parsons’ work base-pair array of the whole fragment is known. Even then, we could obtain much better results, and we succeeded in restructuring contigs covering 100% of the genome sequences.

Electrostatic turbulence with finite parallel correlation length and radial electric field generation

International Nuclear Information System (INIS)

Vlad, M.; Spineanu, F.; Misguich, J.H.; Balescu, R.

2001-01-01

Particle diffusion in a given electrostatic turbulence with a finite correlation length along the confining magnetic field is studied in the test particle approach. An anomalous diffusion regime of amplified diffusion coefficients is found in the conditions when particle trapping in the structure of the stochastic potential is effective. The auto-generated radial electric field is calculated. (author)

Monitoring of antibiotic-induced alterations in the human intestinal microflora and detection of probiotic strains by use of terminal restriction fragment length polymorphism.

Science.gov (United States)

Jernberg, Cecilia; Sullivan, Asa; Edlund, Charlotta; Jansson, Janet K

2005-01-01

Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic.

Molecular characterization of Mycobacterium tuberculosis isolates from Tehran, Iran by restriction fragment length polymorphism analysis and spoligotyping

Directory of Open Access Journals (Sweden)

Seifu Gizaw Feyisa

2016-04-01

Full Text Available Abstract: INTRODUCTION Characterization of Mycobacterium tuberculosis (MTB isolates by DNA fingerprinting has contributed to tuberculosis (TB control. The aim of this study was to determine the genetic diversity of MTB isolates from Tehran province in Iran. METHODS MTB isolates from 60 Iranian and 10 Afghan TB patients were fingerprinted by standard IS6110-restriction fragment length polymorphism (RFLP analysis and spoligotyping. RESULTS The copy number of IS6110 ranged from 10-24 per isolate. The isolates were classified into 22 clusters showing ≥ 80% similarity by RFLP analysis. Fourteen multidrug-resistant (MDR isolates were grouped into 4 IS6110-RFLP clusters, with 10 isolates [71% (95% CI: 45-89%] in 1 cluster, suggesting a possible epidemiological linkage. Eighteen Iranian isolates showed ≥ 80% similarity with Afghan isolates. There were no strains with identical fingerprints. Spoligotyping of 70 isolates produced 23 distinct patterns. Sixty (85.7% isolates were grouped into 13 clusters, while the remaining 10 isolates (14.2% were not clustered. Ural (formerly Haarlem4 (n = 22, 31.4% was the most common family followed by Central Asian strain (CAS (n = 18, 25.7% and T (n = 9, 12.8% families. Only 1strain was characterized as having the Beijing genotype. Among 60 Iranian and 10 Afghan MTB isolates, 25% (95% CI: 16-37 and 70% (95% CI: 39-89 were categorized as Ural lineage, respectively. CONCLUSIONS A higher prevalence of Ural family MTB isolates among Afghan patients than among Iranian patients suggests the possible transmission of this lineage following the immigration of Afghans to Iran.

A flexible receiver with fiber optical parametric amplifier in OCDMA-FSO communication system

Science.gov (United States)

Xia, Min; Yuan, Jin-hui; Sang, Xin-zhu; Yin, Xiao-li; Rao, Lan; Yu, Chong-xiu

2014-11-01

A new receiver is proposed, which uses the fiber optical parametric amplifier (FOPA) in optical code division multiple access (OCDMA) over free space optic (FSO) communication system. The noise tolerance as the performance index in this receiver is derived. The receiver can not only improve the noise tolerance but also change the pump data conveniently for adapting to the length variation of the coding sequence under a complex and fast-changing weather condition. The influence of different factors on the noise tolerance is analyzed, and a significant improvement of about 18.77 dB for the noise tolerance can be achieved when the pump power and the length of coding sequence are 5 W and 256, respectively.

Quantum dots for lasers, amplifiers and computing

International Nuclear Information System (INIS)

Bimberg, Dieter

2005-01-01

For InAs-GaAs based quantum dot lasers emitting at 1300 nm, digital modulation showing an open eye pattern up to 12 Gb s -1 at room temperature is demonstrated, at 10 Gb s -1 the bit error rate is below 10 -12 at -2 dB m receiver power. Cut-off frequencies up to 20 GHz are realised for lasers emitting at 1.1 μm. Passively mode-locked QD lasers generate optical pulses with repetition frequencies between 5 and 50 GHz, with a minimum Fourier limited pulse length of 3 ps. The uncorrelated jitter is below 1 ps. We use here deeply etched narrow ridge waveguide structures which show excellent performance similar to shallow mesa structures, but a circular far field at a ridge width of 1 μm, improving coupling efficiency into fibres. No beam filamentation of the fundamental mode, low a-factors and strongly reduced sensitivity to optical feedback are observed. QD lasers are thus superior to QW lasers for any system or network. Quantum dot semiconductor optical amplifier (QD SOAs) demonstrate gain recovery times of 120-140 fs, 4-7 times faster than bulk/QW SOAs, and a net gain larger than 0.4 dB/(mm*QD-layer) providing us with novel types of booster amplifiers and Mach-Zehnder interferometers. These breakthroughs became possible due to systematic development of self-organized growth technologies

Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

NARCIS (Netherlands)

Acar, M.

2011-01-01

In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

Enhanced performance CCD output amplifier

Science.gov (United States)

Dunham, Mark E.; Morley, David W.

1996-01-01

A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

Molecular phylogeny of Fusarium species by AFLP fingerprint ...

African Journals Online (AJOL)

The high-resolution genotyping method of amplified fragment length polymorphism (AFLP) analysis was used to study the genetic relationships within and between natural populations of five Fusarium spp. AFLP templates were prepared by the digestion of Fusarium DNA with EcoRI and MseI restriction endonucleases and ...

Linkage mapping of a dominant male sterility gene Ms-cd1 in Brassica oleracea

NARCIS (Netherlands)

Wang, X.; Lou, P.; Bonnema, A.B.; Yang, Boujun; He, H.; Zhang, Y.; Fang, Z.

2005-01-01

The dominant male sterility gene Ms-cd1 (c, cabbage; d, dominant) was identified as a spontaneous mutation in the spring cabbage line 79-399-3. The Ms-cd1 gene is successfully applied in hybrid seed production of several Brassica oleracea cultivars in China. Amplified fragment length polymorphism

Genetic and phylogenetic analysis of ten Gobiidae species in China ...

