WorldWideScience

Sample records for amplified fragment length

  1. Identification of amplified fragment length polymorphism (AFLP ...

    African Journals Online (AJOL)

    Identification of amplified fragment length polymorphism (AFLP) fragments linked to soybean mosaic virus resistance gene in Glycine soja and conversion to a sequence characterized amplified regions (SCAR) marker for rapid selection.

  2. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  3. Relationship between morphological and amplified fragment length ...

    African Journals Online (AJOL)

    Relationship between morphological and amplified fragment length polymorphism (AFLP) marker based genetic distance with heterosis in hot pepper (Capsicum annuum L.) SL Krishnamurthy, A Mohan Rao, K Madhavi Reddy, S Ramesh, Shailaja Hittalmani, Rao M. Gopinath ...

  4. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  5. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  6. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...

  7. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Amplified fragment length polymorphism (AFLP) technology was used to reveal the genetic variation in six species of Cycas collected from eleven natural populations. Two sets of primer with 4-selective nucleotides were used in this study and 78% polymorphism was found. The results correlated with.

  8. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including......I restriction endonucleases and subsequent ligation of corresponding site-specific adapters. The amplification of AFLP templates with a single set of nonselective primers resulted in reproducible fingerprints of approximately 60 to 80 fragments in the size range of 50 to 500 bp, The method was able...

  9. Amplified restriction fragment length polymorphism in parasite genetics.

    Science.gov (United States)

    Masiga, D K; Tait, A; Turner, C M

    2000-08-01

    The amplified restriction fragment length polymorphism (AFLP) technique is a relatively new method for the analysis of polymorphism that has not yet been widely used in parasitology. In this article, Dan Masiga, Andy Tait and Mike Turner provide a brief introduction to AFLP and illustrate how it can be used in the investigation of marker inheritance in genetic crosses and in the analysis of polymorphism of field populations. They also briefly highlight the strengths and weaknesses of AFLP in comparison with other methods for detecting polymorphism and conclude that AFLP is a very useful addition to the range of techniques available.

  10. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  11. Application of amplified fragment length polymorphism (AFLPs) for ...

    African Journals Online (AJOL)

    Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

  12. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  13. Genetic Diversity and Sectional Relationships from an Amplified Fragment Length Polymorphism Analysis of Taiwan Bananas

    OpenAIRE

    Chang, Shu-Fen; Chang, Yueh-Long; Yen, Yung-Fu; Miyajima, Ikuo; Huang, Kuang-Liang

    2017-01-01

    Phylogenetic relationships among 19 Musa species or cultivars were examined through DNA fingerprinting with amplified fragment length polymorphism (AFLP) analysis. The AFLP analysis was performed on the Musa species or cultivars with 21 primer combinations, yielding a total of 6,348 DNA bands, among which 6,113 (96.3%) were polymorphic. M. itinerans var. formosana demonstrated 133 monomorphic bands, which is the most among all samples. Unweighted pair–group method with arithmetic averages was...

  14. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...... found by 16S rDNA analysis. The present data support previous observations regarding genetic homogeneity of M. capricolum subsp. capripneumoniae, and confirm the two evolutionary lines of descent found by analysis of 16S rRNA genes....

  15. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  16. Analysis of genetic diversity identified by amplified fragment length polymorphism marker in hybrid wheat.

    Science.gov (United States)

    Ejaz, M; Qidi, Z; Gaisheng, Z; Na, N; Huiyan, Z; Qunzhu, W

    2015-08-07

    Amplified fragment length polymorphism markers were used to assess genetic diversity in 10 male sterile wheat crop lines (hetero-cytoplasm with the same nucleus) in relation to a restorer wheat line. These male sterile lines were evaluated using 64 amplified fragment length polymorphism primer combinations, and 13 primers produced polymorphic bands, generating a total 682 fragments. Of the 682 fragments, 113 were polymorphic. The polymorphic information content and marker index values demonstrated the utility of the primer combinations used in the present study. Unweighted pair group method with arithmetic mean and principal coordinate analysis of the genotypic data revealed clustering of accessions based on genetic relationships, and accessions were separated into 2 groups with their restorer line. Jaccard's similarity coefficient values suggested good variability among the male sterile lines, indicating their utility in breeding programs. The fallouts of analysis of molecular variance showed large within-group population variation, accounting for 77% of variation, while among-group comparison accounted for 23% of the total molecular variation, which was statistically significant. The molecular diversity observed in this study will be useful for selecting appropriate accessions for plant improvement and hybridization through molecular-breeding approaches and for developing suitable conservation strategies.

  17. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs......RI genomic DNA fragment, and a short, degenerated, oligonucleotide covering the remaining TspRI cohesive ends. Other cohesive ends are covered by a short degenerated oligonucleotide lacking the primer site. The ligation mixture is used as a template for amplification using a single primer corresponding...... for differentiation of the organisms without previous knowledge of their DNA sequence. The usefulness of the method is confirmed by genotyping of 70 previously characterized clinical E. coli isolates. The grouping obtained was identical to the results of REA-PFGE. Versatility of the method is highlighted, i.e. its...

  18. Genetic variation in an endemic salamander, Salamandra atra, using amplified fragment length polymorphism.

    Science.gov (United States)

    Riberon, Alexandre; Miaud, Claude; Guyetant, R; Taberlet, P

    2004-06-01

    The pattern of genetic differentiation of the endemic alpine salamander, Salamandra atra, has been studied using amplified fragment length polymorphism (AFLP) from 11 populations throughout the range of the two currently recognized subspecies, atra and aurorae. Five different primer combinations produced 706 bands and were analyzed by constructing a phylogenetic tree using NJ and principal component analysis. Significant genetic variation was revealed by AFLP between and within populations but, our results show a lack of genetic structure. AFLP markers seems to be unsuitable to investigate complex and recent diversification.

  19. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  20. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according to th...

  1. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... to available epidemiological data. We conclude that this amplified fragment length polymorphism fingerprinting method may be a highly effective tool for molecular epidemiological studies of Campylobacter spp....

  2. Genetic variation in hemp and marijuana (Cannabis sativa L.) according to amplified fragment length polymorphisms.

    Science.gov (United States)

    Datwyler, Shannon L; Weiblen, George D

    2006-03-01

    Cannabis sativa L. (Cannabaceae) is one of the earliest known cultivated plants and is important in the global economy today as a licit and an illicit crop. Molecular markers distinguishing licit and illicit cultivars have forensic utility, but no direct comparison of hemp and marijuana amplified fragment length polymorphism (AFLP) has been made to date. Genetic variation was surveyed in three populations of fiber hemp and a potent cultivar of marijuana using AFLP markers. Ten primer pairs yielded 1206 bands, of which 88% were polymorphic. Eighteen bands represented fixed differences between all fiber populations and the drug cultivar. These markers have practical utility for (1) establishing conspiracy in the cultivation and distribution of marijuana, (2) identifying geographic sources of seized drugs, and (3) discriminating illegal, potent marijuana cultivars from hemp where the cultivation of industrial hemp is permitted.

  3. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  4. Using amplified fragment length polymorphism analysis to differentiate isolates of Pasteurella multocida serotype 1

    Science.gov (United States)

    Blehert, D.S.; Jefferson, K.L.; Heisey, D.M.; Samuel, M.D.; Berlowski, B.M.; Shadduck, D.J.

    2008-01-01

    Avian cholera, an infectious disease caused by the bacterium Pasteurella multocida, kills thousands of North American wild waterfowl annually. Pasteurella multocida serotype 1 isolates cultured during a laboratory challenge study of Mallards (Anas platyrhynchos) and collected from wild birds and environmental samples during avian cholera outbreaks were characterized using amplified fragment length polymorphism (AFLP) analysis, a whole-genome DNA fingerprinting technique. Comparison of the AFLP profiles of 53 isolates from the laboratory challenge demonstrated that P. multocida underwent genetic changes during a 3-mo period. Analysis of 120 P. multocida serotype 1 isolates collected from wild birds and environmental samples revealed that isolates were distinguishable from one another based on regional and temporal genetic characteristics. Thus, AFLP analysis had the ability to distinguish P. multocida isolates of the same serotype by detecting spatiotemporal genetic changes and provides a tool to advance the study of avian cholera epidemiology. Further application of AFLP technology to the examination of wild bird avian cholera outbreaks may facilitate more effective management of this disease by providing the potential to investigate correlations between virulence and P. multocida genotypes, to identify affiliations between bird species and bacterial genotypes, and to elucidate the role of specific bird species in disease transmission. ?? Wildlife Disease Association 2008.

  5. Genetic variability of the stable fly assessed on a global scale using amplified fragment length polymorphism.

    Science.gov (United States)

    Kneeland, Kathleen M; Skoda, Steven R; Foster, John E

    2016-10-01

    The stable fly, Stomoxys calcitrans (L.) (Diptera: Muscidae), is a blood-feeding, economically important pest of animals and humans worldwide. Improved management strategies are essential and their development would benefit from studies on genetic diversity of stable flies. Especially if done on a global scale, such research could generate information necessary for the development and application of more efficient control methods. Herein we report on a genetic study of stable flies using amplified fragment length polymorphism, with samples of 10-40 individuals acquired from a total of 25 locations in the Nearctic, Neotropic, Palearctic, Afrotropic and Australasian biogeographical regions. We hypothesized that genetic differentiation would exist across geographical barriers. Although FST (0.33) was moderately high, the GST (0.05; representing genetic diversity between individuals) was very low; Nm values (representing gene flow) were high (9.36). The mismatch distribution and tests of neutrality suggested population expansion, with no genetic differentiation between locations. The analysis of molecular variance (AMOVA) results showed the majority of genetic diversity was within groups. The mantel test showed no correlation between geographic and genetic distance; this strongly supports the AMOVA results. These results suggest that stable flies did not show genetic differentiation but are panmictic, with no evidence of isolation by distance or across geographical barriers. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  6. Rapid identification of rice blast resistance gene by specific length amplified fragment sequencing

    Directory of Open Access Journals (Sweden)

    Shen Chen

    2016-05-01

    Full Text Available Excavation of resistance genes is one of the most effective and environment-friendly measures to control the devastating rice disease caused by Magnaporthe oryzae. Many resistance genes have been mapped and characterized in the last century. Nevertheless, only a few of the total resistance genes could be really applied in the rice breeding program. Huazhan (HZ is a new native rice restorer line developed in China and widely used in hybrid rice in recent years. HZ and its crossed combinations usually show a broad spectrum of resistance against rice blast in different rice ecosystems in China. Dissection of the genetic background of HZ is very useful for its further application. In this study, a combined method based on bulked segregation analysis (BSA and specific length amplified fragment sequencing (SLAF-seq was used to identify blast resistance gene(s in HZ. A total of 56,187 SLAFs labels were captured and 9051 polymorphic SLAFs markers were analysed and procured in this study. One trait associated with candidate resistance genes region on chromosome 12 overlapping 10.2–17.6 Mb has been identified, in which 10 NBS-LRR (nucleotide-binding site-leucine-rich repeat coding genes were used as resistance gene candidates. Our result indicated that SLAF-seq with BSA is a rapid and effective method for initial identification of blast resistance genes. The identification of resistance gene in HZ will improve its molecular breeding and resistance variety application.

  7. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  8. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  9. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...... polymorphism (AFLP). When making genetic trees, all three methods resulted in similar clustering that often corresponded with serotype, although some serotypes displayed more diversity than others. Of the three techniques, MLST was the easiest to interpret and compare between laboratories. Unfortunately...

  10. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  11. Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

    Science.gov (United States)

    Nie, H-T; Li, Q; Kong, L-F

    2014-06-01

    Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

  12. Selection criteria for scoring amplified fragment length polymorphisms (AFLPs) positively affect the reliability of population genetic parameter estimates.

    Science.gov (United States)

    Herrmann, Doris; Poncet, Bénédicte N; Manel, Stéphanie; Rioux, Delphine; Gielly, Ludovic; Taberlet, Pierre; Gugerli, Felix

    2010-04-01

    A reliable data set is a fundamental prerequisite for consistent results and conclusions in population genetic studies. However, marker scoring of genetic fingerprints such as amplified fragment length polymorphisms (AFLPs) is a highly subjective procedure, inducing inconsistencies owing to personal or laboratory-specific criteria. We applied two alternative marker selection algorithms, the newly developed script scanAFLP and the recently published AFLPScore, to a large AFLP genome scan to test how population genetic parameters and error rates were affected. These results were confronted with replicated random selections of marker subsets. We show that the newly developed marker selection criteria reduced the mismatch error rate and had a notable influence on estimates of genetic diversity and differentiation. Both effects are likely to influence biological inference. For example, genetic diversity (HS) was 29% lower while genetic differentiation (FST) was 8% higher when applying scanAFLP compared with AFLPScore. Likewise, random selections of markers resulted in substantial deviations of population genetic parameters compared with the data sets including specific selection criteria. These randomly selected marker sets showed surprisingly low variance among replicates. We conclude that stringent marker selection and phenotype calling reduces noise in the data set while retaining patterns of population genetic structure.

  13. Amplified fragment length polymorphism used to investigate genetic variability of the stable fly (Diptera: Muscidae) across North America.

    Science.gov (United States)

    Kneeland, K M; Skoda, S R; Foster, J E

    2013-09-01

    The stable fly, Stomoxys calcitrans (L.), is a cosmopolitan pest of livestock and humans. The pestiferous nature and painful bite cause stress to cattle and other animals. The stress and resulting avoidance behaviors manifest as reductions in weight gain or milk production in cattle; estimated annual economic loss in the United States exceeds US$2 billion. Understanding the population genetics of stable flies could provide information on their population dynamics, origins of outbreaks, and geographical patterns of insecticide resistance, resulting in a tactical advantage for developing management strategies. Previous studies, mostly on a local scale, reported a high level of gene flow between locations. Here, we report results wherein amplified fragment length polymorphism was used to determine genetic diversity of stable fly samples consisting of 11-40 individuals from 12 locations representing the United States, Canada, and Panama. The Analysis of Molecular Variance showed that the majority of genetic diversity was within groups; very little was among groups. The F(ST) and G(ST) values were low ( 1.0). The tests of neutrality suggested population expansion, and no genetic differentiation was found between locations. These results show that stable flies have a high level of gene flow on a continental scale, with limited isolation owing to distance or geographical barriers.

  14. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  15. A high-density genetic map of cucumber derived from Specific Length Amplified Fragment sequencing (SLAF-seq).

    Science.gov (United States)

    Xu, Xuewen; Xu, Ruixue; Zhu, Biyun; Yu, Ting; Qu, Wenqin; Lu, Lu; Xu, Qiang; Qi, Xiaohua; Chen, Xuehao

    2014-01-01

    High-density genetic map provides an essential framework for accurate and efficient genome assembly and QTL fine mapping. Construction of high-density genetic maps appears more feasible since the advent of next-generation sequencing (NGS), which eases SNP discovery and high-throughput genotyping of large population. In this research, a high-density genetic map of cucumber (Cucumis sativus L.) was successfully constructed across an F2 population by a recently developed Specific Length Amplified Fragment sequencing (SLAF-seq) method. In total, 18.69 GB of data containing 93,460,000 paired-end reads were obtained after preprocessing. The average sequencing depth was 44.92 in the D8 (female parent), 42.16 in the Jin5-508 (male parent), and 5.01 in each progeny. 79,092 high-quality SLAFs were detected, of which 6784 SLAFs were polymorphic, and 1892 of the polymorphic markers met the requirements for constructing genetic map. The genetic map spanned 845.87 cm with an average genetic distance of 0.45 cm. It is a reliable linkage map for fine mapping and molecular breeding of cucumber for its high marker density and well-ordered markers.

  16. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  17. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping ba...

  18. Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-02-01

    Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

  19. Genetic relationship and diversity in a sesame (Sesamum indicum L.) germplasm collection using amplified fragment length polymorphism (AFLP)

    Science.gov (United States)

    Laurentin, Hernán E; Karlovsky, Petr

    2006-01-01

    Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia), and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP). Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA). This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres. Future germplasm

  20. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  1. Female-only sex-linked amplified fragment length polymorphism markers support ZW/ZZ sex determination in the giant freshwater prawn Macrobrachium rosenbergii.

    Science.gov (United States)

    Jiang, Xue-Hui; Qiu, Gao-Feng

    2013-12-01

    Sex determination mechanisms in many crustacean species are complex and poorly documented. In the giant freshwater prawn, Macrobrachium rosenbergii, a ZW/ZZ sex determination system was previously proposed based on sex ratio data obtained by crosses of sex-reversed females (neomales). To provide molecular evidence for the proposed system, novel sex-linked molecular markers were isolated in this species. Amplified fragment length polymorphism (AFLP) using 64 primer combinations was employed to screen prawn genomes for DNA markers linked with sex loci. Approximately 8400 legible fragments were produced, 13 of which were uniquely identified in female prawns with no indication of corresponding male-specific markers. These AFLP fragments were reamplified, cloned and sequenced, producing two reliable female-specific sequence characterized amplified region (SCAR) markers. Additional individuals from two unrelated geographic populations were used to verify these findings, confirming female-specific amplification of single bands. Detection of internal polymorphic sites was conducted by designing new primer pairs based on these internal fragments. The internal SCAR fragments also displayed specificity in females, indicating high levels of variation between female and male specimens. The distinctive feature of female-linked SCAR markers can be applied for rapid detection of prawn gender. These sex-specific SCAR markers and sex-associated AFLP candidates unique to female specimens support a sex determination system consistent with female heterogamety (ZW) and male homogamety (ZZ). © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  2. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...... potential for the differentiation of M. hyosynoviae isolates. Concordant results obtained with the two whole-genome fingerprinting techniques evidence the considerable intraspecies genetic heterogeneity of M. hyosynoviae . Sixteen field strains of M. hyosynoviae and the type strain S16(T) were further...

  3. Using specific length amplified fragment sequencing to construct the high-density genetic map for Vitis ( Vitis vinifera L. × Vitis amurensis Rupr.

    Directory of Open Access Journals (Sweden)

    yinshan eGuo

    2015-06-01

    Full Text Available In this study, 149 F1 plants from the interspecific cross between ‘Red Globe’ (Vitis vinifera L. and ‘Shuangyou’ (Vitis amurensis Rupr. and the parent were used to construct a molecular genetic linkage map by using the specific length amplified fragment sequencing technique. DNA sequencing generated 41.282 Gb data consisting of 206,411,693 paired-end reads. The average sequencing depths were 68.35 for ‘Red Globe,’ 63.65 for ‘Shuangyou,’ and 8.01 for each progeny. In all, 115,629 high-quality specific length amplified fragments were detected, of which 42,279 were polymorphic. The genetic map was constructed using 7,199 of these polymorphic markers. These polymorphic markers were assigned to 19 linkage groups; the total length of the map was 1929.13 cM, with an average distance of 0.28 cM between each maker. To our knowledge, the genetic maps constructed in this study contain the largest number of molecular markers. These high-density genetic maps might form the basis for the fine quantitative trait loci mapping and molecular-assisted breeding of grape.

  4. Encapsulation dehydration colligative cryoprotective strategies and amplified fragment length polymorphism markers to verify the identity and genetic stability of euglenoids following cryopreservation.

    Science.gov (United States)

    Harding, Keith; Miller, Julia; Timmermann, Hella; Lorenz, Maike; Day, John G; Friedl, Thomas

    2010-01-01

    An encapsulation/dehydration procedure was developed for Euglena gracilis Klebs as a 'model alga' to examine various cryoprotective regimes combined with controlled rate cooling to cryopreserve other Euglenoid taxa. Cryoprotective variables were optimised to enable reproducible growth following a combination of alginate encapsulation, sucrose osmotic dehydration, air desiccation, methanol treatment, cooling to -40 degrees C and plunging into liquid nitrogen (LN). Amplified Fragment Length Polymorphism (AFLP) analysis was adapted to: (i) verify algal identity by discriminating between different Euglenoids and (ii) examine the genetic stability of algal cultures prior to various stages of cryoprotective treatments and following exposure to LN. AFLPs were highly reproducible (> 99%) as reliable diagnostic markers, where a single DNA fragment change accounted for -0.4% of the detectable variation in an AFLP pattern. AFLP changes were detected in cryoprotective treatments following LN exposure. Successive stages of the dehydration and desiccation treatments did not accumulate AFLP changes indicating these are random events.

  5. Genetic relatedness among Campylobacter jejuni serotyped isolates of diverse origin as determined by numerical analysis of amplified fragment length polymorphism (AFLP) profiles

    DEFF Research Database (Denmark)

    Siemer, B.L.; Harrington, C.S.; Nielsen, E.M.

    2004-01-01

    health. The remaining 30 groups contained isolates from humans, chickens and associated food products, cattle, sheep, turkeys, ostriches and/or dogs. Strains assigned to serotypes 2, 6/7, 11 and 12 formed major clusters at the 77.6% S-level. Most other serotypes did not form homogeneous clusters......Aims: To use amplified fragment length polymorphism (AFLP) analysis to evaluate the genetic relatedness among 254 Campylobacter jejuni reference and field strains of diverse origin representing all defined 'Penner' serotypes for this species. Methods and Results: Field strains (n = 207) from human...... diarrhoea and diverse animal and environmental sources were collected mainly through a National surveillance programme in Denmark and serotyped by use of the established 'Penner' scheme. Genetic relationships among these isolates, and the archetypal serotype reference strains, were assessed by numerical...

  6. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  7. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  8. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  9. cDNA-amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese-like medium.

    Science.gov (United States)

    Bove, C G; Lazzi, C; Bernini, V; Bottari, B; Neviani, E; Gatti, M

    2011-10-01

    Lactobacillus rhamnosus is a dominant species during Parmigiano Reggiano cheese ripening and exhibits a great adaptability to unfavourable growth conditions. Gene expression of a Lact. rhamnosus, isolated from Parmigiano Reggiano cheese, grown in a rich medium (MRS) and in a cheese-like medium (CB) has been compared by a novel cDNA-amplified fragment length polymorphism (cDNA-AFLP) protocol. Two techniques, capillary and gel electrophoresis cDNA-AFLP, were applied to generate unique transcript tags from reverse-transcribed messenger RNA using the immobilization of biotinylated 3'-terminal cDNA fragments on streptavidin-coated Dynabeads. The use of three pairs of primers allowed detecting 64 genes expressed in MRS and 96 in CB. Different transcripts were observed when Lact. rhamnosus was cultured on CB and MRS. The cDNA-AFLP approach proved to be able to show that Lact. rhamnosus modifies the expression of a large part of genes when cultivated in CB compared with growth under optimal conditions (MRS). In particular, the profiles of the strain grown in CB were more complex probably because the cells activate different metabolic pathways to generate energy and to respond to the environmental changes. This is the first research on Lact. rhamnosus isolated from cheese and represents one of the few concerning bacterial transcriptomic analysis towards cDNA-AFLP approaches. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  10. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  11. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  12. AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

    Science.gov (United States)

    García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

    2012-05-01

    Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

  13. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

    Science.gov (United States)

    Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

    2002-04-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

  14. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  15. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  16. Analysis of genetic variability in endemic medicinal plants of genus Chlorophytum from the Indian subcontinent using amplified fragment length polymorphism marker.

    Science.gov (United States)

    Patil, Swapnil Mahadeo; Chandanshive, Vishal Vinayak; Tamboli, Asif Shabodin; Adsul, Avinash Asraji; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2015-12-01

    The genus Chlorophytum consists of medicinally important species like Chlorophytum borivilianum, C. tuberosum and C. attenuatum. Uncontrolled harvest of this plant from wild habitat due to its high commercial value made the species of this genus be listed in the Red Data Book of Indian plants as an endangered species. In India, approximately nineteen species of Chlorophytum are found; out of these, only C. borivilianum is cultivated commercially. The objective of this study was to measure genetic diversity, population structure and phylogenetic relationship among the species using Amplified Fragment Length Polymorphisms (AFLP). Fifteen pairs of primer (out of 64 primer pairs screened) were used to analyse the genetic diversity in eighteen species of genus Chlorophytum. Cluster analysis, estimation of the gene flow among the species and of the phylogeographic distribution of this genus were carried out using an AFLP data matrix. A high level of genetic diversity was observed on the basis of the percentage of polymorphic bands (99.91%), Shannon's information index (0.3592) and Nei's gene diversity (0.2085) at species level. Cluster analysis of UPGMA dendrogram, principal component analysis and Bayesian method analysis resolved these species in three different clusters, which was supported by morphological information. The Mantel test (r=0.4432) revealed a significant positive correlation between genetic and geographic distances. The collected data have an important implication in the identification, authentication, and conservation of the species of the genus Chlorophytum. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  17. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  18. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  19. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  20. New restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus.

    Science.gov (United States)

    Semighini, C P; Delmas, G; Park, S; Amstrong, D; Perlin, D; Goldman, G H

    2001-07-01

    In this study, we isolated and tested restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus based on PCR products amplified by the random amplified polymorphic DNA (RAPD) primer R108. Four DNA fragments, Afd, Af5, Af4, and Af4A, were amplified. Fragments Afd and Af5 were 85% and 88% identical at the DNA level to part of the Afut1 retrotransposon from A. fumigatus. Fragment Af4A is a duplication of fragment Af4 and both showed similarity at the amino acid level with endonucleases from other fungal retrotransposons. We used both RAPD with primer R108 and RFLP assays with Afut1, Afd, and Af4A, to determine the genetic relatedness of clinical isolates of A. fumigatus isolated sequentially from four patients colonized with A. fumigatus. The combination of these different methods suggested that the isolates infecting the four patients were not identical.

  1. Development and utility of cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLPs) linked to the Fom-2 fusarium wilt resistance gene in melon (Cucumis melo L.).

    Science.gov (United States)

    Zheng, X Y; Wolff, D W; Baudracco-Arnas, S; Pitrat, M

    1999-08-01

    Fusarium wilt, caused by Fusarium oxysporum Schlecht f. sp. melonis Snyder & Hans, is a worldwide soil-borne disease of melon (Cucumis melo L.). Resistance to races 0 and 1 of Fusarium wilt is conditioned by the dominant gene Fom-2. To facilitate marker-assisted backcrossing with selection for Fusarium wilt resistance, we developed cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLP) markers by converting RAPD markers E07 (a 1.25-kb band) and G17 (a 1.05-kb band), respectively. The RAPD-PCR polymorphic fragments from the susceptible line 'Vedrantais' were cloned and sequenced in order to construct primers that would amplify only the target fragment. The derived primers, E07SCAR-1/E07SCAR-2 from E07 and G17SCAR-1/G17SCAR-2 from G17, yielded a single 1.25-kb fragment (designated SCE07) and a 1.05-kb fragment (designated SCG17) (the same as RAPD markers E07 and G17), respectively, from both resistant and susceptible melon lines, thus demonstrating locus-specific associated primers. Potential CAPS markers were first revealed by comparing sequence data between fragments amplified from resistant (PI 161375) and susceptible ('Vedrantais') lines and were then confirmed by electrophoresis of restriction endonuclease digestion products. Twelve restriction endonucleases were evaluated for their potential use as CAPS markers within the SCE07 fragment. Three (BclI, MspI, and BssSI) yielded ideal CAPS markers and were subsequently subjected to extensive testing using an additional 88 diverse melon cultigens, 93 and 119 F(2) individuals from crosses of 'Vedrantais' x PI 161375 and 'Ananas Yokneam'×MR-1 respectively, and 17 families from a backcross BC(1)S(1) population derived from the breeding line 'MD8654' as a resistance source. BclI- and MspI-CAPS are susceptible-linked markers, whereas the BssSI-CAPS is a resistant-linked marker. The CAPS markers that resulted from double digestion by BclI and BssSI are co-dominant. Results

  2. Genetic characterization by amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Mariela Vázquez Calderón, Javier O Mijangos-Cortés, Manuel JL Zavala, L Felipe Sánchez Teyer, Adriana M Quiroz, Matilde Margarita G Ortiz, Amilcar Contreras M Fernando, Espadas G Francisco, Gabriela Fuentes Ortiz, Jorge M Santamaría ...

  3. Amplified Fragment Length Polymorphism markers reveal ...

    African Journals Online (AJOL)

    The understanding of between- and within-population genetic variation and its partitioning on the basis of geographic origin is crucial in designing efficient fishing and conservation strategies of populations and/or species. However, for Lake Malawi's cichlid species, such population genetic studies are hampered by a large ...

  4. Amplified fragment length polymorphism (AFLP) and genealogy ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

  5. Amplified fragment length polymorphisms (AFLPs) analysis of ...

    African Journals Online (AJOL)

    The taxonomy of species belonging to Solanum section Solanum (sometimes referred to as the Solanum nigrum complex or black nightshades) is known to be difficult and has resulted in extensive synonymy. Yet, these species play a significant role in nutrition and food security, especially in developing countries.

  6. Most cases of cryptococcal meningitis in HIV-uninfected patients in Vietnam are due to a distinct amplified fragment length polymorphism-defined cluster of Cryptococcus neoformans var. grubii VN1.

    Science.gov (United States)

    Day, Jeremy N; Hoang, Thu N; Duong, Anh V; Hong, Chau T T; Diep, Pham T; Campbell, James I; Sieu, Tran P M; Hien, Tran T; Bui, Tien; Boni, Maciej F; Lalloo, David G; Carter, Dee; Baker, Stephen; Farrar, Jeremy J

    2011-02-01

    Cryptococcal disease most commonly occurs in patients with an underlying immune deficit, most commonly HIV infection, and is due to Cryptococcus neoformans var. grubii. Occasionally disease due to this variety occurs in apparently immunocompetent patients. The relationship between strains infecting immunosuppressed and immunocompetent patients is not clear. Amplified fragment length polymorphism (AFLP) analysis was used to characterize the relationship between strains infecting HIV-infected and uninfected patients. Isolates from 51 HIV-uninfected patients and 100 HIV-infected patients with cryptococcal meningitis were compared. C. neoformans var. grubii VNI was responsible for infections in 73% of HIV-uninfected and 100% of HIV-infected patients. AFLP analysis defined two distinct clusters, VNIγ and VNIδ. The majority (84%) of isolates from HIV-uninfected patients were VNIγ, compared with only 38% of isolates from HIV-infected patients (odds ratio, 8.30; 95% confidence interval [CI], 3.04 to 26.6; P cryptococcal meningitis in Vietnam. The distribution of these clusters differs according to the immune status of the host.

  7. Most Cases of Cryptococcal Meningitis in HIV-Uninfected Patients in Vietnam Are Due to a Distinct Amplified Fragment Length Polymorphism-Defined Cluster of Cryptococcus neoformans var. grubii VN1▿

    Science.gov (United States)

    Day, Jeremy N.; Hoang, Thu N.; Duong, Anh V.; Hong, Chau T. T.; Diep, Pham T.; Campbell, James I.; Sieu, Tran P. M.; Hien, Tran T.; Bui, Tien; Boni, Maciej F.; Lalloo, David G.; Carter, Dee; Baker, Stephen; Farrar, Jeremy J.

