WorldWideScience

Sample records for amplified fragment length

  1. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  2. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  3. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...

  4. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  5. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    Science.gov (United States)

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  6. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  7. AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF MYCOBACTERIUM AVIUM COMPLEX ISOLATES RECOVERED FROM SOUTHERN CALIFORNIA

    Science.gov (United States)

    Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...

  8. Genetic diversity of Actinobacillus pleuropneumoniae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Angen, Øystein

    2007-01-01

    Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...

  9. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  10. Application of amplified fragment length polymorphism (AFLPs) for ...

    African Journals Online (AJOL)

    Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

  11. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  12. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...

  13. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  14. Genomic Relatedness of Chlamydia Isolates Determined by Amplified Fragment Length Polymorphism Analysis

    OpenAIRE

    Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.

    1999-01-01

    The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...

  15. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  16. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  17. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  18. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...

  19. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  20. Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

    Science.gov (United States)

    Johnsen, G; Kruse, H; Hofshagen, M

    2006-12-01

    We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

  1. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

  2. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  3. Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

    Science.gov (United States)

    K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

    1994-01-01

    A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

  4. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

  5. Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

    International Nuclear Information System (INIS)

    Zhao, B.; Zheng, X.Z.

    2015-01-01

    Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

  6. Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

    Science.gov (United States)

    Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

    1999-09-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

  7. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  8. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  9. Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bernander, S

    2000-01-01

    The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

  10. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  11. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  12. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

  13. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  14. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  15. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  16. Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

    Science.gov (United States)

    Nie, H-T; Li, Q; Kong, L-F

    2014-06-01

    Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

  17. Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

    Science.gov (United States)

    Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

    2006-07-01

    The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

  18. KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Emma Suryati

    2013-03-01

    Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

  19. Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Brouat, C; McKey, D; Douzery, E J P

    2004-05-01

    Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

  20. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  1. Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-02-01

    Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

  2. Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

    Science.gov (United States)

    Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

    2000-01-01

    Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

  3. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  4. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  5. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  6. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  7. A high degree of genetic diversity is revealed in Isatis spp. (dyer's woad) by amplified fragment length polymorphism (AFLP).

    Science.gov (United States)

    Gilbert (nee Stoker), G.; Garton, S.; Karam, A.; Arnold, M.; Karp, A.; Edwards, J.; Cooke, T.; Barker, A.

    2002-05-01

    Genetic diversity in 38 genotypes, representing 28 individual genotypes from five landraces of Isatis tinctoria (three German: Tubingen, Potsdam and Erfurt, one Swiss and one English), five genotypes of Isatis indigotica (Chinese woad) and five genotypes of Isatis glauca, were investigated using AFLP analysis. Five primer combinations detected a total of 502 fragments of which 436 (86.9%) were polymorphic. The level of polymorphism recorded within each species was 29.8, 86.9 and 35.8% for I. indigotica, I. tinctoria and I. glauca, respectively. Clearly, genetic diversity within I. tinctoria was greater than that observed in I. indigotica or I. glauca. Cluster analyses of the AFLP data using UPGMA and PCO revealed the complete separation of the genotypes of each species into distinct groups. I. indigotica separated as an entirely independent group, whereas I. glauca formed a separate cluster within the I. tinctoria group. Indeed, I. tinctoria and I. glauca are more closely related to each other than either is to I. indigotica. In addition, the genotypes of each landrace, apart from one from the English group, were clearly discriminated. However, the anomalous genotype did associate with the rest of its group when it was linked with the Erfurt group. These results provide new and useful information about the make-up of the Isatis genome, which has not previously been evaluated. They will be useful in the selection of plant material for variety development and conservation of the gene-pool.

  8. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  9. Genetic and epigenetic diversity and structure of Phragmites australis from local habitats of the Songnen Prairie using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Qiu, T; Jiang, L L; Yang, Y F

    2016-08-19

    The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.

  10. Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

    OpenAIRE

    Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

    2001-01-01

    Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

  11. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

    Science.gov (United States)

    Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

    2002-04-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

  12. Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

    Science.gov (United States)

    Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

    2003-02-01

    ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

  13. AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

    Science.gov (United States)

    García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

    2012-05-01

    Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

  14. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  15. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  16. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  17. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  18. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An

    2002-07-01

    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  19. Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bergmans, A

    2002-01-01

    The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....

  20. Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

    Science.gov (United States)

    Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

    2015-12-14

    Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

  1. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  2. MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

    Science.gov (United States)

    Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

    2012-05-01

    MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

  3. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  4. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  5. Amplified fragment length polymorphism (AFLP) and genealogy ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

  6. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  7. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  8. Construction of a high-density genetic map using specific length amplified fragment markers and identification of a quantitative trait locus for anthracnose resistance in walnut (Juglans regia L.).

    Science.gov (United States)

    Zhu, Yufeng; Yin, Yanfei; Yang, Keqiang; Li, Jihong; Sang, Yalin; Huang, Long; Fan, Shu

    2015-08-18

    Walnut (Juglans regia, 2n = 32, approximately 606 Mb per 1C genome) is an economically important tree crop. Resistance to anthracnose, caused by Colletotrichum gloeosporioides, is a major objective of walnut genetic improvement in China. The recently developed specific length amplified fragment sequencing (SLAF-seq) is an efficient strategy that can obtain large numbers of markers with sufficient sequence information to construct high-density genetic maps and permits detection of quantitative trait loci (QTLs) for molecular breeding. SLAF-seq generated 161.64 M paired-end reads. 153,820 SLAF markers were obtained, of which 49,174 were polymorphic. 13,635 polymorphic markers were sorted into five segregation types and 2,577 markers of them were used to construct genetic linkage maps: 2,395 of these fell into 16 linkage groups (LGs) for the female map, 448 markers for the male map, and 2,577 markers for the integrated map. Taking into account the size of all LGs, the marker coverage was 2,664.36 cM for the female map, 1,305.58 cM for the male map, and 2,457.82 cM for the integrated map. The average intervals between two adjacent mapped markers were 1.11 cM, 2.91 cM and 0.95 cM for three maps, respectively. 'SNP_only' markers accounted for 89.25% of the markers on the integrated map. Mapping markers contained 5,043 single nucleotide polymorphisms (SNPs) loci, which corresponded to two SNP loci per SLAF marker. According to the integrated map, we used interval mapping (Logarithm of odds, LOD > 3.0) to detect our quantitative trait. One QTL was detected for anthracnose resistance. The interval of this QTL ranged from 165.51 cM to 176.33 cM on LG14, and ten markers in this interval that were above the threshold value were considered to be linked markers to the anthracnose resistance trait. The phenotypic variance explained by each marker ranged from 16.2 to 19.9%, and their LOD scores varied from 3.22 to 4.04. High-density genetic maps for walnut containing 16

  9. Amplifier channel for a fission fragment semiconductor detector

    International Nuclear Information System (INIS)

    Tyurin, G.P.

    1981-01-01

    To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

  10. Amplified Fragment Length Polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    Keywords: AFLP, wheat, stem rust, genetic diversity, population differentiation ... the method described by Vos et al (1995), with little modification, i.e., 1 µl genomic ..... Agriculture, Veterinary Science, Nutrition and Natural Resources, 1, 1- 13.

  11. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... 2University School of Environment Management, Guru Gobind Singh Indraprastha University, New Delhi-100 075, India. Accepted 15 April .... Technologies following principle developed by Zabeau and Vos. (1993). Genomic ...

  12. Amplified fragment length polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    The developed AFLP fingerprints for the Ethiopian Pgt isolates reported herein could support the breeding program to develop strategies for the deployment of resistance genes in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, genetic diversity, population ...

  13. Testing independence of fragment lengths within VNTR loci

    Energy Technology Data Exchange (ETDEWEB)

    Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))

    1993-11-01

    Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

  14. Use of single-enzyme amplified fragment length polymorphism for typing Clostridium perfringens isolated from diarrheic piglets Uso do polimorfismo do comprimento de fragmentos amplificados para tipagem de Clostridium perfringens isolados de suínos com diarréia

    Directory of Open Access Journals (Sweden)

    Luciane Tieko Shinya

    2006-09-01

    Full Text Available Clostridium perfringens is an important pathogen in human and veterinary medicine. In swine, the agent is responsible for necrotic enteritis and enterotoxemia characterized by diarrhea, weight loss, delayed development and, in some cases, death. In the present study amplified fragment length polymorphism analyses (AFLP was used to characterize 54 C. perfringens strains isolated from swine presenting diarrhea. Analysis of the results showed 29 distinct profiles with discriminatory index equal to 0.97. Partial correlation between the origin of the isolates and groups was drawn, and correlation was possible in only 18.5% of the samples. Characterization of the strains in biotypes (A, B, C, D and E, production of beta-2 toxin and enterotoxin were performed by means of the polymerase chain reaction (PCR. Biotypes A, C and D were observed among the strains analyzed. All samples were positive for presence of the gene encoding beta-2 toxin and negative for the gene encoding enterotoxin. AFLP have shown to be a simple, fast, low cost method with high discriminative power and good reproducibility, presenting a great potential in epidemiological studies involving C. perfringens strains of animal origin.Clostridium perfringens é um importante agente infeccioso em medicina veterinária e humana. Em suínos, o agente é responsável pela enterite necrótica e enterotoxemia, caracterizadas por diarréia, perda de peso, atraso no desenvolvimento e morte. No presente estudo foi utilizado o polimorfismo do comprimento de fragmentos amplificados (AFLP, para caracterizar 54 isolados de C. perfringens obtidos de suínos com diarréia. A análise dos resultados do AFLP demonstrou 29 perfis distintos com índice discriminatório igual a 0,97. A correlação entre a origem dos isolados e os agrupamentos obtidos foi parcial, sendo apenas possível a correlação total de 18,5% das amostras estudadas. A caracterização das cepas em biotipos (A, B, C, D e E, produ

  15. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  16. Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

    Science.gov (United States)

    Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

    1999-01-01

    Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

  17. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  18. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  19. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  20. Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

    International Nuclear Information System (INIS)

    Ali, M. S.; Latif, Z.

    2016-01-01

    Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

  1. Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism.

    Science.gov (United States)

    Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B

    2006-03-01

    Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.

  2. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. High-current relativistic klystron amplifier development for microsecond pulse lengths

    International Nuclear Information System (INIS)

    Fazio, M.V.; Carlsten, B.E.; Faehl, R.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.

    1991-01-01

    Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To data the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modeling are presented

  4. Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study

    Directory of Open Access Journals (Sweden)

    Dalia Mohamed Ali

    2016-06-01

    Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.

  5. An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments

    Science.gov (United States)

    Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.

    2015-01-01

    The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.

  6. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    Science.gov (United States)

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  7. High-current relativistic klystron amplifier development for microsecond pulse lengths

    International Nuclear Information System (INIS)

    Fazio, M.V.; Carlsten, B.E.; Faehl, R.J.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.