African Journals Online (AJOL)

To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...

Genetic diversity analysis and conservation of the Chinese herb ...

African Journals Online (AJOL)

STORAGESEVER

2009-10-05

Oct 5, 2009 ... Salvia miltiorrhiza is an economically important floral herb. However, little work has been conducted to further our understanding of the genetics of this herb. In this study, a representative set of germplasm of. S. miltiorrhiza populations was used to analyze genetic diversity using amplified fragment length.

Yam ( Dioscorea spp.) molecular breeding

African Journals Online (AJOL)

Some progress has been made in recent years in germplasm characterization and the development of molecular markers for genome analysis. A genetic linkage map based on amplified fragment length polymorphism (AFLP) markers has been constructed for Guinea and water yams. These linkage maps were used to scan ...

Genetic diversity analysis and conservation of the Chinese herb ...

African Journals Online (AJOL)

Salvia miltiorrhiza is an economically important floral herb. However, little work has been conducted to further our understanding of the genetics of this herb. In this study, a representative set of germplasm of. S. miltiorrhiza populations was used to analyze genetic diversity using amplified fragment length polymorphism ...

Use of DNA markers in forest tree improvement research

Science.gov (United States)

D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

1992-01-01

DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

Molecular survey of the Texas Phoenix decline phytoplasma ...

African Journals Online (AJOL)

user

Restriction fragment length polymorphisms (RFLP) analysis of the PCR-amplified 16S-23S IGS region and the gcp gene using a three restriction enzymes showed that the population of the phytoplasmas infecting S. palmetto in West Central Florida is probably homogenous. The S. palmetto phytoplasma also appeared ...

A comparative genetic diversity analysis in mungbean ( Vigna ...

African Journals Online (AJOL)

Amplified fragment length polymorphism (AFLP) and inter-simple sequence repeat (ISSR) markers were used to study the DNA polymorphism in elite mungbean genotypes. A total of nine AFLP primer combination and 22 ISSR primers were used. Amplification of genomic DNA of the 30 genotypes, using AFLP analysis, ...

Multimegawatt relativistic harmonic gyrotron traveling-wave tube amplifier experiments

International Nuclear Information System (INIS)

Menninger, W.L.; Danly, B.G.; Temkin, R.J.

1996-01-01

The first multimegawatt harmonic relativistic gyrotron traveling-wave tube (gyro-twt) amplifier experiment has been designed, built, and tested. Results from this experimental setup, including the first ever reported third-harmonic gyro-twt results, are presented. Operation frequency is 17.1 GHz. Detailed phase measurements are also presented. The electron beam source is SNOMAD-II, a solid-state nonlinear magnetic accelerator driver with nominal parameters of 400 kV and 350 A. The flat-top pulsewidth is 30 ns. The electron beam is focused using a Pierce geometry and then imparted with transverse momentum using a bifilar helical wiggler magnet. Experimental operation involving both a second-harmonic interaction with the TE 21 mode and a third-harmonic interaction with the TE 31 mode, both at 17 GHz, has been characterized. The third-harmonic interaction resulted in 4-MW output power and 50-dB single-pass gain, with an efficiency of up to ∼8%. The best measured phase stability of the TE 31 amplified pulse was ±10 degree over a 9-ns period. The phase stability was limited because the maximum RF power was attained when operating far from wiggler resonance. The second harmonic, TE 21 had a peak amplified power of 2 MW corresponding to 40-dB single-pass gain and 4% efficiency. The second-harmonic interaction showed stronger superradiant emission than the third-harmonic interaction. Characterizations of the second- and third-harmonic gyro-twt experiments presented here include measurement of far-field radiation patterns, gain and phase versus interaction length, phase stability, and output power versus input power

M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

Directory of Open Access Journals (Sweden)

Good Michael F

2005-10-01

Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

Science.gov (United States)

1988-01-01

A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

Polymer-Optical-Fiber Lasers and Amplifiers Doped with Organic Dyes

Directory of Open Access Journals (Sweden)

Joseba Zubia

2011-07-01

Full Text Available Polymer optical fibers (POFs doped with organic dyes can be used to make efficient lasers and amplifiers due to the high gains achievable in short distances. This paper analyzes the peculiarities of light amplification in POFs through some experimental data and a computational model capable of carrying out both power and spectral analyses. We investigate the emission spectral shifts and widths and on the optimum signal wavelength and pump power as functions of the fiber length, the fiber numerical aperture and the radial distribution of the dopant. Analyses for both step-index and graded-index POFs have been done.

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Fragmentation patterns of evergreen oak woodlands in Southwestern Iberia: identifying key spatial indicators.

Science.gov (United States)

Costa, Augusta; Madeira, Manuel; Lima Santos, José; Plieninger, Tobias; Seixas, Júlia

2014-01-15

Mediterranean evergreen oak woodlands (composed of Quercus suber L. and Quercus rotundifolia Lam.) are becoming increasingly fragmented in the human-modified landscapes of Southwestern Portugal and Spain. Previous studies have largely neglected to assess the spatial changes of oak woodlands in relation to their surrounding landscape matrix, and to characterize and quantify woodland boundaries and edges. The present study aims to fill this gap by analyzing fragmentation patterns of oak woodlands over a 50-year period (1958-2007) in three landscapes. Using archived aerial imagery from 1958, 1995 and 2007, for two consecutive periods (1958-1995 and 1995-2007), we calculated a set of landscape metrics to compare woodland fragmentation over time. Our results indicated a continuous woodland fragmentation characterized by their edge dynamics. From 1958 to 2007, the replacement of open farmland by shrubland and by new afforestation areas in the oak woodland landscape surrounding matrix, led to the highest values for edge contrast length trends of 5.0 and 12.3, respectively. Linear discriminant analysis was performed to delineate fragmented woodland structures and identify metric variables that characterize woodland spatial configuration. The edge contrast length with open farmland showed a strong correlation with F1 (correlations ranging between 0.55 and 0.98) and may be used as a proxy for oak woodland mixedness in landscape matrix. The edge dynamics of oak woodlands may result in different patterns of oak recruitment and therefore, its study may be helpful in highlighting future baselines for the sustainable management of oak woodlands. Copyright © 2013 Elsevier Ltd. All rights reserved.