    2011-01-01

    Cryptococcal disease most commonly occurs in patients with an underlying immune deficit, most commonly HIV infection, and is due to Cryptococcus neoformans var. grubii. Occasionally disease due to this variety occurs in apparently immunocompetent patients. The relationship between strains infecting immunosuppressed and immunocompetent patients is not clear. Amplified fragment length polymorphism (AFLP) analysis was used to characterize the relationship between strains infecting HIV-infected and uninfected patients. Isolates from 51 HIV-uninfected patients and 100 HIV-infected patients with cryptococcal meningitis were compared. C. neoformans var. grubii VNI was responsible for infections in 73% of HIV-uninfected and 100% of HIV-infected patients. AFLP analysis defined two distinct clusters, VNIγ and VNIδ. The majority (84%) of isolates from HIV-uninfected patients were VNIγ, compared with only 38% of isolates from HIV-infected patients (odds ratio, 8.30; 95% confidence interval [CI], 3.04 to 26.6; P cryptococcal meningitis in Vietnam. The distribution of these clusters differs according to the immune status of the host. PMID:21159929

  8. Intestinal carriage of Campylobacter jejuni and Campylobacter coli among cattle from South-western Norway and comparative genotyping of bovine and human isolates by amplified-fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Vardund T

    2006-06-01

    Full Text Available Abstract In a survey conducted in 1999–2001, the carriage of thermotolerant Campylobacters in cattle was investigated, and the genetic diversity of C. jejuni within one herd was examined and compared with human isolates. C. jejuni, C. coli and other thermotolerant Campylobacter spp. were isolated from intestinal contents from 26%, 3% and 2% of 804 cattle, respectively. The carriage rate was higher in calves (46% than in adults (29%. Twenty-nine C. jejuni isolates from one herd and 31 human isolates from the study area were genotyped with amplified-fragment length polymorphism (AFLP. Eighty-three % of the bovine isolates fell into three distinct clusters with 95–100% similarity, persistent in the herd for 5–10 months. Among human isolates, 58% showed >90% similarity with bovine isolates. The results show that cattle are a significant and stable reservoir for C. jejuni in the study area. Transmission between individuals within the herd may be sufficient to maintain a steady C. jejuni population independent of environmental influx. The results of this study have provided new information on C. jejuni and C. coli transmission, and also on the carriage in cattle, genotypes stability and similarity between bovine and human isolates.

  9. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  10. A novel method to infer the origin of polyploids from Amplified Fragment Length Polymorphism data reveals that the alpine polyploid complex of Senecio carniolicus (Asteraceae) evolved mainly via autopolyploidy.

    Science.gov (United States)

    Winkler, Manuela; Escobar García, Pedro; Gattringer, Andreas; Sonnleitner, Michaela; Hülber, Karl; Schönswetter, Peter; Schneeweiss, Gerald M

    2017-09-01

    Despite its evolutionary and ecological relevance, the mode of polyploid origin has been notoriously difficult to be reconstructed from molecular data. Here, we present a method to identify the putative parents of polyploids and thus to infer the mode of their origin (auto- vs. allopolyploidy) from Amplified Fragment Length Polymorphism (AFLP) data. To this end, we use Cohen's d of distances between in silico polyploids, generated within a priori defined scenarios of origin from a priori delimited putative parental entities (e.g. taxa, genetic lineages), and natural polyploids. Simulations show that the discriminatory power of the proposed method increases mainly with increasing divergence between the lower-ploid putative ancestors and less so with increasing delay of polyploidization relative to the time of divergence. We apply the new method to the Senecio carniolicus aggregate, distributed in the European Alps and comprising two diploid, one tetraploid and one hexaploid species. In the eastern part of its distribution, the S. carniolicus aggregate was inferred to comprise an autopolyploid series, whereas for western populations of the tetraploid species, an allopolyploid origin involving the two diploid species was the most likely scenario. Although this suggests that the tetraploid species has two independent origins, other evidence (ribotype distribution, morphology) is consistent with the hypothesis of an autopolyploid origin with subsequent introgression by the second diploid species. Altogether, identifying the best among alternative scenarios using Cohen's d can be straightforward, but particular scenarios, such as allopolyploid origin vs. autopolyploid origin with subsequent introgression, remain difficult to be distinguished. © 2016 John Wiley & Sons Ltd.

  11. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  12. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Directory of Open Access Journals (Sweden)

    Mohammad Asadzadeh

    Full Text Available Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp, C. orthopsilosis (109 bp, C. metapsilosis (217 bp and L. elongisporus (258 bp were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380 by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study was performed by amplified fragment length polymorphism (AFLP analysis. Phenotypically identified C. parapsilosis isolates (n = 380 were identified as C. parapsilosis sensu stricto (n = 361, C. orthopsilosis (n = 15, C. metapsilosis (n = 1 and L. elongisporus (n = 3 by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1 comprising 11 isolates recovered from 10

  13. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  14. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Due to high degree of reproducibility, AFLP is now increasingly used in the determination of genetic diversity of a large number of wild plant species. In previous studies, AFLP has been used successfully for the reconstruction of the phylogeny of closely related species as well as in the studies of population ...

  15. Amplified Fragment Length Polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, ... as the main causes of crop losses in wheat. Of these, stem rust caused by Puccinia graminis f. sp. tritici (Pgt) is the main ..... estimated losses in major food and cash crops. Amsterdam: Elsevier, 808 p. Ordonez ...

  16. Amplified fragment length polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    The developed AFLP fingerprints for the Ethiopian Pgt isolates reported herein could support the breeding program to develop strategies for the deployment of resistance genes in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, genetic diversity, population ...

  17. Fragment Length Distributions and Collision Probabilities for AFLP Markers

    NARCIS (Netherlands)

    Gort, G.; Koopman, W.J.M.; Stein, A.

    2006-01-01

    AFLP is a DNA fingerprinting technique frequently used in plant and animal sciences. A drawback of the technique is the occurrence of multiple DNA fragments of the same length in a single AFLP lane, which we name a collision. In this article we quantify the problem. The well-known birthday problem

  18. Testing independence of fragment lengths within VNTR loci

    Energy Technology Data Exchange (ETDEWEB)

    Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))

    1993-11-01

    Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

  19. Direct endonuclease digestion and multi-analysis of restriction fragment length polymorphisms by microchip electrophoresis.

    Science.gov (United States)

    Akamine, Rie; Yatsushiro, Shouki; Yamamura, Shouhei; Kido, Jun-ichi; Shinohara, Yasuo; Baba, Yoshinobu; Kataoka, Masatoshi

    2009-12-05

    A high-performance multi-analysis system for genotypic mutation by means of restriction fragment length polymorphisms (RFLP) involving endonuclease treatment of PCR-amplified DNA on a microchip and subsequent analysis by microchip electrophoresis for DNA sizing was developed. A Hitachi SV1210 system, with which 12 samples can be analyzed on a plastic chip with good accuracy as to DNA sizing between 25 and 300 bp, was employed for RFLP analysis. We performed RFLP analysis of the ABO genotypes of blood donors for whom the ABO type was known. Six blood samples were analyzed by PCR to amplify two different regions of the genomic DNA, each of the amplified DNAs containing a different nucleotide polymorphism. To analyze the genes at polymorphic sites 261 and 526, restriction endonucleases Kpn I and Ban I were employed, respectively. When an amplified DNA was digested with each endonuclease on a microchip for 20 min, sequential analysis revealed the presence or absence of the respective restriction site. This analysis was performed within 7 min using a 1/10 volume of a DNA sample in comparison with the conventional method, and the estimated DNA size differed from the predicted size by less than 10 bp. The results indicate the potential of microchip electrophoresis for RFLP with on-chip direct endonuclease digestion and sequential analysis, offering high resolution in a short time.

  20. Identification of infectious agents in onychomycoses by PCR-terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith; Monod, Michel

    2012-03-01

    A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na(2)S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5'-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

  1. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  2. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  3. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  4. Using Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis to Assess Microbial Community Structure in Compost Systems

    Science.gov (United States)

    Tiquia, Sonia M.

    Terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR-amplified genes is a widely used fingerprinting technique in composting systems. This analysis is based on the restriction endonuclease digestion of fluorescently end-labeled PCR products. The digested product is mixed with a DNA size standard, itself labeled with a distinct fluorescent dye, and the fragments are then separated by capillary or gel electrophoresis using an automated sequencer. Upon analysis, only the terminal end-labeled restriction fragments are detected. An electropherogram is produced, which shows a profile of compost microbial community as a series of peaks of varying height. This technique has also been effectively used in the exploration of complex microbial environments and in the study of bacterial, archaeal, and eukaryal populations in natural habitats.

  5. Identification of Panulirus homarus puerulus larvae by restriction fragment length polymorphism of mitochondrial cytochrome oxidase I gene.

    Science.gov (United States)

    Dharani, G; Maitrayee, G A; Karthikayalu, S; Kumar, T S; Anbarasu, M; Vijayakumaran, M

    2009-02-01

    Molecular identification of puerulus larvae of Panulirus homarus of the genus Panulirus from Indian coast was studied by employing Polymerase Chain Reaction, Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of the mitochondrial DNA (mtDNA) Cytochrome Oxidase Gene (COI) by agarose gel electrophoresis and Denaturing Gradient Gel Electrophoresis (DGGE). The size of amplified fragment of COI gene was estimated to be approximately 1300 base pairs (bp). Single fragment amplification was recorded during different stages of the life cycle. The RFLP digestion was carried out using five different restriction enzymes (BsplI, HhaI, RsaI, TaqI and AluI). The RFLP profile of the different endonucleases, varied between 1-5 restriction types. RFLP analysis using endonuclease TaqI enabled identification of P. homarus during different stages of its life history.

  6. Coccidioides species determination: does sequence analysis agree with restriction fragment length polymorphism?

    Science.gov (United States)

    Johnson, Suzanne M; Carlson, Erin L; Pappagianis, Demosthenes

    2015-06-01

    Fifteen Coccidioides isolates were previously examined for genetic diversity using restriction fragment length polymorphism (RFLP); two fragment patterns were observed. Two isolates demonstrated one banding pattern (designated RFLP group I), while the remaining 13 isolates demonstrated a second pattern (designated RFLP group II). Recently, molecular studies supported the division of the genera Coccidioides into two species: Coccidioides posadasii and Coccidioides immitis. It has been assumed that the species division corresponds to the RFLP grouping. We tested this hypothesis by amplifying the ribosomal DNA internal transcribed spacer region as well as the dioxygenase, serine proteinase, and urease genes from 13 isolates previously examined by RFLP and then sequencing the PCR products. The appropriate species for each isolate was assigned using phylogenetically informative sites. The RFLP grouping agreed with the Coccidioides species assignment for all but one isolate, which may represent a hybrid. In addition, polymorphic sites among the four genes examined were in agreement for species assignment such that analysis of a single gene may be sufficient for species assignment.

  7. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    Triton X-100 lysis method.17 DNA (1 - 3 ~g) was amplified by. PCR using 1 unit of Taq1 polymerase in 50 ~l of reaction mixture containing polymerase buffer and 1 pmol of oligonucleotides. The primers used were: 5' GAGCGCTCTCGAGGAGTACAC 3' [bp 2238 - 2258] and. 5' GACTGGCTTCCACTGCTGTGC 3' [bp 2956 ...

  8. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  9. Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

    International Nuclear Information System (INIS)

    Ali, M. S.; Latif, Z.

    2016-01-01

    Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

  10. Application of PCR-based restriction fragment length polymorphism for the identification of mycobacterial isolates.

    Science.gov (United States)

    Deepa, P; Therese, K L; Madhavan, H N

    2005-05-01

    Conventional identification of mycobacteria is achieved by standard biochemical tests that are time consuming, laborious and is not always conclusive. This study was thus undertaken to standardize a simple, rapid and cost-effective polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) using primers coding for the 16S - 23S rRNA spacer region to identify the mycobacterial isolates to the species level. The PCR with primers targeting the 16S-23S rRNA spacer region was standardized using the standard mycobacterial strains and applied on 51 clinical isolates. The PCR amplified products were subjected to RFLP using the restriction enzymes, Hae III, MspI and BstXI. The results obtained were compared with those of conventional biochemical tests. PCR was sensitive to detect 2.5 pg of H37Rv DNA (370 bp for slow grower mycobacteria) and 1.5 pg of M. fortuitum DNA (450 bp for rapid grower mycobacteria). Based on the PCRRFLP products obtained the 51 mycobacterial isolates were classified into 41 slow growers and 10 rapid growers. Among the 41 slow growers, 40 were identified as M. tuberculosis, one as M. xenopi and 10 rapid growers as M. fortuitum. PCR using primers targeting the 16S-23S rRNA spacer region was a reliable tool for rapid identification of mycobacterial isolates into slow and rapid growers within 4 h of isolation and further speciation by PCR-RFLP within 6-8 h.

  11. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. High-current relativistic klystron amplifier development for microsecond pulse lengths

    International Nuclear Information System (INIS)

    Fazio, M.V.; Carlsten, B.E.; Faehl, R.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.

    1991-01-01

    Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To data the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modeling are presented

  13. Changes in Mammalian Body Length over 175 Years - Adaptations to a Fragmented Landscape?

    Directory of Open Access Journals (Sweden)

    Niels Martin Schmidt

    2003-12-01

    Full Text Available The potential consequences of anthropogenic habitat fragmentation on species diversity and extinction have drawn considerable attention in recent decades. In many cases, traditional island biogeography theory has been applied to explain the observed patterns. Here, we propose that habitat fragmentation as a selective force can be traced in mammalian body length changes. By exploring historical sources, we are able to show that the body length of Danish mammals has altered over a period of 175 years, possibly in response to increasing habitat fragmentation. The rate of body length change was generally lowest in medium-sized mammals, and increased with both smaller and larger body mass. Small mammals have generally increased, whereas large mammals have decreased in length. In addition to habitat fragmentation, some species may experience other selective forces, such as traffic, and may be trapped in an evolutionary tug-of-war, where the selective forces pull in opposite directions.

  14. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    M.S. Santos

    2010-08-01

    Full Text Available Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP. More specifically: a to evaluate 3 different amplification regions, b to investigate 3 different restriction enzymes, and c to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2 were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  15. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    Science.gov (United States)

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  16. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  17. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  18. Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

    Energy Technology Data Exchange (ETDEWEB)

    Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

    2012-09-15

    Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

  19. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC...

  20. Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome

    DEFF Research Database (Denmark)

    Kveiborg, Marie; Gravholt, Claus Højbjerg; Kassem, M

    2001-01-01

    Clinical and epidemiological studies suggest that premature ageing and increased morbidity and mortality is present in Ullrich-Turner syndrome. We studied telomere restriction fragment length (TRFL) in 30 women with Ullrich-Turner syndrome and 30 age-matched control women. All Turner women had th...

  1. Transposition rates of Mycobacterium tuberculosis IS6110 restriction fragment length polymorphism patterns

    NARCIS (Netherlands)

    Eilers, Paul H. C.; van Soolingen, Dick; Thi Ngoc Lan, Nguyen; Warren, Rob M.; Borgdorff, Martien W.

    2004-01-01

    To determine the rate at which IS6110 restriction fragment length polymorphism (RFLP) patterns in Mycobacterium tuberculosis change over time, we applied a smooth nonparametric survival model to several data sets, including data from previous publications on the rate of change. The results strongly

  2. Use of Restriction Fragment Length Polymorphism of 18S rRNA ...

    African Journals Online (AJOL)

    The restriction fragment length polymorphism (RFLP) pattern of PCR products obtained was the same for T. brucei subspecies: T.b. brucei and T.b. gambiense but different for other trypanosome species and L. donovani. RFLP analysis was also done with genomic DNA from different trypanosome species, subspecies and ...

  3. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  4. Restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene.

    Science.gov (United States)

    Masina, P; Rando, A; Cocozza, S

    1984-10-01

    By Southern blot analysis, a restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene was detected. Two alleles, characterized by 9.7- and 12.4-kb BamHI fragments and by 15.3- and 18.0-kb HindIII fragments, have been detected in a small population of White New Zealand rabbits. The long allele is the most frequent (about 70%). The simultaneous changes in the restriction patterns of the two endonucleases and the constant distance between BamHI and HindIII sites in short and long fragments suggest the possibility that the two alleles arise from a rearrangement phenomenon involving a DNA segment 2.7 kb long. In addition, the presence of the two alleles in individuals genetically unrelated to the White New Zealand breed suggests that this polymorphism is widespread.

  5. Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots.

    Science.gov (United States)

    Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Shinjiro

    2004-10-01

    Contamination with plastid small subunit (SSU) rDNA is a major drawback when analyzing the bacterial communities of plant roots using culture-independent methods. In this study, a polymerase chain reaction (PCR) primer, 783r, was designed and tested to specifically amplify the SSU rDNA of various bacterial species without amplifying the SSU rDNA of plant plastids. To confirm how useful the community analysis of rhizobacteria is using 783r, the terminal restriction fragment length polymorphism (T-RFLP) method was performed with wheat (Triticum aestivum) and spinach (Spinacea oleracea) root samples. Using the standard T-RFLP method, a large T-RF peak of plant plastid SSU rDNA interfered with the bacterial community analysis. In contrast, the T-RFLP method using the 783r primer was able to detect the bacterial DNA while directly eliminating the influence of the plant-derived DNA extracted from the plant roots. Primer 783r might, therefore, be a useful PCR primer for the culture-independent analysis of bacterial communities in plant roots using SSU rDNA.

  6. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  7. Molecular differentiation of Angiostrongylus costaricensis, A. cantonensis, and A. vasorum by polymerase chain reaction- restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2003-01-01

    Full Text Available Angiostrongylus cantonensis, A. costaricensis, and A. vasorum are etiologic agents of human parasitic diseases. Their identification, at present, is only possible by examining the adult worm after a 40-day period following infection of vertebrate hosts with the third-stage larvae. In order to obtain a diagnostic tool to differentiate larvae and adult worm from the three referred species, polymerase chain reaction-restriction fragment length polymorphism was carried out. The rDNA second internal transcribed spacer (ITS2 and mtDNA cytochrome oxidase I regions were amplified, followed by digestion of fragments with the restriction enzymes RsaI, HapII, AluI, HaeIII, DdeI and ClaI. The enzymes RsaI and ClaI exhibited the most discriminating profiles for the differentiation of the regions COI of mtDNA and ITS2 of rDNA respectively. The methodology using such regions proved to be efficient for the specific differentiation of the three species of Angiostrongylus under study.

  8. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. RFLP analysis of a PCR-amplified fragment of the 16S rRNA gene as a tool to identify Enterococcus strains

    Directory of Open Access Journals (Sweden)

    EMD Scheidegger

    2009-11-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of a PCR-amplified fragment of the 16S rRNA gene was performed on reference strains belonging to 21 different enterococcal species and on 75 Enterococcus isolates recovered from poultry meat, pasteurised milk and fresh cheese. PCR amplification generated a 275 bp fragment, which was digested with three restriction endonucleases (DdeI, HaeIII, HinfI. The strains were divided into five groups (groups A-E on the basis of their restriction patterns. Five biochemical tests (arabinose, arginine, manitol, methyl-β-D-glucopyranoside and raffinose were then performed in addition to RFLP analysis to narrow the identification of enterococcal strains to the species level. PCR-RFLP, in conjunction with the selected biochemical tests, allowed the precise identification of the 21 species of Enterococcus included in the present study. This proposed method is relatively simple and rapid and can be useful as an adjunct tool for accurate identification of Enterococcus.

  10. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    OpenAIRE

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction pattern...

  11. Association of restriction fragment length polymorphism in alcohol dehydrogenase 2 gene with alcohol induced liver damage.

    OpenAIRE

    Sherman, D I; Ward, R J; Warren-Perry, M; Williams, R; Peters, T J

    1993-01-01

    OBJECTIVE--To investigate the role of genetically determined differences in the enzymes of alcohol metabolism in susceptibility to liver damage from misusing alcohol. DESIGN--Use of pADH36 probe to study PVU II restriction length fragment polymorphism in alcohol dehydrogenase 2 gene in white alcohol misusers and controls. SETTING--Teaching hospital referral centres for liver disease and alcohol misuse. SUBJECTS--45 white alcohol misusers (38 with alcoholic liver disease) and 23 healthy contro...

  12. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  13. Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

    NARCIS (Netherlands)

    Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

    We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

  14. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  15. Genetic Characterization Of Syrian Erwinia Amylovora Strains By Amplified Fragment Length Polymorphism Technique

    International Nuclear Information System (INIS)

    Ammouneh, H.; Arabi, M.; Shoaib, A.

    2011-01-01

    Thirty Erwinia amylovora strains, collected from the main rosaceous crop-growing regions in Syria, were chosen as representatives of all major pathogenicity groups and were genetically studied by AFLP. Eight primer combinations were utilized and approximately 300 scorable bands in total were generated. Based on similarity coefficient, E. amylovora strains were placed into a main cluster containing two sub clusters, indicating very low genetic variations among the studied pathogen. The existence of two plasmids, pEA29 (present in nearly all E. amylovora isolates) and pEL60 (present mainly in Lebanese strains), was confirmed using multiplex PCR in all tested Syrian E. amylovora strains, indicating that Lebanese and Syrian isolates may share a common origin.(author)

  16. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  17. Modified Terminal Restriction Fragment Analysis for Quantifying Telomere Length Using In-gel Hybridization.

    Science.gov (United States)

    Jenkins, Frank J; Kerr, Charles M; Fouquerel, Elise; Bovbjerg, Dana H; Opresko, Patricia L

    2017-07-10

    There are several different techniques for measuring telomere length, each with their own advantages and disadvantages. The traditional approach, Telomere Restriction Fragment (TRF) analysis, utilizes a DNA hybridization technique whereby genomic DNA samples are digested with restriction enzymes, leaving behind telomere DNA repeats and some sub-telomeric DNA. These are separated by agarose gel electrophoresis, transferred to a filter membrane and hybridized to oligonucleotide probes tagged with either chemiluminescence or radioactivity to visualize telomere restriction fragments. This approach, while requiring a larger quantity of DNA than other techniques such as PCR, can measure the telomere length distribution of a population of cells and allows measurement expressed in absolute kilobases. This manuscript demonstrates a modified DNA hybridization procedure for determining telomere length. Genomic DNA is first digested with restriction enzymes (that do not cut telomeres) and separated by agarose gel electrophoresis. The gel is then dried and the DNA is denatured and hybridized in situ to a radiolabeled oligonucleotide probe. This in situ hybridization avoids loss of telomere DNA and improves signal intensity. Following hybridization, the gels are imaged utilizing phosphor screens and the telomere length is quantified using a graphing program. This procedure was developed by the laboratories of Drs. Woodring Wright and Jerry Shay at the University of Texas Southwestern 1 , 2 . Here, we present a detailed description of this procedure, with some modifications.

  18. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  19. Restriction fragment length polymorphism typing of infectious bursal disease virus field strains in Turkey.

    Science.gov (United States)

    Sareyyüpoğlu, B; Akan, M

    2006-12-01

    Infectious bursal disease (IBD), also known as Gumboro disease, is a highly contagious, immunosuppressive disease of immature chickens. It is caused by IBD virus (IBDV) and is responsible for major economic losses in the poultry industry worldwide. In this study, 280 bursa samples from 56 commercially reared chicken flocks in Turkey with clinical symptoms of IBD were examined for IBDVs using the reverse transcription (RT)-polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) assay. The assay was conducted on a 743-bp fragment of the VP2 gene with the restriction enzymes BstNI, MboI, and SspI. The results indicate the existence of field isolates with new molecular patterns different from those previously published that may well be unique and specific to geographical regions.

  20. Genetic Diversity of African and Worldwide Strains of Ralstonia solanacearum as Determined by PCR-Restriction Fragment Length Polymorphism Analysis of the hrp Gene Region

    Science.gov (United States)

    Poussier, Stephane; Vandewalle, Peggy; Luisetti, Jacques

    1999-01-01

    The genetic diversity among a worldwide collection of 120 strains of Ralstonia solanacearum was assessed by restriction fragment length polymorphism (RFLP) analysis of amplified fragments from the hrp gene region. Five amplified fragments appeared to be specific to R. solanacearum. Fifteen different profiles were identified among the 120 bacterial strains, and a hierarchical cluster analysis distributed them into eight clusters. Each cluster included strains belonging to a single biovar, except for strains of biovars 3 and 4, which could not be separated. However, the biovar 1 strains showed rather extensive diversity since they were distributed into five clusters whereas the biovar 2 and the biovar 3 and 4 strains were gathered into one and two clusters, respectively. PCR-RFLP analysis of the hrp gene region confirmed the results of previous studies which split the species into an “Americanum” division including biovar 1 and 2 strains and an “Asiaticum” division including biovar 3 and 4 strains. However, the present study showed that most of the biovar 1 strains, originating from African countries (Reunion Island, Madagascar, Zimbabwe, and Angola) and being included in a separate cluster, belong to the “Asiaticum” rather than to the “Americanum” division. These African strains could thus have evolved separately from other biovar 1 strains originating from the Americas. PMID:10224018

  1. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  2. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples. Copyright © 2013 Wiley Periodicals, Inc.

  3. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  4. Investigating of yeast species in wine fermentation using terminal restriction fragment length polymorphism method.

    Science.gov (United States)

    Sun, Yue; Liu, Yanlin

    2014-04-01

    The objective of this study was to examine the potential of terminal restriction fragment length polymorphism (T-RFLP) in monitoring yeast communities during wine fermentation and to reveal new information on yeast community of Chinese enology. Firstly, terminal restriction fragment (TRF) lengths database was constructed using 32 pure yeast species. Ten of these species were firstly documented. The species except for Candida vini, Issatchenkia orientalis/Candida krusei, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cerevisiae, Saccharomyces kudriarzevii and Zygosaccharomyces bisporus could be distinguished by the T-RFLP targeting 5.8S-ITS rDNA. Moreover, the yeast communities in spontaneous fermentation of Chardonnay and Riesling were identified by T-RFLP and traditional methods, including colony morphology on Wallerstein Nutrient (WLN) medium and 5.8S-ITS-RFLP analysis. The result showed that T-RFLP profiles of the yeast community correlated well with that of the results identified by the traditional methods. The TRFs with the highest intensity and present in all the samples corresponded to Saccharomyces sp. Other species detected by both approaches were Hanseniaspora uvarum, Metschnikowia pulcherrima, Pichia minuta var. minuta, Saccharomycodes ludwigii/Torulaspora delbrueckii and Candida zemplinina. This study revealed that T-RFLP technique is a rapid and useful tool for monitoring the composition of yeast species during wine fermentation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. The effects of axial length on the fracture and fragmentation of expanding rings

    Directory of Open Access Journals (Sweden)

    Razorenov S.V.

    2012-08-01

    Full Text Available Rings of Ti-6Al-4V with aspect ratios (wall thickness:axial length of 1 : 1, 1 : 2 and 1 : 4 have been expanded to failure at radial strain rates εr ∼ 1 × 104 s−1 using 4340 (EN24T steel and Cu-ETP cylindrical drivers containing a column of RDX. Expansion velocity was measured using VISAR enabling calculation of the stress-strain history of the ring alongside fragment recovery with up to 98% original ring mass recovered. Using the recovered samples average fragment length and mass and final strain have been measured along with analysis of the fracture sites to determine the active failure mechanisms. Perfect rings (aspect ratio 1 : 1 were found to undergo necking before failure, whereas the longer rings failed though ductile tensile cracking at 45∘ to the radius. This data is then compared with finite element analysis results.

  6. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    Science.gov (United States)

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  7. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  8. Genotyping of infectious bursal disease virus strains by restriction fragment length polymorphism analysis of the VP1, VP2, and VP3 genes.

    Science.gov (United States)

    Gomes, A D; Abreu, J T; Redondo, R A F; Martins, N R S; Resende, J S; Resende, M

    2005-12-01

    SUMMARY. This study aimed to genotype infectious bursal disease virus (IBDV) isolates from the Minas Gerais state poultry industry. RNA was extracted from bursae obtained from field cases without passage or commercial vaccines. Genetic subtyping of IBDV isolates and vaccine strains was carried out by the reverse transcriptase-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP) analysis. A 588-bp fragment in the VP1 gene, an 847-bp fragment in the VP2 gene, and a 320-bp fragment in the VP3 gene were amplified by PCR and digested with restriction enzymes PstI and ScaI (VP1); BamHI, BstEII, and PstI (VP2); and NcoI, ScaI, and XbaI (VP3). Our work shows that complementing the clinical history of the outbreaks with RT-PCR followed by RFLP analysis using PstI for VP1, BamHI for VP2, and XbaI for VP3 allowed an accurate classification of a causative agent as a very virulent IBDV.

  9. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  10. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  11. The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

    International Nuclear Information System (INIS)

    Conn, V.

    1987-01-01

    The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

  12. Restriction fragment length polymorphism catalog for molecular identification of Japanese Tetranychus spider mites (Acari: Tetranychidae).

    Science.gov (United States)

    Osakabe, Masahiro; Kotsubo, Yu; Tajima, Ryusen; Hinomoto, Norihide

    2008-08-01

    Species identification is a basic issue in biosecurity. Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) is a useful molecular diagnostic tool for species identification. However, the lack of transferability of data has been a serious shortcoming of this method. A RFLP catalog, i.e., a graph of PCR-RFLP patterns expected from sequence data, was devised as a tool to facilitate PCR-RFLP data sharing among laboratories. Twelve species of Tetranychus spider mites have been recorded in Japan to date. In this study, we analyzed DNA sequences of the internal transcribed spacer (ITS) region in nuclear ribosomal DNA of 11 Tetranychus species. For the species identification using PCR-RFLP, we chose six candidates from 131 restriction endonucleases and developed an RFLP catalog of all known Japanese Tetranychus species except Tetranychus neocaledonicus André. The RFLP catalog revealed that most Tetranychus species had diagnostic restriction fragments. The RFLP catalog is transferable and simple molecular diagnostic tool, and it has the ability to add more species and newly found intraspecific variations. Therefore, we believe that the RFLP catalog will contribute to biosecurity as a practical diagnostic tool for species identification of spider mites.