    1991-01-01

    Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To date the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modelling are presented. 5 refs., 5 figs

  8. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  9. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  10. Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

    Energy Technology Data Exchange (ETDEWEB)

    Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

    2012-09-15

    Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

  11. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  12. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  14. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  15. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  16. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  17. Genetic Characterization Of Syrian Erwinia Amylovora Strains By Amplified Fragment Length Polymorphism Technique

    International Nuclear Information System (INIS)

    Ammouneh, H.; Arabi, M.; Shoaib, A.

    2011-01-01

    Thirty Erwinia amylovora strains, collected from the main rosaceous crop-growing regions in Syria, were chosen as representatives of all major pathogenicity groups and were genetically studied by AFLP. Eight primer combinations were utilized and approximately 300 scorable bands in total were generated. Based on similarity coefficient, E. amylovora strains were placed into a main cluster containing two sub clusters, indicating very low genetic variations among the studied pathogen. The existence of two plasmids, pEA29 (present in nearly all E. amylovora isolates) and pEL60 (present mainly in Lebanese strains), was confirmed using multiplex PCR in all tested Syrian E. amylovora strains, indicating that Lebanese and Syrian isolates may share a common origin.(author)

  18. Amplified fragment length polymorphism analysis of human clinical isolates of Mycobacterium haemophilum from different continents

    NARCIS (Netherlands)

    Bruijnesteijn van Coppenraet, L. E. S.; Savelkoul, P. H. M.; Buffing, N.; van der Bijl, M. W.; Woudenberg, J.; Lindeboom, J. A.; Kiehn, T. E.; Haverkort, F.; Samra, Z.; Kuijper, E. J.

    2009-01-01

    The role of the species Mycobacterium haemophilum as a pathogenic non-tuberculous microorganism is becoming better defined with the use of specific detection methods. However, epidemiological investigations of this species are still scarce. We analysed the genetic diversity of M. haemophilum by

  19. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  20. Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

    NARCIS (Netherlands)

    Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

    We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

  1. A preliminary amplified fragment length polymorphism (AFLP) primers selection for spathoglottis species

    NARCIS (Netherlands)

    Ginibun, F.C.; Bhassu, S.; Khalid, N.; Arens, P.; Vosman, B.; Othman, R.Y.

    2015-01-01

    Spathoglottis is a native terrestrial orchid that attracting horticultural interest as a landscaping plant. Distinguishing orchid at species level based on morphological characteristics is unconvincing as some characteristic may sensitive to environmental. Therefore, molecular characterization

  2. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  3. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  4. Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

    Science.gov (United States)

    Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

    2016-06-01

    To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

  5. Diversity analysis of bacterial community compositions in sediments of urban lakes by terminal restriction fragment length polymorphism (T-RFLP).

    Science.gov (United States)

    Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L

    2012-11-01

    Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.

  6. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  7. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    Science.gov (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  8. Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome

    DEFF Research Database (Denmark)

    Kveiborg, Marie; Gravholt, Claus Højbjerg; Kassem, M

    2001-01-01

    Clinical and epidemiological studies suggest that premature ageing and increased morbidity and mortality is present in Ullrich-Turner syndrome. We studied telomere restriction fragment length (TRFL) in 30 women with Ullrich-Turner syndrome and 30 age-matched control women. All Turner women had...... the 45,X karyotype verified by karyotyping. We found no difference in the mean TRFL in the young age group (TS: 7011+/-521 vs C: 7285+/-917 bp, P = 0.3), or in the older age group (TS: 7357+/-573 vs C: 7221+/-621 bp, P = 0.6). In conclusion, our data suggest that Ullrich-Turner syndrome is not associated...... with excessive telomere loss, at least when studied in peripheral blood leucocytes, and thus quite different from other premature ageing syndromes....

  9. The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

    International Nuclear Information System (INIS)

    Conn, V.

    1987-01-01

    The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

  10. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...

  11. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  12. Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

    Directory of Open Access Journals (Sweden)

    Arihiro Shiozaki

    Full Text Available Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP, we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group (n = 20, those who had preterm labor but delivered term babies (PTL group (n = 11, and those who had preterm birth (PTB group (n = 10. Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

  13. Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Shiozaki, Arihiro; Yoneda, Satoshi; Yoneda, Noriko; Yonezawa, Rika; Matsubayashi, Takamichi; Seo, Genichiro; Saito, Shigeru

    2014-01-01

    Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP), we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group) (n = 20), those who had preterm labor but delivered term babies (PTL group) (n = 11), and those who had preterm birth (PTB group) (n = 10). Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

  14. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    Science.gov (United States)

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  15. Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

    Science.gov (United States)

    Sarmiento, U M; Storb, R F

    1988-01-01

    Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

  16. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  17. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    International Nuclear Information System (INIS)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

  18. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  19. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  20. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  1. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  2. High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

    Science.gov (United States)

    Andeer, Peter; Strand, Stuart E; Stahl, David A

    2012-01-01

    Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

  3. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B

    2000-01-01

    are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

  4. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  5. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  6. Chemoattractive capacity of different lengths of nerve fragments bridging regeneration chambers for the repair of sciatic nerve defects

    Institute of Scientific and Technical Information of China (English)

    Jiren Zhang; Yubo Wang; Jincheng Zhang

    2012-01-01

    A preliminary study by our research group showed that 6-mm-long regeneration chamber bridging is equivalent to autologous nerve transplantation for the repair of 12-mm nerve defects.In this study,we compared the efficacy of different lengths (6,8,10 mm) of nerve fragments bridging 6-mm regeneration chambers for the repair of 12-mm-long nerve defects.At 16 weeks after the regeneration chamber was implanted,the number,diameter and myelin sheath thickness of the regenerated nerve fibers,as well as the conduction velocity of the sciatic nerve and gastrocnemius muscle wet weight ratio,were similar to that observed with autologous nerve transplantation.Our results demonstrate that 6-,8-and 10-mm-long nerve fragments bridging 6-mm regeneration chambers effectively repair 12-mm-long nerve defects.Because the chemoattractive capacity is not affected by the length of the nerve fragment,we suggest adopting 6-mm-long nerve fragments for the repair of peripheral nerve defects.

  7. Typing of Human Mycobacterium avium Isolates in Italy by IS1245-Based Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lari, Nicoletta; Cavallini, Michela; Rindi, Laura; Iona, Elisabetta; Fattorini, Lanfranco; Garzelli, Carlo

    1998-01-01

    All but 2 of 63 Mycobacterium avium isolates from distinct geographic areas of Italy exhibited markedly polymorphic, multibanded IS1245 restriction fragment length polymorphism (RFLP) patterns; 2 isolates showed the low-number banding pattern typical of bird isolates. By computer analysis, 41 distinct IS1245 patterns and 10 clusters of essentially identical strains were detected; 40% of the 63 isolates showed genetic relatedness, suggesting the existence of a predominant AIDS-associated IS1245 RFLP pattern. PMID:9817900

  8. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

    2012-01-01

    The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

  9. Restriction Fragment Length Polymorphism Analysis Reveals High Levels of Genetic Divergence Among the Light Organ Symbionts of Flashlight Fish.

    Science.gov (United States)

    Wolfe, C J; Haygood, M G

    1991-08-01

    Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.

  10. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  11. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

  12. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  13. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  14. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  15. GENETIC DIVERSITY OF VIBRIO CHOLERAE IN CHESAPEAKE BAY DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  16. GENETIC DIVERSITY OF CLINICAL AND ENVIRONMENTAL ISOLATES OF VIBRIO CHOLERAE DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  17. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  18. KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

    OpenAIRE

    Emma Suryati; Lida Puspaningtyas; Utut Widyastuti; Suharsono Suharsono

    2013-01-01

    Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Ba...

  19. Delineation of Campylobacter concisus genomospecies by amplified fragment length polymorphism analysis and correlation of results with clinical data

    DEFF Research Database (Denmark)

    Aabenhus, R.; On, Stephen L.W.; Siemer, Berit L.

    2005-01-01

    Campylobacter concisus has been as frequently isolated from human diarrhea as the important enteropathogen Campylobacter jejuni, but it also occurs in the feces of healthy individuals. The role of C concisus in human disease has been difficult to determine, since the species comprises at least two...... infections. We identified two additional C. concisus genomospecies: genomospecies 3 comprised a single strain from an immunocompetent patient, and genomospecies 4 contained five isolates from severely immunodeficient patients, i.e., organ transplantation recipients or those with hematological malignancies...

  20. Origin of Spanish invasion by the zebra mussel, Dreissena polymorpha (Pallas, 1771) revealed by amplified fragment length polymorphism (AFLP) fingerprinting

    NARCIS (Netherlands)

    Rajagopal, S.; Pollux, B.J.A.; Peters, J.L.; Cremers, G.; Moon- van der Staay, S.Y.; Alen, van T.; Eygensteyn, J.; Hoek, van A.H.A.M.; Palau, A.; Vaate, de A.B.; Velde, van der G.

    2009-01-01

    The zebra mussel, Dreissena polymorpha is an aquatic nuisance invasive species originally native to the Ponto-Caspian region where it is found in lakes and delta areas of large rivers draining into the Black and Caspian seas. The dispersal of D. polymorpha began at the end of the 18th century, at a

  1. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  2. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  3. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt....... Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis...

  4. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  5. Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

    Science.gov (United States)

    Cao, Hu; Lu, Yonggang

    2017-01-01

    With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

  6. PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

    Science.gov (United States)

    Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

    2007-01-01

    PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

  7. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  8. Genotyping of Madurella mycetomatis by selective amplification of restriction fragments (amplified fragment length polymorphism) and subtype correlation with geographical origin and lesion size.

    NARCIS (Netherlands)

    W.W.J. van de Sande (Wendy); R.F.J. Gorkink (Raymond); G. Simons (Guus); A. Ott (Alewijn); A. Ahmed (Asif); H.A. Verbrugh (Henri); A.F. van Belkum (Alex)

    2005-01-01

    textabstractOne of the causative organisms of mycetoma is the fungus Madurella mycetomatis. Previously, extensive molecular typing studies identified Sudanese isolates of this fungus as clonal, but polymorphic genetic markers have not yet been identified. Here, we report on the selective

  9. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  10. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  11. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  12. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  13. Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities.

    Science.gov (United States)

    Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S

    2007-08-01

    Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.

  14. Use of Full-Length Recombinant Calflagin and Its C Fragment for Improvement of Diagnosis of Trypanosoma cruzi Infection†

    Science.gov (United States)

    Marcipar, Iván S.; Roodveldt, Cintia; Corradi, Gerardo; Cabeza, María L.; Brito, Maria Edileuza F.; Winter, Lucile M. Floeter; Marcipar, Alberto J.; Silber, Ariel M.