Fragmentation Energy-Saving Theory of Full Face Rock Tunnel Boring Machine Disc Cutters

Science.gov (United States)

Zhang, Zhao-Huang; Gong, Guo-Fang; Gao, Qing-Feng; Sun, Fei

2017-07-01

Attempts to minimize energy consumption of a tunnel boring machine disc cutter during the process of fragmentation have largely focused on optimizing disc-cutter spacing, as determined by the minimum specific energy required for fragmentation; however, indentation tests showed that rock deforms plastically beneath the cutters. Equations for thrust were developed for both the traditional, popularly employed disc cutter and anew design based on three-dimensional theory. The respective energy consumption for penetration, rolling, and side-slip fragmentations were obtained. A change in disc-cutter fragmentation angles resulted in a change in the nature of the interaction between the cutter and rock, which lowered the specific energy of fragmentation. During actual field excavations to the same penetration length, the combined energy consumption for fragmentation using the newly designed cutters was 15% lower than that when using the traditional design. This paper presents a theory for energy saving in tunnel boring machines. Investigation results showed that the disc cutters designed using this theory were more durable than traditional designs, and effectively lowered the energy consumption.

Final amplifier design and mercury

International Nuclear Information System (INIS)

Rose, E.A.; Hanson, D.E.

1991-01-01

The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

A pulse amplifier for nuclear instrumentation

International Nuclear Information System (INIS)

Martin, D.; Cliff, P.

1987-01-01

A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM

Inter simple sequence repeat (ISSR) analysis of Ethiopian white ...

African Journals Online (AJOL)

Oumer

2015-05-06

May 6, 2015 ... flowers are quite distinctive and mainly self-pollinating but can be occasionally ... AFLP, amplified fragment length polymorphism. Author(s) agree that this ... Lupine plants growing on an individual farmers plot of land were considered as ..... PROTA (plant resources of tropical Africa /ressourcesvégétales de.

Genetic characterization of two traditional leafy vegetables ...

African Journals Online (AJOL)

Genetic characterization of two traditional leafy vegetables (Sesamum radiatum Thonn. ex Hornem and Ceratotheca sesamoides Endl.) of Benin, using flow cytometry and amplified fragment length polymorphism (AFLP) markers. K Adéoti, A Rival, A Dansi, S Santoni, S Brown, T Beule, A Nato, Y Henry, R Vodouhe, L Loko, ...

Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

DEFF Research Database (Denmark)

Kastern, W.; Dyrberg, T.; Scholler, J.

1984-01-01

DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

An Implantable CMOS Amplifier for Nerve Signals

DEFF Research Database (Denmark)

Nielsen, Jannik Hammel; Lehmann, Torsten

2003-01-01

In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

Directory of Open Access Journals (Sweden)

Tatsuya Ishikawa

2017-06-01

Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

Fast logarithmic amplifier

International Nuclear Information System (INIS)

Tai, I.; Hasegawa, K.

1975-01-01

This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)

Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area.

Directory of Open Access Journals (Sweden)

Zeyan Wu

Full Text Available Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF, coniferous forest (CF, subalpine dwarf forest (SDF and alpine meadow (AM were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC, total nitrogen (TN, total phosphorus (TP and total potassium (TK were positively correlated with the diversity of bacterial communities.

Flashlamp excited fluid laser amplified

International Nuclear Information System (INIS)

1976-01-01

The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation

The grain-size distribution of pyroclasts: Primary fragmentation, conduit sorting or abrasion?

Science.gov (United States)

Kueppers, U.; Schauroth, J.; Taddeucci, J.

2013-12-01

Explosive volcanic eruptions expel a mixture of pyroclasts and lithics. Pyroclasts, fragments of the juvenile magma, record the state of the magma at fragmentation in terms of porosity and crystallinity. The grain size distribution of pyroclasts is generally considered to be a direct consequence of the conditions at magma fragmentation that is mainly driven by gas overpressure in bubbles, high shear rates, contact with external water or a combination of these factors. Stress exerted by any of these processes will lead to brittle fragmentation by overcoming the magma's relaxation timescale. As a consequence, most pyroclasts exhibit angular shapes. Upon magma fragmentation, the gas pyroclast mixture is accelerated upwards and eventually ejected from the vent. The total grain size distribution deposited is a function of fragmentation conditions and transport related sorting. Porous pyroclasts are very susceptible to abrasion by particle-particle or particle-conduit wall interaction. Accordingly, pyroclastic fall deposits with angular clasts should proof a low particle abrasion upon contact to other surfaces. In an attempt to constrain the degree of particle interaction during conduit flow, monomodal batches of washed pyroclasts have been accelerated upwards by rapid decompression and subsequently investigated for their grain size distribution. In our set-up, we used a vertical cylindrical tube without surface roughness as conduit. We varied grain size (0.125-0.25; 0.5-1; 1-2 mm), porosity (0; 10; 30 %), gas-particle ratio (10 and 40%), conduit length (10 and 28 cm) and conduit diameter (2.5 and 6 cm). All ejected particles were collected after settling at the base of a 3.3 m high tank and sieved at one sieve size below starting size (half-Φ). Grain size reduction showed a positive correlation with starting grain size, porosity and overpressure at the vent. Although milling in a volcanic conduit may take place, porous pyroclasts are very likely to be a primary product

Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module

NARCIS (Netherlands)

Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.