  13. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  14. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    Science.gov (United States)

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  15. Construction of a high-density genetic map based on large-scale marker development in mango using specific-locus amplified fragment sequencing (SLAF-seq

    Directory of Open Access Journals (Sweden)

    Chun Luo

    2016-08-01

    Full Text Available Genetic maps are particularly important and valuable tools for quantitative trait locus (QTL mapping and marker assisted selection (MAS of plant with desirable traits. In this study, 173 F1 plants from a cross between Mangifera indica L. ‘Jin-Hwang’ and M. indica L. ‘Irwin’ and their parent plants were subjected to high-throughput sequencing and specific-locus amplified fragment (SLAF library construction. After preprocessing, 66.02 Gb of raw data containing 330.64 M reads were obtained. A total of 318,414 SLAFs were detected, of which 156,368 were polymorphic. Finally, 6,594 SLAFs were organized into a linkage map consisting of 20 linkage groups (LGs. The total length of the map was 3148.28 cM and the average distance between adjacent markers was 0.48 cM. This map could be considered, to our knowledge, the first high-density genetic map of mango, and might form the basis for fine QTL mapping and MAS of mango.

  16. Terminal restriction fragment length measurement errors are affected mainly by fragment length, G+C nucleotide content and secondary structure melting point

    Czech Academy of Sciences Publication Activity Database

    Bukovská, Petra; Jelínková, Markéta; Hršelová, Hana; Sýkorová, Zuzana; Gryndler, Milan

    2010-01-01

    Roč. 82, č. 3 (2010), s. 223-228 ISSN 0167-7012 R&D Projects: GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z50200510 Keywords : T-RFLP * drift * DNA fragment Subject RIV: EF - Botanics Impact factor: 2.018, year: 2010

  17. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    International Nuclear Information System (INIS)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

  18. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  19. Use of Restriction Fragment Length Polymorphisms to Investigate Strain Variation Within Neisseria Meningitidis.

    Science.gov (United States)

    Williams, Shelley Diane

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty -six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P ^{32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analysed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population. This analysis demonstrates the lack of structure within Neisseria meningitidis due primarily to a heterogenous population and the lack of geographic segregation. The potential utility of this technique as a

  20. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  1. Heterogeneity among Dermatophilus congolensis isolates demonstrated by restriction fragment length polymorphisms.

    Science.gov (United States)

    Faibra, D T

    1993-01-01

    There is evidence of antigenic diversity and of differences in virulence in Dermatophilus congolensis. For the understanding of the epidemiology of dermatophilosis it is important to distinguish between strains of the organism. Twenty field isolates from cattle in Chad and Cameroon, and an American reference strain, have been examined on restriction fragment length polymorphisms. After restriction enzyme digestion of DNA by BamHI and Southern blotting, a rDNA probe consisting of plasmid pMC5 carrying a 4.8 kb insert of Mycoplasma capricolum DNA coding for the 5S, 23S and part of 16S rRNA allowed to distinguish 6 ribotypes of D. congolensis, based on their hybridized rDNA patterns. Particular ribotypes may be distributed over a wide geographical area. On the other hand, strains belonging to at least 5 different ribotypes may be found in one herd; this may partly explain the lack of success in immunization against dermatophilosis in the field.

  2. Using terminal restriction fragment length polymorphism (T-RFLP) to identify mycorrhizal fungi: a methods review.

    Science.gov (United States)

    Dickie, I A; FitzJohn, R G

    2007-06-01

    Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. In this paper, we review the technique as it is used to identify species of mycorrhizal fungi and distinguish two different versions of the technique: peak-profile T-RFLP (the original version) and database T-RFLP. We define database T-RFLP as the use of T-RFLP to identify individual species within samples by comparison of unknown data with a database of known T-RFLP patterns. This application of T-RFLP avoids some of the pitfalls of peak-profile T-RFLP and allows T-RFLP to be applied to polyphyletic functional groups such as ectomycorrhizal fungi. The identification of species using database T-RFLP is subject to several sources of potential error, including (1) random erroneous matches of peaks to species, (2) shared T-RFLP profiles across species, and (3) multiple T-RFLP profiles within a species. A mathematical approximation of the risk of the first type of error as a function of experimental parameters is discussed. Although potentially less accurate than some other methods such as clone libraries, the high throughput of database T-RFLP permits much greater replication and may, therefore, be preferable for many ecological questions, particularly when combined with other techniques such as cloning.

  3. Mycobacterium tuberculosis complex differentiation using gyrB-restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Erica Chimara

    2004-11-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC members are causative agents of human and animal tuberculosis. Differentiation of MTBC members is required for appropriate treatment of individual patients and for epidemiological purposes. Strains from six MTBC species - M. tuberculosis, M. bovis subsp. bovis, M. bovis BCG, M. africanum, M. pinnipedii, and "M. canetti" - were studied using gyrB-restriction fragment length polymorphism (gyrB-RFLP analysis. A table was elaborated, based on observed restriction patterns and published gyrB sequences. To evaluate applicability of gyrB-RFLP at Instituto Adolfo Lutz, São Paulo, Mycobacterial Reference Laboratory, 311 MTBC clinical isolates, previously identified using traditional methods as M. tuberculosis (306, M. bovis (3, and M. bovis BCG (2, were analyzed by gyrB-RFLP. All isolates were correctly identified by the molecular method, but no distinction between M. bovis and M. bovis BCG was obtained. Differentiation of M. tuberculosis and M. bovis is of utmost importance, because they require different treatment schedules. In conclusion, gyrB-RFLP is accurate and easy-to-perform, with potential to reduce time needed for conventional differentiation methods. However, application for epidemiological studies remains limited, because it cannot differentiate M. tuberculosis from M. africanum subtype II, and "M. canetti", M. africanum subtype I from M. pinnipedii, and. M. bovis from M. bovis BCG.

  4. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  5. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, J; Lundgren, B

    2000-01-01

    are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

  6. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...

  7. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  8. Novel polymerase chain reaction-restriction fragment length polymorphism assay to determine internal transcribed spacer-2 group in the Chagas disease vector, Triatoma dimidiata (Latreille, 1811

    Directory of Open Access Journals (Sweden)

    Bethany Richards

    2013-06-01

    Full Text Available Triatoma dimidiata is the most important Chagas disease insect vector in Central America as this species is primarily responsible for Trypanosoma cruzi transmission to humans, the protozoan parasite that causes Chagas disease. T. dimidiata sensu lato is a genetically diverse assemblage of taxa and effective vector control requires a clear understanding of the geographic distribution and epidemiological importance of its taxa. The nuclear ribosomal internal transcribed spacer 2 (ITS-2 is frequently used to infer the systematics of triatomines. However, oftentimes amplification and sequencing of ITS-2 fails, likely due to both the large polymerase chain reaction (PCR product and polymerase slippage near the 5' end. To overcome these challenges we have designed new primers that amplify only the 3'-most 200 base pairs of ITS-2. This region distinguishes the ITS-2 group for 100% of known T. dimidiata haplotypes. Furthermore, we have developed a PCR-restriction fragment length polymorphism (RFLP approach to determine the ITS-2 group, greatly reducing, but not eliminating, the number of amplified products that need to be sequenced. Although there are limitations with this new PCR-RFLP approach, its use will help with understanding the geographic distribution of T. dimidiata taxa and can facilitate other studies characterising the taxa, e.g. their ecology, evolution and epidemiological importance, thus improving vector control.

  9. Length heterogeneity of amplified circular rDNA molecules in oocytes of the house cricket Acheta domesticus (Orthoptera: Gryllidae).

    Science.gov (United States)

    Cave, M D

    1979-02-13

    Amplification of the genes coding for rRNA occurs in the oocytes of a wide variety of organisms. The amplification process appears to be mediated through a rolling-circle mechanism. The approximate molecular weight of the smallest rDNA circles is equivalent to the estimated combined molecular weight of DNA which codes for a single ribosomal RNA precursor molecule and an associated non-transcribed spacer DNA sequence. RNA-DNA hybridization studies carried out on oocytes of the house cricket, Acheta domesticus, suggest that DNA coding for rRNA accounts for only a small fraction of the rDNA satellite, all of which is amplified in the oocyte. In order to test the possibility that the remainder of the amplified rDNA represents spacer and to determine whether a rolling-circle mechanism might also be involved in amplification in A. domesticus oocytes, rDNA was isolated from ovaries of A. domesticus and spread for electron microscopy. A large proportion of the rDNA isolated from ovaries is circular, while main-band DNA and rDNA prepared from other tissues demonstrates few if any circles. The mean size of the smallest rDNA circles is approximately 8 times longer than the length estimated for DNA which codes for 18S and 28 S rRNA. Denaturation mapping shows the rDNA circles to contain two major readily denaturing regions located about equidistant from one another on the circle. Each readily denaturing region accounts for 4--6% of the total DNA in the circle. The fact that only 12% of the average molecule is required to code for A. domesticus 18S and 28S rRNA is consistent with the hybridization data. Considerable size heterogeneity exists in the length of the smallest class of rDNA molecules. In the rDNA of other species such heterogeneity has been shown to reside in the non-transcribed spacer.

  10. Genetic diversity for restriction fragment length polymorphisms and heterosis for two diallel sets of maize inbreds.

    Science.gov (United States)

    Melchinger, A E; Lee, M; Lamkey, K R; Hallauer, A R; Woodman, W L

    1990-10-01

    Changes that may have occurred over the past 50 years of hybrid breeding in maize (Zea maize L.) with respect to heterosis for yield and heterozygosity at the molecular level are of interest to both maize breeders and quantitative geneticists. The objectives of this study were twofold: The first, to compare two diallels produced from six older maize inbreds released in the 1950's and earlier and six newer inbreds released during the 1970's with respect to (a) genetic variation for restriction fragment length polymorphisms (RFLPs) and (b) the size of heterosis and epistatic effects, and the second, to evaluate the usefulness of RFLP-based genetic distance measures in predicting heterosis and performance of single-cross hybrids. Five generations (parents, F1; F2, and backcrosses) from the 15 crosses in each diallel were evaluated for grain yield and yield components in four Iowa environments. Genetic effects were estimated from generation means by ordinary diallel analyses and by the Eberhart-Gardner model. Newer lines showed significantly greater yield for inbred generations than did older lines but smaller heterosis estimates. In most cases, estimates of additive x additive epistatic effects for yield and yield components were significantly positive for both groups of lines. RFLP analyses of inbred lines included two restriction enzymes and 82 genomic DNA clones distributed over the maize genome. Eighty-one clones revealed polymorphisms with at least one enzyme. In each set, about three different RFLP variants were typically found per RFLP locus. Genetic distances between inbred lines were estimated from RFLP data as Rogers' distance (RD), which was subdivided into general (GRD) and specific (SRD) Rogers' distances within each diallel. The mean and range of RDs were similar for the older and newer lines, suggesting that the level of heterozygosity at the molecular level had not changed. GRD explained about 50% of the variation among RD values in both sets. Cluster

  11. Restriction fragment length polymorphism pattern of Mycobacterium isolates from rodents in infected cattle farms.

    Science.gov (United States)

    Alizadeh, Khatereh; Mosavari, Nader; Nazari, Razieh

    2016-12-01

    Mycobacterium tuberculosis, the etiologic agent of tuberculosis, causes large-scale morbidity and mortality, particularly in developing countries. In recent years, there has been a significant increase in the drug-resistant ability of M. tuberculosis, triggering a major public health crisis. A detailed analysis of the evolution of the mycobacterial genome helps to better understand the genotype-phenotype relationship in this bacterium. Different strain typing methods have already revealed the worldwide diversity of mycobacterial isolates. Therefore, DNA-fingerprinting tools have been developed to improve tuberculosis case detection and control. Molecular typing techniques allow to detect and follow the spread of individual strains of the M. tuberculosis complex (MTC), complementing conventional epidemiological methods. Among these techniques, restriction fragment length polymorphism (RFLP) has been considered the standard method for genotyping of MTC. The aim of this work was to isolate M. tuberculosis from rodents in cattle farms contaminated with MTC located in the city of Booin-Zahra, Iran. A total of 100 samples were collected from the rodents in the contaminated farms and analyzed for the presence of Mycobacterium by growing the samples on Lowenstein-Jensen medium. All isolates were further identified by RFLP and DNA hybridization studies. As much as five samples showed the presence of Mycobacterium and these were subjected to PCR-16SrRNA, PCR-IS6110, and RD Typing (RD1, RD4, RD9, and RD12) methods. Further differentiation was performed with PvuII digestion (RFLP) and DNA hybridization using the polymorphic guanine/cytosine-rich repetitive sequences (PGRS) probe. The PGRS probe results classified two of the isolates as belonging to one cluster, whereas the remaining isolates were classified as belonging to different clusters. An analysis of the obtained genetic pattern and a comparison of these patterns with the genetic pattern of other infected farms allowed

  12. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  13. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

    2012-01-01

    The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

  14. Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene.

    Science.gov (United States)

    Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

    2015-01-01

    Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species.

  15. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  16. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  17. Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus.

    Science.gov (United States)

    Passinho-Soares, Helna; Felix, Durvalina; Kaplan, Maria Auxiliadora; Margis-Pinheiro, Marcia; Margis, Rogério

    2006-08-01

    In Brazil, Plectranthus species are known as "boldo" and have been used in popular medicine for analgesic and dyspeptic purposes. Plectranthus need to be well identified in order to be used as commercially genuine medicinal plants. Here we describe AFLP DNA patterns able to distinguish among different Pectranthus species. The genetic variability of P. grandis Cramer, P. barbatus Andr. and P. ornatus Codd was analyzed with two sets of AFLP primers allowing detection of 241 loci. A total of 22 monomorphic loci were identified in P. barbatus, 15 in P. grandis and 30 in P. ornatus. Among these, 5 loci were informative and species-specific to P. barbatus, 3 to P. grandis and 2 loci were unique to P. ornatus. The AFLP pattern analyzed by different clustering methods assembled individuals according to their species. So far, AFLP represents a genuine and strong method to certify medicinal plant materials.

  18. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  19. Origin of Spanish invasion by the zebra mussel, Dreissena polymorpha (Pallas, 1771) revealed by amplified fragment length polymorphism (AFLP) fingerprinting

    NARCIS (Netherlands)

    Rajagopal, S.; Pollux, B.J.A.; Peters, J.L.; Cremers, G.; Moon- van der Staay, S.Y.; Alen, van T.; Eygensteyn, J.; Hoek, van A.H.A.M.; Palau, A.; Vaate, de A.B.; Velde, van der G.

    2009-01-01

    The zebra mussel, Dreissena polymorpha is an aquatic nuisance invasive species originally native to the Ponto-Caspian region where it is found in lakes and delta areas of large rivers draining into the Black and Caspian seas. The dispersal of D. polymorpha began at the end of the 18th century, at a

  20. Delineation of Campylobacter concisus genomospecies by amplified fragment length polymorphism analysis and correlation of results with clinical data

    DEFF Research Database (Denmark)

    Aabenhus, R.; On, Stephen L.W.; Siemer, Berit L.

    2005-01-01

    frequently isolated from immunocompetent patients and/or patients without concomitant infections that presented with fever, chronic diarrhea, and gut inflammation than was genomospecies 1, clustering with the type strain of oral origin. Bloody diarrhea was recorded only with C. concisus genomospecies 2......Campylobacter concisus has been as frequently isolated from human diarrhea as the important enteropathogen Campylobacter jejuni, but it also occurs in the feces of healthy individuals. The role of C concisus in human disease has been difficult to determine, since the species comprises at least two......, and numerical analysis of these data distributed the strains among four clusters. The clustering was of taxonomic significance: two clusters contained, respectively, the type strain (of oral origin) and a reference strain (from diarrhea) of each of the known genomospecies. Genomospecies 2 strains were more...

  1. GENETIC DIVERSITY OF VIBRIO CHOLERAE IN CHESAPEAKE BAY DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  2. GENETIC DIVERSITY OF CLINICAL AND ENVIRONMENTAL ISOLATES OF VIBRIO CHOLERAE DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  3. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  4. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  5. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    International Nuclear Information System (INIS)

    Szafer, F.; Brautbar, C.; Tzfoni, E.

    1987-01-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQβ, DQα, and DRβ cDNA probes. Hybridization with the DQβ probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQα and DRβ probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease

  6. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  7. A Population Genetics Study of Anopheles Darlingi (Diptera: Culicidae) from Colombia Based on Random Amplified Polymorphic DNA-Polymerase Chain Reaction and Amplified Fragment Length Polymorphism Markers

    Science.gov (United States)

    2007-06-01

    of Aedes aegypti from Puerto Rico, Apostol et aI. (1996) found an expected heterozygosity of 0.354. similar to that found by Posso et al. (2003) in An...ing on the marker type used. In Ae. aegypt ; from Trinidad and Tobago, they found that the heterozygosity observed with the Rt-:LPs was significantly...Reiter P, Miller BR 1996. Population genctics with RAPD-PCR markers: thc breeding structurc of Aedes aeRypt; in Puerto Rico. Heredity 76: 325-334

  8. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5...

  9. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  10. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt......-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes...

  11. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  12. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  13. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  14. Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

    Science.gov (United States)

    Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

    2015-01-01

    Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Differentiation of mixed lactic acid bacteria communities in beverage fermentations using targeted terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Bokulich, Nicholas A; Mills, David A

    2012-08-01

    Lactic acid bacteria (LAB) are an important group of bacteria in beer and wine fermentations both as beneficial organisms and as spoilage agents. However, sensitive, rapid, culture-independent methods for identification and community analyses of LAB in mixed-culture fermentations are limited. We developed a terminal restriction fragment length polymorphism (TRFLP)-based assay for the detection and identification of lactic acid bacteria and Bacilli during wine, beer, and food fermentations. This technique can sensitively discriminate most species of Lactobacillales, and most genera of Bacillales, in mixed culture, as indicated by both bioinformatic predictions and empirical observations. This method was tested on a range of beer and wine fermentations containing mixed LAB communities, demonstrating the efficacy of this technique for discriminating LAB in mixed culture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...

  17. Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils.

    Science.gov (United States)

    Edel-Hermann, Véronique; Dreumont, Christiane; Pérez-Piqueres, Ana; Steinberg, Christian

    2004-03-01

    Monitoring the structure and dynamics of fungal communities in soils under agricultural and environmental disturbances is currently a challenge. In this study, a terminal restriction fragment length polymorphism (T-RFLP) fingerprinting method was developed for the rapid comparison of fungal community structures. The terminal restriction fragment polymorphism of different regions of the small-subunit (SSU) ribosomal RNA (rRNA) gene was simulated by sequence comparison using 10 restriction enzymes, and analyzed among three different soils using fungal-specific primers. Polymerase chain reaction amplification of the 3' end of the SSU rRNA gene with the primer nu-SSU-0817-5' and with the fluorescently labelled primer nu-SSU-1536-3', and digestion of the amplicons with AluI and MboI were found to be optimal and were used in a standardized T-RFLP procedure. Both the number and the intensity of terminal restriction fragments detected by capillary gel electrophoresis were integrated in correspondence analyses. Three soils with contrasting physicochemical properties were differentiated according to the structure of their fungal communities. Assessment of the impact on the fungal community structure of the amendment of two soils with compost or manure confirmed the reproducibility and the sensitivity of the method. Shifts in the community structure were detected between non-amended and amended soil samples. In both soils, the shift differed with the organic amendment applied. In addition, the fungal community structures of the two soils were affected in a different way by the same organic amendment. The fingerprinting method provides a rapid tool to investigate the effect of various perturbations on the fungal communities in soils.

  18. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  19. Characterization of Bois noir isolates by restriction fragment length polymorphism of a Stolbur-specific putative membrane protein gene.

    Science.gov (United States)

    Pacifico, D; Alma, A; Bagnoli, B; Foissac, X; Pasquini, G; Tessitori, M; Marzachì, C

    2009-06-01

    Bois noir phytoplasma (BNp), widespread in wine-producing areas of Europe and endemic in France and Italy, is classified in the 16SrXII-A subgroup, whose members are referred to as Stolbur phytoplasmas. The 16S rDNA gene of Stolbur phytoplasma shows low variability, and few non-ribosomal genes are available as markers to assess variation among isolates. We used the Stolbur-specific stol-1H10 gene, encoding a putative membrane-exposed protein, to investigate genetic diversity of French and Italian BNp isolates from plants and insects. Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp isolates were more variable than Italian ones, and different profiles were present in infected grapevines from France and Italy. Isolate V3, most abundant among Italian affected grapes but present among French ones, was found in one Urtica dioica sample and in all H. obsoletus collected on this species. Four Italian-specific profiles were represented among infected Convolvulus arvensis, the most frequent of which (V12) was also detected in H. obsoletus collected on this species. Most of the variability in the stol-1H10 sequence was associated with type II on the tuf gene.

  20. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  1. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  2. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  3. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  4. Use of mgc2-polymerase chain reaction-restriction fragment length polymorphism for rapid differentiation between field isolates and vaccine strains of Mycoplasma gallisepticum in Israel.

    Science.gov (United States)

    Lysnyansky, Inna; Garcia, Maricarmen; Levisohn, Sharon

    2005-06-01

    Increasing use of Mycoplasma gallisepticum (MG) live vaccines has led to a need for a rapid test for differentiation of MG field strains from the live vaccine strains ts-11 and 6/85. We examined the differentiating potential of diagnostic polymerase chain reaction (PCR) primers targeted to the gene mgc2, encoding a cytadherence-related surface protein uniquely present in MG. The mgc2-PCR diagnostic primers are specific for MG in tests of all avian mycoplasmas or bacteria present in the chicken trachea and are sensitive enough to readily detect MG in tracheal swabs from field outbreaks. Differentiation of vaccine strain ts-11 was based on identification of restriction enzyme sites in the 300-base-pair (bp) mgc2-PCR amplicon present in ts-11 and missing in MG isolates from field outbreaks in Israel. Restriction sites for the enzymes HaeII and SfaN1 were identified in the amplified region in strain ts-11 and were not found in 28 field isolates of MG, comprising a representative cross section of all the MG isolates from the period 1997-2003. In practice, differential diagnosis of MG is achieved within 1 day of submission of tracheal swab samples by mgc2-PCR amplification and restriction of the amplicon with HaeII, giving a 270-bp fragment for ts-11 or no restriction for other MG strains tested. Application of the mgc2-PCR-restriction fragment length polymorphism (mgc2-PCR-RFLP) assay enabled differential diagnosis of both components of a mixture of ts-11 and non-ts-11 DNA, detecting the field strain in the presence of a large excess of ts-11. The test was successfully applied in vivo for monitoring vaccinates in a ts-11 vaccine trial. In principle, the test may also be used to identify the 6/85 vaccine strain, which yields a 237-bp product, readily differentiated from the approximately 300-bp PCR product of all other strains tested. Further testing of field isolates will be necessary to determine the applicability of this test in the United States and other countries.

  5. Use of Full-Length Recombinant Calflagin and Its C Fragment for Improvement of Diagnosis of Trypanosoma cruzi Infection†

    Science.gov (United States)

    Marcipar, Iván S.; Roodveldt, Cintia; Corradi, Gerardo; Cabeza, María L.; Brito, Maria Edileuza F.; Winter, Lucile M. Floeter; Marcipar, Alberto J.; Silber, Ariel M.

    2005-01-01

    Serological diagnosis of Trypanosoma cruzi infection is hampered by issues related to test specificity due to the cross-reactivity of most antigens with proteins of related parasites such as Leishmania spp. The recombinant calflagins are considered relevant antigens for the diagnosis of infection by Trypanosoma cruzi. In the present work, we describe two genes coding for putative calflagins in Leishmania major with the N-terminal moieties presenting high similarity with T. cruzi genes. This fact raised questions about their role in some cross-recognition of this antigen by sera from Leishmania spp.-infected individuals. The complete T. cruzi calflagin and two fragments of the protein, consisting of 146 amino acids of the N-terminal and 65 amino acids of the C-terminal regions, were expressed and evaluated against a panel of sera, which included well-characterized samples from T. cruzi, and Leishmania-infected patients. We were able to show that sera from Leishmania (Viannia) braziliensis-infected individuals recognized the recombinant full-length calflagin. Both the N-terminal and the complete protein presented the same high sensitivity (98.5% of sera from T. cruzi-infected patients was detected) but different specificities (94% and 98%, respectively, when evaluated against sera from people not infected by T. cruzi, including 15 sera from people infected with L. braziliensis). The C-terminal fragment presented low sensitivity (70%) but 100% specificity. We propose the use of these antigens in two sequential assays to optimize the serological diagnosis of T. cruzi infection in humans in geographic areas where Leishmania spp. infection is coendemic. PMID:16272476

  6. Close correlation between restriction fragment length polymorphism of the L-MYC gene and metastasis of human lung cancer to the lymph nodes and other organs

    International Nuclear Information System (INIS)

    Kawashima, Kazuko; Shikama, Hiroshi; Imoto, Kazuhiko; Izawa, Mitsuo; Nishimura, Susumu; Naruke, Tsuguo; Okabayashi, Kenzo

    1988-01-01

    Restriction length fragment polymorphism of the L-MYC gene was examined in DNAs from lung cancer tissues and normal tissues of 51 Japanese patients with lung cancer. In individual patients, no difference was seen between the restriction length fragments of the two alleles of L-MYC [6-kilobase (kb)] and 10-kb fragments in EcoRI digests in lung cancer tissues and normal tissues. But a striking correlation was found between the restriction length fragment polymorphism pattern of L-MYC and the extent of metastasis, particularly to the lymph nodes at the time of surgery: Patients with only the L band (10 kb) had few lymph node metastatic lesions, whereas patients with either the S band (6 kb) or the S and L bands almost always had lymph node metastatic lesion. A similar correlation was found between the presence of the S band and metastases to other organs. This correlation was particularly marked in cases of adenocarcinoma. These results indicate a clear genetic influence on metastases and a consequent poor prognosis for certain patients of lung cancer; L-MYC restriction length fragment polymorphism is thus shown to be a useful marker for predicting the metastatic potential of human lung cancer

  7. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

    Directory of Open Access Journals (Sweden)

    A.C. Panunto

    2003-10-01

    Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  8. The effect of varying the peptide linker length in a single chain variable fragment antibody against wogonin glucuronide.

    Science.gov (United States)

    Paudel, Madan Kumar; Sakamoto, Seiichi; Van Huy, Le; Tanaka, Hiroyuki; Miyamoto, Tomofumi; Morimoto, Satoshi

    2017-06-10

    Peptide linkers of three different lengths were constructed to join the variable regions of the heavy chain (VH) and the light chain (VL) in a single-chain variable fragment antibody (scFv) specific for wogonin glucuronide (Wgn) that has the structure VH-(GGGGS) n -VL (n=3, 5, or 7). The scFv antibodies, which were expressed in Escherichia coli, were derived from an anti-Wgn monoclonal antibody (315A). An indirect competitive enzyme-linked immunosorbent assay (icELISA) was used to evaluate their reactivity and sensitivity, which is also used for quantitative analysis of Wgn. Our results, showed that the reactivity and specificity of the three different scFvs were, in fact, similar. Subsequently, the scFv having a VH-(GGGGS) 3 -VL linker which was slightly better that other two scFvs against Wgn, was applied to indirect competitive ELISA (icELISA) to analyze Scutellariae Radix (S. Radix). The utility of the icELISA was demonstrated for quality control and analysis of S. Radix in this report. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-07-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  10. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    Energy Technology Data Exchange (ETDEWEB)

    Severson, D.W.; Thathy, V.; Mori, A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  11. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  12. Prevalence of Trichomonas spp. in domestic pigeons in Shandong Province, China, and genotyping by restriction fragment length polymorphism.

    Science.gov (United States)

    Jiang, Xiyue; Sun, Jingjing; Wang, Fangkun; Li, Hongmei; Zhao, Xiaomin

    2016-05-01

    Oropharyngeal swabs (n = 609) were collected randomly from 80,000 domestic pigeons (Columba livia domestica) on five pigeon farms and at one pigeon slaughterhouse in Shandong Province, China, from September 2012 to July 2013. Trichomonas spp. were detected in 206/609 (33.8%) samples. The prevalence was 14.9-31.1%, depending on different levels of sanitation and management, and was 4.8% in nestling pigeons, 13.6% in breeding pigeons and 35.2% in adolescent pigeons. Trichomonas gallinae genotypes A and B, and Trichomonas tenax-like isolates were identified by PCR-restriction fragment length polymorphism (RFLP) analysis and sequencing of the 5.8S rDNA-internal transcribed spacer (ITS) regions. RFLP analysis with the restriction enzyme BsiEI generated different RFLP band patterns between T. gallinae and T.tenax-like isolates. When BsiEI RFLP analysis was combined with HaeIII RFLP analysis, all infection types of T. gallinae and T.tenax-like isolates could be identified. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  14. Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Diaz R

    2001-01-01

    Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

  15. Intra-specific variability of hindlimb length in the palmate newt: an indicator of population isolation induced by habitat fragmentation?

    Science.gov (United States)

    Trochet, Audrey; Le Chevalier, Hugo; Baillat, Boris; Barthe, Laurent; Pottier, Gilles; Calvez, Olivier; Ribéron, Alexandre; Blanchet, Simon

    2016-04-01

    Habitat fragmentation is one of the main drivers of global amphibian decline. Anthropogenic landscape elements can act as barriers, hindering the dispersal that is essential for maintaining gene flow between populations. Dispersal ability can be influenced by locomotor performance, which in turn can depend on morphological traits, such as hindlimb length (HLL) in amphibians. Here, we tested relationships between HLL and environmental variables--road types, forests and agricultural lands--among 35 sub-populations of palmate newts (Lissotriton helveticus) in southwestern France. We expected roads to select for short-legged newts due to a higher mortality of more mobile individuals (long-legged newts) when crossing roads. Accordingly, short-legged newts were found in the vicinity of roads, whereas long-legged newts were found closer to forests and in ponds close geographically to another water body. HLL in newts was hence influenced by habitat types in a heterogeneous landscape, and could therefore be used as an indicator of population isolation in a meta-population system. © 2016 The Author(s).

  16. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    Science.gov (United States)

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  17. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  18. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  19. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    Science.gov (United States)

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of

  20. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    Energy Technology Data Exchange (ETDEWEB)

    Szafer, F.; Brautbar, C.; Tzfoni, E.; Frankel, G.; Sherman, L.; Cohen, I.; Hacham-Zadeh, S.; Aberer, W.; Tappeiner, G.; Holubar, K.; Steinman, L.

    1987-09-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ..beta.., DQ..cap alpha.., and DR..beta.. cDNA probes. Hybridization with the DQ..beta.. probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ..cap alpha.. and DR..beta.. probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease.