    2005-01-01

    Serological diagnosis of Trypanosoma cruzi infection is hampered by issues related to test specificity due to the cross-reactivity of most antigens with proteins of related parasites such as Leishmania spp. The recombinant calflagins are considered relevant antigens for the diagnosis of infection by Trypanosoma cruzi. In the present work, we describe two genes coding for putative calflagins in Leishmania major with the N-terminal moieties presenting high similarity with T. cruzi genes. This fact raised questions about their role in some cross-recognition of this antigen by sera from Leishmania spp.-infected individuals. The complete T. cruzi calflagin and two fragments of the protein, consisting of 146 amino acids of the N-terminal and 65 amino acids of the C-terminal regions, were expressed and evaluated against a panel of sera, which included well-characterized samples from T. cruzi, and Leishmania-infected patients. We were able to show that sera from Leishmania (Viannia) braziliensis-infected individuals recognized the recombinant full-length calflagin. Both the N-terminal and the complete protein presented the same high sensitivity (98.5% of sera from T. cruzi-infected patients was detected) but different specificities (94% and 98%, respectively, when evaluated against sera from people not infected by T. cruzi, including 15 sera from people infected with L. braziliensis). The C-terminal fragment presented low sensitivity (70%) but 100% specificity. We propose the use of these antigens in two sequential assays to optimize the serological diagnosis of T. cruzi infection in humans in geographic areas where Leishmania spp. infection is coendemic. PMID:16272476

  15. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

    Directory of Open Access Journals (Sweden)

    A.C. Panunto

    2003-10-01

    Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  16. Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Diaz R

    2001-01-01

    Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

  17. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  18. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

  19. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    Science.gov (United States)

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  20. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  1. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    Science.gov (United States)

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  2. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  3. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  4. Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

    1998-02-01

    A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

  5. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  6. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  7. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

    NARCIS (Netherlands)

    Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

    2013-01-01

    BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

  8. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

    2013-01-01

    In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

  9. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

    NARCIS (Netherlands)

    Coolen, MJL; Post, E; Davis, CC; Forney, LJ

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

  10. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  11. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  12. Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

    Science.gov (United States)

    Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

    2014-03-01

    Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

  13. Molecular characterization of Mycobacterium tuberculosis isolates from Tehran, Iran by restriction fragment length polymorphism analysis and spoligotyping

    Directory of Open Access Journals (Sweden)

    Seifu Gizaw Feyisa

    2016-04-01

    Full Text Available Abstract: INTRODUCTION Characterization of Mycobacterium tuberculosis (MTB isolates by DNA fingerprinting has contributed to tuberculosis (TB control. The aim of this study was to determine the genetic diversity of MTB isolates from Tehran province in Iran. METHODS MTB isolates from 60 Iranian and 10 Afghan TB patients were fingerprinted by standard IS6110-restriction fragment length polymorphism (RFLP analysis and spoligotyping. RESULTS The copy number of IS6110 ranged from 10-24 per isolate. The isolates were classified into 22 clusters showing ≥ 80% similarity by RFLP analysis. Fourteen multidrug-resistant (MDR isolates were grouped into 4 IS6110-RFLP clusters, with 10 isolates [71% (95% CI: 45-89%] in 1 cluster, suggesting a possible epidemiological linkage. Eighteen Iranian isolates showed ≥ 80% similarity with Afghan isolates. There were no strains with identical fingerprints. Spoligotyping of 70 isolates produced 23 distinct patterns. Sixty (85.7% isolates were grouped into 13 clusters, while the remaining 10 isolates (14.2% were not clustered. Ural (formerly Haarlem4 (n = 22, 31.4% was the most common family followed by Central Asian strain (CAS (n = 18, 25.7% and T (n = 9, 12.8% families. Only 1strain was characterized as having the Beijing genotype. Among 60 Iranian and 10 Afghan MTB isolates, 25% (95% CI: 16-37 and 70% (95% CI: 39-89 were categorized as Ural lineage, respectively. CONCLUSIONS A higher prevalence of Ural family MTB isolates among Afghan patients than among Iranian patients suggests the possible transmission of this lineage following the immigration of Afghans to Iran.

  14. M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Good Michael F

    2005-10-01

    Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

  15. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  16. Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area.

    Directory of Open Access Journals (Sweden)

    Zeyan Wu

    Full Text Available Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF, coniferous forest (CF, subalpine dwarf forest (SDF and alpine meadow (AM were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC, total nitrogen (TN, total phosphorus (TP and total potassium (TK were positively correlated with the diversity of bacterial communities.

  17. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  18. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  19. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  20. Studies of nontarget-mediated distribution of human full-length IgG1 antibody and its FAb fragment in cardiovascular and metabolic-related tissues.

    Science.gov (United States)

    Davidsson, Pia; Söderling, Ann-Sofi; Svensson, Lena; Ahnmark, Andrea; Flodin, Christine; Wanag, Ewa; Screpanti-Sundqvist, Valentina; Gennemark, Peter

    2015-05-01

    Tissue distribution and pharmacokinetics (PK) of full-length nontargeted antibody and its antigen-binding fragment (FAb) were evaluated for a range of tissues primarily of interest for cardiovascular and metabolic diseases. Mice were intravenously injected with a dose of 10 mg/kg of either human IgG1or its FAb fragment; perfused tissues were collected at a range of time points over 3 weeks for the human IgG1 antibody and 1 week for the human FAb antibody. Tissues were homogenized and antibody concentrations were measured by specific immunoassays on the Gyros system. Exposure in terms of maximum concentration (Cmax ) and area under the curve was assessed for all nine tissues. Tissue exposure of full-length antibody relative to plasma exposure was found to be between 1% and 10%, except for brain (0.2%). Relative concentrations of FAb antibody were the same, except for kidney tissue, where the antibody concentration was found to be ten times higher than in plasma. However, the absolute tissue uptake of full-length IgG was significantly higher than the absolute tissue uptake of the FAb antibody. This study provides a reference PK state for full-length whole and FAb antibodies in tissues related to cardiovascular and metabolic diseases that do not include antigen or antibody binding. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

  1. Fiber Amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten

    2017-01-01

    The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

  2. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  3. Fragment length analysis screening for detection of CEBPA mutations in intermediate-risk karyotype acute myeloid leukemia.

    Science.gov (United States)

    Fuster, Oscar; Barragán, Eva; Bolufer, Pascual; Such, Esperanza; Valencia, Ana; Ibáñez, Mariam; Dolz, Sandra; de Juan, Inmaculada; Jiménez, Antonio; Gómez, Maria Teresa; Buño, Ismael; Martínez, Joaquín; Cervera, José; Montesinos, Pau; Moscardó, Federico; Sanz, Miguel Ángel

    2012-01-01

    During last years, molecular markers have been increased as prognostic factors routinely screened in acute myeloid leukemia (AML). Recently, an increasing interest has been reported in introducing to clinical practice screening for mutations in the CCAAT/enhancer-binding protein α (CEBPA) gene in AML, as it seems to be a good prognostic factor. However, there is no reliable established method for assessing CEBPA mutations during the diagnostic work-up of AMLs. We describe here a straightforward and reliable fragment analysis method based in PCR capillary electrophoresis (PCR-CE) for screening of CEBPA mutations; moreover, we present the results obtained in 151 intermediate-risk karyotype AML patients (aged 16-80 years). The method gave a specificity of 100% and sensitivity of 93% with a lower detection limit of 1-5% for CEBPA mutations. The series found 19 mutations and four polymorphisms in 12 patients, seven of whom (58%) presented two mutations. The overall frequency of CEBPA mutations in AML was 8% (n = 12). CEBPA mutations showed no coincidence with FLT3-ITD or NPM1 mutations. CEBPA mutation predicted better disease-free survival in the group of patients without FLT3-ITD, NPM, or both genes mutated (HR 3.6, IC 95%; 1.0-13.2, p = 0.05) and better overall survival in patients younger than 65 of this group without molecular markers (HR 4.0, IC 95%; 1.0-17.4, p = 0.05). In conclusion, the fragment analysis method based in PCR-CE is a rapid, specific, and sensitive method for CEBPA mutation screening and our results confirm that CEBPA mutations can identify a subgroup of patients with favorable prognosis in AML with intermediate-risk karyotype.

  4. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  5. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  6. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  7. TARC: Carlo Rubbia's Energy Amplifier

    CERN Multimedia

    Laurent Guiraud

    1997-01-01

    Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

  8. A Set of Plastid Loci for Use in Multiplex Fragment Length Genotyping for Intraspecific Variation in Pinus (Pinaceae

    Directory of Open Access Journals (Sweden)

    Austin M. Wofford

    2014-04-01

    Full Text Available Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences ofycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group.

  9. A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

    Science.gov (United States)

    Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

    2014-01-01

    • Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

  10. Design and length optimization of an adiabatic coupler for on-chip vertical integration of rare-earth-doped double tungstate waveguide amplifiers

    NARCIS (Netherlands)

    Mu, Jinfeng; Sefünç, Mustafa; García Blanco, Sonia Maria

    2014-01-01

    The integration of rare-earth doped double tungstate waveguide amplifiers onto passive technology platforms enables the on-chip amplification of very high bit rate signals. In this work, a methodology for the optimized design of vertical adiabatic couplers between a passive Si3N4 waveguide and the

  11. Molecular epidemiology of contagious bovine pleuropneumonia in Tanzania based on amplified fragment length polymorphism and pulsed-field gel electrophoresis analysis

    DEFF Research Database (Denmark)

    Kusiluka, L.J.M.; Ojeniyi, B.; Friis, N.F.

    2001-01-01

    anti vaccine strains. The strong genomic homogeneity among, M. mycoides SC strains associated with outbreaks of contagious bovine pleuropneumonia in different regions of Tanzania suggests that the outbreaks of the disease in the 1990-99 period might have been caused Ly a single epidemic clone. Moreover......The genetic diversity of 60 field strains of Mycoplasma mycoides ssp. mycoides, small colony type (M,. mycoides), comprising 56 isolates from cattle in Tanzania, one from Kenya, two from Botswana and one from Portugal, as well as the type (PG1(T)) and vaccine (T-1-SR49) strains, was ivestigated...... strains. The AFLP profiles of the type and vaccine strains were indistingiuishable from each other. Indistinguishable AFLP profiles were found for 55 Tanzanian held strains, one of them isolated in 1990 and the other 54 isolated in 1998/1999), although one strain isolated in 1999 showed a different...

  12. Molecular characterization of the U.S. Phaseolus acutifolius A. Gray collection using Amplified Fragment Length Polymorphism (AFLP) and Targeted Region Amplification Polymorphism (TRAP) markers.

    Science.gov (United States)

    Tepary bean (Phaseolus acutifolius A. Gray), a truly Native American crop, is a short life-cycle annual desert legume indigenous to northwestern Mexico and the southwestern USA and is considered drought and heat tolerant. The Western Regional Plant Introduction Station currently maintains 211 acce...

  13. Genetic relatedness among Campylobacter jejuni serotyped isolates of diverse origin as determined by numerical analysis of amplified fragment length polymorphism (AFLP) profiles

    DEFF Research Database (Denmark)

    Siemer, B.L.; Harrington, C.S.; Nielsen, E.M.