2002-01-01

This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described

Influence of core NA on thermal-induced mode instabilities in high power fiber amplifiers

International Nuclear Information System (INIS)

Tao, Rumao; Ma, Pengfei; Wang, Xiaolin; Zhou, Pu; Liu, Zejin

2015-01-01

We report on the influence of core NA on thermal-induced mode instabilities (MI) in high power fiber amplifiers. The influence of core NA and the V-parameter on MI has been investigated numerically. It shows that core NA has a larger influence on MI for fibers with a smaller core-cladding-ratio, and the influence of core NA on the threshold is more obvious when the amplifiers are pumped at 915 nm. The dependence of the threshold on the V-parameter revealed that the threshold increases linearly as the V-parameter decreases when the V-parameter is larger than 3.5, and the threshold shows an exponential increase as the V-parameter decreases when the V-parameter is less than 3.5. We also discussed the effect of linewidth on MI, which indicates that the influence of linewidth can be neglected for a linewidth smaller than 1 nm when the fiber core NA is smaller than 0.07 and the fiber length is shorter than 20 m. Fiber amplifiers with different core NA were experimentally analyzed, which agreed with the theoretical predictions. (letter)

Challenges in higher order mode Raman amplifiers

DEFF Research Database (Denmark)

Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

2015-01-01

A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

S-band low noise amplifier and 40 kW high power amplifier subsystems of Japanese Deep Space Earth Station

Science.gov (United States)

Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.

This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.

Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

Directory of Open Access Journals (Sweden)

Roberto A. Caffaro-Filho

2007-12-01

Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

Small signal microwave amplifier design

CERN Document Server

Grosch, Theodore

2000-01-01

This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

Science.gov (United States)

Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

2015-03-01

DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

Genetic diversity and structure of western white pine (Pinus monticola) in North America: A baseline study for conservation, restoration, and addressing impacts of climate change

Science.gov (United States)

Mee-Sook Kim; Bryce A. Richardson; Geral I. McDonald; Ned B. Klopfenstein

2010-01-01

Western white pine (Pinus monticola) is an economically and ecologically important species in western North America that has declined in prominence over the past several decades, mainly due to the introduction of Cronartium ribicola (cause of white pine blister rust) and reduced opportunities for regeneration. Amplified fragment length polymorphism (AFLP) markers were...

A specific PCR-assay for resistance to Biotypes 1 and 2 of the rosy leaf curling aphid in apple based on an RFLP marker closely linked to the Sd1 gene

NARCIS (Netherlands)

Roche, P.; Arkel, van G.; Heusden, van A.W.

1997-01-01

This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this

Assessment of genetic diversity among accessions of two traditional ...

African Journals Online (AJOL)

Assessment of genetic diversity among accessions of two traditional leafy vegetables (Acmella uliginosa (L.) and Justicia tenella (Nees) T.) consumed in Benin using amplified fragment length polymorphism (AFLP) markers. K Adéoti, A Rival, A Dansi, BS Ahohuendo, S Santoni, T Beule, A Nato, Y Henry, A Ahanchédé, ...

Noise in Optical Amplifiers

DEFF Research Database (Denmark)

Jeppesen, Palle

1997-01-01

Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

International Nuclear Information System (INIS)

Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

2017-01-01

The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

Amplified spontaneous emissions in a high-gain laser amplifier

International Nuclear Information System (INIS)

Osada, Hidenori; Gamo, Hideya.

1978-01-01

The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, T V; Madsen, H O; Morling, N

1992-01-01

endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

Dual-range linearized transimpedance amplifier system

Science.gov (United States)

Wessendorf, Kurt O.

2010-11-02

A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

Detection of Non-Amplified Genomic DNA

CERN Document Server

Corradini, Roberto

2012-01-01

This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

A reflexing electron microwave amplifier for rf particle accelerator applications

International Nuclear Information System (INIS)

Fazio, M.V.; Hoeberling, R.F.

1988-01-01

The evolution of rf-accelerator technology toward high-power, high-current, low-emittance beams produces an ever-increasing demand for efficient, very high power microwave power sources. The present klystron technology has performed very well but is not expected to produce reliable gigawatt peak-power units in the 1- to 10-GHz regime. Further major advancements must involve other types of sources. The reflexing-electron class of sources can produce microwave powers at the gigawatt level and has demonstrated operation from 800-MHz to 40-GHz. The pulse length appears to be limited by diode closure, and reflexing-electron devices have been operated in a repetitively pulsed mode. A design is presented for a reflexing electron microwave amplifier that is frequency and phase locked. In this design, the generated microwave power can be efficiently coupled to one or several accelerator loads. Frequency and phase-locking capability may permit parallel-source operation for higher power. The low-frequency (500-MHz to 10-GHz) operation at very high power required by present and proposed microwave particle accelerators makes an amplifier, based on reflexing electron phenomena, a candidate for the development of new accelerator power sources. (author)

Is there a role for amplifiers in sexual selection?

Science.gov (United States)

Gualla, Filippo; Cermelli, Paolo; Castellano, Sergio

2008-05-21

The amplifier hypothesis states that selection could favour the evolution of traits in signallers that improve the ability of receivers to extract honest information from other signals or cues. We provide a formal definition of amplifiers based on the receiver's mechanisms of signal perception and we present a game-theoretical model in which males advertise their quality and females use sequential-sampling tactics to choose among prospective mates. The main effect of an amplifier on the female mating strategy is to increase her mating threshold, making the female more selective as the effectiveness of the amplifier increases. The effects of the amplifier on male advertising strategy depends both on the context and on the types of the amplifier involved. We consider two different contexts for the evolution of amplifiers (when the effect of amplifiers is on signals and when it is on cues) and two types of amplifiers (the 'neutral amplifier', when it improves quality assessment without altering male attractiveness, and the 'attractive amplifier', when it improves both quality assessment and male attractiveness). The game-theoretical model provides two main results. First, neutral and attractive amplifiers represent, respectively, a conditional and an unconditional signalling strategy. In fact, at the equilibrium, neutral amplifiers are displayed only by males whose advertising level lays above the female acceptance threshold, whereas attractive amplifiers are displayed by all signalling males, independent of their quality. Second, amplifiers of signals increase the differences in advertising levels between amplifying and not-amplifying males, but they decrease the differences within each group, so that the system converges towards an 'all-or-nothing' signalling strategy. By applying concepts from information theory, we show that the increase in information transfer at the perception level due to the amplifier of signals is contrasted by a decrease in information

An Implantable CMOS Amplifier for Nerve Signals

DEFF Research Database (Denmark)

Nielsen, Jannik Hammel; Lehmann, Torsten

2001-01-01

In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...