  1. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

    2013-01-01

    In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

  2. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

    NARCIS (Netherlands)

    Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

    2013-01-01

    BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

  3. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  4. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  5. On the power to detect differences between male and female mutation rates for Duchenne muscular dystrophy, using classical segregation analysis and restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Karel, E.R.; te Meerman, G J; Ten Kate, L P

    The power to detect departures from the theoretical proportion of new mutants in X-linked lethal disorders has been analyzed for several types of segregation analysis, including methods based on completely linked restriction fragment length polymorphisms. It is shown that all methods require large

  6. Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

    Science.gov (United States)

    Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

    2014-03-01

    Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

  7. M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Good Michael F

    2005-10-01

    Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

  8. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  9. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.

    Directory of Open Access Journals (Sweden)

    Hideki Shojo

    Full Text Available Polymerase chain reaction-amplified product length polymorphism (PCR-APLP is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  10. Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing

    Directory of Open Access Journals (Sweden)

    Qiaojun Jia

    2017-08-01

    Full Text Available Black barley is caused by phytomelanin synthesized in lemma and/or pericarp and the trait is controlled by one dominant gene Blp1. The gene is mapped on chromosome 1H by molecular markers, but it is yet to be isolated. Specific-locus amplified fragment sequencing (SLAF-seq is an effective method for large-scale de novo single nucleotide polymorphism (SNP discovery and genotyping. In the present study, SLAF-seq with bulked segregant analysis (BSA was employed to obtain sufficient markers to fine mapping Blp1 gene in an F2 population derived from Hatiexi No.1 × Zhe5819. Based on SNP screening criteria, a total of 77,542 polymorphic SNPs met the requirements for association analysis. Combining two association analysis methods, the overlapped region with a size of 32.41 Mb on chromosome 1H was obtained as the candidate region of Blp1 gene. According to SLAF-seq data, markers were developed in the target region and were used for mapping the Blp1 gene. Linkage analysis showed that Blp1 co-segregated with HZSNP34 and HZSNP36, and was delimited by two markers (HZSNP35 and HZSNP39 spanning 8.1 cM in 172 homozygous yellow grain F2 plants of Hatiexi No.1 × Zhe5819. More polymorphic markers were screened in the reduced target region and were used to genotype the population. As a result, Blp1 was delimited within a 1.66 Mb on chromosome 1H by the upstream marker HZSNP63 and the downstream marker HZSNP59. Our results demonstrated the utility of SLAF-seq-BSA approach to identify the candidate region and discover polymorphic markers at the specific targeted genomic region.

  11. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  12. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    OpenAIRE

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length ...

  13. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis. Part 1: Fungal field study

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Tor P. Schultz; Susan V. Dieh

    2012-01-01

    The effects of chlorothalonil (CTN), butylated hydroxytoluene (BHT), and ammoniacal copper quat (ACQ-C) on the fungal community on southern yellow pine (SYP) were assessed using terminal restriction fragment length polymorphism (T-RFLP) analysis over 15 months. Field stakes, treated with 0.25 and 0.37 % ACQ-C, 0.1 and 0.25 % CTN, 2 % BHT alone, 0.1 and 0.25 % CTN...

  14. Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

    Science.gov (United States)

    Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

    2004-02-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

  15. The First High-Density Genetic Map Construction in Tree Peony (Paeonia Sect. Moutan) using Genotyping by Specific-Locus Amplified Fragment Sequencing.

    Science.gov (United States)

    Cai, Changfu; Cheng, Fang-Yun; Wu, Jing; Zhong, Yuan; Liu, Gaixiu

    2015-01-01

    Genetic linkage maps, permitting the elucidation of genome structure, are one of most powerful genomic tools to accelerate marker-assisted breeding. However, due to a lack of sufficient user-friendly molecular markers, no genetic linkage map has been developed for tree peonies (Paeonia Sect. Moutan), a group of important horticultural plants worldwide. Specific-locus amplified fragment sequencing (SLAF-seq) is a recent molecular marker development technology that enable the large-scale discovery and genotyping of sequence-based marker in genome-wide. In this study, we performed SLAF sequencing of an F1 population, derived from the cross P. ostti 'FenDanBai' × P. × suffruticosa 'HongQiao', to identify sufficient high-quality markers for the construction of high-density genetic linkage map in tree peonies. After SLAF sequencing, a total of 78 Gb sequencing data and 285,403,225 pair-end reads were generated. We detected 309,198 high-quality SLAFs from these data, of which 85,124 (27.5%) were polymorphic. Subsequently, 3518 of the polymorphic markers, which were successfully encoded in to Mendelian segregation types, and were in conformity with the criteria of high-quality markers, were defined as effective markers and used for genetic linkage mapping. Finally, we constructed an integrated genetic map, which comprised 1189 markers on the five linkage groups, and spanned 920.699 centiMorgans (cM) with an average inter-marker distance of 0.774 cM. There were 1115 'SNP-only' markers, 18 'InDel-only' markers, and 56 'SNP&InDel' markers on the map. Among these markers, 450 (37.85%) showed significant segregation distortion (P < 0.05). In conclusion, this investigation reported the first large-scale marker development and high-density linkage map construction for tree peony. The results of this study will serve as a solid foundation not only for marker-assisted breeding, but also for genome sequence assembly for tree peony.

  16. Fiber Amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten

    2017-01-01

    The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

  17. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  18. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  19. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism...... analysis. The method was used to compare ORF 1 sequences of two divergent European-type PRRSV strains. Our results indicated that the structural and replicase parts of these two strains had evolved at overall similar rates....

  20. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  1. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  2. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  3. TARC: Carlo Rubbia's Energy Amplifier

    CERN Multimedia

    Laurent Guiraud

    1997-01-01

    Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

  4. Molecular epidemiology of contagious bovine pleuropneumonia in Tanzania based on amplified fragment length polymorphism and pulsed-field gel electrophoresis analysis

    DEFF Research Database (Denmark)

    Kusiluka, L.J.M.; Ojeniyi, B.; Friis, N.F.

    2001-01-01

    anti vaccine strains. The strong genomic homogeneity among, M. mycoides SC strains associated with outbreaks of contagious bovine pleuropneumonia in different regions of Tanzania suggests that the outbreaks of the disease in the 1990-99 period might have been caused Ly a single epidemic clone. Moreover...

  5. Genome-wide assessment of population structure and genetic diversity and development of a core germplasm set for sweet potato based on specific length amplified fragment (SLAF) sequencing.

    Science.gov (United States)

    Su, Wenjin; Wang, Lianjun; Lei, Jian; Chai, Shasha; Liu, Yi; Yang, Yuanyuan; Yang, Xinsun; Jiao, Chunhai

    2017-01-01

    Sweet potato, Ipomoea batatas (L.) Lam., is an important food crop that is cultivated worldwide. However, no genome-wide assessment of the genetic diversity of sweet potato has been reported to date. In the present study, the population structure and genetic diversity of 197 sweet potato accessions most of which were from China were assessed using 62,363 SNPs. A model-based structure analysis divided the accessions into three groups: group 1, group 2 and group 3. The genetic relationships among the accessions were evaluated using a phylogenetic tree, which clustered all the accessions into three major groups. A principal component analysis (PCA) showed that the accessions were distributed according to their population structure. The mean genetic distance among accessions ranged from 0.290 for group 1 to 0.311 for group 3, and the mean polymorphic information content (PIC) ranged from 0.232 for group 1 to 0.251 for group 3. The mean minor allele frequency (MAF) ranged from 0.207 for group 1 to 0.222 for group 3. Analysis of molecular variance (AMOVA) showed that the maximum diversity was within accessions (89.569%). Using CoreHunter software, a core set of 39 accessions was obtained, which accounted for approximately 19.8% of the total collection. The core germplasm set of sweet potato developed will be a valuable resource for future sweet potato improvement strategies.

  6. Operation amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2008-01-01

    To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

  7. Development of a polymerase chain reaction/restriction fragment length polymorphism method for Saccharomyces cerevisiae and Saccharomyces bayanus identification in enology.

    Science.gov (United States)

    Masneuf, I; Aigle, M; Dubourdieu, D

    1996-05-01

    Several yeast strains of the species Saccharomyces cerevisiae, S. bayanus and S. paradoxus, first identified by hybridization experiments and measurements of DNA/DNA homology, were characterized using polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) analysis of the MET2 gene. There was no exception to the agreement between this method and classical genetic analyses for any of the strains examined, so PCR/RFLP of the MET2 gene is a reliable and fast technique for delimiting S. cerevisiae and S. bayanus. Enological strains classified as S. bayanus, S. chevalieri, and S. capensis gave S. cerevisiae restriction patterns, whereas most S. uvarum strains belong to S. bayanus. Enologists should no longer use the name of S. bayanus for S. cerevisiae Gal strains, and should consider S. bayanus as a distinct species.

  8. Genetic Typing of Bovine Viral Diarrhoea Virus (BVDV by Restriction Fragment Length Polymorphism (RFLP and Identification of a New Subtype in Poland

    Directory of Open Access Journals (Sweden)

    Kuta Aleksandra

    2015-04-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis was developed for genetic typing of Polish strains of bovine viral diarrhoea virus (BVDV. The method was applied using 60 BVDV isolates, which included BVDV genotype 1, subtypes a, b, d, e, f, and g, and genotype 2a. RT-PCR products of the 5’untranslated region (5’UTR were digested using three enzymes. Restriction patterns classified the strains into seven groups, each with a specific and different pattern from other subtypes. These findings were confirmed by nucleotide sequencing and phylogenetic analysis. The results suggest that RFLP analysis is a simple, reliable, and fast genotyping method for BVDV strains in comparison with sequencing. This method can distinguish six subtypes of BVDV-1 including a new subtype 1e, identified exclusively by this method, and it allows differentiation of BVDV-1 from BVDV-2 genotype.

  9. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  10. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  11. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A...

  12. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A......Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...

  13. Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example.

    Science.gov (United States)

    Yang, Zhi-Hui; Huang, Ji-Xiang; Yao, Yi-Jian

    2007-12-01

    A molecular method based on PCR-restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) ribosomal DNA sequences was designed to rapidly identify fungal species, with members of the genus Pleurotus as an example. Based on the results of phylogenetic analysis of ITS sequences from Pleurotus, a PCR-RFLP endonuclease autoscreening (PRE Auto) program was developed to screen restriction endonucleases for discriminating multiple sequences from different species. The PRE Auto program analyzes the endonuclease recognition sites and calculates the sizes of the fragments in the sequences that are imported into the program in groups according to species recognition. Every restriction endonuclease is scored through the calculation of the average coefficient for the sequence groups and the average coefficient for the sequences within a group, and then virtual electrophoresis maps for the selected restriction enzymes, based on the results of the scoring system, are displayed for the rapid determination of the candidate endonucleases. A total of 85 haplotypes representing 151 ITS sequences were used for the analysis, and 2,992 restriction endonucleases were screened to find the candidates for the identification of species. This method was verified by an experiment with 28 samples representing 12 species of Pleurotus. The results of the digestion by the restriction enzymes showed the same patterns of DNA fragments anticipated by the PRE Auto program, apart from those for four misidentified samples. ITS sequences from 14 samples (of which nine sequences were obtained in this study), including four originally misidentified samples, confirmed the species identities revealed by the PCR-RFLP analysis. The method developed here can be used for the identification of species of other living microorganisms.

  14. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  15. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  16. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  17. Development of PCR primers based on a fragment from randomly amplified polymorphic DNA for the detection of Escherichia coli O157:H7/NM.

    Science.gov (United States)

    Lin, Chien-Ku; Lin, Jia-Chi

    2007-06-01

    Serotype O157:H7 of EHEC is by far the most prevalent serotype associated with haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS). Although PCR methods aimed on the detection of genes associated with the pathogenicity of Escherichia coli O157:H7 have been reported, tests allowing the direct identification of this serotype are rare. In this study, we used RAPD-PCR tests to analyze strains of E. coli O157:H7 serotype, strains of non-pathogenic E. coli, and strains of other pathotypes, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), and enteroaggregation E. coli (EAggEC). One RAPD fragment co-shared by serotype O157:H7 strains was observed when 10-mer primer termed as OPQ3 was used. After sequencing this fragment, three primers were designed and combined to form two PCR primer pairs. These two primer pairs were highly specific to the strains belonging to E. coli O157:H7/NM (non-motile).

  18. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  19. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Chain-amplified photochemical fragmentation of N-alkoxypyridinium salts: proposed reaction of alkoxyl radicals with pyridine bases to give pyridinyl radicals.

    Science.gov (United States)

    Shukla, Deepak; Adiga, Shashishekar P; Ahearn, Wendy G; Dinnocenzo, Joseph P; Farid, Samir

    2013-03-01

    Photoinduced electron transfer to N-alkoxypyridiniums, which leads to N–O bond cleavage and alkoxyl radical formation, is highly chain amplified in the presence of a pyridine base such as lutidine. Density functional theory calculations support a mechanism in which the alkoxyl radicals react with lutidine via proton-coupled electron transfer (PCET) to produce lutidinyl radicals (BH•). A strong electron donor, BH• is proposed to reduce another alkoxypyridinium cation, leading to chain amplification, with quantum yields approaching 200. Kinetic data and calculations support the formation of a second, stronger reducing agent: a hydrogen-bonded complex between BH• and another base molecule (BH•···B). Global fitting of the quantum yield data for the reactions of four pyridinium salts (4-phenyl and 4-cyano with N-methoxy and N-ethoxy substituents) led to a consistent set of kinetic parameters. The chain nature of the reaction allowed rate constants to be determined from steady-state kinetics and independently determined chain-termination rate constants. The rate constant of the reaction of CH3O• with lutidine to form BH•, k1, is ~6 × 10(6) M(–1) s(–1); that of CH3CH2O• is ~9 times larger. Reaction of CD3O• showed a deuterium isotope effect of ~6.5. Replacing lutidine by 3-chloropyridine, a weaker base, decreases k1 by a factor of ~400.

  1. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  2. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2011-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

  3. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, S.; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

  4. Amplifier Distortion

    Science.gov (United States)

    Keeports, David

    2006-12-01

    By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

  5. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    Science.gov (United States)

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  6. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Huyen Mai NT

    2013-02-01

    Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.

  7. Application of restriction fragment length polymorphism analysis to simple and rapid genotyping of bovine viral diarrhea virus strains isolated in Japan.

    Science.gov (United States)

    Seki, Yoshihisa; Seimiya, Yukio M; Motokawa, Masato; Yaegashi, Gakuji; Nagai, Makoto; Hayashi, Michiko

    2008-04-01

    The E2 regions of 177 bovine viral diarrhea virus (BVDV) strains isolated in Japan between 1957 and 2006 were analyzed for genotyping. The strains were classified into 8 genotypes (1a, 1b, 1c, 1d, 1e, 1f, So and 2a) based on the phylogenetic analysis. The restriction fragment length polymorphism (RFLP) analysis of the RT-PCR products using 6 selected enzymes (Apo I, Mly I, BstAP I, Pvu II, Ear I, EcoR V) disclosed the cutting patterns classified into 11 groups (I-XI), each of that consisted of strains belonging to a single genotype. Namely, groups-I and -II were composed by genotype-1a strains, groups-III and -IV by 1b strains, and groups-V and -VI by 1c strains. Other groups-VII, -VIII, -IX, -X and -XI comprised genotypes-1d, -1e, -1f, -So and -2a strains, respectively. The results suggest that the RFLP analysis can simply and rapidly differentiate the 8 genotypes of BVDV strains.

  8. [Establishing a new genotyping method of hepatitis B virus by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) to analysis on S region and its application].

    Science.gov (United States)

    Peng, Liang; Ding, Jing-Juan; Zhang, Li-Sha

    2004-08-01

    To establish a new polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method of genotyping HBV using Mbo I, BsTN I, BsmA I, Hpa II and investigate the relationship between genotype and clinical spectrum of hepatitis B. 124 full-genomic HBV sequences and 13 S-genomic sequences were analyzed, genotype specific regions were identified by the restriction enzymes Mbo I, BsTN I, BsmA I, Hpa II. And 176 samples from different kinds of hepatitis B were genotyped by this method. Five samples had been randomly selected and directly sequenced their S gene, to assess the accuracy. In 176 serum samples of patients with hepatitis B from Guizhou area, genotype B and C were found in 56.8% and 43.2% respectively. The proportions of genotype B and C in ASC were 40.0% and 15.7% (chi-square = 12.16, P < 0.005); and they were 31.6% and 14.0% in CHB (chi-square = 7.88, P < 0.005). Genotyping HBV, based on S gene RFLP seems to be highly sensitive, differential and accurate and could be used in large-scale surveys. HBV genotype B and C are existed in Guizhou area.

  9. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  10. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  11. Genetic Characterization of Campylobacter Jejuni and C. coli Isolated From Broilers Using flaA PCR-Restriction Fragment Length Polymorphism Method in Shiraz, Southern Iran.

    Science.gov (United States)

    Khoshbakht, Rahem; Tabatabaei, Mohammad; Hosseinzadeh, Saeid; Shirzad Aski, Hesamaddin; Seifi, Saeed

    2015-05-01

    Thermophilic campylobacters, particularly Campylobacter jejuni and C. coli are the main agents of human campylobacteriosis. Campylobacter contaminated chicken products is the most important source of foodborne gastroenteritis. Evaluation of genetic diversity among Campylobacter population is critical for understanding the epidemiology of this bacterium and developing effective control strategies against Campylobacter infections and other related disorders. The aim of this study was to investigate the polymorphism of thermophilic Campylobacter isolated from broiler fecal samples in Shiraz, southern Iran. Ninety Campylobacter isolates were recovered from broiler feces using enrichment process followed by cultivation method. The isolates were species typing on the basis of polymerase chain reaction (PCR) detection of 16SrRNA and multiplex PCR for determining two thermophilic species. To evaluate strain diversity of thermophilic Campylobacter isolates, flaA PCR-Restriction Fragment Length Polymorphism (RFLP) was performed using DdeI restriction enzyme. All 90 Campylobacter isolates confirmed by m-PCR were successfully typed using flaA-PCR-RFLP. Eleven different types were defined according to flaA-typing method and the RFLP patterns were located at three separate clusters in RFLP image analysis dendrogram. Campylobacter jejuni isolates significantly showed more variety than C. coli isolates. A relatively low genetic diversity existed among C. jejuni and C. coli isolated from broilers in Shiraz, southern Iran. In our knowledge, this was the first report of genetic diversity among broiler originated human pathogen thermophilic campylobacters in Shiraz, southern Iran.

  12. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    Science.gov (United States)

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  13. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    NARCIS (Netherlands)

    Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  14. Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

    NARCIS (Netherlands)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  15. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  16. Molecular identification of Mycobacterium tuberculosis complex by region of differentiation-typing and polymerase chain reaction-restriction fragment length polymorphism method.

    Science.gov (United States)

    Mirzaki, Seydeh Zeinab; Mosavari, Nader; Nazari, Razieh; Akbarian, Morteza

    2016-12-01

    Tuberculosis (TB) is one of the most common zoonotic infectious diseases in the world. Identification of Mycobacterium isolates is essential for proper treatment of TB. The aim of this study was to identify Mycobacterium isolates collected from TB patients in Alborz Province, Iran, by region of differentiation (RD)-typing. Fifty samples from tuberculosis patients were cultured in pyruvate and glycerinated Lowenstein-Jensen medium. DNA was extracted from the isolates by the van Solingen method and subjected to polymerase chain reaction (PCR)-16SrRNA, PCR-IS6110, and RD-typing with primers RD1, RD4, RD9, and RD12, respectively. Out of 50 isolates, only one isolate appeared negative in IS6110-PCR and was considered nontuberculosis complex. The remaining isolates gave PCR products of approximately 543bp, 245bp, 146bp, 172bp, 235bp, and 369bp with 16s-rRNA, IS6110-PCR, RD-1, RD-4, RD-9, and RD-12 PCR, respectively. PCR-restriction fragment length polymorphism of oxyR pseudogene confirmed the results. All isolates except one from Alborz Province appeared positive for Mycobacterium tuberculosis. Based on the obtained results, all isolates except one were identified as M. tuberculosis. The only negative isolate appeared 93% and 97% similar to Nocardia or Mycobacterium sp. (Mycobacterium neoaurum), respectively, based on sequencing and alignment of 16s-rRNA and hsp65. Accurate identification of Mycobacterium isolates is of utmost importance for proper and immediate treatment of TB patients. In this study, RD-typing appeared to be a suitable method for correct identification of M. tuberculosis isolates. Copyright © 2016.

  17. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  18. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  19. Isolates of Ureplasma diversum genotyped by single-enzyme amplified length polymorphism Tipagem genotípica de estirpes de Ureplasma diversum por meio da amplificação de fragmentos polimórficos com única enzima (SE-AFLP

    Directory of Open Access Journals (Sweden)

    Melissa Buzinhani

    2007-03-01

    Full Text Available Isolates of Ureaplasma diversum recovered from bovines with reproductive disorders and healthy ones of four premises were compared by SE-AFLP. Twenty-eight SE-AFLP profiles without monomorphic fragments were obtained. The ureaplasma studied were divided in clusters A and B. Cluster A was divided in subclusters A1 and A2, while A1 was divided in subclusters A1a and A1b. Cluster B grouped only the reference strains. The clusters obtained were not associated with the reproductive disorders. The dendrogram obtained showed high heterogeneity among the studied ureaplasmas and indicated a low genomic stability as detected in other species of microorganisms of class Mollicutes.Cepas de referência e 30 estirpes de Ureaplasma diversum isoladas do muco vaginal de bovinos apresentando ou não distúrbios reprodutivos, de quatro diferentes propriedades, foram comparadas por meio da metodologia da SE-AFLP (single-enzyme amplified fragment length polymorphism. Foram obtidos 28 perfis, com ausência de fragmentos monomórficos. No dendrograma, as amostras foram divididas em grupos A e B. O grupo A foi subdividido em A1 e A2 e o A1 dividiu-se em A1a e A1b. As amostras de referência formaram o grupo B. Não houve diferenciação entre as estirpes isoladas de animais doentes ou sadios. Evidenciou-se grande heterogeneidade entre os ureaplasmas estudados indicando baixa estabilidade genômica, como detectado em outras espécies dos microrganismos da classe Mollicutes.

  20. Diversity of nitrite reductase (nirK and nirS) gene fragments in forested upland and wetland soils

    DEFF Research Database (Denmark)

    Priemé, Anders; Braker, Gesche; Tiedje, James M.

    2002-01-01

    The genetic heterogeneity of nitrite reductase gene (nirK and nirS) fragments from denitrifying prokaryotes in forested upland and marsh soil was investigated using molecular methods. nirK gene fragments could be amplified from both soils, whereas nirS gene fragments could be amplified only from...... the marsh soil. PCR products were cloned and screened by restriction fragment length polymorphism (RFLP), and representative fragments were sequenced. The diversity of nirK clones was lower than the diversity of nirS clones. Among the 54 distinct nirK RFLP patterns identified in the two soils, only one...... marsh clones and all upland clones. Only a few of the nirK clone sequences branched with those of known denitrifying bacteria. The nirS clones formed two major clusters with several subclusters, but all nirS clones showed less than 80% identity to nirS sequences from known denitrifying bacteria. Overall...

  1. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  2. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  3. Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

    1999-09-01

    In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

  4. Identification of Human T-lymphotropic Virus Type I (HTLV-I Subtypes Using Restrited Fragment Length Polymorphism in a Cohort of Asymptomatic Carriers and Patients with HTLV-I-associated Myelopathy/tropical Spastic Paraparesis from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Aluisio AC Segurado

    2002-04-01

    Full Text Available Although human T-lymphotropic virus type I (HTLV-I exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV, genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, using restricted fragment length polymorphism (RFLP analysis of long terminal repeat (LTR HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%, cosmopolitan C (7.1% and cosmopolitan E (3.6% subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.

  5. Gamma-irradiation of homodeoxyoligonucleotides 32P-labelled at one end: computer simulation of the chain length distribution of the radioactive fragments

    International Nuclear Information System (INIS)

    Teoule, R.; Duplaa, A.M.

    1987-01-01

    Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)

  6. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  7. Distribution of two DNA restriction fragment length polymorphisms (RFLPs) corresponding to Ag(c/g) and Ag(al/d) of the apo B gene in the Orang Asli (aborigines) of West Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Candlish, J.K.; Gajra, B; Saha, N. [National Univ. of Singapore, Kuala Lumpur (Malaysia)] [and others

    1994-09-01

    One hundred and ninety five subjects of the Semai group of Orang Asli in peninsular Malaysia were examined for the distribution of Ag(c/g) and Ag(al/d) RFLPs of the apoB gene. Regions of apoB gene corresponding to nt 421 and 1981 representing these two Ags were amplified by polymerase chain reaction using primers of published sequences. Thr{sub 71} to Ile (Ag c/g) was detected as an ApaL I RFLP and Val{sub 591} to Ala (Ag al/d) by Alu I RFLP. DNA fragments were separated by 4% agarose gel electrophoresis and photographed over a UV transilluminator. The frequencies of Ag(d) (absence of ApaL I site) and Ag(d) (presence of Alu I site) were found to be 0.13 and 0.14, respectively, in the Orang Asli compared to frequencies of 0.30 and 0.45 in the Caucasian population. Distribution of the genotypes of these two polymorphisms was at Hardy-Weinberg equiilibrium.

  8. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  10. Transient processes in high-power gas laser amplifiers

    Energy Technology Data Exchange (ETDEWEB)

    Bakanina, L.P.; Belonuchkin, V.E.; Kozel, S.M.; Kuznetsov, E.P.; Lokshin, T.R.

    1980-01-01

    A system of equations is derived which describes the laser onset process in a high-gain gas laser amplifier. The intrinsic, amplified spontaneous emission plays the determinate role in the transient processes. The transient processes for a HeFe (3.39 micrometers) laser amplifier are calculated on a computer for three amplifier lengths (40, 80 and 200 centimeters) with the instantaneous onset of inversion.

  11. Analysis of the locus D1S80 by amplified fragment length polymorphism technique (AMP-FLP). Frequency distribution in Danes. Intra and inter laboratory reproducibility of the technique

    DEFF Research Database (Denmark)

    Thymann, M; Nellemann, L J; Masumba, G

    1993-01-01

    -FLP) analysis of the D1S80 locus demonstrated 21 alleles and a heterozygosity of 77%. Of the 231 possible phenotypes, 57 were observed. All mother/child pairs shared at least one D1S80 allele. The D1S80 typing results in 70 Danes were compared to the results obtained on the same samples in another laboratory...

  12. Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bergmans, A

    2002-01-01

    Infections (EWGLI) AFLP types, (ii). describes the EWGLI AFLP types identified for the 130 strains in the EWGLI culture collection, and (iii). reports the results of a newly introduced international programme of proficiency testing. Following preliminary analysis of 20 epidemiologically unrelated isolates...... (recorded as AFLP type 001-016 or untypeable) was determined by participants with reference to these 16 AFLP types, either visually or using gel analysis software where available, and reported to the coordinating centre. Nine of the 12 strains, including an epidemiologically related pair and two pairs...

  13. Amplifier for nuclear spectrometry

    International Nuclear Information System (INIS)

    Suarez Canner, E.

    1996-01-01

    The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

  14. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  15. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  16. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  17. RF power amplifiers

    CERN Document Server

    Albulet, Mihai

    2001-01-01

    This text presents a full account of RF amplifiers and provides a thorough understanding of power amplifier principles and their applications. This comprehensive book covers all important design techniques for power amplifiers and includes mathematical derivations and the assumptions used to develop design rules.

  18. Use of PCR-restriction fragment length polymorphism analysis to identify the main new world Leishmania species and analyze their taxonomic properties and polymorphism by application of the assay to clinical samples.

    Science.gov (United States)

    Rotureau, Brice; Ravel, Christophe; Couppié, Pierre; Pratlong, Francine; Nacher, Mathieu; Dedet, Jean-Pierre; Carme, Bernard

    2006-02-01

    At least 13 characterized Leishmania species are known to infect humans in South America. Five of these parasites are transmitted in the sylvatic ecotopes of the whole French Guianan territory and responsible for cutaneous leishmaniasis. For the diagnosis of cutaneous leishmaniasis, restriction fragment length polymorphism (RFLP) analyses have shown promising results. Thus, the end of the small subunit and internal transcribed spacer 1 of the rRNA genes were sequenced and targeted by PCR-RFLP analysis in the 10 main New World (NW) Leishmania species from the two subgenera. Then, the procedure was tested on 40 samples from patients with cutaneous leishmaniasis, and its results were compared with those of conventional methods. (i) The results of this simple genus-specific method were in agreement with those of previous isoenzyme analyses. (ii) This method distinguished the most medically relevant Leishmania species with only one enzyme (RsaI). (iii) This method could be performed directly on human biopsy specimens (sensitivity of 85.7%). Performing NW Leishmania species typing rapidly and easily in the field constitutes a very valuable improvement for detection of Leishmania spp. Revealing great diversity with several enzymes, this method could also be useful for taxonomic, ecological, and epidemiological studies in space and time.

  19. SPS RF System Amplifier plant

    CERN Multimedia

    1977-01-01

    The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

  20. 'Length'at Length

    Indian Academy of Sciences (India)

    Admin

    He was interested to know how `large' is the set of numbers x for which the series is convergent. Here large refers to its length. But his set is not in the class ♢. Here is another problem discussed by Borel. Consider .... have an infinite collection of pairs of new shoes and want to choose one shoe from each pair. We have an ...

  1. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  2. Analysis of Bacterial Communities in the Rhizosphere of Chrysanthemum via Denaturing Gradient Gel Electrophoresis of PCR-Amplified 16S rRNA as Well as DNA Fragments Coding for 16S rRNA†

    Science.gov (United States)

    Duineveld, Bernadette M.; Kowalchuk, George A.; Keijzer, Anneke; van Elsas, Jan Dirk; van Veen, Johannes A.

    2001-01-01

    The effect of developing chrysanthemum roots on the presence and activity of bacterial populations in the rhizosphere was examined by using culture-independent methods. Nucleic acids were extracted from rhizosphere soil samples associated with the bases of roots or root tips of plants harvested at different stages of development. PCR and reverse transcriptase (RT) PCR were used to amplify 16S ribosomal DNA (rDNA) and 16S rRNA, respectively, and the products were subjected to denaturing gradient gel electrophoresis (DGGE). Prominent DGGE bands were excised and sequenced to gain insight into the identities of predominantly present (PCR) and predominantly active (RT-PCR) bacterial populations. The majority of DGGE band sequences were related to bacterial genera previously associated with the rhizosphere, such as Pseudomonas, Comamonas, Variovorax, and Acetobacter, or typical of root-free soil environments, such as Bacillus and Arthrobacter. The PCR-DGGE patterns observed for bulk soil were somewhat more complex than those obtained from rhizosphere samples, and the latter contained a subset of the bands present in bulk soil. DGGE analysis of RT-PCR products detected a subset of bands visible in the rDNA-based analysis, indicating that some dominantly detected bacterial populations did not have high levels of metabolic activity. The sequences detected by the RT-PCR approach were, however, derived from a wide taxonomic range, suggesting that activity in the rhizosphere was not determined at broad taxonomic levels but rather was a strain- or species-specific phenomenon. Comparative analysis of DGGE profiles grouped all DNA-derived root tip samples together in a cluster, and within this cluster the root tip samples from young plants formed a separate subcluster. Comparison of rRNA-derived bacterial profiles showed no grouping of root tip samples versus root base samples. Rather, all profiles derived from 2-week-old plant rhizosphere soils grouped together regardless of

  3. Wireless Josephson amplifier

    International Nuclear Information System (INIS)

    Narla, A.; Sliwa, K. M.; Hatridge, M.; Shankar, S.; Frunzio, L.; Schoelkopf, R. J.; Devoret, M. H.