    2004-01-01

    health. The remaining 30 groups contained isolates from humans, chickens and associated food products, cattle, sheep, turkeys, ostriches and/or dogs. Strains assigned to serotypes 2, 6/7, 11 and 12 formed major clusters at the 77.6% S-level. Most other serotypes did not form homogeneous clusters....... conclusions: High-resolution genotyping applied to strains from a comprehensive range of sources provides evidence for multiple sources of sporadic C. jejuni infection. The results suggest that public health protection measures should be directed at all foods of animal origin. Significance and Impct...... diarrhoea and diverse animal and environmental sources were collected mainly through a National surveillance programme in Denmark and serotyped by use of the established 'Penner' scheme. Genetic relationships among these isolates, and the archetypal serotype reference strains, were assessed by numerical...

  14. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  15. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  16. Monitoring of antibiotic-induced alterations in the human intestinal microflora and detection of probiotic strains by use of terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Jernberg, Cecilia; Sullivan, Asa; Edlund, Charlotta; Jansson, Janet K

    2005-01-01

    Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic.

  17. Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis.

    Science.gov (United States)

    Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele

    2009-11-01

    A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.

  18. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta Lima

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  19. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  20. Operation amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2008-01-01

    To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

  1. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  2. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  3. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Science.gov (United States)

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  4. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Huyen Mai NT

    2013-02-01

    Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.

  6. KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

    Directory of Open Access Journals (Sweden)

    Gusti Ngurah Permana

    2016-11-01

    The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

  7. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  8. Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon.

    Science.gov (United States)

    Lee, Hsien-Chung; Yang, Man-Miao; Yeh, Wen-Bin

    2008-08-01

    The occurrence of pear decline, a disease found in some pear (Pyrus spp.) orchards of Taiwan in recent years, is accompanied by an outbreak of Cacopsylla chinensis (Yang & Li). Two major morphological forms (summer and winter forms) with a variety of intermediate body color and two phylogenetic lineages of this psyllid have been described. The work herein used sequences of mitochondrial cytochrome oxidase I (COI) and 16S rDNA regions to delineate the genetic differentiation of this color-variable insect and to elucidate their relationship. Sequence divergence and phylogenetic analysis have shown that C. chinensis individuals could be divided into two lineages with 3.3 and 2.3% divergence of COI and 16S rDNA, respectively. All specimens from China were found to belong to lineage I. Restriction fragment length polymorphism analysis of COI with restriction enzymes AcuI, AseI, BccI, and FokI on 263 specimens of six populations from Taiwan produced two digestion patterns, which are in agreement with the two lineages described above. Both patterns could be found in each population, with most individuals belonging to lineage I and 5-21% of the individuals belonging to lineage II. Because these two lineages included summer as well as winter morphological forms, the lineage differentiation is apparently not related to morphological characters of this psyllid. Because the invasive records are not in favor of a sympatric differentiation, this psyllid is more likely introduced as different populations from countries in temperate regions.

  9. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    Science.gov (United States)

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  10. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  11. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2011-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

  12. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, S.; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

  13. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  14. Amplifier Distortion

    Science.gov (United States)

    Keeports, David

    2006-12-01

    By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

  15. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    NARCIS (Netherlands)

    Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  16. Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

    NARCIS (Netherlands)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  17. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  18. Characterization of gut microbiota profiles by disease activity in patients with Crohn's disease using data mining analysis of terminal restriction fragment length polymorphisms.

    Science.gov (United States)

    Andoh, Akira; Kobayashi, Toshio; Kuzuoka, Hiroyuki; Tsujikawa, Tomoyuki; Suzuki, Yasuo; Hirai, Fumihito; Matsui, Toshiyuki; Nakamura, Shiro; Matsumoto, Takayuki; Fujiyama, Yoshihide

    2014-05-01

    The gut microbiota plays a significant role in the pathogenesis of Crohn's disease (CD). In this study, we analyzed the disease activity and associated fecal microbiota profiles in 160 CD patients and 121 healthy individuals. Fecal samples from the CD patients were collected during three different clinical phases, the active (n=66), remission-achieved (n=51) and remission-maintained (n=43) phases. Terminal restriction fragment length polymorphism (T-RFLP) and data mining analysis using the Classification and Regression Tree (C&RT) approach were performed. Data mining provided a decision tree that clearly identified the various subject groups (nodes). The majority of the healthy individuals were divided into Node-5 and Node-8. Healthy subjects comprised 99% of Node-5 (91 of 92) and 84% of Node-8 (21 of 25 subjects). Node-3 was characterized by CD (136 of 160 CD subjects) and was divided into Node-6 and Node-7. Node-6 (n=103) was characterized by subjects in the active phase (n=48; 46%) and remission-achieved phase (n=39; 38%) and Node-7 was characterized by the remission-maintained phase (21 of 37 subjects; 57%). Finally, Node-6 was divided into Node-9 and Node-10. Node-9 (n=78) was characterized by subjects in the active phase (n=43; 55%) and Node-10 (n=25) was characterized by subjects in the remission-maintained phase (n=16; 64%). Differences in the gut microbiota associated with disease activity of CD patients were identified. Thus, data mining analysis appears to be an ideal tool for the characterization of the gut microbiota in inflammatory bowel disease.

  19. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  20. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  1. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  2. Amplified Policymaking

    Science.gov (United States)

    Prince, Katherine; Woempner, Carolyn

    2010-01-01

    This brief examines the policy implications of two drivers of change presented in the "2020 Forecast: Creating the Future of Learning"-- Pattern Recognition and Amplified Organization. These drivers point toward a series of cultural shifts and illuminate how we are developing new ways of organizing, constructing, and managing knowledge.…

  3. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  4. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  5. Identification of Human T-lymphotropic Virus Type I (HTLV-I Subtypes Using Restrited Fragment Length Polymorphism in a Cohort of Asymptomatic Carriers and Patients with HTLV-I-associated Myelopathy/tropical Spastic Paraparesis from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Segurado Aluisio AC

    2002-01-01

    Full Text Available Although human T-lymphotropic virus type I (HTLV-I exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV, genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, using restricted fragment length polymorphism (RFLP analysis of long terminal repeat (LTR HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%, cosmopolitan C (7.1% and cosmopolitan E (3.6% subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.

  6. Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

    1999-09-01

    In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

  7. Gamma-irradiation of homodeoxyoligonucleotides 32P-labelled at one end: computer simulation of the chain length distribution of the radioactive fragments

    International Nuclear Information System (INIS)

    Teoule, R.; Duplaa, A.M.

    1987-01-01

    Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)

  8. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  9. Dielectric waveguide amplifiers and lasers

    NARCIS (Netherlands)

    Pollnau, Markus

    The performance of semiconductor amplifiers and lasers has made them the preferred choice for optical gain on a micro-chip. In the past few years, we have demonstrated that also rare-earth-ion-doped dielectric waveguides show remarkable performance, ranging from a small-signal gain per unit length

  10. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  11. Nanoscale electromechanical parametric amplifier

    Science.gov (United States)

    Aleman, Benjamin Jose; Zettl, Alexander

    2016-09-20

    This disclosure provides systems, methods, and apparatus related to a parametric amplifier. In one aspect, a device includes an electron source electrode, a counter electrode, and a pumping electrode. The electron source electrode may include a conductive base and a flexible conductor. The flexible conductor may have a first end and a second end, with the second end of the flexible conductor being coupled to the conductive base. A cross-sectional dimension of the flexible conductor may be less than about 100 nanometers. The counter electrode may be disposed proximate the first end of the flexible conductor and spaced a first distance from the first end of the flexible conductor. The pumping electrode may be disposed proximate a length of the flexible conductor and spaced a second distance from the flexible conductor.

  12. Genetic diversity of nifH gene sequences in Paenibacillus azotofixans strains and soil samples analyzed by denaturing gradiënt gel electrophoresis of PCR-amplified gene fragments

    NARCIS (Netherlands)

    Rosado, A.S.; Duarte, G.F.; Seldin, L.; Elsas, van J.D.

    1998-01-01

    The diversity of dinitrogenase reductase gene (nifH) fragments in Paenibacillus azotofixans strains was investigated by using molecular methods. The partial nifH gene sequences of eight P. azotofixans strains, as well as one strain each of the close relatives Paenibacillus durum, Paenibacillus

  13. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  15. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  16. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  17. Amplifier for nuclear spectrometry

    International Nuclear Information System (INIS)

    Suarez Canner, E.

    1996-01-01

    The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

  18. Portable musical instrument amplifier

    Science.gov (United States)

    Christian, David E.

    1990-07-24

    The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

  19. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

    Science.gov (United States)

    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

    2012-08-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  20. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  1. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  2. SPS RF System Amplifier plant

    CERN Multimedia

    1977-01-01

    The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

  3. Transmission characteristics of acoustic amplifier in thermoacoustic engine

    International Nuclear Information System (INIS)

    Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

    2008-01-01

    Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

  4. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  5. Characterization of gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism: gut microbiota could be a diagnostic marker of coronary artery disease.

    Science.gov (United States)

    Emoto, Takuo; Yamashita, Tomoya; Kobayashi, Toshio; Sasaki, Naoto; Hirota, Yushi; Hayashi, Tomohiro; So, Anna; Kasahara, Kazuyuki; Yodoi, Keiko; Matsumoto, Takuya; Mizoguchi, Taiji; Ogawa, Wataru; Hirata, Ken-Ichi

    2017-01-01

    The association between atherosclerosis and gut microbiota has been attracting increased attention. We previously demonstrated a possible link between gut microbiota and coronary artery disease. Our aim of this study was to clarify the gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism (T-RFLP). This study included 39 coronary artery disease (CAD) patients and 30 age- and sex- matched no-CAD controls (Ctrls) with coronary risk factors. Bacterial DNA was extracted from their fecal samples and analyzed by T-RFLP and data mining analysis using the classification and regression algorithm. Five additional CAD patients were newly recruited to confirm the reliability of this analysis. Data mining analysis could divide the composition of gut microbiota into 2 characteristic nodes. The CAD group was classified into 4 CAD pattern nodes (35/39 = 90 %), while the Ctrl group was classified into 3 Ctrl pattern nodes (28/30 = 93 %). Five additional CAD samples were applied to the same dividing model, which could validate the accuracy to predict the risk of CAD by data mining analysis. We could demonstrate that operational taxonomic unit 853 (OTU853), OTU657, and OTU990 were determined important both by the data mining method and by the usual statistical comparison. We classified the gut microbiota profiles in coronary artery disease patients using data mining analysis of T-RFLP data and demonstrated the possibility that gut microbiota is a diagnostic marker of suffering from CAD.

  6. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  7. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    Science.gov (United States)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841

  8. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  9. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  10. Oscillators and operational amplifiers

    OpenAIRE

    Lindberg, Erik

    2005-01-01

    A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

  11. FLUIDIC AC AMPLIFIERS.

    Science.gov (United States)

    Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

  12. Antares laser power amplifier

    International Nuclear Information System (INIS)

    Stine, R.D.; Ross, G.F.; Silvernail, C.