Operational amplifiers theory and design

CERN Document Server

Huijsing, Johan

2017-01-01

This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

Use of AFLP marker system on sugarcane somaclones to study their resistance to rust

OpenAIRE

María Ileana Oloriz; Luis Rojas; Víctor Gil; Milady Mendoza; Ariel Arencibia; Elva Rosa Carmona; Elio Jiménez

2002-01-01

AFLPs (amplified fragment length polymorphism) was carried out from genomic DNA of five rust resistant sugar cane somaclons and their susceptible donor, Saccharum officinarum var B 4362, using three combinations of primers (EcoRI/aca: MseI/acc; EcoRI/aca: MseI/atg and EcoRI/aca: MseI/agg). Six polymorphic bands were obtained, two of these only appeared in the resistant genotypes, which are probably DNA sequences, related to rust resistance locus. These fragments have been cloned to study thei...

Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

NARCIS (Netherlands)

Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

2005-01-01

Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

Design and length optimization of an adiabatic coupler for on-chip vertical integration of rare-earth-doped double tungstate waveguide amplifiers

NARCIS (Netherlands)

Mu, Jinfeng; Sefünç, Mustafa; García Blanco, Sonia Maria

2014-01-01

The integration of rare-earth doped double tungstate waveguide amplifiers onto passive technology platforms enables the on-chip amplification of very high bit rate signals. In this work, a methodology for the optimized design of vertical adiabatic couplers between a passive Si3N4 waveguide and the

Applicability of SCAR markers to food genomics: olive oil traceability.

Science.gov (United States)

Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson

2007-07-25

DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.

Phase noise in RF and microwave amplifiers.

Science.gov (United States)

Boudot, Rodolphe; Rubiola, Enrico

2012-12-01

Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and

Non-ideal magnetohydrodynamic simulations of the two-stage fragmentation model for cluster formation

International Nuclear Information System (INIS)

Bailey, Nicole D.; Basu, Shantanu

2014-01-01

We model molecular cloud fragmentation with thin-disk, non-ideal magnetohydrodynamic simulations that include ambipolar diffusion and partial ionization that transitions from primarily ultraviolet-dominated to cosmic-ray-dominated regimes. These simulations are used to determine the conditions required for star clusters to form through a two-stage fragmentation scenario. Recent linear analyses have shown that the fragmentation length scales and timescales can undergo a dramatic drop across the column density boundary that separates the ultraviolet- and cosmic-ray-dominated ionization regimes. As found in earlier studies, the absence of an ionization drop and regular perturbations leads to a single-stage fragmentation on pc scales in transcritical clouds, so that the nonlinear evolution yields the same fragment sizes as predicted by linear theory. However, we find that a combination of initial transcritical mass-to-flux ratio, evolution through a column density regime in which the ionization drop takes place, and regular small perturbations to the mass-to-flux ratio is sufficient to cause a second stage of fragmentation during the nonlinear evolution. Cores of size ∼0.1 pc are formed within an initial fragment of ∼pc size. Regular perturbations to the mass-to-flux ratio also accelerate the onset of runaway collapse.

Enhanced Gain in Photonic Crystal Amplifiers

DEFF Research Database (Denmark)

Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

2012-01-01

We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....

Compact Aberration-Free Relay-Imaging Multi-Pass Layouts for High-Energy Laser Amplifiers

Directory of Open Access Journals (Sweden)

Jörg Körner

2016-11-01

Full Text Available We present the results from a theoretical investigation of laser beam propagation in relay imaging multi-pass layouts, which recently found application in high-energy laser amplifiers. Using a method based on the well-known ABCD-matrix formalism and proven by ray tracing, it was possible to derive a categorization of such systems. Furthermore, basic rules for the setup of such systems and the compensation for low order aberrations are derived. Due to the introduced generalization and parametrization, the presented results can immediately be applied to any system of the investigated kinds for a wide range of parameters, such as number of round-trips, focal lengths and optics sizes. It is shown that appropriate setups allow a close-to-perfect compensation of defocus caused by a thermal lens and astigmatism caused by non-normal incidence on the imaging optics, as well. Both are important to avoid intensity spikes leading to damages of optics in multi-pass laser amplifiers.

GENETIC DIVERSITY OF VIBRIO CHOLERAE IN CHESAPEAKE BAY DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

Science.gov (United States)

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

OpenAIRE

Emma Suryati; Lida Puspaningtyas; Utut Widyastuti; Suharsono Suharsono

2013-01-01

Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Ba...

Signal and noise analysis of a-Si:H radiation detector-amplifier system

International Nuclear Information System (INIS)

Cho, Gyuseong.

1992-03-01

Hydrogenated amorphous silicon (a-Si:H) has potential advantages in making radiation detectors for many applications because of its deposition capability on a large-area substrate and its high radiation resistance. Position-sensitive radiation detectors can be made out of a 1d strip or a 2-d pixel array of a Si:H pin diodes. In addition, signal processing electronics can be made by thin-film transistors on the same substrate. The calculated radiation signal, based on a simple charge collection model agreed well with results from various wave length light sources and 1 MeV beta particles on sample diodes. The total noise of the detection system was analyzed into (a) shot noise and (b) 1/f noise from a detector diode, and (c) thermal noise and (d) 1/f noise from the frontend TFT of a charge-sensitive preamplifier. the effective noise charge calculated by convoluting these noise power spectra with the transfer function of a CR-RC shaping amplifier showed a good agreement with the direct measurements of noise charge. The derived equations of signal and noise charge can be used to design an a-Si:H pixel detector amplifier system optimally. Signals from a pixel can be readout using switching TFTs, or diodes. Prototype tests of a double-diode readout scheme showed that the storage time and the readout time are limited by the resistances of the reverse-biased pixel diode and the forward biased switching diodes respectively. A prototype charge-sensitive amplifier was made using poly-Si TFTs to test the feasibility of making pixel-level amplifiers which would be required in small-signal detection. The measured overall gain-bandwidth product was ∼400 MHz and the noise charge ∼1000 electrons at a 1 μsec shaping time. When the amplifier is connected to a pixel detector of capacitance 0.2 pF, it would give a charge-to-voltage gain of ∼0.02 mV/electron with a pulse rise time less than 100 nsec and a dynamic range of 48 dB

Signal and noise analysis of a-Si:H radiation detector-amplifier system

Energy Technology Data Exchange (ETDEWEB)