    2014-01-01

    Josephson junction parametric amplifiers are playing a crucial role in the readout chain in superconducting quantum information experiments. However, their integration with current 3D cavity implementations poses the problem of transitioning between waveguide, coax cables, and planar circuits. Moreover, Josephson amplifiers require auxiliary microwave components, like directional couplers and/or hybrids, that are sources of spurious losses and impedance mismatches that limit measurement efficiency and amplifier tunability. We have developed a wireless architecture for these parametric amplifiers that eliminates superfluous microwave components and interconnects. This greatly simplifies their assembly and integration into experiments. We present an experimental realization of such a device operating in the 9–11 GHz band with about 100 MHz of amplitude gain-bandwidth product, on par with devices mounted in conventional sample holders. The simpler impedance environment presented to the amplifier also results in increased amplifier tunability.

  4. Characterization of gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism: gut microbiota could be a diagnostic marker of coronary artery disease.

    Science.gov (United States)

    Emoto, Takuo; Yamashita, Tomoya; Kobayashi, Toshio; Sasaki, Naoto; Hirota, Yushi; Hayashi, Tomohiro; So, Anna; Kasahara, Kazuyuki; Yodoi, Keiko; Matsumoto, Takuya; Mizoguchi, Taiji; Ogawa, Wataru; Hirata, Ken-Ichi

    2017-01-01

    The association between atherosclerosis and gut microbiota has been attracting increased attention. We previously demonstrated a possible link between gut microbiota and coronary artery disease. Our aim of this study was to clarify the gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism (T-RFLP). This study included 39 coronary artery disease (CAD) patients and 30 age- and sex- matched no-CAD controls (Ctrls) with coronary risk factors. Bacterial DNA was extracted from their fecal samples and analyzed by T-RFLP and data mining analysis using the classification and regression algorithm. Five additional CAD patients were newly recruited to confirm the reliability of this analysis. Data mining analysis could divide the composition of gut microbiota into 2 characteristic nodes. The CAD group was classified into 4 CAD pattern nodes (35/39 = 90 %), while the Ctrl group was classified into 3 Ctrl pattern nodes (28/30 = 93 %). Five additional CAD samples were applied to the same dividing model, which could validate the accuracy to predict the risk of CAD by data mining analysis. We could demonstrate that operational taxonomic unit 853 (OTU853), OTU657, and OTU990 were determined important both by the data mining method and by the usual statistical comparison. We classified the gut microbiota profiles in coronary artery disease patients using data mining analysis of T-RFLP data and demonstrated the possibility that gut microbiota is a diagnostic marker of suffering from CAD.

  5. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    Science.gov (United States)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841

  6. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  7. Assessment of nucleic acid modification induced by amotosalen and ultraviolet A light treatment of platelets and plasma using real-time polymerase chain reaction amplification of variable length fragments of mitochondrial DNA.

    Science.gov (United States)

    Bakkour, Sonia; Chafets, Daniel M; Wen, Li; Dupuis, Kent; Castro, Grace; Green, Jennifer M; Stassinopoulos, Adonis; Busch, Michael P; Lee, Tzong-Hae

    2016-02-01

    Pathogen inactivation methods are increasingly used to reduce the risk of infections after transfusion of blood products. Photochemical treatment (PCT) of platelets (PLTs) and plasma with amotosalen and ultraviolet A (UVA) light inactivates pathogens and white blood cells through formation of adducts between amotosalen and nucleic acid that block replication, transcription, and translation. The same adducts block the amplification of nucleic acids using polymerase chain reaction (PCR) in a manner that correlates with the number of adducts formed, providing a direct quality control (QC). Current QC measures for PCT rely on indirect methods that measure the delivered UVA dose or percent residual amotosalen after illumination, rather than directly measuring nucleic acid modification. Endogenous mitochondrial DNA (mtDNA), which is detectable in PLT and plasma units, was chosen as a target for the quantification of photochemically induced modifications. DNA was extracted from untreated or amotosalen and UVA-treated PLTs or plasma, and mtDNA fragments of variable lengths were quantified using a real-time PCR inhibition assay. PCT induced increasing real-time PCR inhibition of mtDNA amplification for larger amplicon sizes. Amplification was unaffected by treatment with amotosalen or UVA alone, whereas up to 3 log inhibition was observed after PCT. Blinded PCR testing of a panel of 110 samples each, from PLT or plasma components prepared for routine use within a blood center, allowed 100% discrimination between untreated and treated units. Our initial findings indicate that an adequately sensitive, quantitative real-time PCR inhibition assay targeting mtDNA could provide a valuable tool to confirm and monitor PCT. © 2015 The Authors. Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  8. Evaluation of the Epidemiological Relevance of Variable-Number Tandem-Repeat Genotyping of Mycobacterium bovis and Comparison of the Method with IS6110 Restriction Fragment Length Polymorphism Analysis and Spoligotyping†

    Science.gov (United States)

    Allix, Caroline; Walravens, Karl; Saegerman, Claude; Godfroid, Jacques; Supply, Philip; Fauville-Dufaux, Maryse

    2006-01-01

    Sources of Mycobacterium bovis contamination remain unclear for many cases of animal and human disease. A major limitation is the lack of sufficiently informative or epidemiologically well evaluated molecular methods for typing. Here, we report an evaluation of a high-throughput method based on 29 mycobacterial interspersed repetitive unit-variable-number tandem-repeat (MIRU-VNTR) loci to genotype 127 M. bovis isolates from cattle from 77 different Belgian farms, representative of a nationwide collection obtained from 1995 to 2003. MIRU-VNTR stability was demonstrated by analyzing a series of 74 isolates in total, obtained from different animals from a single farm or from different farms with an identified epidemiological link. The genotyping results and the genotypic diversity (h) were compared with those obtained by IS6110 restriction fragment length polymorphism (RFLP) analysis and spoligotyping. Among 68 isolates with no known epidemiological link, MIRU-VNTR typing discriminated better than either RFLP analysis or spoligotyping, with isolates taken individually (32 versus 16 and 17 genotypes; h = 0.91 versus 0.73 and 0.85, respectively) or in combination (32 versus 28 genotypes; h = 0.91 versus 0.92). Maximal resolution was already achieved with a subset of 9 loci. The observed congruence of the genetic relationships based on IS6110 RFLP analysis, spoligotyping, and MIRU-VNTR markers is consistent with a clonal population structure of M. bovis. These results support MIRU-VNTR typing as a convenient and discriminatory technique for analysis of the population structure of M. bovis in much greater detail and for addressing some still unresolved issues in the epidemiology of the pathogen. PMID:16757584

  9. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  10. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  11. Antares laser power amplifier

    International Nuclear Information System (INIS)

    Stine, R.D.; Ross, G.F.; Silvernail, C.

    1979-01-01

    The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

  12. Digital automatic gain amplifier

    Science.gov (United States)

    Holley, L. D.; Ward, J. O. (Inventor)

    1978-01-01

    A circuit is described for adjusting the amplitude of a reference signal to a predetermined level so as to permit subsequent data signals to be interpreted correctly. The circuit includes an operational amplifier having a feedback circuit connected between an output terminal and an input terminal; a bank of relays operably connected to a plurality of resistors; and a comparator comparing an output voltage of the amplifier with a reference voltage and generating a compared signal responsive thereto. Means is provided for selectively energizing the relays according to the compared signal from the comparator until the output signal from the amplifier equals to the reference signal. A second comparator is provided for comparing the output of the amplifier with a second voltage source so as to illuminate a lamp when the output signal from the amplifier exceeds the second voltage.

  13. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning

    OpenAIRE

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the ta...

  14. Auto-Zero Differential Amplifier

    Science.gov (United States)

    Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

    2017-01-01

    An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

  15. A Study on Campylobacter jejuni and Campylobacter coli through Commercial Broiler Production Chains in Thailand: Antimicrobial Resistance, the Characterization of DNA Gyrase Subunit A Mutation, and Genetic Diversity by Flagellin A Gene Restriction Fragment Length Polymorphism.

    Science.gov (United States)

    Thomrongsuwannakij, Thotsapol; Blackall, Patrick J; Chansiripornchai, Niwat

    2017-06-01

    chain reaction-restriction fragment length polymorphism of the flagellin A gene (flaA-RFLP) to determine their genetic relationships. Ten distinct clusters were recognized by flaA-RFLP typing. The results showed that horizontal transmission was the major route of Campylobacter transmission in this study. In conclusion, the emergence of MDR and high resistance rates to several antimicrobials are major concerns identified in this study. The prudent use of these agents and active surveillance of resistance at the farm level are essential steps to reduce the public health risks identified in this work.

  16. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  17. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  18. An efficient method for generation and subcloning of tandemly repeated DNA sequences with defined length, orientation and spacing.

    Science.gov (United States)

    Jiang, S W; Trujillo, M A; Eberhardt, N L

    1996-08-15

    Tandemly repeated DNA sequences generated from single synthetic oligonucleotide monomers are useful for many purposes. With conventional ligation procedures low yields and random orientation of oligomers makes cloning of defined repeated sequences difficult. We solved these problems using 2 bp overhangs to direct orientation and random incorporation of linkers containing restriction sites during ligation. Ligation products are amplified by PCR using the linker oligonucleotides as primers. Restriction digestion of the PCR products generate multimer distributions whose length is controlled by the monomer/linker ratio. The concatenated DNA fragments of defined length, orientation and spacing can be directly used for subcloning or other applications without further treatment.

  19. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    ‘Engaging Through Architecture’ in 2015 by Aarhus School of Architecture as a part of the Ventura Lambrate Milan Design Week, where it was exhibited under the name Concrete. The fundamental pool of techniques and knowledge that set the agenda for the fragment was established before the intentions...

  20. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    to create architectural meaning and give character to an architecture of fragmentation. Layers are both seen as conceptual as well as material frames which define certain strong properties or meanings in the architectural work. Defining layers is a way of separating and organizing; it both defines...

  1. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  2. Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

    Directory of Open Access Journals (Sweden)

    Roberto A. Caffaro-Filho

    2007-12-01

    Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

  3. Noise in Optical Amplifiers

    DEFF Research Database (Denmark)

    Jeppesen, Palle

    1997-01-01

    Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

  4. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    the Eskimo and Danish populations. Significant differences were observed between the distribution of fragments ('alleles') in Greenland Eskimos and in Danes. The allele MBP-A7 was considerably more frequent in Eskimos (0.2214) than in Danes (0.0775) and also the allele MBP-B9 was considerably more frequent......DNA from the double short tandem repeat (STR) system MBP (locus 18q23-pter) was amplified by the polymerase chain reaction (PCR) and the two polymorphic repeat systems were separated by cutting with the restriction enzyme NlaIII. The lengths of the DNA fragments of the two MBP STR systems MBP...

  5. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    or from a position as business leader to a position in the state apparatus or in the Party and vice versa. To conceptualize the coexistence of the contradicting forces for further enterprise autonomy and continued central control that characterizes the evolving relationship between business groups...... and the Party-state, I suggest the notion of integrated fragmentation....

  6. Electrospun amplified fiber optics.

    Science.gov (United States)

    Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

    2015-03-11

    All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

  7. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  8. Fast pulse amplifier

    International Nuclear Information System (INIS)

    Lepetit, J.; Poussier, E.

    1984-01-01

    This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

  9. A micropower electrocardiogram amplifier.

    Science.gov (United States)

    Fay, L; Misra, V; Sarpeshkar, R

    2009-10-01

    We introduce an electrocardiogram (EKG) preamplifier with a power consumption of 2.8 muW, 8.1 muVrms input-referred noise, and a common-mode rejection ratio of 90 dB. Compared to previously reported work, this amplifier represents a significant reduction in power with little compromise in signal quality. The improvement in performance may be attributed to many optimizations throughout the design including the use of subthreshold transistor operation to improve noise efficiency, gain-setting capacitors versus resistors, half-rail operation wherever possible, optimal power allocations among amplifier blocks, and the sizing of devices to improve matching and reduce noise. We envision that the micropower amplifier can be used as part of a wireless EKG monitoring system powered by rectified radio-frequency energy or other forms of energy harvesting like body vibration and body heat.

  10. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  11. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    the photographs as a starting point for a series of paintings. This way of creating representations of something that already exists is for me to see a way forward in the "decoding" of my own models into other depictions. The models are analyzed through a series of representations in different types of drawings....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...

  12. Sex determination in highly fragmented human DNA by high-resolution melting (HRM analysis.

    Directory of Open Access Journals (Sweden)

    Brenda A Álvarez-Sandoval

    Full Text Available Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM. HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  13. Sex determination in highly fragmented human DNA by high-resolution melting (HRM) analysis.

    Science.gov (United States)

    Álvarez-Sandoval, Brenda A; Manzanilla, Linda R; Montiel, Rafael

    2014-01-01

    Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp) of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM). HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  14. Construction of human anti-tetanus single-chain variable fragment applying SYMPLEX technology.

    Science.gov (United States)

    Esmati, Laya; Mehrabadi, Jalil Fallah; Bazaz, Masoumeh; Nejad, Hamideh Rouhani

    2016-01-01

    Human monoclonal antibodies are important molecules in clinical research. Current Limitations of mAb technologies namely instability of immortalized B-cell line and probability of forming unusual VH-VL pairs in phage-display method led to mAbs technology based on single plasma cell called ``SYMPLEX''. In this method, cognate VH and VL fragments generated from individual antibody genes exactly the same as natural ones. PBMCs of whole blood of an immunized candidate was used as a resource of rearranged Ab genes. Then flow-cytometric screening was performed to isolate VH and VL from PBMCs. Various VH and VLκ were amplified by six pairs of primers. Overlap Extension PCR was accomplished to link VH and Vκ regions. ScFv inserted into T-vector and its sequence was determined and eventually analyzed by using blast analysis tools. Electrophoresis results indicated that VH and VL fragments were separately amplified by PCR with a length of about 400bp and linked through OE-PCR. Hence, ScFv, which was approximately 800bp in size, was constructed then sequencing and BLASTn results of the ScFv fragment consequently proved the accuracy. Results showed 88% similarity to available sequences in mentioned databank. ScFv was ultimately inserted into expression vector for producing recombinant human anti-tetanus mAb.

  15. Modeling FWM and impairments aware amplifiers placement technique for an optical MAN/WAN: Inline amplifiers case

    Science.gov (United States)

    Singh, Gurpreet; Singh, Maninder Lal

    2015-08-01

    A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.

  16. Fundamental length and relativistic length

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1988-01-01

    It si noted that the introduction of fundamental length contradicts the conventional representations concerning the contraction of the longitudinal size of fast-moving objects. The use of the concept of relativistic length and the following ''elongation formula'' permits one to solve this problem

  17. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    proved their influence by obstructing the creation of new ministries and regulatory commissions that would limit their powers. The heads of these business groups often outrank their counterparts in state administrative organs and bureaus that are supposed to regulate their activities. The increased role...... of these business leaders prompts the question of whether we are seeing the development of distinct interest groups that could challenge Party and state authority and create a fragmented polity. However, through the nomenklatura system the Party has an important instrument of control to wield over business groups....... Through this system the Party controls the appointment and promotion of the heads of the most important state-owned enterprises. The nomenklatura system also enables the Party to rotate leaders in big business from a position as CEO in one company to a similar position in another state-owned company...

  18. Flame Length

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Flame length was modeled using FlamMap, an interagency fire behavior mapping and analysis program that computes potential fire behavior characteristics. The tool...

  19. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  20. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Directory of Open Access Journals (Sweden)

    Roger Wumba

    2012-01-01

    in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n=19 among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3% and 5 type IV strains of E. bieneusi (26.3% were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo, and the concurrence of type I and type IV strains.

  1. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Science.gov (United States)

    Wumba, Roger; Jean, Menotti; Benjamin, Longo-Mbenza; Madone, Mandina; Fabien, Kintoki; Josué, Zanga; Jean, Sala; Eric, Kendjo; AC, Guillo-Olczyk; Marc, Thellier

    2012-01-01

    Objective. To determine the prevalence and the genotypes of Enterocytozoon bieneusi in stool specimens from HIV patients. Methods. This cross-sectional study was carried out in Kinshasa hospitals between 2009 and 2012. Detection of microsporidia including E. bieneusi and E. intestinalis was performed in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI) in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM) was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n = 19) among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3%) and 5 type IV strains of E. bieneusi (26.3%) were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo), and the concurrence of type I and type IV strains. PMID:22811884

  2. Electronic amplifiers for automatic compensators

    CERN Document Server

    Polonnikov, D Ye

    1965-01-01

    Electronic Amplifiers for Automatic Compensators presents the design and operation of electronic amplifiers for use in automatic control and measuring systems. This book is composed of eight chapters that consider the problems of constructing input and output circuits of amplifiers, suppression of interference and ensuring high sensitivity.This work begins with a survey of the operating principles of electronic amplifiers in automatic compensator systems. The succeeding chapters deal with circuit selection and the calculation and determination of the principal characteristics of amplifiers, as

  3. Simplified design of IC amplifiers

    CERN Document Server

    Lenk, John

    1996-01-01

    Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

  4. Building valve amplifiers

    CERN Document Server

    Jones, Morgan

    2013-01-01

    Building Valve Amplifiers is a unique hands-on guide for anyone working with tube audio equipment--as an electronics hobbyist, audiophile or audio engineer. This 2nd Edition builds on the success of the first with technology and technique revisions throughout and, significantly, a major new self-build project, worked through step-by-step, which puts into practice the principles and techniques introduced throughout the book. Particular attention has been paid to answering questions commonly asked by newcomers to the world of the valve, whether audio enthusiasts tackling their first build or

  5. Low Noise Optical Amplifiers

    Science.gov (United States)

    2010-05-01

    Technical University of Denmark, Oersteds Plads 343, DK-2800 Kgs. Lyngby, Denmark lris@fotonik.dtu.dk, karo@fotonik.dtu.dk Abstract: Impact on the second...1990). 9. P. Kylemark, H. Sunnerud, M. Karlsson, and P. A. Andrekson, “Semi-analytic saturation theory of fiber optical parametric amplifiers,” J...a flat broadband gain over 87 nm. 2. Theory In general we consider an electric field consisting of four CW waves, at frequencies ω1 through ω4. In non

  6. Wideband amplifier design

    CERN Document Server

    Hollister, Allen L

    2007-01-01

    In this book, the theory needed to understand wideband amplifier design using the simplest models possible will be developed. This theory will be used to develop algebraic equations that describe particular circuits used in high frequency design so that the reader develops a ""gut level"" understanding of the process and circuit. SPICE and Genesys simulations will be performed to show the accuracy of the algebraic models. By looking at differences between the algebraic equations and the simulations, new algebraic models will be developed that include parameters originally left out of the model

  7. Fundamental length

    International Nuclear Information System (INIS)

    Pradhan, T.

    1975-01-01

    The concept of fundamental length was first put forward by Heisenberg from purely dimensional reasons. From a study of the observed masses of the elementary particles known at that time, it is sumrised that this length should be of the order of magnitude 1 approximately 10 -13 cm. It was Heisenberg's belief that introduction of such a fundamental length would eliminate the divergence difficulties from relativistic quantum field theory by cutting off the high energy regions of the 'proper fields'. Since the divergence difficulties arise primarily due to infinite number of degrees of freedom, one simple remedy would be the introduction of a principle that limits these degrees of freedom by removing the effectiveness of the waves with a frequency exceeding a certain limit without destroying the relativistic invariance of the theory. The principle can be stated as follows: It is in principle impossible to invent an experiment of any kind that will permit a distintion between the positions of two particles at rest, the distance between which is below a certain limit. A more elegant way of introducing fundamental length into quantum theory is through commutation relations between two position operators. In quantum field theory such as quantum electrodynamics, it can be introduced through the commutation relation between two interpolating photon fields (vector potentials). (K.B.)

  8. CARM and harmonic gyro-amplifier experiments at 17 GHz

    International Nuclear Information System (INIS)

    Menninger, W.L.; Danly, B.G.; Alberti, S.; Chen, C.; Rullier, J.L.; Temkin, R.J.

    1993-01-01

    Cyclotron resonance maser amplifiers are possible sources for applications such as electron cyclotron resonance heating of fusion plasmas and driving high-gradient rf linear accelerators. For accelerator drivers, amplifiers or phase locked-oscillators are required. A 17 GHz cyclotron autoresonance maser (CARM) amplifier experiment and a 17 GHz third harmonic gyro-amplifier experiment are presently underway at the MIT Plasma Fusion Center. Using the SRL/MIT SNOMAD II introduction accelerator to provide a 380 kV, 180 A, 30 ns flat top electron beam, the gyro-amplifier experiment has produced 5 MW of rf power with over 50 dB of gain at 17 GHz. The gyro-amplifier operates in the TE 31 mode using a third harmonic interaction. Because of its high power output, the gyro-amplifier will be used as the rf source for a photocathode rf electron gun experiment also taking place at MIT. Preliminary gyro-amplifier results are presented, including measurement of rf power, gain versus interaction length, and the far-field pattern. A CARM experiment designed to operate in the TE 11 mode is also discussed

  9. Superconducting digital logic amplifier

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper describes a superconducting digital logic amplifier for interfacing between a Josephson junction logic circuit having output current and a higher voltage semiconductor circuit input. The amplifier comprising: an input terminal for connection to a; an output terminal for connection to a semiconductor circuit input; an input, lower critical current, Josephson junction having first and second terminals; a first series string of at least three lower critical current Josephson junctions. The first series string being connected to the first terminal of the input Josephson junction such that the first series string is in series with the input Josephson junction to provide a series combination. The input terminal being connected to the first terminal of the input Josephson junction, and with the critical current of the lower critical current Josephson junctions of the input Josephson junction and the first series Josephson junctions being less than the output current of the low voltage Josephson junction circuit; a second series string of at least four higher critical current Josephson junctions. The second string being connected in parallel with the series combination to provide parallel strings having an upper common connection and a lower common connection. The lower common connection being connected to the second terminal of the input Josephson junction and the upper common connection being connected to the output terminal; and a pulsed DC current source connected the parallel strings at the upper common connection. The DC current source having a current at least equal to the critical current of the higher critical current Josephson junctions

  10. Optical amplifier exhibiting net phase-mismatch selected to at least partially reduce gain-induced phase-matching during operation and method of operation

    Science.gov (United States)

    Feve, Jean-Philippe [Cupertino, CA; Kliner, Dahv A. V. [San Ramon, CA; Farrow,; Roger, L [Pleasanton, CA

    2011-02-01

    An optical amplifier, such as an optical waveguide amplifier (e.g., an optical fiber amplifier or a planar waveguide) or a non-guiding optical amplifier, that exhibits a net phase-mismatch selected to at least partially reduce gain-induced phase-matching during operation thereof is disclosed. In one aspect of the invention, an optical amplifier structure includes at least one optical amplifier having a length and a gain region. The at least one optical amplifier exhibits a net phase-mismatch that varies along at least part of the length thereof selected to at least partially reduce gain-induced phase-matching during operation thereof.

  11. A new and improved method based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for the determination of A1298C mutation in the methylenetetrahydrofolate reductase (MTHFR) gene.

    Science.gov (United States)

    Machnik, Grzegorz; Zapala, Malgorzata; Pelc, Ewa; Gasecka-Czapla, Monika; Kaczmarczyk, Grzegorz; Okopien, Boguslaw

    2013-01-01

    Intracellular folate homeostasis and metabolism is regulated by numerous genes. Among them, 5,10-methylenetetrahydrofolate reductase (MTHFR) is of special interest because of its involvement in regulation of the homocysteine level in the body as a result of folate metabolism. Moreover, some studies demonstrated that the homocysteine plasma level in individuals may be influenced by polymorphisms present in the MTHFR gene. Two common, clinically relevant mutations have been described: MTHFR C677T and MTHFR A1298C. Although several laboratory techniques allow genotyping of both polymorphisms, PCR-RFLP analysis is simple to perform, relatively cheap, and thus one of the most utilized. In the case of A1298C, the PCR-RFLP technique that utilizes MboII endonuclease class II requires an acrylamide gel electrophoresis, since agarose gel electrophoresis is unable to resolve short deoxyribonucleic acid (DNA) fragments after restriction digestion. Agarose gel electrophoresis is commonly preferred over that of acrylamide. To resolve this inconvenience, a novel PCR-RFLP, AjuI-based method to genotype A1298C alleles has been developed that can be performed on standard agarose gel.

  12. Gain characteristics of erbium doped fiber amplifier

    Science.gov (United States)

    Zhang, Lihua; Du, Yungang; Xi, Ying; Li, Jijun; Zhao, Chunwang

    2008-12-01

    In the design of Erbium Doped Fiber Amplifier (EDFA), improving flat-gain has great important significance. The working principle and gain characteristics of EDFA are introduced briefly, the influence of the factors such as Erbium doped fiber (EDF) length and pump power on the gain of EDFA is analyzed in detail, and the simulation experiments were carried out with Optisystem software. The result shows that, when pump power is constant, with EDF length departing the optimal value, the gain of each channel decreases at different degrees; when EDF length is constant, with pump power departing the optimal value, the gain of each channel changes at different degrees. Moreover, Er3+ concentration has significant effect on the gain, and there is an optimal Er3+ concentration to get the largest gain.

  13. Microbial diversity in a thermophilic aerobic biofilm process: analysis by length heterogeneity PCR (LH-PCR).

    Science.gov (United States)

    Tiirola, Marja A; Suvilampi, Juhani E; Kulomaa, Markku S; Rintala, Jukka A

    2003-05-01

    A two-stage pilot-scale thermophilic aerobic suspended carrier biofilm process (SCBP) was set up for the on-site treatment of pulp and paper mill whitewater lining. The microbial diversity in this process was analyzed by length heterogeneity analysis of PCR-amplified 16S ribosomal DNA. The primer pair selected for PCR amplification was first evaluated by a computational analysis of fragment lengths in ten main phylogenetical eubacterial groups. The fragment contained the first third of the 16S rRNA gene, which was shown to vary naturally between 465 and 563 bp in length. The length heterogeneity analysis of polymerase chain reaction (LH-PCR) profile of the biomass attached to carrier elements was found to be diverse in both stages of the SCBP. During normal operating conditions, sequences belonging to beta-Proteobacteria, Cytophaga/Flexibacter/Bacteroides group and gamma-Proteobacteria were assigned to the most prominent LH-PCR peak. Samples from the suspended biomass consisted of completely different bacterial populations, which were, however, similar in the serial reactors. The pilot process experienced alkaline shocks, after which Bacillus-like sequences were detected in both the biofilm and suspended biomass. However, when the conditions were reversed, the normal microbial population in the biofilm recovered rapidly without further biomass inoculations. This study shows that LH-PCR is a valuable method for profiling microbial diversity and dynamics in industrial wastewater processes.

  14. Overview of bunch length measurements

    International Nuclear Information System (INIS)

    Lumpkin, A. H.

    1999-01-01

    An overview of particle and photon beam bunch length measurements is presented in the context of free-electron laser (FEL) challenges. Particle-beam peak current is a critical factor in obtaining adequate FEL gain for both oscillators and self-amplified spontaneous emission (SASE) devices. Since measurement of charge is a standard measurement, the bunch length becomes the key issue for ultrashort bunches. Both time-domain and frequency-domain techniques are presented in the context of using electromagnetic radiation over eight orders of magnitude in wavelength. In addition, the measurement of microbunching in a micropulse is addressed

  15. Modeling of Yb3+-sensitized Er3+-doped silica waveguide amplifiers

    DEFF Research Database (Denmark)

    Lester, Christian; Bjarklev, Anders Overgaard; Rasmussen, Thomas

    1995-01-01

    A model for Yb3+-sensitized Er3+-doped silica waveguide amplifiers is described and numerically investigated in the small-signal regime. The amplified spontaneous emission in the ytterbium-band and the quenching process between excited erbium ions are included in the model. For pump wavelengths...... between 860 and 995 nm, the amplified spontaneous emission in the ytterbium-band is found to reduce both the gain and the optimum length of the amplifier significantly. The achievable gain of the Yb3+-sensitized amplifier is found to be higher than in an Er3+-doped silica waveguide without Yb 3+ (18 d...

  16. Metatronic transistor amplifier

    Science.gov (United States)

    Chettiar, Uday K.; Engheta, Nader

    2015-10-01

    Utilizing the notion of metamaterials, in recent years the concept of a circuit and lumped circuit elements have been extended to the optical domains, providing the paradigm of optical metatronics, i.e., metamaterial-inspired optical nanocircuitry, as a powerful tool for design and study of more complex systems at the nanoscale. In this paper we present a design for a new metatronic element, namely, a metatronic transistor that functions as an amplifier. As shown by our analytical and numerical paper here, this metatronic transistor provides gain as well as isolation between the input and output ports of such two-port device. The cascadability and fan-out aspects of this element are also explored.

  17. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

  18. Modeling of semiconductor optical amplifiers

    DEFF Research Database (Denmark)

    Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

    We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

  19. High sensitivity amplifier/discriminator for PWC's

    International Nuclear Information System (INIS)

    Hansen, S.