    1979-01-01

    The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

  13. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  14. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  15. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  16. Auto-Zero Differential Amplifier

    Science.gov (United States)

    Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

    2017-01-01

    An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

  17. Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

    Directory of Open Access Journals (Sweden)

    Roberto A. Caffaro-Filho

    2007-12-01

    Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

  18. Amplified spontaneous emission in solar-pumped iodine laser

    Science.gov (United States)

    Cho, Yong S.; Hwang, In H.; Han, Kwang S.; Lee, Ja H.

    1992-01-01

    The amplified spontaneous emission (ASE) from a long pulse, solar-simulating radiation pumped iodine laser amplifier is studied. The ASE threshold pump intensity is almost proportional to the inverse of the laser gain length when the gas pressure is constant in the laser tube.

  19. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  20. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  1. Noise in Optical Amplifiers

    DEFF Research Database (Denmark)

    Jeppesen, Palle

    1997-01-01

    Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

  2. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  3. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  4. Electrospun amplified fiber optics.

    Science.gov (United States)

    Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

    2015-03-11

    All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

  5. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  6. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  7. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  8. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    Science.gov (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  9. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

    Science.gov (United States)

    Robarts, Daniel W H; Wolfe, Andrea D

    2014-07-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  10. Fast pulse amplifier

    International Nuclear Information System (INIS)

    Lepetit, J.; Poussier, E.

    1984-01-01

    This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

  11. Fast logarithmic amplifier

    International Nuclear Information System (INIS)

    Tai, I.; Hasegawa, K.

    1975-01-01

    This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)

  12. Fundamental length and relativistic length

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1988-01-01

    It si noted that the introduction of fundamental length contradicts the conventional representations concerning the contraction of the longitudinal size of fast-moving objects. The use of the concept of relativistic length and the following ''elongation formula'' permits one to solve this problem

  13. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  14. Flame Length

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Flame length was modeled using FlamMap, an interagency fire behavior mapping and analysis program that computes potential fire behavior characteristics. The tool...

  15. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  16. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  17. Modeling FWM and impairments aware amplifiers placement technique for an optical MAN/WAN: Inline amplifiers case

    Science.gov (United States)

    Singh, Gurpreet; Singh, Maninder Lal

    2015-08-01

    A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.

  18. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  19. Amplifying genetic logic gates.

    Science.gov (United States)

    Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

    2013-05-03

    Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

  20. Flashlamp excited fluid laser amplified

    International Nuclear Information System (INIS)

    1976-01-01

    The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation

  1. Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

    Science.gov (United States)

    Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

    2016-02-02

    Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Science.gov (United States)

    Wumba, Roger; Jean, Menotti; Benjamin, Longo-Mbenza; Madone, Mandina; Fabien, Kintoki; Josué, Zanga; Jean, Sala; Eric, Kendjo; AC, Guillo-Olczyk; Marc, Thellier

    2012-01-01

    Objective. To determine the prevalence and the genotypes of Enterocytozoon bieneusi in stool specimens from HIV patients. Methods. This cross-sectional study was carried out in Kinshasa hospitals between 2009 and 2012. Detection of microsporidia including E. bieneusi and E. intestinalis was performed in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI) in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM) was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n = 19) among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3%) and 5 type IV strains of E. bieneusi (26.3%) were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo), and the concurrence of type I and type IV strains. PMID:22811884

  3. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  4. Improved-Bandwidth Transimpedance Amplifier

    Science.gov (United States)

    Chapsky, Jacob

    2009-01-01

    The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

  5. Fundamental length

    International Nuclear Information System (INIS)

    Pradhan, T.

    1975-01-01

    The concept of fundamental length was first put forward by Heisenberg from purely dimensional reasons. From a study of the observed masses of the elementary particles known at that time, it is sumrised that this length should be of the order of magnitude 1 approximately 10 -13 cm. It was Heisenberg's belief that introduction of such a fundamental length would eliminate the divergence difficulties from relativistic quantum field theory by cutting off the high energy regions of the 'proper fields'. Since the divergence difficulties arise primarily due to infinite number of degrees of freedom, one simple remedy would be the introduction of a principle that limits these degrees of freedom by removing the effectiveness of the waves with a frequency exceeding a certain limit without destroying the relativistic invariance of the theory. The principle can be stated as follows: It is in principle impossible to invent an experiment of any kind that will permit a distintion between the positions of two particles at rest, the distance between which is below a certain limit. A more elegant way of introducing fundamental length into quantum theory is through commutation relations between two position operators. In quantum field theory such as quantum electrodynamics, it can be introduced through the commutation relation between two interpolating photon fields (vector potentials). (K.B.)

  6. Simplified design of IC amplifiers

    CERN Document Server

    Lenk, John

    1996-01-01

    Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

  7. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  8. Overview of bunch length measurements

    International Nuclear Information System (INIS)

    Lumpkin, A. H.

    1999-01-01

    An overview of particle and photon beam bunch length measurements is presented in the context of free-electron laser (FEL) challenges. Particle-beam peak current is a critical factor in obtaining adequate FEL gain for both oscillators and self-amplified spontaneous emission (SASE) devices. Since measurement of charge is a standard measurement, the bunch length becomes the key issue for ultrashort bunches. Both time-domain and frequency-domain techniques are presented in the context of using electromagnetic radiation over eight orders of magnitude in wavelength. In addition, the measurement of microbunching in a micropulse is addressed

  9. Wideband amplifier design

    CERN Document Server

    Hollister, Allen L

    2007-01-01

    In this book, the theory needed to understand wideband amplifier design using the simplest models possible will be developed. This theory will be used to develop algebraic equations that describe particular circuits used in high frequency design so that the reader develops a ""gut level"" understanding of the process and circuit. SPICE and Genesys simulations will be performed to show the accuracy of the algebraic models. By looking at differences between the algebraic equations and the simulations, new algebraic models will be developed that include parameters originally left out of the model

  10. Building valve amplifiers

    CERN Document Server

    Jones, Morgan

    2013-01-01

    Building Valve Amplifiers is a unique hands-on guide for anyone working with tube audio equipment--as an electronics hobbyist, audiophile or audio engineer. This 2nd Edition builds on the success of the first with technology and technique revisions throughout and, significantly, a major new self-build project, worked through step-by-step, which puts into practice the principles and techniques introduced throughout the book. Particular attention has been paid to answering questions commonly asked by newcomers to the world of the valve, whether audio enthusiasts tackling their first build or

  11. An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

    Science.gov (United States)

    Prakash, Celine; Haeseler, Arndt Von

    2017-03-01

    RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

  12. CARM and harmonic gyro-amplifier experiments at 17 GHz

    International Nuclear Information System (INIS)

    Menninger, W.L.; Danly, B.G.; Alberti, S.; Chen, C.; Rullier, J.L.; Temkin, R.J.

    1993-01-01

    Cyclotron resonance maser amplifiers are possible sources for applications such as electron cyclotron resonance heating of fusion plasmas and driving high-gradient rf linear accelerators. For accelerator drivers, amplifiers or phase locked-oscillators are required. A 17 GHz cyclotron autoresonance maser (CARM) amplifier experiment and a 17 GHz third harmonic gyro-amplifier experiment are presently underway at the MIT Plasma Fusion Center. Using the SRL/MIT SNOMAD II introduction accelerator to provide a 380 kV, 180 A, 30 ns flat top electron beam, the gyro-amplifier experiment has produced 5 MW of rf power with over 50 dB of gain at 17 GHz. The gyro-amplifier operates in the TE 31 mode using a third harmonic interaction. Because of its high power output, the gyro-amplifier will be used as the rf source for a photocathode rf electron gun experiment also taking place at MIT. Preliminary gyro-amplifier results are presented, including measurement of rf power, gain versus interaction length, and the far-field pattern. A CARM experiment designed to operate in the TE 11 mode is also discussed

  13. Superconducting digital logic amplifier

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper describes a superconducting digital logic amplifier for interfacing between a Josephson junction logic circuit having output current and a higher voltage semiconductor circuit input. The amplifier comprising: an input terminal for connection to a; an output terminal for connection to a semiconductor circuit input; an input, lower critical current, Josephson junction having first and second terminals; a first series string of at least three lower critical current Josephson junctions. The first series string being connected to the first terminal of the input Josephson junction such that the first series string is in series with the input Josephson junction to provide a series combination. The input terminal being connected to the first terminal of the input Josephson junction, and with the critical current of the lower critical current Josephson junctions of the input Josephson junction and the first series Josephson junctions being less than the output current of the low voltage Josephson junction circuit; a second series string of at least four higher critical current Josephson junctions. The second string being connected in parallel with the series combination to provide parallel strings having an upper common connection and a lower common connection. The lower common connection being connected to the second terminal of the input Josephson junction and the upper common connection being connected to the output terminal; and a pulsed DC current source connected the parallel strings at the upper common connection. The DC current source having a current at least equal to the critical current of the higher critical current Josephson junctions

  14. Cascade energy amplifier

    International Nuclear Information System (INIS)

    Barzilov, A.P.; Gulevich, A.V.; Kukharchuk, O.F.

    2000-01-01

    The technical problem of long-life fission product and minor actinide incineration and production of plutonium fuel in the prospective nuclear systems will arise at significant scales of nuclear power industry development. Subcritical nuclear reactors driven by extemal neutron sources (energy amplifiers) are considered as incinerators of toxicity of complete nuclear industry. In the frames of this concept, the subcritical reactor part consisting of two coupled blanket regions (inner fast neutron spectrum core and outer thermal core) driven by extemal neutron source is discussed. Two types of source are studied: spallation target and 14-MeV fusion bum of micropellets. Liquid metal Pb-Bi is considered as target material and coolant of inner fast core. Thermal core is a heavy-water subcritical reactor of the Candu-type. The fast core is protected from thermal neutrons influence with the boron shield. All reactor technologies used in this concept are tested during years of operation and commercially available. Thus, the cascade energy amplifiers have a set of advantages in comparison with traditional concepts: in energy production, in transmutation efficiency, and in economics. (authors)

  15. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

  16. The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

    Science.gov (United States)

    Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

    2013-01-01

    In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

  17. Linear pulse amplifier

    International Nuclear Information System (INIS)

    Tjutju, R.L.

    1977-01-01

    Pulse amplifier is standard significant part of spectrometer. Apart from other type of amplification, it's a combination of amplification and pulse shaping. Because of its special purpose the device should fulfill the following : High resolution is desired to gain a high yield comparable to its actual state of condition. High signal to noise is desired to nhν resolution. High linearity to facilitate calibration. A good overload recovery, in order to the device will capable of analizing a low energy radiation which appear joinly on the high energy fields. Other expections of the device are its economical and practical use its extentive application. For that reason it's built on a standard NIM principle. Taking also into account the above mentioned considerations. High quality component parts are used throughout, while its availability in the domestic market is secured. (author)

  18. Modeling of semiconductor optical amplifiers

    DEFF Research Database (Denmark)

    Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

    We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

  19. High sensitivity amplifier/discriminator for PWC's

    International Nuclear Information System (INIS)

    Hansen, S.