Cho, Gyuseong [Univ. of California, Berkeley, CA (United States)

1992-03-01

Hydrogenated amorphous silicon (a-Si:H) has potential advantages in making radiation detectors for many applications because of its deposition capability on a large-area substrate and its high radiation resistance. Position-sensitive radiation detectors can be made out of a 1d strip or a 2-d pixel array of a Si:H pin diodes. In addition, signal processing electronics can be made by thin-film transistors on the same substrate. The calculated radiation signal, based on a simple charge collection model agreed well with results from various wave length light sources and 1 MeV beta particles on sample diodes. The total noise of the detection system was analyzed into (a) shot noise and (b) 1/f noise from a detector diode, and (c) thermal noise and (d) 1/f noise from the frontend TFT of a charge-sensitive preamplifier. the effective noise charge calculated by convoluting these noise power spectra with the transfer function of a CR-RC shaping amplifier showed a good agreement with the direct measurements of noise charge. The derived equations of signal and noise charge can be used to design an a-Si:H pixel detector amplifier system optimally. Signals from a pixel can be readout using switching TFTs, or diodes. Prototype tests of a double-diode readout scheme showed that the storage time and the readout time are limited by the resistances of the reverse-biased pixel diode and the forward biased switching diodes respectively. A prototype charge-sensitive amplifier was made using poly-Si TFTs to test the feasibility of making pixel-level amplifiers which would be required in small-signal detection. The measured overall gain-bandwidth product was ~400 MHz and the noise charge ~1000 electrons at a 1 μsec shaping time. When the amplifier is connected to a pixel detector of capacitance 0.2 pF, it would give a charge-to-voltage gain of ~0.02 mV/electron with a pulse rise time less than 100 nsec and a dynamic range of 48 dB.

Signal and noise analysis of a-Si:H radiation detector-amplifier system

Energy Technology Data Exchange (ETDEWEB)

Cho, Gyuseong.

1992-03-01

Hydrogenated amorphous silicon (a-Si:H) has potential advantages in making radiation detectors for many applications because of its deposition capability on a large-area substrate and its high radiation resistance. Position-sensitive radiation detectors can be made out of a 1d strip or a 2-d pixel array of a Si:H pin diodes. In addition, signal processing electronics can be made by thin-film transistors on the same substrate. The calculated radiation signal, based on a simple charge collection model agreed well with results from various wave length light sources and 1 MeV beta particles on sample diodes. The total noise of the detection system was analyzed into (a) shot noise and (b) 1/f noise from a detector diode, and (c) thermal noise and (d) 1/f noise from the frontend TFT of a charge-sensitive preamplifier. the effective noise charge calculated by convoluting these noise power spectra with the transfer function of a CR-RC shaping amplifier showed a good agreement with the direct measurements of noise charge. The derived equations of signal and noise charge can be used to design an a-Si:H pixel detector amplifier system optimally. Signals from a pixel can be readout using switching TFTs, or diodes. Prototype tests of a double-diode readout scheme showed that the storage time and the readout time are limited by the resistances of the reverse-biased pixel diode and the forward biased switching diodes respectively. A prototype charge-sensitive amplifier was made using poly-Si TFTs to test the feasibility of making pixel-level amplifiers which would be required in small-signal detection. The measured overall gain-bandwidth product was {approximately}400 MHz and the noise charge {approximately}1000 electrons at a 1 {mu}sec shaping time. When the amplifier is connected to a pixel detector of capacitance 0.2 pF, it would give a charge-to-voltage gain of {approximately}0.02 mV/electron with a pulse rise time less than 100 nsec and a dynamic range of 48 dB.

A system for biasing a differential amplifier

International Nuclear Information System (INIS)

Barbier, Daniel; Ittel, J.M.; Poujois, Robert

1975-01-01

This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

Diversification in continental island archipelagos: new evidence on the roles of fragmentation, colonization and gene flow on the genetic divergence of Aegean Nigella (Ranunculaceae).

Science.gov (United States)

Jaros, Ursula; Tribsch, Andreas; Comes, Hans Peter

2018-02-12

Disentangling the relative roles of past fragmentation (vicariance), colonization (dispersal) and post-divergence gene flow in the genetic divergence of continental island organisms remains a formidable challenge. Amplified fragment length polymorphisms (AFLPs) were used to (1) gain further insights into the biogeographical processes underlying the Pleistocene diversification of the Aegean Nigella arvensis complex; (2) evaluate the role of potential key factors driving patterns of population genetic variability (mating system, geographical isolation and historical contingencies); and (3) test the robustness of conclusions previously drawn from chloroplast (cp) DNA. Genetic diversity was analysed for 235 AFLP markers from 48 populations (497 individuals) representing 11 taxa of the complex using population genetic methods and Bayesian assignment tests. Most designated taxa are identifiable as genetically distinct units. Both fragmentation and dispersal-driven diversification processes occurred at different geological time scales, from Early to Late Pleistocene, specifically (1) sea barrier-induced vicariant speciation in the Cyclades, the Western Cretan Strait and Ikaria; and (2) bi-regional colonizations of the 'Southern Aegean Island Arc' from the Western vs. Eastern Aegean mainland, followed by allopatric divergences in Crete vs. Rhodos and Karpathos/Kasos. Outcrossing island taxa experienced drift-related demographic processes that are magnified in the two insular selfing species. Population genetic differentiation on the mainland seems largely driven by dispersal limitation, while in the Central Aegean it may still be influenced by historical events (island fragmentation and sporadic long-distance colonization). The biogeographical history of Aegean Nigella is more complex than expected for a strictly allopatric vicariant model of divergence. Nonetheless, the major phylogeographical boundaries of this radiation are largely congruent with the geography and

Genetic relationships among Arachis species based on AFLP

Directory of Open Access Journals (Sweden)

Gimenes Marcos A.