    1983-01-01

    The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design

  20. CERN: Energy amplifier

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Even under the heavy burden of responsibility as CERN's Director General from 1989-3 the fertile mind of Carlo Rubbia the scientist was never still. A long-time Rubbia 'hobby' has been the search for new sources of nuclear energy, exploiting knowledge and skills from high energy physics. An initial objective was to adopt heavy ion techniques to induce controlled thermonuclear fusion, but in 1994 this quest changed direction. Putting the problems of thermonuclear fusion aside, Rubbia began to explore an alternative route to energy production through controlled nuclear fission. The idea is to use a particle accelerator producing neutrons by spallation (interaction of particles with a target) to feed a fuel/moderator assembly where the neutrons multiply by fission chain reactions. If the energy liberated becomes substantially greater than that needed to drive the accelerator, the process has a net gain and becomes selfsupporting. Hence the name ''Energy Amplifier'' (EA). Similar systems for energy production or for nuclear waste incineration have been proposed at Los Alamos and in Japan and Russia, but appear to require the prior development of innovative linear accelerators. For Rubbia's Amplifier, the requisite accelerator is a reasonable extrapolation of an existing cyclotron such that at the Swiss Paul Scherrer Institute. Moreover, the EA would require fuel rods very similar to those of conventional reactors, rather than demand-ing new technology using liquid fuel loops (molten salts) with on-line separation of radioactive products. Unlike a reactor, the EA's fission reaction is not self-sustaining: it is sub-critical and needs a continuous supply of neutrons from the accelerator. This makes Chernobyl-type meltdowns unlikely: if the accelerator stops, the reaction stops too. Another major advantage is that the old dream of using thorium as a fuel is now made possible. Thorium is not itself fissile, but under neutron

  1. Fully differential cryogenic transistor amplifier

    Science.gov (United States)

    Beev, Nikolai; Kiviranta, Mikko

    2013-10-01

    We have constructed a dc-coupled differential amplifier capable of operating in the 4.2 K-300 K temperature range. The amplifier can be operated at high-bias setting, where it dissipates 5 mW, has noise temperature TN ≈ 0.7 K at RS ≈ 5 kΩ and >40 MHz bandwidth at 4.2 K bath temperature. The bias setting can be adjusted: at our lowest tested setting the amplifier dissipates 2 MHz bandwidth. The 1/f noise corner frequency is a few times 10 kHz. We foresee the amplifier to have an application in the readout of Superconducting Quantum Interference Devices (SQUIDs), Superconducting Tunnel Junction Detectors (STJs) and Transition Edge Sensors (TESes). We have verified the practical use of the amplifier by reading out a 4.2 K 480-SQUID array with 40 MHz bandwidth and <8 × 10-8 Φ0/Hz1/2 flux noise.

  2. Millimeter-wave power amplifiers

    CERN Document Server

    du Preez, Jaco

    2017-01-01

    This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

  3. Small signal microwave amplifier design

    CERN Document Server

    Grosch, Theodore

    2000-01-01

    This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

  4. New Packaging for Amplifier Slabs

    Energy Technology Data Exchange (ETDEWEB)

    Riley, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Thorsness, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Suratwala, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Steele, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rogowski, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-03-18

    The following memo provides a discussion and detailed procedure for a new finished amplifier slab shipping and storage container. The new package is designed to maintain an environment of <5% RH to minimize weathering.

  5. Operational amplifiers theory and design

    CERN Document Server

    Huijsing, Johan

    2017-01-01

    This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

  6. Photonic-band-gap gyrotron amplifier with picosecond pulses.

    Science.gov (United States)

    Nanni, Emilio A; Jawla, Sudheer; Lewis, Samantha M; Shapiro, Michael A; Temkin, Richard J

    2017-12-04

    We report the amplification of 250 GHz pulses as short as 260 ps without observation of pulse broadening using a photonic-band-gap circuit gyrotron traveling-wave-amplifier. The gyrotron amplifier operates with a device gain of 38 dB and an instantaneous bandwidth of 8 GHz. The operational bandwidth of the amplifier can be tuned over 16 GHz by adjusting the operating voltage of the electron beam and the magnetic field. The amplifier uses a 30 cm long photonic-band-gap interaction circuit to confine the desired TE 03 -like operating mode while suppressing lower order modes which can result in undesired oscillations. The circuit gain is >55 dB for a beam voltage of 23 kV and a current of 700 mA. These results demonstrate the wide bandwidths and a high gain achievable with gyrotron amplifiers. The amplification of picosecond pulses of variable lengths, 260-800 ps, shows good agreement with the theory using the coupled dispersion relation and the gain-spectrum of the amplifier as measured with quasi-CW input pulses.

  7. Photonic-band-gap gyrotron amplifier with picosecond pulses

    Science.gov (United States)

    Nanni, Emilio A.; Jawla, Sudheer; Lewis, Samantha M.; Shapiro, Michael A.; Temkin, Richard J.

    2017-12-01

    We report the amplification of 250 GHz pulses as short as 260 ps without observation of pulse broadening using a photonic-band-gap circuit gyrotron traveling-wave-amplifier. The gyrotron amplifier operates with a device gain of 38 dB and an instantaneous bandwidth of 8 GHz. The operational bandwidth of the amplifier can be tuned over 16 GHz by adjusting the operating voltage of the electron beam and the magnetic field. The amplifier uses a 30 cm long photonic-band-gap interaction circuit to confine the desired TE03-like operating mode while suppressing lower order modes which can result in undesired oscillations. The circuit gain is >55 dB for a beam voltage of 23 kV and a current of 700 mA. These results demonstrate the wide bandwidths and a high gain achievable with gyrotron amplifiers. The amplification of picosecond pulses of variable lengths, 260-800 ps, shows good agreement with the theory using the coupled dispersion relation and the gain-spectrum of the amplifier as measured with quasi-CW input pulses.

  8. A Secreted Slit2 Fragment Regulates Adipose Tissue Thermogenesis and Metabolic Function.

    Science.gov (United States)

    Svensson, Katrin J; Long, Jonathan Z; Jedrychowski, Mark P; Cohen, Paul; Lo, James C; Serag, Sara; Kir, Serkan; Shinoda, Kosaku; Tartaglia, Julia A; Rao, Rajesh R; Chédotal, Alain; Kajimura, Shingo; Gygi, Steven P; Spiegelman, Bruce M

    2016-03-08

    Activation of brown and beige fat can reduce obesity and improve glucose homeostasis through nonshivering thermogenesis. Whether brown or beige fat also secretes paracrine or endocrine factors to promote and amplify adaptive thermogenesis is not fully explored. Here we identify Slit2, a 180 kDa member of the Slit extracellular protein family, as a PRDM16-regulated secreted factor from beige fat cells. In isolated cells and in mice, full-length Slit2 is cleaved to generate several smaller fragments, and we identify an active thermogenic moiety as the C-terminal fragment. This Slit2-C fragment of 50 kDa promotes adipose thermogenesis, augments energy expenditure, and improves glucose homeostasis in vivo. Mechanistically, Slit2 induces a robust activation of PKA signaling, which is required for its prothermogenic activity. Our findings establish a previously unknown peripheral role for Slit2 as a beige fat secreted factor that has therapeutic potential for the treatment of obesity and related metabolic disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. PCR amplification, cloning, and construction of HIV-1 infectious molecular clones from virtually full-length HIV-1 genomes.

    Science.gov (United States)

    Ehrenberg, Philip K; Michael, Nelson L

    2005-01-01

    The development of mixtures of highly processive and high-fidelity thermostable DNA polymerases has enabled the routine recovery of DNA sequences in excess of 25 kb generated by polymerase chain reaction. This powerful tool has been instrumental in the ability to recover virtually full-length HIV-1 proviral DNA as a single, contiguous fragment. Such fragments allow for the clean interpretation of the genomic organization of HIV-1 provirus, as they are not confounded by molecular mosaicism that accrues to overlapping subgenomic amplification strategies. We detail here a robust procedure to produce virtually full-length, single contiguous 9.2-kb HIV-1 amplimers whose full-length infectious potential is reconstituted upon cloning into long terminal repeat-replacement vectors. Large numbers of HIV-1 proviral clones can now be quickly generated and screened to identify the fraction of the viral quasispecies with the highest capacity for viral replication. The methods used to construct long terminal repeat-replacement vectors, amplify HIV-1 provirus, reconstitute full-length provirus, and recover viral stocks will be illustrated using a circulating recombinant form 1 (CRF01_AE, formerly known as subtype E) primary isolate.

  10. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  11. Optimal cloning of PCR fragments by homologous recombination in Escherichia coli.

    Science.gov (United States)

    Jacobus, Ana Paula; Gross, Jeferson

    2015-01-01

    PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5' termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories.

  12. HLA DQJ3 restriction fragment length polymorphism and ...

    African Journals Online (AJOL)

    1991-03-16

    Mar 16, 1991 ... We should like to thank Dr Fritz Bach, University of Minnesota, for generously providing the DQf3 probe; Dr R. Martell for his advice and constructive criticism; Chris Martin and Derek Taljaard for technical assistance and Veronique Bruneau for typing the manuscript. This work was supported by grants from ...

  13. HLA DQβ restriction fragment length polymorphism and rheumatQid ...

    African Journals Online (AJOL)

    Two variants of the HLA-DR4-linked DQw3 allele, namely OQw7 and DQw8, were analysed in patients of mixed ancestry (Cape Coloureds) with rheumatoid arthritis and in healthy individuals from the same population group using a DQ-β specific cDNA probe. The DQw7 allele, identified by 3,4 kb Hind III or 3,7 kb and 6,9 ...

  14. Dispersion-Engineered Traveling Wave Kinetic Inductance Parametric Amplifier

    Science.gov (United States)

    Zmuidzinas, Jonas (Inventor); Day, Peter K. (Inventor)

    2014-01-01

    A traveling wave kinetic inductance parametric amplifier comprises a superconducting transmission line and a dispersion control element. The transmission line can include periodic variations of its dimension along its length. The superconducting material can include a high normal state resistivity material. In some instances the high normal state resistivity material includes nitrogen and a metal selected from the group consisting of titanium, niobium and vanadium. The traveling wave kinetic inductance parametric amplifier is expected to exhibit a noise temperature below 100 mK/GHz.

  15. Development of High Power Amplifiers for Space and Ground-based Applications

    DEFF Research Database (Denmark)

    Hernández, Carlos Cilla

    -based amplifiers. They are efficient and provide very high power levels operating at low duty cycles. But they have a questionable longterm reliability, large footprints and they are not suitable for modern equipment with a decentralized transmitter, like a phase array system. Solid State Power Amplifier....... An efficient 100 W X-band hybrid high power amplifier using 0.25 µm gate length GaN technology was successfully designed, assembled and tested. The goal of the project was to develop a high power amplifier for X-band frequencies with capabilities to replace the vacuum tubes used in the radar systems designed...

  16. Spectroscopic amplifier for pin diode

    International Nuclear Information System (INIS)

    Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.

    2014-10-01

    The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)

  17. Low-Noise Band-Pass Amplifier

    Science.gov (United States)

    Kleinberg, L.

    1982-01-01

    Circuit uses standard components to overcome common limitation of JFET amplifiers. Low-noise band-pass amplifier employs JFET and operational amplifier. High gain and band-pass characteristics are achieved with suitable choice of resistances and capacitances. Circuit should find use as low-noise amplifier, for example as first stage instrumentation systems.

  18. Capacitively-coupled chopper amplifiers

    CERN Document Server

    Fan, Qinwen; Huijsing, Johan H

    2017-01-01

    This book describes the concept and design of the capacitively-coupled chopper technique, which can be used in precision analog amplifiers. Readers will learn to design power-efficient amplifiers employing this technique, which can be powered by regular low supply voltage such as 2V and possibly having a +\\-100V input common-mode voltage input. The authors provide both basic design concepts and detailed design examples, which cover the area of both operational and instrumentation amplifiers for multiple applications, particularly in power management and biomedical circuit designs. Discusses basic working principles and details of implementation for proven designs; Includes a diverse set of applications, along with measurement results to demonstrate the effectiveness of the technique; Explains advantages and drawbacks of the technique, given particular circumstances.

  19. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  20. Analysis and simulation of nonlinearity and effects of spontaneous emission in Schottky-junction-based plasmonic amplifiers.

    Science.gov (United States)

    Livani, Abdolber Mallah; Kaatuzian, Hassan

    2015-07-01

    An amplifier that operates on surface plasmon polaritons has been analyzed and simulated. Nonlinearity behavior and the spontaneous emission effects of the plasmonic amplifier are investigated in this paper. A rate equations approach has been used in which parameters are derived from simulation results of the plasmonic amplifier (Silvaco/ATLAS). Details on the method of this derivation are included, which were not previously reported. Rate equations are solved numerically by MATLAB codes. These codes verify the Silvaco results. The plasmonic amplifier operates on surface plasmons with a free-space wavelength of 1550 nm. Results show that, even without the effect of spontaneous emission, gain of the plasmonic amplifier saturates in high input levels. Saturation power, which can be used for comparing nonlinearity of different amplifiers, is 2.1 dBm for this amplifier. Amplified spontaneous emission reduces the gain of the amplifiers, which is long. There is an optimum value for the length of the amplifier. For the amplifier of this work, the optimum length for the small signal condition is 265 μm.

  1. Medium response limitations in short pulse amplifiers and absorbers

    International Nuclear Information System (INIS)

    Schappert, G.T.

    1976-07-01

    This report reviews some of the basic considerations which determine temporal pulse characteristics in amplifiers and absorbers. To concentrate on analytical results, the amplification or absorption of a step pulse is worked out in detail. It is shown that in the small signal regime the medium response time of T 2 is modified because of propagation effects to T 2 gL/2 for an amplifier of gain g and length L and T 2 /αl for an absorber of loss coefficient 1 and length L. Once saturation sets in, general analytical results are no longer possible except in the T 2 → 0, or rate equation limit. However, combining the finite T 2 small signals results with the rate equation results one can estimate risetime effects. Coherent effects, such as π pulses and self induced transparency have not yet found applications in high power, high pressure gas lasers. (orig.) [de

  2. Optical steganography based on amplified spontaneous emission noise.

    Science.gov (United States)

    Wu, Ben; Wang, Zhenxing; Tian, Yue; Fok, Mable P; Shastri, Bhavin J; Kanoff, Daniel R; Prucnal, Paul R

    2013-01-28

    We propose and experimentally demonstrate an optical steganography method in which a data signal is transmitted using amplified spontaneous emission (ASE) noise as a carrier. The ASE serving as a carrier for the private signal has an identical frequency spectrum to the existing noise generated by the Erbium doped fiber amplifiers (EDFAs) in the transmission system. The system also carries a conventional data channel that is not private. The so-called "stealth" or private channel is well-hidden within the noise of the system. Phase modulation is used for both the stealth channel and the public channel. Using homodyne detection, the short coherence length of the ASE ensures that the stealth signal can only be recovered if the receiver closely matches the delay-length difference, which is deliberately changed in a dynamic fashion that is only known to the transmitter and its intended receiver.

  3. Fragmentation characteristics analysis of sandstone fragments based on impact rockburst test

    Directory of Open Access Journals (Sweden)

    Dongqiao Liu

    2014-06-01

    Full Text Available Impact rockburst test on sandstone samples with a central hole is carried out under true triaxial static loads and vertical dynamic load conditions, and rock fragments after the test are collected. The fragments of sandstone generated from strain rockburst test and uniaxial compression test are also collected. The fragments are weighed and the length, width and thickness of each piece of fragments are measured respectively. The fragment quantities with coarse, medium, fine and micro grains in different size ranges, mass and particles distributions are also analyzed. Then, the fractal dimension of fragments is calculated by the methods of size-frequency, mass-frequency and length-to-thickness ratio-frequency. It is found that the crushing degree of impact rockburst fragments is higher, accompanied with blocky characteristics observably. The mass percentage of small grains, including fine and micro grains, in impact rockburst test is higher than those in strain rockburst test and uniaxial compression test. Energy dissipation from rockburst tests is more than that from uniaxial compression test, as the quantity of micro grains generated does.

  4. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... (Islam and Shepherd, 1992). But these markers were not considered suitable for large scale mapping. With the recent introduction of molecular biology, DNA based markers including polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), single nucleotide polymorphisms ...

  5. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  6. Characteristics research on self-amplified distributed feedback fiber laser

    Science.gov (United States)

    Song, Zhiqiang; Qi, Haifeng; Guo, Jian; Wang, Chang; Peng, Gangding

    2014-09-01

    A distributed feedback (DFB) fiber laser with a ratio of the backward to forward output power of 1:100 was composed by a 45-mm-length asymmetrical phase-shifted fiber grating fabricated on the 50-mm erbium-doped photosensitive fiber. Forward output laser was amplified using a certain length of Nufern EDFL-980-Hp erbium-doped fiber to absorb the surplus pump power after the active phase-shifted fiber grating and get population inversion. By using OptiSystem software, the best fiber length of the EDFL to get the highest gain was simulated. In order to keep the amplified laser with the narrow line-width and low noise, a narrow-band light filter consisting of a fiber Bragg grating (FBG) with the same Bragg wavelength as the laser and an optical circulator was used to filter the amplified spontaneous emission (ASE) noise of the out-cavity erbium-doped fiber. The designed laser structure sufficiently utilized the pump power, and a DFB fiber laser with the 32.5-mW output power, 11.5-kHz line width, and -87-dB/Hz relative intensity noise (RIN) at 300 mW of 980 nm pump power was brought out.

  7. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  8. Low Cost RF Amplifier for Community TV

    Science.gov (United States)

    Ch, Syafaruddin; Sasongko, Sudi Mariyanto Al; Made Budi Suksmadana, I.; Mustiko Okta Muvianto, Cahyo; Ariessaputra, Suthami

    2016-01-01

    he capability of television to deliver audio video makes this media become the most effective method to spread information. This paper presents an experiment of RF amplifier design having low-cost design and providing sufficient RF power particularly for community television. The RF amplifier consists of two stages of amplifier. The first stage amplifier was used to leverage output of TV modulator from 11dBm to enable to drive next stage amplifier. CAD simulation and fabrication were run to reach optimum RF amplifier design circuit. The associated circuit was made by determining stability circle, stability gain, and matching impedance. Hence, the average power of first stage RF amplifier was 24.68dBm achieved. The second stage used RF modules which was ready match to 50 ohm for both input and output port. The experiment results show that the RF amplifier may operate at frequency ranging from 174 to 230MHz. The average output power of the 2nd stage amplifier was 33.38 Watt with the overall gain of 20.54dB. The proposed RF amplifier is a cheap way to have a stable RF amplifier for community TV. The total budget for the designed RF amplifier is only a 1/5 compared to local design of final TV amplifier.

  9. Linearisation of RF Power Amplifiers

    DEFF Research Database (Denmark)

    Nielsen, Per Asbeck

    2001-01-01

    This thesis deals with linearisation techniques of RF power amplifiers (PA), PA design techniques and integration of the necessary building blocks in a CMOS technology. The opening chapters introduces the theory of transmitter architectures, RF-signal representation and the principles of digital...... modulation. Furthermore different types of power amplifiers, models and measures of non-linearities are presented. A chapter is also devoted to different types of linearisation systems. The work carried out and described in this thesis can be divided into a more theoretical and system oriented treatment...... the polar loop architecture and it’s suitability to modern digital transmitters is discussed. A proposal of an architecture that is suitable for digital transmitters, which means that it has an interface to the digital back-end, defined by low-pass signals in polar form, is presented. Simulation guidelines...

  10. Single conversion stage amplifier - SICAM

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2005-12-15

    This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

  11. Superconducting switch and amplifier device

    International Nuclear Information System (INIS)

    Faris, S.M.

    1982-01-01

    An amplifying or switching superconductive device is described whose current-voltage characteristic is drastically altered by heavy injection of excess energetic quasi-particles. In this device, the superconducting bandgap of a superconducting layer is greatly altered by overinjection of energetic quasi-particles so that the bandgap changes greatly with respect to its thermal equilibrium value, and in most cases is made to vanish. In a preferred embodiment, a three electrode device is fabricated where at least one of the electrodes is a superconductor. Tunnel barriers are located between the electrodes. A first tunnel junction is used to heavily inject energetic quasi-particles into the superconducting electrode to change its superconducting bandgap drastically. In turn, this greatly modifies the currentvoltage characteristics of the second tunnel junction. This device can be used to provide logic circuits, or as an amplifier, and has an output sufficiently large that it can drive other similar devices

  12. Higher order mode optical fiber Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Friis, Søren Michael Mørk; Usuga Castaneda, Mario A.

    2016-01-01

    We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations.......We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations....

  13. High power regenerative laser amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Miller, John L. (Livermore, CA); Hackel, Lloyd A. (Livermore, CA); Dane, Clifford B. (Dublin, CA); Zapata, Luis E. (Livermore, CA)

    1994-01-01

    A regenerative amplifier design capable of operating at high energy per pulse, for instance, from 20-100 Joules, at moderate repetition rates, for instance from 5-20 Hertz is provided. The laser amplifier comprises a gain medium and source of pump energy coupled with the gain medium; a Pockels cell, which rotates an incident beam in response to application of a control signal; an optical relay system defining a first relay plane near the gain medium and a second relay plane near the rotator; and a plurality of reflectors configured to define an optical path through the gain medium, optical relay and Pockels cell, such that each transit of the optical path includes at least one pass through the gain medium and only one pass through the Pockels cell. An input coupler, and an output coupler are provided, implemented by a single polarizer. A control circuit coupled to the Pockels cell generates the control signal in timed relationship with the input pulse so that the input pulse is captured by the input coupler and proceeds through at least one transit of the optical path, and then the control signal is applied to cause rotation of the pulse to a polarization reflected by the polarizer, after which the captured pulse passes through the gain medium at least once more and is reflected out of the optical path by the polarizer before passing through the rotator again to provide an amplified pulse.

  14. The fragmentation of prestellar clouds

    International Nuclear Information System (INIS)

    Ibanez S, M.H.

    1979-10-01

    The radiative heating problem has been solved analytically, in first approximation, for a semi-infinite cloud model with transverse fluctuations in extinction. The radiative heating problem has been solved with the help of a numerical (approximated) method for the following models: a) semi-infinite cloud with transverse fluctuations in extinction; b) finite cloud with mean optical thickness tau 0 and transverse fluctuations in extinction. Assuming isobaricity as a first approximation, the chemical equation for H 2 formation (in non-equilibrium condition) and the energy equation were solved numerically like a two boundary-value problem. The conditions under which H 2 formation can induce fragmentation in a contracting cloud are examined. A study (in orders of magnitude) of the turbulence as a mechanism generator of density fluctuations has been done. If the Kolmogorov spectral law is assumed, subsonic turbulence is enough to provide any prestellar cloud with the elemental fluctuations which are effectively amplified by molecule formation in a time shorter than one free-fall. (author)

  15. Improved charge amplifier using hybrid hysteresis compensation

    Science.gov (United States)

    Amin-Shahidi, Darya; Trumper, David L.

    2013-08-01

    We present a novel charge amplifier, with a robust feedback circuit and a method for compensating piezoelectric actuator's hysteresis at low frequencies. The amplifier uses a modified feedback circuit which improves robustness to the addition of series load impedance such as in cabling. We also describe a hybrid hysteresis compensation method for enabling the charge amplifier to reduce hysteresis at low frequencies. Experimental results demonstrate the utility of the new amplifier design.

  16. Switching power amplifier for TAR3

    OpenAIRE

    Moore, Eric Wesley

    1995-01-01

    This thesis describes the theory, design, construction, and testing of a switching power amplifier. The major emphasis of the research and development effort reported herein is to design and construct an efficient power amplifier for varying load conditions which provides 40 Watts of power, at 85% efficiency, and with no more than 10% harmonic distortion. The power amplifier will need one voltage supply and one input audio signal. The amplifier will be used to power demonstration thermoacoust...

  17. Balanced Amplifier dengan Menggunakan Driver Op Amp

    OpenAIRE

    Khoswanto, Handry; T.D.S, Yohanes; Wahyudi, Iwan

    2004-01-01

    In Bahasa Indonesia : Pada umumnya amplifier konvensional melibatkan jalur power supply (ground) yang berhubungan dengan jalur audio. Hal ini mengakibatkan pengolahan sinyal audio akan muncul IHM (Interval Hum Modulation) noise. Oleh karena itu, untuk dapat menekan timbulnya noise seminimal mungkin, maka dibuat sebuah amplifier yang tidak bereferensi pada ground power supply. Amplifier tersebut harus benar-benar balance dari input sampai ke output. Untuk merealisasikan balance amplifier ...

  18. Challenges in higher order mode Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

    2015-01-01

    A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

  19. European Research on THz Vacuum Amplifiers

    DEFF Research Database (Denmark)

    Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

    2010-01-01

    The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players of the Eu...

  20. Spontaneous emission from saturated parametric amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Ott, Johan Raunkjær; Steffensen, Henrik

    2009-01-01

    Noise performance of parametric amplifiers is typically calculated assuming un-depleted operation. However, in many applications especially when applied as regenerative amplifiers in systems based on phase shift keyed modulation schemes, this assumption is not valid. Here we show the impact...... on accumulated spontaneous emission for a parametric amplifier operated in saturation....

  1. low pump power photonic crystal fibre amplifiers

    DEFF Research Database (Denmark)

    Hougaard, Kristian G.; Broeng, Jes; Bjarklev, Anders Overgaard

    2003-01-01

    Designs of low pump power optical amplifiers, based on photonic crystal fibres are presented. The potential of these fibre amplifiers is investigated, and it is demonstrated that such amplifiers may deliver gains of more than 15 dB at 1550 nm with less than 1 mW of optical pump power....

  2. Radio frequency amplifier with effective decoupling

    NARCIS (Netherlands)

    Besling, W.F.A.; Bakker, T.W.; Lamy, Y.; Kochupurackal, J.; Roozeboom, F.

    2011-01-01

    A variety of circuits, methods and devices are implemented for radiofrequency amplifiers. According to one such implementation, a radiofrequency amplifier circuit is implemented in a SMD package. The circuit amplifies a radiofrequency signal having a base-band portion and a plurality of carrier

  3. Series transistors isolate amplifier from flyback voltage

    Science.gov (United States)

    Banks, W.

    1967-01-01

    Circuit enables high sawtooth currents to be passed through a deflection coil and isolate the coil driving amplifier from the flyback voltage. It incorporates a switch consisting of transistors in series with the driving amplifier and deflection coil. The switch disconnects the deflection coil from the amplifier during the retrace time.

  4. Remote Acquisition Amplifier For 50-Ohm Cable

    Science.gov (United States)

    Amador, Jose J.

    1995-01-01

    Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

  5. DETECÇÃO DO COMPLEXO Mycobacterium tuberculosis NO LEITE PELA REAÇÃO EM CADEIA DA POLIMERASE SEGUIDA DE ANÁLISE DE RESTRIÇÃO DO FRAGMENTO AMPLIFICADO (PRA DETECTION OF Mycobacterium tuberculosis COMPLEX BY PCR-RESTRICTION FRAGMENT LENGTH POLYMORFISM ANALYSIS OF THE HSP65 GENE

    Directory of Open Access Journals (Sweden)

    Joab Trajano Silva

    2008-12-01

    , up to species level, is time consuming and difficult. In this work, the objective was to standardize a polymerase chain reaction followed by an enzyme restriction analysis in order to identify the M. tuberculosis complex in milk, without a microbiological isolation step. Reference strains and raw milk seeded with M. Bovis, were used as the starting material.  A 441pb fragment of the hsp65 gene was amplified and digested by two restriction enzymes BstEII and HaeIII. The obtained profile was used to identify the M. tuberculosis complex in milk. The minimum limit of detection of M. bovis in milk was 10CFU/mL. PRA methodology proved to be a specific and sensible method. It can be used to assist the microbiological and biochemical methods commonly used to identifying the bacilli in clinical samples, as milk 

    Key word: Detection limit (PRA, Mycobacterium tuberculosis complex, milk Mycobacterium bovis, Restriction Enzyme Analysis (PCR,

  6. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  7. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  8. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    , edited and performed by the storyteller in an ongoing process allowing tensions, discontinuities and editing between failures and achievements, between dreams and work realities and between home and work life. We argue that by including different types of fragmentation, we offer a new type......Following a strand of narrative studies pointing to the living conditions of storytelling and the micro-level implications of working within fragmented narrative perspectives, this article contributes to narrative research on work stories by focusing on how meaning is created from fragmented...... stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  9. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  10. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  11. Optical architecture for a multi-megajoule ICF driver incorporating megajoule class KrF amplifiers

    International Nuclear Information System (INIS)

    McLeod, J.

    1989-01-01

    A gaseous amplifying medium should be scalable to any arbitrary size. A system architecture is reported which will produce 10 MJ with only four amplifiers in the last stage by making use of this scalability. The system described uses optical angular multiplexing for efficient utilization of such large KrF amplifiers. For such large amplifiers, each multiplex beamline carries 16 kJ toward the target chamber. This is because the pump duration need only be increased as the cube root of the output energy and is only 2050 ns. While the use of angular multiplexing does not increase the total count of beamlines, it does increase their length since space has to be provided for the temporal decoder; a possible site plan is shown. Optical beam tubes are filled with He to avoid propagation problems and to promote cleanliness. Single shot sacrificial windows are proposed for large amplifiers. Relatively large multiplexing angles reduce crosstalk to a manageable level

  12. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  13. Semiconductor quantum-dot lasers and amplifiers

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

    2002-01-01

    -power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

  14. High temperature charge amplifier for geothermal applications

    Energy Technology Data Exchange (ETDEWEB)

    Lindblom, Scott C.; Maldonado, Frank J.; Henfling, Joseph A.

    2015-12-08

    An amplifier circuit in a multi-chip module includes a charge to voltage converter circuit, a voltage amplifier a low pass filter and a voltage to current converter. The charge to voltage converter receives a signal representing an electrical charge and generates a voltage signal proportional to the input signal. The voltage amplifier receives the voltage signal from the charge to voltage converter, then amplifies the voltage signal by the gain factor to output an amplified voltage signal. The lowpass filter passes low frequency components of the amplified voltage signal and attenuates frequency components greater than a cutoff frequency. The voltage to current converter receives the output signal of the lowpass filter and converts the output signal to a current output signal; wherein an amplifier circuit output is selectable between the output signal of the lowpass filter and the current output signal.

  15. Specific circuit design: electrocardiogram amplifier

    International Nuclear Information System (INIS)

    Laribiere, Laurent

    1991-01-01

    The electrocardiogram amplifier is a specific integrated circuit. It is based on a linear array of Raytheon. This circuit is fitted with the following functions and characteristics: - electrocardiogram signals amplification, - pacemaker detection, - electrode un-sticking detection, - defibrillator overload protection, - battery-powered, - internal regulation 5 V, - low supply current 2.5 mA, - according to French norms on electrocardiogram surveillance devices - 28 pin package, available in CMS version It can be used for any surveillance device, requiring an analog processing of cardiac signals. (author) [fr

  16. Audio power amplifier design handbook

    CERN Document Server

    Self, Douglas

    2013-01-01

    This book is essential for audio power amplifier designers and engineers for one simple reason...it enables you as a professional to develop reliable, high-performance circuits. The Author Douglas Self covers the major issues of distortion and linearity, power supplies, overload, DC-protection and reactive loading. He also tackles unusual forms of compensation and distortion produced by capacitors and fuses. This completely updated fifth edition includes four NEW chapters including one on The XD Principle, invented by the author, and used by Cambridge Audio. Cro

  17. Cathode-follower power amplifier

    International Nuclear Information System (INIS)

    Giordano, S.; Puglisi, M.