    1983-01-01

    The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design

  20. Effect of fragmentation on the Costa Rican dry forest avifauna

    OpenAIRE

    Barrantes, Gilbert; Ocampo, Diego; Ram?rez-Fern?ndez, Jos? D.; Fuchs, Eric J.

    2016-01-01

    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird comm...

  1. CERN: Energy amplifier

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Even under the heavy burden of responsibility as CERN's Director General from 1989-3 the fertile mind of Carlo Rubbia the scientist was never still. A long-time Rubbia 'hobby' has been the search for new sources of nuclear energy, exploiting knowledge and skills from high energy physics. An initial objective was to adopt heavy ion techniques to induce controlled thermonuclear fusion, but in 1994 this quest changed direction. Putting the problems of thermonuclear fusion aside, Rubbia began to explore an alternative route to energy production through controlled nuclear fission. The idea is to use a particle accelerator producing neutrons by spallation (interaction of particles with a target) to feed a fuel/moderator assembly where the neutrons multiply by fission chain reactions. If the energy liberated becomes substantially greater than that needed to drive the accelerator, the process has a net gain and becomes selfsupporting. Hence the name ''Energy Amplifier'' (EA). Similar systems for energy production or for nuclear waste incineration have been proposed at Los Alamos and in Japan and Russia, but appear to require the prior development of innovative linear accelerators. For Rubbia's Amplifier, the requisite accelerator is a reasonable extrapolation of an existing cyclotron such that at the Swiss Paul Scherrer Institute. Moreover, the EA would require fuel rods very similar to those of conventional reactors, rather than demand-ing new technology using liquid fuel loops (molten salts) with on-line separation of radioactive products. Unlike a reactor, the EA's fission reaction is not self-sustaining: it is sub-critical and needs a continuous supply of neutrons from the accelerator. This makes Chernobyl-type meltdowns unlikely: if the accelerator stops, the reaction stops too. Another major advantage is that the old dream of using thorium as a fuel is now made possible. Thorium is not itself fissile, but under neutron

  2. Millimeter-wave power amplifiers

    CERN Document Server

    du Preez, Jaco

    2017-01-01

    This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

  3. A high-power two stage traveling-wave tube amplifier

    International Nuclear Information System (INIS)

    Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.

    1991-01-01

    Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length

  4. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  5. Small signal microwave amplifier design

    CERN Document Server

    Grosch, Theodore

    2000-01-01

    This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

  6. Final amplifier design and mercury

    International Nuclear Information System (INIS)

    Rose, E.A.; Hanson, D.E.

    1991-01-01

    The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

  7. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  8. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    The elevated apo-AI levels in marathon runners therefore bear no relation to ..... correlation between levels of physical activity and apo-AI levels.15 In the group of ... previously reported for Caucasians in Europe.'9-'3 The higher levels of HDL ...

  9. HLA DQJ3 restriction fragment length polymorphism and ...

    African Journals Online (AJOL)

    1991-03-16

    Mar 16, 1991 ... We should like to thank Dr Fritz Bach, University of Minnesota, for generously providing the DQf3 probe; Dr R. Martell for his advice and constructive criticism; Chris Martin and Derek Taljaard for technical assistance and Veronique Bruneau for typing the manuscript. This work was supported by grants from ...

  10. HLA DQβ restriction fragment length polymorphism and rheumatQid ...

    African Journals Online (AJOL)

    Two variants of the HLA-DR4-linked DQw3 allele, namely OQw7 and DQw8, were analysed in patients of mixed ancestry (Cape Coloureds) with rheumatoid arthritis and in healthy individuals from the same population group using a DQ-β specific cDNA probe. The DQw7 allele, identified by 3,4 kb Hind III or 3,7 kb and 6,9 ...

  11. New Packaging for Amplifier Slabs

    Energy Technology Data Exchange (ETDEWEB)

    Riley, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Thorsness, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Suratwala, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Steele, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rogowski, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-03-18

    The following memo provides a discussion and detailed procedure for a new finished amplifier slab shipping and storage container. The new package is designed to maintain an environment of <5% RH to minimize weathering.

  12. Operational amplifiers theory and design

    CERN Document Server

    Huijsing, Johan

    2017-01-01

    This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

  13. Enhanced performance CCD output amplifier

    Science.gov (United States)

    Dunham, Mark E.; Morley, David W.

    1996-01-01

    A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

  14. Governmentally amplified output volatility

    Science.gov (United States)

    Funashima, Yoshito

    2016-11-01

    Predominant government behavior is decomposed by frequency into several periodic components: updating cycles of infrastructure, Kuznets cycles, fiscal policy over business cycles, and election cycles. Little is known, however, about the theoretical impact of such cyclical behavior in public finance on output fluctuations. Based on a standard neoclassical growth model, this study intends to examine the frequency at which public investment cycles are relevant to output fluctuations. We find an inverted U-shaped relationship between output volatility and length of cycle in public investment. This implies that periodic behavior in public investment at a certain frequency range can cause aggravated output resonance. Moreover, we present an empirical analysis to test the theoretical implication, using the U.S. data in the period from 1968 to 2015. The empirical results suggest that such resonance phenomena change from low to high frequency.

  15. Photonic-band-gap gyrotron amplifier with picosecond pulses

    Science.gov (United States)

    Nanni, Emilio A.; Jawla, Sudheer; Lewis, Samantha M.; Shapiro, Michael A.; Temkin, Richard J.

    2017-12-01

    We report the amplification of 250 GHz pulses as short as 260 ps without observation of pulse broadening using a photonic-band-gap circuit gyrotron traveling-wave-amplifier. The gyrotron amplifier operates with a device gain of 38 dB and an instantaneous bandwidth of 8 GHz. The operational bandwidth of the amplifier can be tuned over 16 GHz by adjusting the operating voltage of the electron beam and the magnetic field. The amplifier uses a 30 cm long photonic-band-gap interaction circuit to confine the desired TE03-like operating mode while suppressing lower order modes which can result in undesired oscillations. The circuit gain is >55 dB for a beam voltage of 23 kV and a current of 700 mA. These results demonstrate the wide bandwidths and a high gain achievable with gyrotron amplifiers. The amplification of picosecond pulses of variable lengths, 260-800 ps, shows good agreement with the theory using the coupled dispersion relation and the gain-spectrum of the amplifier as measured with quasi-CW input pulses.

  16. Dispersion-Engineered Traveling Wave Kinetic Inductance Parametric Amplifier

    Science.gov (United States)

    Zmuidzinas, Jonas (Inventor); Day, Peter K. (Inventor)

    2014-01-01

    A traveling wave kinetic inductance parametric amplifier comprises a superconducting transmission line and a dispersion control element. The transmission line can include periodic variations of its dimension along its length. The superconducting material can include a high normal state resistivity material. In some instances the high normal state resistivity material includes nitrogen and a metal selected from the group consisting of titanium, niobium and vanadium. The traveling wave kinetic inductance parametric amplifier is expected to exhibit a noise temperature below 100 mK/GHz.

  17. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  18. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  19. Spectroscopic amplifier for pin diode

    International Nuclear Information System (INIS)

    Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.

    2014-10-01

    The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)

  20. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  1. Quantum dots for lasers, amplifiers and computing

    International Nuclear Information System (INIS)

    Bimberg, Dieter

    2005-01-01

    For InAs-GaAs based quantum dot lasers emitting at 1300 nm, digital modulation showing an open eye pattern up to 12 Gb s -1 at room temperature is demonstrated, at 10 Gb s -1 the bit error rate is below 10 -12 at -2 dB m receiver power. Cut-off frequencies up to 20 GHz are realised for lasers emitting at 1.1 μm. Passively mode-locked QD lasers generate optical pulses with repetition frequencies between 5 and 50 GHz, with a minimum Fourier limited pulse length of 3 ps. The uncorrelated jitter is below 1 ps. We use here deeply etched narrow ridge waveguide structures which show excellent performance similar to shallow mesa structures, but a circular far field at a ridge width of 1 μm, improving coupling efficiency into fibres. No beam filamentation of the fundamental mode, low a-factors and strongly reduced sensitivity to optical feedback are observed. QD lasers are thus superior to QW lasers for any system or network. Quantum dot semiconductor optical amplifier (QD SOAs) demonstrate gain recovery times of 120-140 fs, 4-7 times faster than bulk/QW SOAs, and a net gain larger than 0.4 dB/(mm*QD-layer) providing us with novel types of booster amplifiers and Mach-Zehnder interferometers. These breakthroughs became possible due to systematic development of self-organized growth technologies

  2. Multipath interference test method for distributed amplifiers

    Science.gov (United States)

    Okada, Takahiro; Aida, Kazuo

    2005-12-01

    A method for testing distributed amplifiers is presented; the multipath interference (MPI) is detected as a beat spectrum between the multipath signal and the direct signal using a binary frequency shifted keying (FSK) test signal. The lightwave source is composed of a DFB-LD that is directly modulated by a pulse stream passing through an equalizer, and emits the FSK signal of the frequency deviation of about 430MHz at repetition rate of 80-100 kHz. The receiver consists of a photo-diode and an electrical spectrum analyzer (ESA). The base-band power spectrum peak appeared at the frequency of the FSK frequency deviation can be converted to amount of MPI using a calibration chart. The test method has improved the minimum detectable MPI as low as -70 dB, compared to that of -50 dB of the conventional test method. The detailed design and performance of the proposed method are discussed, including the MPI simulator for calibration procedure, computer simulations for evaluating the error caused by the FSK repetition rate and the fiber length under test and experiments on singlemode fibers and distributed Raman amplifier.

  3. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  4. Amplified spontaneous emission measurements on the Aurora large aperture module

    International Nuclear Information System (INIS)

    Oertel, J.A.; Czuchlewski, S.J.; Leland, W.T.; Turner, T.P.

    1990-01-01

    The large aperture module (LAM) of the Aurora KrF laser can be used to address a number of issues that relate to the scaling of KrF amplifiers to larger ICF systems. Perhaps foremost among these are the possible effects of amplified spontaneous emission (ASE) on laser performance. To assess this problem a 3-D computer code has been developed to model these ASE effects. The code uses an iterative procedure to arrive at a self-consistent steady state solution to the 3-D distribution of coherent and incoherent fluxes within the amplifier. Two-pass energy extraction, wall reflectivity, and nonuniform excitation are included in the model. The authors previously reported the effects of ASE on the small signal gains measured in the 1- x 1- x 2-m 3 LAM. The code also makes quantitative predictions of the ASE that should be generated in the amplifier. This paper indicates the radiance expected for a medium of uniform gain in terms of the (g - ν)L product and the parameter g/a. The quantity (g - ν)L is the product of the net gain and the path length along the direction of observation. The present experiments compare values of ASE measured at various locations around the LAM with the code predictions. The impact of ASE on amplifier output, is also discussed

  5. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  6. Flying between sky islands: the effect of naturally fragmented habitat on butterfly population structure.