2002-01-01

Full Text Available Amplified Fragment Length Polymorphism (AFLP was used to establish the genetic relationships among 20 species from seven of the nine sections of genus Arachis. The level of polymorphism among nine accessions of the cultivated peanut, A. hypogaea L., was also evaluated. Three combinations of primers were used to amplify the AFLPs. The fragments were separated in 6% denaturing acrylamide gels. A total of 408 fragments were analyzed. An average of 135.3 fragments per primer combination were scored, and the largest number of fragments was 169 using primer combination Eco RI - ACC / Mse I - CTG, while the lowest was 108, with Eco RI - ACT / Mse I - CTT. In general, the genetic relationships established using AFLPs agreed with the classification established using morphology and crossability data. The results indicated that AFLPs are good markers for establishing the relationships among Arachis species. The polymorphism detected in A. hypogaea by this method was higher than the one found with other markers, like RAPDs and RFLPs. However, our data suggest that the polymorphism detected be using AFLP with only three primer combinations is still too low to be used for any kind of genetic study in this species.

PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products

Directory of Open Access Journals (Sweden)

Y. Erwanto

2011-04-01

Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Mojibake - The rehearsal of word fragments in verbal recall.

Science.gov (United States)

Lange-Küttner, Christiane; Sykorova, Eva

2015-01-01

Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the 'grain size' of word units (Ziegler and Goswami, 2005). In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF) English words versus geographical (UK) town names to control for content. We also tested unfamiliar international (INT) non-words and names of international (INT) European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words.

Solid-state disk amplifiers for fusion-laser systems

Energy Technology Data Exchange (ETDEWEB)

Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.

1981-09-01

We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.

Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations

Directory of Open Access Journals (Sweden)

DiaS Edelberto S.

1998-01-01

Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.

DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

DEFF Research Database (Denmark)

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

Stroma-induced Jagged1 expression drives PC3 prostate cancer cell migration; disparate effects of RIP-generated proteolytic fragments on cell behaviour and Notch signaling

Energy Technology Data Exchange (ETDEWEB)

Delury, Craig, E-mail: c.delury@lancaster.ac.uk [Division of Biomedical and Life Sciences, Faculty of Health and Medicine, Lancaster University, Lancaster, LA1 4YQ (United Kingdom); Hart, Claire, E-mail: claire.hart@manchester.ac.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Brown, Mick, E-mail: michael.brown@ics.manchester.ac.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Clarke, Noel, E-mail: noel.clarke@christie.nhs.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Parkin, Edward, E-mail: e.parkin@lancaster.ac.uk [Division of Biomedical and Life Sciences, Faculty of Health and Medicine, Lancaster University, Lancaster, LA1 4YQ (United Kingdom)

2016-03-25

The Notch ligand Jagged1 is subject to regulated intramembrane proteolysis (RIP) which yields a soluble ectodomain (sJag) and a soluble Jagged1 intracellular domain (JICD). The full-length Jagged1 protein enhances prostate cancer (PCa) cell proliferation and is highly expressed in metastatic cells. However, little is known regarding the mechanisms by which Jagged1 or its RIP-generated fragments might promote PCa bone metastasis. In the current study we show that bone marrow stroma (BMS) induces Jagged1 expression in bone metastatic prostate cancer PC3 cells and that this enhanced expression is mechanistically linked to the promotion of cell migration. We also show that RIP-generated Jagged1 fragments exert disparate effects on PC3 cell behaviour and Notch signaling. In conclusion, the expression of both the full-length ligand and its RIP-generated fragments must be considered in tandem when attempting to regulate Jagged1 as a possible PCa therapy. - Highlights: • Bone marrow stroma induces Jagged1 expression in prostate cancer (PCa) PC3 cells. • This enhanced expression of full-length Jagged1 is required for PC3 cell migration. • Proteolytic fragments of Jagged1 exert disparate effects on PC3 cell behaviour. • Effects of fragments on cell behaviour do not correlate with Notch signaling. • Effects of Jagged1 and its fragments on PCa metastasis likely to be complex.

Breeding of a hybrid capsicum variety 'Hangjiao-6' and its RAPD analysis

International Nuclear Information System (INIS)

Lu Jinying; Han Xinyun; Xue Huai; Pan Yi; Zhang Chunhua; Liu Min; Liang Fang; Bao Wensheng

2008-01-01

Dry seeds of two capsicum landraces 'Tianshuiyangjiaojiao (TSYJJ)' and 'Tianshuiniujiaojiao (TSNJJ)' were carried by 'Shenzhou-3' spaceship. Two mutant lines '021-7-1' and '024-3-1' were selected after four generations of self-cross, respectively by crossing these two lines (021-7-1 as female and '024-3-1' as male), a new variety 'Hangjiao-6' was selected. Agronomic characteristics evaluation of Hangjiao-6 and random amplified polymorphic DNA analysis were carried out on '021-7-1', '024-3-1', 'Hangjiao-6', 'TSYJJ' and 'TSNJJ'. Compared with the originals 'TSNJJ', the new line '024-3-1' was bigger fruit size, with a single fruit weight 52.4 g, increased by 12.7%. The new line '021-7-1' observed the increase of fruit number per plant, the average fruit number per plant reached 10.4, and increased by 25.3%. 'Hangjiao-6' has obvious heterosis in its fruit yield. 'Hangjiao-6', which shows early maturity, takes about 50 days from planting to harvest. The fruit is long sheep-horn shaped of 26.3 cm length, 3.68 cm in diameter, and 0.32 cm in flesh thickness. Average fruit weight is 51 g. The average yield is 41225.5 kg/hm 2 and showed strong disease resistance. By RAPD analysis, seven different fragments were amplified between the ground control 'TSNJJ' and the new line '024-3-1', and one different fragment was amplified between the ground control 'TSYJJ' and the new line '021-7-1'. 'Hangjiao-6 amplified the same fragments and the special fragments of the male and female parents, and also has the variant fragments from space mutation. (authors)

Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

OpenAIRE

Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

1995-01-01

The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Corridor Length and Patch Colonization by a Butterfly Junonia coenia

Energy Technology Data Exchange (ETDEWEB)

Nick Haddad

2000-06-01

Habitat corridors have been proposed to reduce patch isolation and increase population persistence in fragmented landscapes. This study tested whether patch colonization was increased by the presence and various length corridors. The specific butterfly species tested has been shown to use corridors, however, the results indicate that neither the distance between patches or the presence of a corridor influenced colonization.