    1983-01-01

    In circular accelerators and particularly in storage rings it is essential that the total impedance, as seen by the beam, be kept below some critical value. A model of the accelerating system was built using a single-ended cathode-follower amplifier driving a ferrite-loaded cavity. The system operated at 234.5 kHz with a peak output voltage of +-10 kV on the gap. The dynamic output impedance, as measured on the gap, was < 15 ohms

  18. The Flp double cross system a simple efficient procedure for cloning DNA fragments

    Directory of Open Access Journals (Sweden)

    Sadowski Paul D

    2003-07-01

    Full Text Available Abstract Background While conventional cloning methods using restriction enzymes and polynucleotide ligase are adequate for most DNAs, fragments made by the polymerase chain reaction are difficult to clone because the amplifying DNA polymerase tends to add untemplated nucleotides to the 3'-termini of the amplified strands. Conservative site-specific recombinases offer an efficient alternative to conventional cloning methods. Results In this paper I describe the use of the Flp site-specific recombinase for cloning PCR-amplified fragments. A DNA fragment is amplified with primers that contain at their ends inverted target sequences for Flp. Flp readily recombines these fragments in vitro into a vector that also contains two inverted Flp target sequences surrounding the α-complementing region of the lacZ gene of E. coli. The recombinants are conveniently detected as white colonies by the familiar blue/white screening test for lacZ activity. A useful feature of the system is that both orientations of the inserted DNA are usually obtained. If the recipient vector is cut between the two inverted Flp targets, Flp "heals" the double-strand break by inserting a linear fragment flanked by Flp targets. Conclusion This system ("The Flp Double Cross System" should be useful for cloning multiple PCR fragments into many sites in several vectors. It has certain advantages over other available recombinase-based cloning procedures.

  19. A multistep evaporation model for intermediate mass fragment emission

    International Nuclear Information System (INIS)

    Cole, A.J.; Grotowski, K.; Kozik, T.; Rebel, H.

    1988-11-01

    A multistep evaporation model for intermediate mass fragment emission in heavy ion reactions is described. It applies the canonical transition-state method for the determination of the probability for disintegration of a fused system. The energy and angular momentum relations at the saddle and scission points are calculated on the basis of the finite range liquid drop model. The derivation of the total kinetic energy release uses the concept of amplifying modes which is equivalent to that of shape fluctuations at the ridge point. The model reproduces fairly well the mass and angular distributions and the energy spectra of intermediate mass fragments yields from inclusive and coincidence experiments. (orig.) [de

  20. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    International Nuclear Information System (INIS)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

    2013-01-01

    We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  1. Antibody Fragments and Their Purification by Protein L Affinity Chromatography

    Directory of Open Access Journals (Sweden)

    Gustav Rodrigo

    2015-09-01

    Full Text Available Antibodies and related proteins comprise one of the largest and fastest-growing classes of protein pharmaceuticals. A majority of such molecules are monoclonal antibodies; however, many new entities are antibody fragments. Due to their structural, physiological, and pharmacological properties, antibody fragments offer new biopharmaceutical opportunities. In the case of recombinant full-length antibodies with suitable Fc regions, two or three column purification processes centered around Protein A affinity chromatography have proven to be fast, efficient, robust, cost-effective, and scalable. Most antibody fragments lack Fc and suitable affinity for Protein A. Adapting proven antibody purification processes to antibody fragments demands different affinity chromatography. Such technology must offer the unit operation advantages noted above, and be suitable for most of the many different types of antibody fragments. Protein L affinity chromatography appears to fulfill these criteria—suggesting its consideration as a key unit operation in antibody fragment processing.

  2. CAG-encoded polyglutamine length polymorphism in the human genome

    Directory of Open Access Journals (Sweden)

    Hayden Michael R

    2007-05-01

    Full Text Available Abstract Background Expansion of polyglutamine-encoding CAG trinucleotide repeats has been identified as the pathogenic mutation in nine different genes associated with neurodegenerative disorders. The majority of individuals clinically diagnosed with spinocerebellar ataxia do not have mutations within known disease genes, and it is likely that additional ataxias or Huntington disease-like disorders will be found to be caused by this common mutational mechanism. We set out to determine the length distributions of CAG-polyglutamine tracts for the entire human genome in a set of healthy individuals in order to characterize the nature of polyglutamine repeat length variation across the human genome, to establish the background against which pathogenic repeat expansions can be detected, and to prioritize candidate genes for repeat expansion disorders. Results We found that repeats, including those in known disease genes, have unique distributions of glutamine tract lengths, as measured by fragment analysis of PCR-amplified repeat regions. This emphasizes the need to characterize each distribution and avoid making generalizations between loci. The best predictors of known disease genes were occurrence of a long CAG-tract uninterrupted by CAA codons in their reference genome sequence, and high glutamine tract length variance in the normal population. We used these parameters to identify eight priority candidate genes for polyglutamine expansion disorders. Twelve CAG-polyglutamine repeats were invariant and these can likely be excluded as candidates. We outline some confusion in the literature about this type of data, difficulties in comparing such data between publications, and its application to studies of disease prevalence in different populations. Analysis of Gene Ontology-based functions of CAG-polyglutamine-containing genes provided a visual framework for interpretation of these genes' functions. All nine known disease genes were involved in DNA

  3. Fragmentation of kidney stones

    International Nuclear Information System (INIS)

    Kovacs, K.; Kun, F.; Vertse, T.

    2005-01-01

    Complete text of publication follows. Fragmentation, i.e. the breaking of particulate materials into smaller pieces is abundant in nature and underlies several industrial processes, which attracted a continuous interest in scientific and engineering research over the past decades. In industrial applications, fragmentation processes are mostly used for the comminution of ores in various types of mills. Kidney stone is a well known human dis- ease which embitters the life of many people (in a country like the USA about 10 6 cases are registered yearly). In order to extract large kidney stones (diameter ≥ 1 cm) from the human body without operation, one of the most efficient treatment is the fragmentation of kidney stones by the so-called extracorporal shock wave lithography method: a shock wave penetrating the human body is generated by an electric pulse. The repeated application of the shock wave gradually fragments the stones into pieces of size ≤ 2 mm which then leave the body through the urine system. Recently, a novel type of lithographic method has been suggested by using widely focused shock waves which fragment the stones by a squeezing mechanism. Laboratory experiments showed that the widely focused squeezing waves achieve a higher fragmentation efficiency than the frequently used shock waves of sharp focus. Based on this method a novel medical treatment can be introduced which is less demanding for the patients. Before the application of the method in the clinical practice a detailed understanding of the fragmentation mechanism of kidney stones due to shock waves is required. Since analytic theoretical methods have serious limitations in this field, we develop a realistic model of the mechanical behavior of kidney stones and a simulation code which makes possible to study the mechanism of breakup under various external conditions. Computer simulations in two dimensions have revealed a peculiar way of crack formation, i.e. the crack which finally breaks

  4. [The random amplified polymorphic DNA identification of 9 Taenia saginata isolates from four provinces].

    Science.gov (United States)

    Zhang, Ke; Yang, Ming; Bao, Huai-En

    2006-12-01

    To make molecular identification for 9 isolates of Taenia saginata from 4 provinces. Genomic DNA was extracted from the segments of adult tapeworms collected from Taoyuan of Taiwan (TW1), Duyun of Guizhou (DY1, DY2), Congjiang of Guizhou (CJ1, CJ2, CJ3, CJ4), Dali of Yunnan (DL1) and Wushi of Xinjiang (XJ1) respectively. PCRs were carried out with 13 random primers. A phylogenetic tree of different geographical strains was constructed. 331 DNA fragments were amplified. The number of DNA fragments amplified by single primer was between 3 and 28. The average number of amplified DNA fragments by the 13 primers was 14.15. The average number of fragments from the 9 isolates of T. saginata was 14.08. Phylogenetic tree revealed that there were two branches in the tree, DY1, DY2, DL1 and TW1 occupied one branch, while CJ1, CJ2, CJ3, CJ4 and XJ1 occupied the other one. By the RAPD analysis, the isolates DY1, DY2, DL1 and TW1 belong to Taenia saginata asiatica, and the isolates CJ1, CJ2, CJ3, CJ4 and XJ1 belong to T. saginata saginata.

  5. A system for biasing a differential amplifier

    International Nuclear Information System (INIS)

    Barbier, Daniel; Ittel, J.M.; Poujois, Robert

    1975-01-01

    This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

  6. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2001-01-01

    on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR......In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... greater than 84 dB. The equivalent input referred noise in the bandwidth of interest is 5 nV/√Hz. The amplifier power consumption is 275 μW....

  7. Genetic Differentiation of Archachatina marginata Populations from Three Vegetation Zones Using Radom Amplified Polymorphic DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Comfort O. AFOLAYAN

    2015-09-01

    Full Text Available The genetic differentiation of Archachatina marginata populations from three different zones of Nigeria was studied with a view to delimiting them into sub-species. One hundred and nineteen (119 snail specimens were collected, comprising of forty (40 specimens from Yenagoa (Mangrove forest and from Kabba (Guinea Savanna and thirty nine (39 specimens were from Ile-Ife (Rainforest. Eight parameters of the shell specimens of A. marginata which included height of shell, width of shell, aperture height, aperture width, spire length, spire width, penultimate whorl length and first whorl length were subjected to Principal Component Analysis (PCA and Canonical Variates Analysis (CVA to delimit the populations into sub-species. DNA of the various populations was extracted from the foot muscle using CTAB (Cetyl Trimethyl Ammonium Bromide method, which was subjected to RAPD analysis. The RAPD studies employed five (5 oligonucleotide primers (OPB – 17, OPH – 12, OPH – 17, OPI – 06 and OPU – 14 to amplify DNA from 27 samples of A. marginata selected. All five primers produced different band patterns, and the number of fragments amplified per primer varied. Among them, OPB- 17 gave DNA profiles with more numerous bands than the others primers. Both PCA and CVA produced overlapped clusters of A. marginata specimens from the three vegetation zones. The height of shell was observed to be the most variable feature and preferably the most suitable parameter for population grouping. Analysis of the proportions of polymorphic loci and band sharing based on similarity indices for A. marginata samples indicated a relatively high level of genetic variation in the populations from the three areas.

  8. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  9. Picking Up (On) Fragments

    NARCIS (Netherlands)

    Ellis, Phil

    2015-01-01

    abstractThis article discusses the implications for archival and media archaeological research and reenactment artwork relating to a recent arts practice project: reenacttv: 30 lines / 60 seconds. It proposes that archival material is unstable but has traces and fragments that are full of creative

  10. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...

  11. Wildlife habitat fragmentation.

    Science.gov (United States)

    John. Lehmkuhl

    2005-01-01

    A primary issue in forest wildlife management is habitat fragmentation and its effects on viability, which is the "bottom line" for plant and animal species of conservation concern. Population viability is the likelihood that a population will be able to maintain itself (remain viable) over a long period of time-usually 100 years or more. Though it is true...

  12. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  13. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Some delicate nerves and fibres in the surrounding areas of the stones present in the kidney are also damaged by high ultrasonic intensity used in such systems. In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavitation bubbles are found to implode faster, with more ...

  14. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  15. Transverse pumped laser amplifier architecture

    Science.gov (United States)

    Bayramian, Andrew James; Manes, Kenneth; Deri, Robert; Erlandson, Al; Caird, John; Spaeth, Mary

    2013-07-09

    An optical gain architecture includes a pump source and a pump aperture. The architecture also includes a gain region including a gain element operable to amplify light at a laser wavelength. The gain region is characterized by a first side intersecting an optical path, a second side opposing the first side, a third side adjacent the first and second sides, and a fourth side opposing the third side. The architecture further includes a dichroic section disposed between the pump aperture and the first side of the gain region. The dichroic section is characterized by low reflectance at a pump wavelength and high reflectance at the laser wavelength. The architecture additionally includes a first cladding section proximate to the third side of the gain region and a second cladding section proximate to the fourth side of the gain region.

  16. Silicon Germanium Cryogenic Low Noise Amplifiers

    Science.gov (United States)

    Bardin, J. C.; Montazeri, S.; Chang, Su-Wei

    2017-05-01

    Silicon germanium heterojunction bipolar transistors have emerged in the last decade as an excellent option for use in cryogenic low noise amplifiers. This paper begins with a review of the critical developments that have led to today’s cryogenic low noise amplifiers. Next, recent work focused on minimizing the power consumption of SiGe cryogenic amplifiers is presented. Finally, open issues related to the cryogenic noise properties of SiGe HBTs are discussed.

  17. Short Rayleigh Range Free Electron Laser Amplifiers

    CERN Document Server

    Yu, L H; Murphy, J B; Rose, J; Shaftan, T V; Wang, X J; Watanabe, T

    2005-01-01

    An important requirement for a high average power laser system is a manageable power density on the first optical element. One possibility to achieve this is a single pass amplifier which generates a short Rayleigh range (SRL) light beam. We present design parameters and calculated performances for several SRL configurations. These include a simulation of the optically guided (pinched) MW class FEL [1], the scalloped beam FEL amplifier [2] and high gain TOK amplifiers we propose to explore at our SDL facility.

  18. Characteristics research of self-amplified distributed feedback fiber laser

    Science.gov (United States)

    Song, Zhiqiang; Qi, Haifeng; Guo, Jian; Wang, Chang; Peng, Gangding

    2013-09-01

    A distributed feedback (DFB) fiber laser with a ratio of backward to forward output power of 1:100 was composed by a 45mm length asymmetrical phase-shifted fiber grating fabricated on 50mm erbium-doped photosensitive fiber. Forward output laser was amplified using a certain length of Nufern EDFL980-Hp erbium-doped fiber to absorb surplus pump power after the active phase-shifted fiber grating and get population inversion. Using OptiSystem software, the best fiber length of the EDFL to get the highest gain was simulated. In order to keep the amplified laser with narrow line-width and low noise, a narrow-band light filter consisted of a FBG with the same Bragg wavelength as the laser and an optical circulator was used to filter the ASE noise of the out-cavity erbium-doped fiber. The designed laser structure sufficiently utilized the pump power, a DFB fiber laser of 32.5mW output power, 11.5 kHz line width, and -87dB/Hz relative intensity noise (RIN) at 300mW of 980 nm pump power was brought out.

  19. Dynamics of soliton cascades in fiber amplifiers.

    Science.gov (United States)

    Arteaga-Sierra, F R; Antikainen, A; Agrawal, Govind P

    2016-11-15

    We study numerically the formation of cascading solitons when femtosecond optical pulses are launched into a fiber amplifier with less energy than required to form a soliton of equal duration. As the pulse is amplified, cascaded fundamental solitons are created at different distances, without soliton fission, as each fundamental soliton moves outside the gain bandwidth through the Raman-induced spectral shifts. As a result, each input pulse creates multiple, temporally separated, ultrashort pulses of different wavelengths at the amplifier output. The number of pulses depends not only on the total gain of the amplifier but also on the width of the input pulse.

  20. Reflection amplifiers in self-regulated learning

    NARCIS (Netherlands)

    Verpoorten, Dominique

    2012-01-01

    Verpoorten, D. (2012). Reflection amplifiers in self-regulated learning. Doctoral thesis. November, 9, 2012, Heerlen, The Netherlands: Open Universiteit (CELSTEC). Datawyse / Universitaire Pers Maastricht.

  1. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning.

    Science.gov (United States)

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the target vector. We test its universality in our script programmed in Python. Our data shows that, among the entire human and mouse CDS, at least 70% of long CDS cloning will benefit from this strategy.

  2. Comparison of the value of pulsed-field gel electrophoresis, random amplified polymorphic DNA and amplified rDNA restriction analysis for subtyping Taylorella equigenitalis.

    Science.gov (United States)

    Kagawa, S; Moore, J E; Murayama, O; Matsuda, M

    2001-05-01

    Eight strains of Taylorella equigenitalis were identified by a polymerase chain reaction using a primer pair specific to the 16S rDNA of T equigenitalis. These eight strains were chosen because they had previously been shown to represent eight distinct genotypes by pulsed-field gel electrophoresis analysis after separate digestion of the genomic DNA with ApaI or NotI. The eight strains could be classified into six or seven types by random amplified polymorphic DNA analysis using different kinds of primers. Amplified rDNA restriction analysis after separate digestion with five restriction enzymes, including AluI and MboI, of the 1,500 bp fragments of rDNA amplified by polymerase chain reaction did not discriminate the genomic variations among the eight strains of T equigenitalis. Thus, pulsed-field gel electrophoresis was shown to discriminate these eight organisms better than random amplified polymorphic DNA analysis, while amplified rDNA restriction analysis was found to be unsuitable for subtyping T equigenitalis.

  3. HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS.

    Energy Technology Data Exchange (ETDEWEB)

    BEN-ZVI, ILAN, DAYRAN, D.; LITVINENKO, V.

    2005-08-21

    Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department.

  4. Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

    DEFF Research Database (Denmark)

    Wang, Z.; Durhuus, T.; Mikkelsen, Benny

    1994-01-01

    A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

  5. Subcloning of DNA fragments.

    Science.gov (United States)

    Struhl, K

    2001-05-01

    The essence of recombinant DNA technology is the joining of two or more separate segments of DNA to generate a single DNA molecule that is capable of autonomous replication in a given host. The simplest constructions of hybrid DNA molecules involve the cloning of insert sequences into plasmid or bacteriophage cloning vectors. The insert sequences can derive from essentially any organism, and they may be isolated directly from the genome, from mRNA, or from previously cloned DNA segments (in which case, the procedure is termed subcloning). Alternatively, insert DNAs can be created directly by DNA synthesis. This unit provides protocols for the subcloning of DNA fragments and ligation of DNA fragments in gels.

  6. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    , it was the central government’s task to coordinate, steer and control the newly emerged decentralized organizations. This raises questions about the overall design of the public sector at present. Our paper engages with the prevalent public governance phenomenon of fragmentation from a design perspective in order......Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  7. Design and development of a spectroscopy amplifier

    International Nuclear Information System (INIS)

    Ahmad, N.; Khalaf, M.A.

    1998-01-01

    Spectroscopy amplifier is an integral part of my detection system used for the measurement and spectroscopy of nuclear radiations. Its performance determination the contribution of the electronics to the energy resolution of the system. A spectroscopy amplifier has been designed and developed using locally available components. The design and description of this unit is discussed in this article. (author)

  8. Bevalac injector final stage RF amplifier upgrades

    International Nuclear Information System (INIS)

    Howard, D.; Calvert, J.; Dwinell, R.; Lax, J.; Lindner, A.; Richter, R.; Ridgeway, W.

    1991-01-01

    With the assistance of the DOE In-house Energy Management Program, the Bevalac injector final stage RF amplifier systems have been successfully upgraded to reduce energy consumption and operating costs. This recently completed project removed the energy-inefficient plate voltage modulator circuits that were used in conjunction with the final stage RF amplifiers. Construction, design, and operating parameters are described in detail

  9. BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER

    DEFF Research Database (Denmark)

    2010-01-01

    Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...

  10. A CMOS current-mode operational amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1993-01-01

    A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanc...

  11. Enhanced Gain in Photonic Crystal Amplifiers

    DEFF Research Database (Denmark)

    Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

    2012-01-01

    We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission...

  12. High Average Power Optical FEL Amplifiers

    CERN Document Server

    Ben-Zvi, I; Litvinenko, V

    2005-01-01

    Historically, the first demonstration of the FEL was in an amplifier configuration at Stanford University. There were other notable instances of amplifying a seed laser, such as the LLNL amplifier and the BNL ATF High-Gain Harmonic Generation FEL. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance a 100 kW average power FEL. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting energy recovery linacs combine well with the high-gain FEL amplifier to produce unprecedented average power FELs with some advantages. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Li...

  13. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2003-01-01

    . A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

  14. Self-pulsation in Raman fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, Martin Erland Vestergaard; Ott, Johan Raunkjær; Rottwitt, Karsten

    2009-01-01

    Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated.......Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated....

  15. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  16. Design of an 1800 nm Raman Amplifier

    DEFF Research Database (Denmark)

    Svane, Ask Sebastian; Rottwitt, Karsten

    , also extended band amplifiers are required. As a solution to the latter challenge, Raman amplifiers are suggested as promising candidates. The main hurdle when designing a long wavelength Raman amplifier is the increased intrinsic fiber attenuation which as a consequence leads to an increase...... in the pump power requirement and deteriorated noise properties. Here we demonstrate a Raman amplifier designed for signal wavelengths around 1800 nm. The amplification fiber is an OFS PM Raman fiber, and is pumped by a Raman fiber laser emitting at 1680 nm [4]. The amplifier was pumped co......-polarized and backward, with respect to the singal. In Fig. 2 a measured Raman on/off gain exceeding 9 dB for 285 mW of injected pump power is obtained in a 4.35 km long fiber. A broadband supercontinuum source was used as a signal from 1700 nm to 1900 nm....

  17. Dual-range linearized transimpedance amplifier system

    Science.gov (United States)

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  18. Design of an 1800nm Raman amplifier

    DEFF Research Database (Denmark)

    Svane, Ask Sebastian; Rottwitt, Karsten

    2013-01-01

    We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...... performance of the amplifier is also investigated for both configurations. Our results show an on/off gain exceeding 20 dB at 1810 nm for which the obtained effective noise figure is below 3 dB....

  19. Ultrafast disk lasers and amplifiers

    Science.gov (United States)

    Sutter, Dirk H.; Kleinbauer, Jochen; Bauer, Dominik; Wolf, Martin; Tan, Chuong; Gebs, Raphael; Budnicki, Aleksander; Wagenblast, Philipp; Weiler, Sascha

    2012-03-01

    Disk lasers with multi-kW continuous wave (CW) output power are widely used in manufacturing, primarily for cutting and welding applications, notably in the automotive industry. The ytterbium disk technology combines high power (average and/or peak power), excellent beam quality, high efficiency, and high reliability with low investment and operating costs. Fundamental mode picosecond disk lasers are well established in micro machining at high throughput and perfect precision. Following the world's first market introduction of industrial grade 50 W picosecond lasers (TruMicro 5050) at the Photonics West 2008, the second generation of the TruMicro series 5000 now provides twice the average power (100 W at 1030 nm, or 60 W frequency doubled, green output) at a significantly reduced footprint. Mode-locked disk oscillators achieve by far the highest average power of any unamplified lasers, significantly exceeding the 100 W level in laboratory set-ups. With robust long resonators their multi-microjoule pulse energies begin to compete with typical ultrafast amplifiers. In addition, significant interest in disk technology has recently come from the extreme light laser community, aiming for ultra-high peak powers of petawatts and beyond.

  20. Gene Prediction in Metagenomic Fragments with Deep Learning

    Directory of Open Access Journals (Sweden)

    Shao-Wu Zhang

    2017-01-01

    Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

  1. A broadband high-efficiency Doherty power amplifier using symmetrical devices

    Science.gov (United States)

    Cheng, Zhiqun; Zhang, Ming; Li, Jiangzhou; Liu, Guohua

    2018-04-01

    This paper proposes a method for broadband and high-efficiency amplification of Doherty power amplifier (DPA) using symmetric devices. In order to achieve the perfect load modulation, the carrier amplifier output circuit total power length is designed to odd multiple of 90°, and the peak amplifier output total power length is designed to even multiple of 180°. The proposed method is demonstrated by designing a broadband high-efficiency DPA using identical 10-W packaged GaN HEMT devices. Measurement results show that over 51% drain efficiency is achieved at 6-dB back-off power, over the frequency band of 1.9–2.4 GHz. Project supported by the National Natural Science Foundation of China (No. 60123456), the Zhejiang Provincial Natural Science Foundation of China (No. LZ16F010001), and the Zhejiang Provincial Public Technology Research Project (No. 2016C31070).

  2. Critical Features of Fragment Libraries for Protein Structure Prediction

    Science.gov (United States)

    dos Santos, Karina Baptista

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction. PMID:28085928

  3. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Directory of Open Access Journals (Sweden)

    Raphael Trevizani

    Full Text Available The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  4. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Science.gov (United States)

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  5. Amplified CWDM-based Next Generation Broadband Access Networks

    Science.gov (United States)

    Peiris, Sasanthi Chamarika

    The explosive growth of both fixed and mobile data-centric traffic along with the inevitable trend towards all-IP/Ethernet transport protocols and packet switched networks will ultimately lead to an all-packet-based converged fixed-mobile optical transport network from the core all the way out to the access network. To address the increasing capacity and speed requirements in the access networks, Wavelength-Division Multiplexed (WDM) and/or Coarse WDM (CWDM)-based Passive Optical Networks (PONs) are expected to emerge as the next-generation optical access infrastructures. However, due to several techno-economic hurdles, CWDM-PONs are still considered an expensive solution and have not yet made any significant inroads into the current access area. One of the key technology hurdles is the scalability of the CWDM-based PONs. Passive component optical insertion losses limit the reach of the network or the number of served optical network units (ONUs). In the recent years, optical amplified CWDM approaches have emerged and new designs of optical amplifiers have been proposed and demonstrated. The critical design parameter for these amplifiers is the very wide optical amplification bandwidth (e.g., 340 nm combined for both directions). The objective of this PhD dissertation work is first to engineer ring and tree-ring based PON architectures that can achieve longer unamplified PON reach and/or provide service to a greater number of ONUs and customers. Secondly is to develop new novel optical amplifier schemes to further address the scalability limitation of the CWDM-based PONs. Specifically, this work proposes and develops novel ultra wide-band hybrid Raman-Optical parametric amplifier (HROPA) schemes that operate over nearly the entire specified CWDM band to provide 340 nm bidirectional optical gain bandwidth over the amplified PON's downstream and upstream CWDM wavelength bands (about 170 nm in each direction). The performance of the proposed HROPA schemes is assessed

  6. Construction of a human recombinant polyclonal Fab fragment antibody library using peripheral blood lymphocytes of snake bitten victims

    Directory of Open Access Journals (Sweden)

    Motedayen, M.H.

    2015-12-01

    Full Text Available Human snake bitten poisoning is a serious threat in many tropical and subtropical countries such as Iran. The best acceptable treatment of envenomated humans is antivenoms; however they have a series of economic and medical problems and need more improvements. In this study a combinatorial human immunoglobulin gene library against some of Iranian snakes venoms was constructed. Total RNA prepared from peripheral blood lymphocytes of two recovered snake victims. RT-PCR was used for cDNA synthesis and amplification of the heavy (Fd segment and kappa light chains of IgG antibody. After digestion of the heavy chain with SpeI and XhoI and light chain with XbaI and SacI enzymes, inserted successively into the cloning vector pComb3x, and then recombinant vector transformed to TG1 bacteria to construct the Fab library. For determination insertion rate of Fab segment into cloning vector, plasmids of 12 clones of library were extracted and digested with SfiI. Length of amplified Fd and κ chains, were 650 - 750 bp. Primary library size was determined to contain 4.9×105 members out of which half of them contained the same size of Fab fragment. This result is comparable to some researchers and shows that this method could be appropriate tool for the production of human polyclonal Fab fragment antibodies for management of poisonous snake bitted victims.

  7. Fragment-fragment correlations in near-binary fragmentation of C60

    International Nuclear Information System (INIS)

    Vandenbosch, R.; Henry, B.; Cooper, C.H.; Liang, J.F.; Will, D.I.

    1997-01-01

    The collision dynamics of C 60 with H 2 and He gas has been studied using reverse kinematics. A beam of C 60 - is obtained by electron attachment to neutral molecules exiting an oven and then accelerated to energies between 75 and 150 keV. The collisions take place in a windowless gas cell. We energy analyze the products in a pair of electrostatic analyzers which are oriented so that coincidences between light and heavy fragments can be observed. Our energy, and hence mass, resolution is sufficient to uniquely identify all C n clusters between n=1 and 60. The principal question we are addressing is whether heavy products in the mass range C 34 to C 56 are produced solely by sequential emission of C 2 fragments, or whether longer chains (and possibly rings) compete with C 2 emission. From our coincidence studies we have conclusive evidence that fragments such as C 8 are fragmentation partners to heavy fragments. In general we find that the products of a binary fragmentation are sufficiently excited that sequential decay follows the initial fragmentation. Although only even-n heavy fragments are observed, the coincident light fragments include both odd and even-n fragments due to subsequent fragmentation of the excited lighter partner of the initial binary fragmentation. This scenario has been confirmed by studying coincidences between two light fragments. copyright 1997 American Institute of Physics

  8. SCALING AND 4-QUARK FRAGMENTATION

    NARCIS (Netherlands)

    SCHOLTEN, O; BOSVELD, GD

    1991-01-01

    The conditions for a scaling behaviour from the fragmentation process leading to slow protons are discussed- The scaling referred to implies that the fragmentation functions depend on the light-cone momentum fraction only. It is shown that differences in the fragmentation functions for valence- and

  9. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  10. Generic behaviours in impact fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Sator, N.; Mechkov, S.; Sausset, F. [Paris-6 Univ. Pierre et Marie Curie, Lab. de Physique Theorique de la Matiere Condensee, UMR CNRS 7600, 75 - Paris (France); Mechkov, S. [Ecole Normale Superieure, Lab. de Physique Statistique, 75 - Paris (France)

    2008-02-15

    From atomic nuclei to supernovae, including plates and rocks, every cohesive system can be broken into fragments, provided that the deposited energy is sufficiently large compared to its cohesive energy. We present a simple numerical model for investigating the general properties of fragmentation. By use of molecular dynamics simulations, we study the impact fragmentation of a solid disk of interacting particles with a wall. Regardless of the particular form of the interaction potential, the fragment size distribution exhibits a power law behaviour with an exponent that increases logarithmically with the energy deposited in the system, in agreement with experiments. We expect this behaviour to be generic in fragmentation phenomena. (authors)

  11. Fundamentals of RF and microwave transistor amplifiers

    CERN Document Server

    Bahl, Inder J

    2009-01-01

    A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read

  12. Quantum electronics maser amplifiers and oscillators

    CERN Document Server

    Fain, V M; Sanders, J H

    2013-01-01

    Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma

  13. A parallel input composite transimpedance amplifier

    Science.gov (United States)

    Kim, D. J.; Kim, C.

    2018-01-01

    A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.

  14. Self-Amplified Optical Pattern Recognizer

    Science.gov (United States)

    Liu, Hua-Kuang

    1993-01-01

    Self-amplified optical pattern recognizers developed for use in recognition of patterns, in optical computing, and in optoelectronic neural networks. In recognizer, photorefractive crystal serves as medium in which one holographically records diffraction-grating filter representing pattern with which recognition sought. Apparatus "self-amplified" because signal amplified within filter to many orders of magnitude greater than in prior optical pattern recognizers. Basic principle of operation applicable to many types of correlation filters, including (but not limited to) Vander Lugt matched filters, joint-transform filters, and phase-only filters.