    Science.gov (United States)

    Sekar, Sandhya; Karanth, Praveen

    2013-01-01

    High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.

  7. Analysis and simulation of nonlinearity and effects of spontaneous emission in Schottky-junction-based plasmonic amplifiers.

    Science.gov (United States)

    Livani, Abdolber Mallah; Kaatuzian, Hassan

    2015-07-01

    An amplifier that operates on surface plasmon polaritons has been analyzed and simulated. Nonlinearity behavior and the spontaneous emission effects of the plasmonic amplifier are investigated in this paper. A rate equations approach has been used in which parameters are derived from simulation results of the plasmonic amplifier (Silvaco/ATLAS). Details on the method of this derivation are included, which were not previously reported. Rate equations are solved numerically by MATLAB codes. These codes verify the Silvaco results. The plasmonic amplifier operates on surface plasmons with a free-space wavelength of 1550 nm. Results show that, even without the effect of spontaneous emission, gain of the plasmonic amplifier saturates in high input levels. Saturation power, which can be used for comparing nonlinearity of different amplifiers, is 2.1 dBm for this amplifier. Amplified spontaneous emission reduces the gain of the amplifiers, which is long. There is an optimum value for the length of the amplifier. For the amplifier of this work, the optimum length for the small signal condition is 265 μm.

  8. Comparison of Direct Sequencing, Real-Time PCR-High Resolution Melt (PCR-HRM) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis for Genotyping of Common Thiopurine Intolerant Variant Alleles NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C).

    Science.gov (United States)

    Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat

    2017-05-12

    Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.

  9. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  10. CMOS Current-mode Operational Amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1992-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  11. A CMOS current-mode operational amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1993-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  12. Amplified spontaneous emissions in a high-gain laser amplifier

    International Nuclear Information System (INIS)

    Osada, Hidenori; Gamo, Hideya.

    1978-01-01

    The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)

  13. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  14. Telomere Length and Mortality

    DEFF Research Database (Denmark)

    Kimura, Masayuki; Hjelmborg, Jacob V B; Gardner, Jeffrey P

    2008-01-01

    Leukocyte telomere length, representing the mean length of all telomeres in leukocytes, is ostensibly a bioindicator of human aging. The authors hypothesized that shorter telomeres might forecast imminent mortality in elderly people better than leukocyte telomere length. They performed mortality...

  15. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  16. DETECÇÃO DO COMPLEXO Mycobacterium tuberculosis NO LEITE PELA REAÇÃO EM CADEIA DA POLIMERASE SEGUIDA DE ANÁLISE DE RESTRIÇÃO DO FRAGMENTO AMPLIFICADO (PRA DETECTION OF Mycobacterium tuberculosis COMPLEX BY PCR-RESTRICTION FRAGMENT LENGTH POLYMORFISM ANALYSIS OF THE HSP65 GENE

    Directory of Open Access Journals (Sweden)

    Joab Trajano Silva

    2008-12-01

    , up to species level, is time consuming and difficult. In this work, the objective was to standardize a polymerase chain reaction followed by an enzyme restriction analysis in order to identify the M. tuberculosis complex in milk, without a microbiological isolation step. Reference strains and raw milk seeded with M. Bovis, were used as the starting material.  A 441pb fragment of the hsp65 gene was amplified and digested by two restriction enzymes BstEII and HaeIII. The obtained profile was used to identify the M. tuberculosis complex in milk. The minimum limit of detection of M. bovis in milk was 10CFU/mL. PRA methodology proved to be a specific and sensible method. It can be used to assist the microbiological and biochemical methods commonly used to identifying the bacilli in clinical samples, as milk 

    Key word: Detection limit (PRA, Mycobacterium tuberculosis complex, milk Mycobacterium bovis, Restriction Enzyme Analysis (PCR,

  17. Single conversion stage amplifier - SICAM

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2005-12-15

    This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

  18. Analog circuit design designing high performance amplifiers

    CERN Document Server

    Feucht, Dennis

    2010-01-01

    The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.

  19. Higher order mode optical fiber Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Friis, Søren Michael Mørk; Usuga Castaneda, Mario A.

    2016-01-01

    We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations.......We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations....

  20. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  1. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  2. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  3. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  4. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  5. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  6. Challenges in higher order mode Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

    2015-01-01

    A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

  7. European Research on THz Vacuum Amplifiers

    DEFF Research Database (Denmark)

    Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

    2010-01-01

    The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

  8. Integrated amplifying circuit with MOS transistors

    Energy Technology Data Exchange (ETDEWEB)

    Baylac, B; Merckel, G; Meunier, P

    1974-01-25

    The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

  9. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  10. Optical architecture for a multi-megajoule ICF driver incorporating megajoule class KrF amplifiers

    International Nuclear Information System (INIS)

    McLeod, J.

    1989-01-01

    A gaseous amplifying medium should be scalable to any arbitrary size. A system architecture is reported which will produce 10 MJ with only four amplifiers in the last stage by making use of this scalability. The system described uses optical angular multiplexing for efficient utilization of such large KrF amplifiers. For such large amplifiers, each multiplex beamline carries 16 kJ toward the target chamber. This is because the pump duration need only be increased as the cube root of the output energy and is only 2050 ns. While the use of angular multiplexing does not increase the total count of beamlines, it does increase their length since space has to be provided for the temporal decoder; a possible site plan is shown. Optical beam tubes are filled with He to avoid propagation problems and to promote cleanliness. Single shot sacrificial windows are proposed for large amplifiers. Relatively large multiplexing angles reduce crosstalk to a manageable level

  11. Influences of finite gain bandwidth on pulse propagation in parabolic fiber amplifiers with distributed gain profiles

    International Nuclear Information System (INIS)

    Zhao Jia-Sheng; Li Pan; Chen Xiao-Dong; Feng Su-Juan; Mao Qing-He

    2012-01-01

    The evolutions of the pulses propagating in decreasing and increasing gain distributed fiber amplifiers with finite gain bandwidths are investigated by simulations with the nonlinear Schrödinger equation. The results show that the parabolic pulse propagations in both the decreasing and the increasing gain amplifiers are restricted by the finite gain bandwidth. For a given input pulse, by choosing a small initial gain coefficient and gain variation rate, the whole gain for the pulse amplification limited by the gain bandwidth may be higher, which is helpful for the enhancement of the output linearly chirped pulse energy. Compared to the decreasing gain distributed fiber amplifier, the increasing gain distributed amplifier may be more conducive to suppress the pulse spectral broadening and increase the critical amplifier length for achieving a larger output linearly chirped pulse energy

  12. NASA developments in solid state power amplifiers

    Science.gov (United States)

    Leonard, Regis F.

    1990-01-01

    Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

  13. A pulse amplifier for nuclear instrumentation

    International Nuclear Information System (INIS)

    Martin, D.; Cliff, P.

    1987-01-01

    A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM

  14. Remote Acquisition Amplifier For 50-Ohm Cable

    Science.gov (United States)

    Amador, Jose J.

    1995-01-01

    Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

  15. Large area electron beam pumped krypton fluoride laser amplifier

    International Nuclear Information System (INIS)

    Sethian, J.D.; Obenschain, S.P.; Gerber, K.A.; Pawley, C.J.; Serlin, V.; Sullivan, C.A.; Webster, W.; Deniz, A.V.; Lehecka, T.; McGeoch, M.W.; Altes, R.A.; Corcoran, P.A.; Smith, I.D.; Barr, O.C.

    1997-01-01

    Nike is a recently completed multi-kilojoule krypton fluoride (KrF) laser that has been built to study the physics of direct drive inertial confinement fusion. This paper describes in detail both the pulsed power and optical performance of the largest amplifier in the Nike laser, the 60 cm amplifier. This is a double pass, double sided, electron beam-pumped system that amplifies the laser beam from an input of 50 J to an output of up to 5 kJ. It has an optical aperture of 60 cm x 60 cm and a gain length of 200 cm. The two electron beams are 60 cm high x 200 cm wide, have a voltage of 640 kV, a current of 540 kA, and a flat top power pulse duration of 250 ns. A 2 kG magnetic field is used to guide the beams and prevent self-pinching. Each electron beam is produced by its own Marx/pulse forming line system. The amplifier has been fully integrated into the Nike system and is used on a daily basis for laser-target experiments. copyright 1997 American Institute of Physics

  16. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    International Nuclear Information System (INIS)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

    2013-01-01

    We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  17. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2003-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

  18. Semiconductor quantum-dot lasers and amplifiers

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

    2002-01-01

    -power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

  19. CMOS Current-mode Operational Amplifier

    OpenAIRE

    Kaulberg, Thomas

    1992-01-01

    A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

  20. NIF/LMJ prototype amplifier mechanical design

    International Nuclear Information System (INIS)

    Horvath, J.

    1996-10-01

    Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

  1. Mass distribution of fission fragments using SSNTDs based image analysis system

    International Nuclear Information System (INIS)

    Kolekar, R.V.; Sharma, D.N.

    2006-01-01

    Lexan polycarbonate track detector was used to obtain mass distribution of fission fragments from 252 Cf planchette source, Normally, if the fission fragments are incident perpendicular to the lexan surface, the diameter of heavy fragment is greater than that of lighter fragment. In practical problems fission fragments are incident on the detector at all angles. So, in the present experiment, lexan detector was exposed to 252 Cf planchette source in 2π geometry. Fission fragments were incident on the detector with various angles. So the projected fission track length for fission fragment of same energy is different because of different angle of incidence. Image analysis software was used to measure the projected track length. But the problem is that for fission fragment having greater angle of incidence the entire track length is not focused on the surface. So reduced track length is measured. This problem is solved by taking two images, one at the surface and one at the tip of track and then overlapping both the images using image analysis software. The projected track length and the depth of the track were used to get the angle of incidence. Fission track lengths were measured for same angle of incidence. In all 500 track lengths were measured and plot for mass distribution for fission fragment was obtained.(author)

  2. HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

    International Nuclear Information System (INIS)

    2005-01-01

    Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

  3. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  4. Criterion of transverse coherence of self-amplified spontaneous emission in high gain free electron laser amplifiers

    International Nuclear Information System (INIS)

    Xie, M.; Kim, K.J.