Multi-pass amplifier architecture for high power laser systems

Science.gov (United States)

Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C

2014-04-01

A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.

Design of an 1800nm Raman amplifier

DEFF Research Database (Denmark)

Svane, Ask Sebastian; Rottwitt, Karsten

2013-01-01

We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

International Nuclear Information System (INIS)

Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

2013-01-01

Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

Remote Acquisition Amplifier For 50-Ohm Cable

Science.gov (United States)

Amador, Jose J.

1995-01-01

Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

Genotyping of Madurella mycetomatis by selective amplification of restriction fragments (amplified fragment length polymorphism) and subtype correlation with geographical origin and lesion size.

NARCIS (Netherlands)

W.W.J. van de Sande (Wendy); R.F.J. Gorkink (Raymond); G. Simons (Guus); A. Ott (Alewijn); A. Ahmed (Asif); H.A. Verbrugh (Henri); A.F. van Belkum (Alex)

2005-01-01

textabstractOne of the causative organisms of mycetoma is the fungus Madurella mycetomatis. Previously, extensive molecular typing studies identified Sudanese isolates of this fungus as clonal, but polymorphic genetic markers have not yet been identified. Here, we report on the selective

Effects of heat stress on gene expression in eggplant ( Solanum ...

African Journals Online (AJOL)

In order to identify differentially expressed genes involved in heat shock response, cDNA amplified fragment length polymorphism (cDNA-AFLP) and quantitative real-time polymerase chain reaction (QPCR) were used to study gene expression of eggplant seedlings subjected to 0, 6 and 12 h at 43°C. A total of 53 of over ...

AFLP/SSR mapping of resistance genes to Alectra vogelii in cowpea ...

African Journals Online (AJOL)

To find and map the resistance gene to A. vogelii in cowpea, a F2 population from a cross involving a resistant parent IT81D-994 and a susceptible TVX3236 was screened. Amplified fragment length polymorphism (AFLP) in combination with Single Sequence Repeat (SSR) analysis was used to identify markers that may be ...

Multiple excitation regenerative amplifier inertial confinement system

International Nuclear Information System (INIS)

George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

1980-01-01

The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

Insertion of Introns: A Strategy to Facilitate Assembly of Infectious Full Length Clones

DEFF Research Database (Denmark)

Johansen, Ida Elisabeth; Lund, Ole Søgaard

2008-01-01

Some DNA fragments are difficult to clone in Escherichia coli by standard methods. It has been speculated that unintended transcription and translation result in expression of proteins that are toxic to the bacteria. This problem is frequently observed during assembly of infectious full-length vi...

Spectral hole-burning and carrier-heating dynamics in quantum-dot amplifiers: Comparison with bulk amplifiers

DEFF Research Database (Denmark)

Borri, P.; Langbein, W.; Hvam, Jørn Märcher

2001-01-01

The ultrafast gain dynamics in an electrically pumped InAs/InGaAs/GaAs quantum-dot amplifier are measured at room temperature with femtosecond resolution, and compared with results on an InGaAsP bulk amplifier. The role of spectral hole burning and carrier heating in the recovery of the gain...

General analysis of group velocity effects in collinear optical parametric amplifiers and generators.

Science.gov (United States)

Arisholm, Gunnar

2007-05-14

Group velocity mismatch (GVM) is a major concern in the design of optical parametric amplifiers (OPAs) and generators (OPGs) for pulses shorter than a few picoseconds. By simplifying the coupled propagation equations and exploiting their scaling properties, the number of free parameters for a collinear OPA is reduced to a level where the parameter space can be studied systematically by simulations. The resulting set of figures show the combinations of material parameters and pulse lengths for which high performance can be achieved, and they can serve as a basis for a design.

The OPTHER Project: Progress toward the THz Amplifier

DEFF Research Database (Denmark)

Paoloni, C; Brunetti, F; Di Carlo, A

2011-01-01

This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....

Typing of Mycobacterium avium subspecies paratuberculosis isolates from Newfoundland using fragment analysis.

Directory of Open Access Journals (Sweden)

Milka P Podder

Full Text Available Short Sequence Repeat (SSR typing of Mycobacterium avium subspecies paratuberculosis (Map isolates is one of the most commonly used method for genotyping this pathogen. Currently used techniques have challenges in analyzing mononucleotide repeats >15 bp, which include some of the Map SSRs. Fragment analysis is a relatively simple technique, which can accurately measure the size of DNA fragments and can be used to calculate the repeat length of the target SSR loci. In the present study, fragment analysis was used to analyze 4 Map SSR loci known to provide sufficient discriminatory power to determine the relationship between Map isolates. Eighty-five Map isolates from 18 animals from the island of Newfoundland were successfully genotyped using fragment analysis. To the best of our knowledge, this is the first report on Map SSR diversity from Newfoundland dairy farms. Previously unreported Map SSR-types or combinations were also identified during the course of the described work. In addition, multiple Map SSR-types were isolated from a single animal in many cases, which is not a common finding.

Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

Directory of Open Access Journals (Sweden)

Santos Carlos A.F.

2002-01-01

Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

Use of random amplified polymorphic DNA (RAPD) for generating specific DNA probes for oxyuroid species (Nematoda).

Science.gov (United States)

Jobet, E; Bougnoux, M E; Morand, S; Rivault, C; Cloarec, A; Hugot, J P

1998-03-01

Random amplified DNA markers (RAPD; Williams et al., 1990) were used to obtained specific RAPD fragments characterising different species of oxyuroids. We tested six species of worms parasitizing vertebrates or invertebrates: Passalurus ambiguus Rudolphi, 1819, parasite of Leporids; Syphacia obvelata (Rudolphi, 1802) Seurat, 1916, a parasite of rodents; Blatticola blattae (Graeffe, 1860) Chitwood, 1932 parasite of the cockroach Blattella germanica; Hammerschmidtiella diesingi (Hammerschmidt, 1838) Chitwood, 1932 and Thelastoma bulhoesi (Magalhaes, 1990) Travassos, 1929, parasites of the cockroach Periplaneta americana, and an undescribed parasite species of a passalid insect from New Caledonia. Among 15 oligonucleotides tested, nine produced several specific bands allowing the interspecific discrimination.

Spectroscopic amplifier for pin diode