  15. Noiseless attenuation using an optical parametric amplifier

    Science.gov (United States)

    Brewster, R. A.; Nodurft, I. C.; Pittman, T. B.; Franson, J. D.

    2017-10-01

    The process of heralded noiseless amplification, and the inverse process of heralded noiseless attenuation, have potential applications in the context of quantum communications. Although several different physical implementations of heralded noiseless amplifiers have now been demonstrated, the research on heralded noiseless attenuators has been largely confined to a beam-splitter based approach. Here we show that an optical parametric amplifier (OPA), combined with appropriate heralding, can also serve as a heralded noiseless attenuator. The counterintuitive use of an optical amplifier as an attenuator is only possible due to the probabilistic nature of the device.

  16. Fragmentation of Chitosan by Acids

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Kasaai

    2013-01-01

    Full Text Available Fragmentation of chitosan in aqueous solution by hydrochloric acid was investigated. The kinetics of fragmentation, the number of chain scissions, and polydispersity of the fragments were followed by viscometry and size exclusion chromatography. The chemical structure and the degree of N-acetylation (DA of the original chitosan and its fragments were examined by 1H NMR spectroscopy and elemental analysis. The kinetic data indicates that the reaction was of first order. The results of polydispersity and the DA suggest that the selected experimental conditions (temperature and concentration of acid were appropriate to obtain the fragments having the polydispersity and the DA similar to or slightly different from those of the original one. A procedure to estimate molecular weight of fragments as well as the number of chain scissions of the fragments under the experimental conditions was also proposed.

  17. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 10617, Taiwan (China); Teixeira, Paula S. [Institut fuer Astrophysik, Universitaet Wien, Tuerkenschanzstrasse 17, A-1180, Wien (Austria); Zapata, Luis A., E-mail: satoko_t@asiaa.sinica.edu.tw [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, Morelia, Michoacan 58090 (Mexico)

    2013-01-20

    We present a high angular resolution map of the 850 {mu}m continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 Multiplication-Sign 2.'0 (0.88 Multiplication-Sign 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H{sub 2} mass between 0.3-5.7 M {sub Sun} and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n{sub H{sub 2}}{>=}10{sup 6} cm{sup -3}), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of Almost-Equal-To 17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud ( Almost-Equal-To 35 pc), large-scale clumps ( Almost-Equal-To 1.3 pc), and small-scale clumps ( Almost-Equal-To 0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  18. Telomere length analysis.

    Science.gov (United States)

    Canela, Andrés; Klatt, Peter; Blasco, María A

    2007-01-01

    Most somatic cells of long-lived species undergo telomere shortening throughout life. Critically short telomeres trigger loss of cell viability in tissues, which has been related to alteration of tissue function and loss of regenerative capabilities in aging and aging-related diseases. Hence, telomere length is an important biomarker for aging and can be used in the prognosis of aging diseases. These facts highlight the importance of developing methods for telomere length determination that can be employed to evaluate telomere length during the human aging process. Telomere length quantification methods have improved greatly in accuracy and sensitivity since the development of the conventional telomeric Southern blot. Here, we describe the different methodologies recently developed for telomere length quantification, as well as their potential applications for human aging studies.

  19. Microwave parametric amplifiers using externally pumped Josephson junctions

    DEFF Research Database (Denmark)

    Sørensen, O. H.; Mygind, Jesper; Pedersen, Niels Falsig

    1978-01-01

    Externally pumped parametric amplifiers are discussed. Theory and experiments on the singly degenerate parametric amplifier based on a Josephson junction are presented. Advantages and limitations of the singly degenerate and doubly degenerate parametric amplifiers are discussed. Some plans and pr...

  20. Comparação entre fragmentos obtidos com agulhas de calibres 14 e 12 em "core biopsy" estereotáxica de lesões mamárias impalpáveis: diferenças entre o tamanho dos fragmentos e freqüência dos tipos de lesões diagnosticadas Comparison between the fragments obtained by stereotactic core biopsy of nonpalpable breast lesions using 14- and 12-gauge needles: differences on the length of the fragments obtained and on the frequency of the types of diagnosed lesions

    Directory of Open Access Journals (Sweden)

    Maria do Carmo Abreu-e-Lima

    2001-10-01

    Full Text Available Com o objetivo de avaliar o desempenho das agulhas de calibres 14 e 12 na obtenção de "core biopsies" da mama sob controle estereotáxico, os autores compararam biópsias de lesões mamárias impalpáveis obtidas com agulhas desses calibres quanto ao tamanho dos fragmentos e freqüência dos tipos de lesões diagnosticadas. De um total de 1.009 biópsias, os autores analisaram 900 obtidas por agulhas 14 e 109 obtidas por agulhas 12, para análise da freqüência das lesões. Os tamanhos dos fragmentos foram analisados nos 700 primeiros casos para os espécimes obtidos por agulhas 14. A utilização de agulhas 12 resultou em maior tamanho dos fragmentos (p The purpose of this study was to compare the performance of 14- and 12-gauge needles for obtaining biopsy specimens under stereotactic guidance. The authors compared the biopsies of nonpalpable breast lesions using these different size needles, regarding the length of the fragments obtained and the types of diagnosed lesions. A total of 1,009 samples were obtained using 14-gauge (900 samples and 12-gauge (109 samples needles. The size of the samples was evaluated on the first 700 consecutive biopsies using 14-gauge needles. The use of 12-gauge needles consistently provided larger size specimens than 14-gauge needles (p < 0.001; a reduction in the prevalence of benign nonneoplastic lesions (p = 0.03 and a higher frequency of in situ and invasive carcinomas (p < 0.001 were also observed. These findings may suggest a higher diagnostic accuracy of biopsies performed with 12-gauge needles due to the larger samples obtained and/or due to a better radiological selection of those lesions, which were detected by digital mammography and biopsied under digital stereotactic guidance.

  1. Genetic differentiation and inheritance of random amplified ...

    African Journals Online (AJOL)

    ufuoma

    2013-09-11

    populations; the pectoral spine phenotypic groups ... Key words: Random amplified polymorphic DNA (RAPD) marker, morphologic and genetic variability, Clarias gariepinus. ..... However, genetic variability of the stock will have to be.

  2. Noise in phase-preserving linear amplifiers

    Energy Technology Data Exchange (ETDEWEB)

    Pandey, Shashank; Jiang, Zhang; Combes, Joshua [Center for Quantum Information and Control, University of New Mexico, Albuquerque, NM 87131-0001 (United States); Caves, Carlton M. [Center for Quantum Information and Control, University of New Mexico, Albuquerque, NM 87131-0001, USA and Centre for Engineered Quantum Systems, School of Mathematics and Physics, University of Queensland, Brisbane, QLD 4072 (Australia)

    2014-12-04

    The purpose of a phase-preserving linear amplifier is to make a small signal larger, so that it can be perceived by instruments incapable of resolving the original signal, while sacrificing as little as possible in signal-to-noise. Quantum mechanics limits how well this can be done: the noise added by the amplifier, referred to the input, must be at least half a quantum at the operating frequency. This well-known quantum limit only constrains the second moments of the added noise. Here we provide the quantum constraints on the entire distribution of added noise: any phasepreserving linear amplifier is equivalent to a parametric amplifier with a physical state σ for the ancillary mode; σ determines the properties of the added noise.

  3. (ISSR) and randomly amplified polymorphic DNA

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... The phylogenic relationship within four species of Polygonum (including Polygonum hyrcanicum Rech. f. (three samples), Polygonum persicaria Boiss & Bushe Boiss, Polygonum avicular L., and Polygonum hydropiper L. subsp. Hydropiper) was investigated by randomly amplified polymorphic DNA ...

  4. Quantum-Limited Directional Amplifiers with Optomechanics

    Science.gov (United States)

    Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas

    2018-01-01

    Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.

  5. EQUIPMENT WITH HYDROSTATIC AMPLIFIER MODELED 3D

    Directory of Open Access Journals (Sweden)

    EFTIMIE Dorin

    2013-11-01

    Full Text Available The equipment with hydrostatic amplifier is a new constructive solution modeled 3D using NX 7.5 software. Hydraulic equipment allows the amplification of a constant torque of a DC electric motor of low power at a variable speed. The hydrostatic speed amplifier of constant torque with electric control device is a hydraulic device which provides by design a bridge between the conventional hydraulic and the servo-hydraulic.

  6. EQUIPMENT WITH HYDROSTATIC AMPLIFIER MODELED 3D

    OpenAIRE

    EFTIMIE Dorin; FRONE Alexandru

    2013-01-01

    The equipment with hydrostatic amplifier is a new constructive solution modeled 3D using NX 7.5 software. Hydraulic equipment allows the amplification of a constant torque of a DC electric motor of low power at a variable speed. The hydrostatic speed amplifier of constant torque with electric control device is a hydraulic device which provides by design a bridge between the conventional hydraulic and the servo-hydraulic.

  7. Intermediate mass fragments emission in binary fragmentation model

    International Nuclear Information System (INIS)

    Bhattacharya, C.; Bhattacharya, S.

    1991-01-01

    Intermediate mass fragments emission in intermediate-energy nucleus-nucleus collisions has been studied in the framework of a generalized model where the fragments are assumed to be emitted from binary fissionlike decay of the fully equilibrated compound nucleus. The present formulation, with a schematic exit channel shape configuration and simple rotating liquid-drop nuclear potential, has been found to explain most of the intermediate mass fragments emission cross sections reasonably well without incorporating any free parameters in the calculation

  8. Multiple excitation regenerative amplifier inertial confinement system

    International Nuclear Information System (INIS)

    George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

    1980-01-01

    The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

  9. Proposal of Switching Power Amplifier Using Small Capacity Linear Amplifier and LC Filter

    Science.gov (United States)

    Kamada, Jo; Funato, Hirohito; Ogasawara, Satoshi

    The higher efficiency and the low noise in output voltage and current has been required in some applications, i.e. audio-video equipment, medical equipment and so on. This paper proposes a power amplifier in which a PWM inverter is used as a main circuit. In the proposed power amplifier, a hybrid filter composed of a simple and general LC filter and a small capacity linear amplifier is connected to the output of the inverter. The linear amplifier is inserted in series to the filter capacitor to improve the filtering effect of the LC filter. Switching ripples and LC resonances are considerably suppressed by controlling the amplifier using the proposed method and a low distortion switching power amplifier is realized. The effects of the proposal circuit are verified by simulations and experiments. As a result, the proposed circuit achieves low noise about THD=0.68% in simulation and THD=1.7% in experiment.

  10. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  11. Saturating representation of loop conformational fragments in structure databanks

    Directory of Open Access Journals (Sweden)

    Fiser András

    2006-07-01

    Full Text Available Abstract Background Short fragments of proteins are fundamental starting points in various structure prediction applications, such as in fragment based loop modeling methods but also in various full structure build-up procedures. The applicability and performance of these approaches depend on the availability of short fragments in structure databanks. Results We studied the representation of protein loop fragments up to 14 residues in length. All possible query fragments found in sequence databases (Sequence Space were clustered and cross referenced with available structural fragments in Protein Data Bank (Structure Space. We found that the expansion of PDB in the last few years resulted in a dense coverage of loop conformational fragments. For each loops of length 8 in the current Sequence Space there is at least one loop in Structure Space with 50% or higher sequence identity. By correlating sequence and structure clusters of loops we found that a 50% sequence identity generally guarantees structural similarity. These percentages of coverage at 50% sequence cutoff drop to 96, 94, 68, 53, 33 and 13% for loops of length 9, 10, 11, 12, 13, and 14, respectively. There is not a single loop in the current Sequence Space at any length up to 14 residues that is not matched with a conformational segment that shares at least 20% sequence identity. This minimum observed identity is 40% for loops of 12 residues or shorter and is as high as 50% for 10 residue or shorter loops. We also assessed the impact of rapidly growing sequence databanks on the estimated number of new loop conformations and found that while the number of sequentially unique sequence segments increased about six folds during the last five years there are almost no unique conformational segments among these up to 12 residues long fragments. Conclusion The results suggest that fragment based prediction approaches are not limited any more by the completeness of fragments in databanks but

  12. Telomere length and depression

    DEFF Research Database (Denmark)

    Wium-Andersen, Marie Kim; Ørsted, David Dynnes; Rode, Line

    2017-01-01

    BACKGROUND: Depression has been cross-sectionally associated with short telomeres as a measure of biological age. However, the direction and nature of the association is currently unclear. AIMS: We examined whether short telomere length is associated with depression cross-sectionally as well...... as prospectively and genetically. METHOD: Telomere length and three polymorphisms, TERT, TERC and OBFC1, were measured in 67 306 individuals aged 20-100 years from the Danish general population and associated with register-based attendance at hospital for depression and purchase of antidepressant medication....... RESULTS: Attendance at hospital for depression was associated with short telomere length cross-sectionally, but not prospectively. Further, purchase of antidepressant medication was not associated with short telomere length cross-sectionally or prospectively. Mean follow-up was 7.6 years (range 0...

  13. Myofilament length dependent activation

    Energy Technology Data Exchange (ETDEWEB)

    de Tombe, Pieter P.; Mateja, Ryan D.; Tachampa, Kittipong; Mou, Younss Ait; Farman, Gerrie P.; Irving, Thomas C. (IIT); (Loyola)

    2010-05-25

    The Frank-Starling law of the heart describes the interrelationship between end-diastolic volume and cardiac ejection volume, a regulatory system that operates on a beat-to-beat basis. The main cellular mechanism that underlies this phenomenon is an increase in the responsiveness of cardiac myofilaments to activating Ca{sup 2+} ions at a longer sarcomere length, commonly referred to as myofilament length-dependent activation. This review focuses on what molecular mechanisms may underlie myofilament length dependency. Specifically, the roles of inter-filament spacing, thick and thin filament based regulation, as well as sarcomeric regulatory proteins are discussed. Although the 'Frank-Starling law of the heart' constitutes a fundamental cardiac property that has been appreciated for well over a century, it is still not known in muscle how the contractile apparatus transduces the information concerning sarcomere length to modulate ventricular pressure development.

  14. Two-wave mixing in a broad-area semiconductor amplifier

    DEFF Research Database (Denmark)

    Chi, M.; Jensen, S.B.; Huignard, J.P.

    2006-01-01

    The two-wave mixing in the broad-area semiconductor amplifier was investigated, both theoretically and experimentally. In detail we investigated how the optical gain is affected by the presence of the two-wave mixing interference grating. In the experimental setup we are able to turn on and off t...... obtain a decrease in the optical gain. The experimental results obtained in an 810 nm, 200 µm wide GaAlAs amplifier show good agreement with the theory. A diffusion length of 2.0 µm is determined from the experiment. © 2006 Optical Society of America...

  15. Measurements and calculation of the critical pulsewidth for gain saturation in semiconductor optical amplifiers

    DEFF Research Database (Denmark)

    Borri, Paola; Scaffetti, Stefano; Mørk, Jesper

    1999-01-01

    The nonlinear gain response of InGaAsP bulk optical amplifiers under ultrafast optical excitation at 1.53 ìm investigated. In particular, the dependence of the gain saturation energy on the pulse duration is measured in the range of pulse durations from 150 fs to 11 ps, for different bias current...... and lengths of the amplifier. By comparison with a theoretical model, a critical pulsewidth is inferred below which nonlinear carrier dynamics like carrier heating and spectral hole burning dominate the gain saturation....

  16. Genetic variation of loci potentially under selection confounds species-genetic diversity correlations in a fragmented habitat.

    Science.gov (United States)

    Bertin, Angeline; Gouin, Nicolas; Baumel, Alex; Gianoli, Ernesto; Serratosa, Juan; Osorio, Rodomiro; Manel, Stephanie

    2017-01-01

    Positive species-genetic diversity correlations (SGDCs) are often thought to result from the parallel influence of neutral processes on genetic and species diversity. Yet, confounding effects of non-neutral mechanisms have not been explored. Here, we investigate the impact of non-neutral genetic diversity on SGDCs in high Andean wetlands. We compare correlations between plant species diversity and genetic diversity (GD) calculated with and without loci potentially under selection (outlier loci). The study system includes 2188 specimens from five species (three common aquatic macroinvertebrate and two dominant plant species) that were genotyped for 396 amplified fragment length polymorphism loci. We also appraise the importance of neutral processes on SGDCs by investigating the influence of habitat fragmentation features. Significant positive SGDCs were detected for all five species (mean SGDC = 0.52 ± 0.05). While only a few outlier loci were detected in each species, they resulted in significant decreases in GD and in SGDCs. This supports the hypothesis that neutral processes drive species-genetic diversity relationships in high Andean wetlands. Unexpectedly, the effects on genetic diversity GD of the habitat fragmentation characteristics in this study increased with the presence of outlier loci in two species. Overall, our results reveal pitfalls in using habitat features to infer processes driving SGDCs and show that a few loci potentially under selection are enough to cause a significant downward bias in SGDC. Investigating confounding effects of outlier loci thus represents a useful approach to evidence the contribution of neutral processes on species-genetic diversity relationships. © 2016 John Wiley & Sons Ltd.

  17. Upper Extremity Length Equalization

    OpenAIRE

    DeCoster, Thomas A.; Ritterbusch, John; Crawford, Mark

    1992-01-01

    Significant upper extremity length inequality is uncommon but can cause major functional problems. The ability to position and use the hand may be impaired by shortness of any of the long bones of the upper extremity. In many respects upper and lower extremity length problems are similar. They most commonly occur after injury to a growing bone and the treatment modalities utilized in the lower extremity may be applied to the upper extremity. These treatment options include epiphysiodesis, sho...

  18. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  19. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  20. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab......Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar...... and by variables having program fragments as values. Basic operations such as valuetransfer, composition and decomposition are defined for program fragments allowing more complicated operations to be implemented. Usual operations such as testing for equality are defined, and in addition more specialized operations...... such as testing that a program fragment is derivable from another and converting program fragments in concrete form to abstract form are defined. By introducing regular expressions in the grammar these may be used in program fragments in concrete form. By defining constructors for regular expressions these may...

  1. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  2. Optimized quantification of fragmented, free circulating DNA in human blood plasma using a calibrated duplex real-time PCR.

    Directory of Open Access Journals (Sweden)

    Martin Horlitz

    Full Text Available BACKGROUND: Duplex real-time PCR assays have been widely used to determine amounts and concentrations of free circulating DNA in human blood plasma samples. Circulatory plasma DNA is highly fragmented and hence a PCR-based determination of DNA concentration may be affected by the limited availability of full-length targets in the DNA sample. This leads to inaccuracies when counting PCR target copy numbers as whole genome equivalents. METHODOLOGY/PRINCIPAL FINDINGS: A model system was designed allowing for assessment of bias in a duplex real-time PCR research assay. We collected blood plasma samples from male donors in pools of 6 to 8 individuals. Circulatory plasma DNA was extracted and separated by agarose gel electrophoresis. Separated DNA was recovered from the gel in discrete size fractions and analyzed with different duplex real-time PCR Taqman assays detecting a Y chromosome-specific target and an autosomal target. The real-time PCR research assays used differed significantly in their ability to determine the correct copy number ratio of 0.5 between Y chromosome and autosome targets in DNA of male origin. Longer PCR targets did not amplify quantitatively in circulatory DNA, due to limited presence of full-length target sequence in the sample. CONCLUSIONS: PCR targets of the same small size are preferred over longer targets when comparing fractional circulatory DNA concentrations by real-time PCR. As an example, a DYS14/18S duplex real-time PCR research assay is presented that correctly measures the fractional concentration of male DNA in a male/female mixture of circulatory, fragmented DNA.

  3. Span length and information rate optimisation in optical transmission systems using single-channel digital backpropagation.

    Science.gov (United States)

    Karanov, Boris; Xu, Tianhua; Shevchenko, Nikita A; Lavery, Domaniç; Killey, Robert I; Bayvel, Polina

    2017-10-16

    The optimisation of span length when designing optical communication systems is important from both performance and cost perspectives. In this paper, the optimisation of inter-amplifier spacing and the potential increase of span length at fixed information rates in optical communication systems with practically feasible nonlinearity compensation schemes have been investigated. It is found that in DP-16QAM, DP-64QAM and DP-256QAM systems with practical transceiver noise limitations, single-channel digital backpropagation can allow a 50% reduction in the number of amplifiers without sacrificing information rates compared to systems with optimal span lengths and linear compensation.

  4. Relative stability of transgene DNA fragments from GM rapeseed in mixed ruminal cultures.

    Science.gov (United States)

    Sharma, Ranjana; Alexander, Trevor W; John, S Jacob; Forster, Robert J; McAllister, Tim A

    2004-05-01

    The use of transgenic crops as feeds for ruminant animals has prompted study of the possible uptake of transgene fragments by ruminal micro-organisms and/or intestinal absorption of fragments surviving passage through the rumen. The persistence in buffered ruminal contents of seven different recombinant DNA fragments from GM rapeseed expressing the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) transgene was tracked using PCR. Parental and transgenic (i.e. glyphosphate-tolerant; Roundup Ready, Monsanto Company, St Louis, MO, USA) rapeseed were incubated for 0, 2, 4, 8, 12, 24 and 48 h as whole seeds, cracked seeds, rapeseed meal, and as pelleted, barley-based diets containing 65 g rapeseed meal/kg. The seven transgene fragments ranged from 179 to 527 bp and spanned the entire 1363 bp EPSPS transgene. A 180 bp ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit fragment and a 466 bp 16S rDNA fragment were used as controls for endogenous rapeseed DNA and bacterial DNA respectively. The limit of detection of the PCR assay, established using negative controls spiked with known quantities of DNA, was 12.5 pg. Production of gas and NH3 was monitored throughout the incubation and confirmed active in vitro fermentation. Bacterial DNA was detected in all sample types at all time points. Persistence patterns of endogenous (Rubisco) and recombinant (EPSPS) rapeseed DNA were inversely related to substrate digestibility (amplifiable for 48, 8 and 4 h in whole or cracked seeds, meal and diets respectively), but did not differ between parental and GM rapeseed, nor among fragments. Detection of fragments was representative of persistence of the whole transgene. No EPSPS fragments were amplifiable in microbial DNA, suggesting that transformation had not occurred during the 48 h incubation. Uptake of transgenic DNA fragments by ruminal bacteria is probably precluded or time-limited by rapid degradation of plant DNA upon plant cell lysis.

  5. Fragment Merger: An Online Tool to Merge Overlapping Long Sequence Fragments

    Directory of Open Access Journals (Sweden)

    Anna Kramvis

    2013-03-01

    Full Text Available While PCR amplicons extend to a few thousand bases, the length of sequences from direct Sanger sequencing is limited to 500–800 nucleotides. Therefore, several fragments may be required to cover an amplicon, a gene or an entire genome. These fragments are typically sequenced in an overlapping fashion and assembled by manually sliding and aligning the sequences visually. This is time-consuming, repetitive and error-prone, and further complicated by circular genomes. An online tool merging two to twelve long overlapping sequence fragments was developed. Either chromatograms or FASTA files are submitted to the tool, which trims poor quality ends of chromatograms according to user-specified parameters. Fragments are assembled into a single sequence by repeatedly calling the EMBOSS merger tool in a consecutive manner. Output includes the number of trimmed nucleotides, details of each merge, and an optional alignment to a reference sequence. The final merge sequence is displayed and can be downloaded in FASTA format. All output files can be downloaded as a ZIP archive. This tool allows for easy and automated assembly of overlapping sequences and is aimed at researchers without specialist computer skills. The tool is genome- and organism-agnostic and has been developed using hepatitis B virus sequence data.

  6. Advances in high-power rf amplifiers

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1979-01-01

    Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems

  7. Transpermeance Amplifier Applied to Magnetic Bearings

    Directory of Open Access Journals (Sweden)

    Jossana Ferreira

    2017-02-01

    Full Text Available The most conventional approach of controlling magnetic forces in active magnetic bearings (AMBs is through current feedback amplifiers: transconductance. This enables the operation of the AMB to be understood in terms of a relatively simple current-based model as has been widely reported on in the literature. The alternative notion of using transpermeance amplifiers, which approximate the feedback of gap flux rather than current, has been in commercial use in some form for at least thirty years, however is only recently seeing more widespread acceptance as a commercial standard. This study explores how such alternative amplifiers should be modeled and then examines the differences in behavior between AMBs equipped with transconductance and transpermeance amplifiers. The focus of this study is on two aspects. The first is the influence of rotor displacement on AMB force, commonly modeled as a constant negative equivalent mechanical stiffness, and it is shown that either scheme actually leads to a finite bandwidth effect, but that this bandwidth is much lower when transpermeance is employed. The second aspect is the influence of eddy currents. Using a very simple model of eddy currents (a secondary short-circuited coil, it is demonstrated that transpermeance amplifiers can recover significant actuator bandwidth compared with transconductance, but at the cost of needing increased peak current headroom.

  8. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  9. ZigBee Radio with External Power Amplifier and Low-Noise Amplifier

    Directory of Open Access Journals (Sweden)

    Allan HUYNH

    2010-07-01

    Full Text Available This paper presents the performance study of a ZigBee module with both an external power amplifier and a low-noise amplifier, measured in outdoor and indoor environments, respectively. Our previous study has already shown that the indoor campus environment such as walls and floors would reduce the radio link range drastically and the packet error rate increased. In this study, both an external power amplifier and a low-noise amplifier have been added to a ZigBee module to increase both the transmitter power and receiver sensitivity. It is shown that with an external power amplifier and a low-noise amplifier the outdoor radio range can reach up to 1600 m with a negligible packet error rate compared to 144 m without any external amplifier for point-to-point radio connection. Thus, by increasing both the transmitter power and receiver sensitivity the radio range can be increased significantly. The power consumption issue with the added amplifiers is studied as well, indicating that the module can still be battery driven with a battery lifetime of about 9 years at a normal sampling rate to the sensor.

  10. The OPTHER Project: Progress toward the THz Amplifier

    DEFF Research Database (Denmark)

    Paoloni, C; Brunetti, F; Di Carlo, A

    2011-01-01

    This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within th...

  11. Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

    NARCIS (Netherlands)

    Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

    2005-01-01

    Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

  12. A set of primers conserved in genus Parnassius (Lepidoptera, Papilionidae) for amplification and sequencing of 1016 bp fragment of cytochrome oxidase subunit I from museum specimens.

    Science.gov (United States)

    Konopinski, Maciej K

    2008-05-01

    Four short, overlapping amplicons covering a 1016 bp fragment of mitochondrial cytochrome oxidase subunit I were developed. All four fragments were successfully amplified and sequenced in eight species of butterflies belonging to the genus Parnassius including over 100-year-old DNA from pinned museum specimens. The fragment contains sufficient variation for both inter- and intraspecific analyses. A total of 105 sites were polymorphic within 52 haplotypes found in 186 samples from Parnassius mnemosyne. © 2007 The Authors.

  13. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  14. Efficient double fragmentation ChIP-seq provides nucleotide resolution protein-DNA binding profiles

    NARCIS (Netherlands)

    Mokry, M.; Hatzis, P.; de Bruijn, E.; Koster, J.; Versteeg, R.; Schuijers, J.; van de Wetering, M.L.; Guryev, V.; Clevers, H.; Cuppen, E.

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  15. Relativistic Length Agony Continued

    Science.gov (United States)

    Redzic, D. V.

    2014-06-01

    We made an attempt to remedy recent confusing treatments of some basic relativistic concepts and results. Following the argument presented in an earlier paper (Redzic 2008b), we discussed the misconceptions that are recurrent points in the literature devoted to teaching relativity such as: there is no change in the object in Special Relativity, illusory character of relativistic length contraction, stresses and strains induced by Lorentz contraction, and related issues. We gave several examples of the traps of everyday language that lurk in Special Relativity. To remove a possible conceptual and terminological muddle, we made a distinction between the relativistic length reduction and relativistic FitzGerald-Lorentz contraction, corresponding to a passive and an active aspect of length contraction, respectively; we pointed out that both aspects have fundamental dynamical contents. As an illustration of our considerations, we discussed briefly the Dewan-Beran-Bell spaceship paradox and the 'pole in a barn' paradox.

  16. Telomere Length and Mortality

    DEFF Research Database (Denmark)

    Kimura, Masayuki; Hjelmborg, Jacob V B; Gardner, Jeffrey P

    2008-01-01

    Leukocyte telomere length, representing the mean length of all telomeres in leukocytes, is ostensibly a bioindicator of human aging. The authors hypothesized that shorter telomeres might forecast imminent mortality in elderly people better than leukocyte telomere length. They performed mortality...... telomeres predicted the death of the first co-twin better than the mTRFL did (mTRFL: 0.56, 95% confidence interval (CI): 0.49, 0.63; mTRFL(50): 0.59, 95% CI: 0.52, 0.66; mTRFL(25): 0.59, 95% CI: 0.52, 0.66; MTRFL: 0.60, 95% CI: 0.53, 0.67). The telomere-mortality association was stronger in years 3-4 than...

  17. Polymer fragmentation in extensional flow

    International Nuclear Information System (INIS)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-01-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments

  18. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  19. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  20. Regime for a Self-ionizing Raman Laser Amplifier

    International Nuclear Information System (INIS)

    Clark, D.S.; Fisch, N.J.

    2001-01-01

    Backward Raman amplification and compression at high power might occur if a long pumping laser pulse is passed through a plasma to interact resonantly with a counter-propagating short seed pulse [V.M. Malkin, et al., Phys. Rev. Lett. 82 (1999) 4448-4451]. One critical issue, however, is that the pump may be unacceptably depleted due to spontaneous Raman backscatter from intrinsic fluctuations in the amplifying plasma medium prior to its useful interaction with the seed. Premature backscatter may be avoided, however, by employing a gaseous medium with pump intensities too low to ionize the medium, and using the intense seed to produce the plasma by rapid photoionization as it is being amplified [V.M. Malkin, et al., Phys. Plasmas (2001)]. In addition to allowing that only rather low power pumps be used, photoionization introduces a damping of the short pulse which must be overcome by the Raman growth rate for net amplification to occur. The parameter space of gas densities, laser wavelengths, and laser intensities is surveyed to identify favorable regimes for this effect. Output laser intensities of 10(superscript ''17'') W/cm(superscript ''2'') for 0.5 mm radiation are found to be feasible for such a scheme using a pump of 10(superscript ''13'') W/cm(superscript ''2'') and an initial seed of 5 x 10(superscript ''14'') W/cm(superscript ''2'') over an amplification length of 5.6 cm in hydrogen gas