    1995-01-01

    In a high gain free electron laser amplifier based on Self-Amplified Spontaneous Emission (SASE) the spontaneous radiation generated by an electron beam near the undulator entrance is amplified many orders of magnitude along the undulator. The transverse coherence properties of the amplified radiation depends on both the amplification process and the coherence of the seed radiation (the undulator radiation generated in the first gain length or so). The evolution of the transverse coherence in the amplification process is studied based on the solution of the coupled Maxwell-Vlasov equations including higher order transverse modes. The coherence of the seed radiation is determined by the number of coherent modes in the phase space area of the undulator radiation. We discuss the criterion of transverse coherence and identify governing parameters over a broad range of parameters. In particular we re-examine the well known emittance criterion for the undulator radiation, which states that full transverse coherence is guaranteed if the rms emittance is smaller than the wavelength divided by 4π. It is found that this criterion is modified for SASE because of the different optimization conditions required for the electron beam. Our analysis is a generalization of the previous study by Yu and Krinsky for the case of vanishing emittance with parallel electron beam. Understanding the transverse coherence of SASE is important for the X-ray free electron laser projects now under consideration at SLAC and DESY

  5. Audio power amplifier design handbook

    CERN Document Server

    Self, Douglas

    2013-01-01

    This book is essential for audio power amplifier designers and engineers for one simple reason...it enables you as a professional to develop reliable, high-performance circuits. The Author Douglas Self covers the major issues of distortion and linearity, power supplies, overload, DC-protection and reactive loading. He also tackles unusual forms of compensation and distortion produced by capacitors and fuses. This completely updated fifth edition includes four NEW chapters including one on The XD Principle, invented by the author, and used by Cambridge Audio. Cro

  6. Cathode-follower power amplifier

    International Nuclear Information System (INIS)

    Giordano, S.; Puglisi, M.

    1983-01-01

    In circular accelerators and particularly in storage rings it is essential that the total impedance, as seen by the beam, be kept below some critical value. A model of the accelerating system was built using a single-ended cathode-follower amplifier driving a ferrite-loaded cavity. The system operated at 234.5 kHz with a peak output voltage of +-10 kV on the gap. The dynamic output impedance, as measured on the gap, was < 15 ohms

  7. Fragger: a protein fragment picker for structural queries.

    Science.gov (United States)

    Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

    2017-01-01

    Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

  8. Fragmentation under the Scaling Symmetry and Turbulent Cascade with Intermittency

    Science.gov (United States)

    Gorokhovski, M.

    2003-01-01

    Fragmentation plays an important role in a variety of physical, chemical, and geological processes. Examples include atomization in sprays, crushing of rocks, explosion and impact of solids, polymer degradation, etc. Although each individual action of fragmentation is a complex process, the number of these elementary actions is large. It is natural to abstract a simple 'effective' scenario of fragmentation and to represent its essential features. One of the models is the fragmentation under the scaling symmetry: each breakup action reduces the typical length of fragments, r (right arrow) alpha r, by an independent random multiplier alpha (0 Saveliev, the fragmentation under the scaling symmetry has been reviewed as a continuous evolution process with new features established. The objective of this paper is twofold. First, the paper synthesizes and completes theoretical part of Gorokhovski & Saveliev. Second, the paper shows a new application of the fragmentation theory under the scale invariance. This application concerns the turbulent cascade with intermittency. We formulate here a model describing the evolution of the velocity increment distribution along the progressively decreasing length scale. The model shows that when the turbulent length scale gets smaller, the velocity increment distribution has central growing peak and develops stretched tails. The intermittency in turbulence is manifested in the same way: large fluctuations of velocity provoke highest strain in narrow (dissipative) regions of flow.

  9. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  10. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  11. Comparison of different wavelength pump sources for Tm subnanosecond amplifier

    Science.gov (United States)

    Cserteg, Andras; Guillemet, Sébastien; Hernandez, Yves; Giannone, Domenico

    2012-06-01

    We report here a comparison of different pumping wavelengths for short pulse Thulium fibre amplifiers. We compare the results in terms of efficiency and required fibre length. As we operate the laser in the sub-nanosecond regime, the fibre length is a critical parameter regarding non linear effects. With 793 nm clad-pumping, a 4 m long active fibre was necessary, leading to strong spectral deformation through Self Phase Modulation (SPM). Core-pumping scheme was then more in-depth investigated with several wavelengths tested. Good results with Erbium and Raman shifted pumping sources were obtained, with very short fibre length, aiming to reach a few micro-joules per pulse without (or with limited) SPM.

  12. Stochastic phenomena in a fiber Raman amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Kalashnikov, Vladimir [Aston Institute of Photonic Technologies, Aston University, Birmingham (United Kingdom); Institute of Photonics, Vienna University of Technology (Austria); Sergeyev, Sergey V. [Aston Institute of Photonic Technologies, Aston University, Birmingham (United Kingdom); Ania-Castanon, Juan Diego [Instituto de Optica CSIC, Madrid (Spain); Jacobsen, Gunnar [Acreo, Kista (Sweden); Popov, Sergei [Royal Institute of Technology (KTH), Stockholm (Sweden)

    2017-01-15

    The interplay of such cornerstones of modern nonlinear fiber optics as a nonlinearity, stochasticity and polarization leads to variety of the noise induced instabilities including polarization attraction and escape phenomena harnessing of which is a key to unlocking the fiber optic systems specifications required in high resolution spectroscopy, metrology, biomedicine and telecommunications. Here, by using direct stochastic modeling, the mapping of interplay of the Raman scattering-based nonlinearity, the random birefringence of a fiber, and the pump-to-signal intensity noise transfer has been done in terms of the fiber Raman amplifier parameters, namely polarization mode dispersion, the relative intensity noise of the pump laser, fiber length, and the signal power. The obtained results reveal conditions for emergence of the random birefringence-induced resonance-like enhancement of the gain fluctuations (stochastic anti-resonance) accompanied by pulse broadening and rare events in the form of low power output signals having probability heavily deviated from the Gaussian distribution. (copyright 2016 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. A high-average power tapered FEL amplifier at submillimeter frequencies using sheet electron beams and short-period wigglers

    International Nuclear Information System (INIS)

    Bidwell, S.W.; Radack, D.J.; Antonsen, T.M. Jr.; Booske, J.H.; Carmel, Y.; Destler, W.W.; Granatstein, V.L.; Levush, B.; Latham, P.E.; Zhang, Z.X.

    1990-01-01

    A high-average-power FEL amplifier operating at submillimeter frequencies is under development at the University of Maryland. Program goals are to produce a CW, ∼1 MW, FEL amplifier source at frequencies between 280 GHz and 560 GHz. To this end, a high-gain, high-efficiency, tapered FEL amplifier using a sheet electron beam and a short-period (superconducting) wiggler has been chosen. Development of this amplifier is progressing in three stages: (1) beam propagation through a long length (∼1 m) of short period (λ ω = 1 cm) wiggler, (2) demonstration of a proof-of-principle amplifier experiment at 98 GHz, and (3) designs of a superconducting tapered FEL amplifier meeting the ultimate design goal specifications. 17 refs., 1 fig., 1 tab

  14. PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.; Hinsberg, N.P. van; Abadjieva, E.

    2013-01-01

    An analytical model that describes the PELE fragmentation dynamics is presented and compared with experimental results from literature. The model accounts for strong shock effects and detailed interactions taking place between the filling – the inner core of the ammunition – and the target

  15. Cryobiology of coral fragments.

    Science.gov (United States)

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  17. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  18. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  19. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  20. A system for biasing a differential amplifier

    International Nuclear Information System (INIS)

    Barbier, Daniel; Ittel, J.M.; Poujois, Robert

    1975-01-01

    This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

  1. Enhanced Gain in Photonic Crystal Amplifiers

    DEFF Research Database (Denmark)

    Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

    2012-01-01

    We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....

  2. Very broad bandwidth klystron amplifiers

    Science.gov (United States)

    Faillon, G.; Egloff, G.; Farvet, C.

    Large surveillance radars use transmitters at peak power levels of around one MW and average levels of a few kW, and possibly several tens of kW, in S band, or even C band. In general, the amplification stage of these transmitters is a microwave power tube, frequently a klystron. Although designers often turn to klystrons because of their good peak and average power capabilities, they still see them as narrow band amplifiers, undoubtedly because of their resonant cavities which, at first sight, would seem highly selective. But, with the progress of recent years, it has now become quite feasible to use these tubes in installations requiring bandwidths in excess of 10 - 12 percent, and even 15 percent, at 1 MW peak for example, in S-band.

  3. Hydraulically amplified PZT mems actuator

    Science.gov (United States)

    Miles, Robin R.

    2004-11-02

    A hydraulically amplified microelectromechanical systems actuator. A piece of piezoelectric material or stacked piezo bimorph is bonded or deposited as a thin film. The piece is operatively connected to a primary membrane. A reservoir is operatively connected to the primary membrane. The reservoir contains a fluid. A membrane is operatively connected to the reservoir. In operation, energizing the piezoelectric material causing the piezoelectric material to bow. Bowing of the piezoelectric material causes movement of the primary membrane. Movement of the primary membrane results in a force in being transmitted to the liquid in the reservoir. The force in the liquid causes movement of the membrane. Movement of the membrane results in an operating actuator.

  4. Transverse pumped laser amplifier architecture

    Science.gov (United States)

    Bayramian, Andrew James; Manes, Kenneth; Deri, Robert; Erlandson, Al; Caird, John; Spaeth, Mary

    2013-07-09

    An optical gain architecture includes a pump source and a pump aperture. The architecture also includes a gain region including a gain element operable to amplify light at a laser wavelength. The gain region is characterized by a first side intersecting an optical path, a second side opposing the first side, a third side adjacent the first and second sides, and a fourth side opposing the third side. The architecture further includes a dichroic section disposed between the pump aperture and the first side of the gain region. The dichroic section is characterized by low reflectance at a pump wavelength and high reflectance at the laser wavelength. The architecture additionally includes a first cladding section proximate to the third side of the gain region and a second cladding section proximate to the fourth side of the gain region.

  5. Design of an 1800nm Raman amplifier

    DEFF Research Database (Denmark)

    Svane, Ask Sebastian; Rottwitt, Karsten

    2013-01-01

    We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...

  6. Reflection amplifiers in self-regulated learning

    NARCIS (Netherlands)

    Verpoorten, Dominique

    2012-01-01

    Verpoorten, D. (2012). Reflection amplifiers in self-regulated learning. Doctoral thesis. November, 9, 2012, Heerlen, The Netherlands: Open Universiteit (CELSTEC). Datawyse / Universitaire Pers Maastricht.

  7. Development of high sensitivity transimpedance amplifier module for self powered neutron detectors

    International Nuclear Information System (INIS)

    Khan, T.K.; Tamboli, P.K.; Antony, J.; Balasubramanian, R.; Agilandaeswari, K.; Pramanik, M.

    2010-01-01

    This paper describes design and development of a Transimpedance Amplifier for amplification of very low current from in core Self Powered Neutron Detectors (SPND). Measurement of neutron flux is very important for operation, control and protection of Nuclear Power Plant (NPP). SPND is used to measure Reactor incore flux/power. Based on sensitivity of emitter material used in SPND, pitch length and neutron flux (power level); the current output from SPND varies from few pA to few μA. The described amplifier is suitable to use for this current range. The amplifier provides a very high gain using a resistive T network feedback topology. The amplifier is designed in two stages using ultra low bias current FET OPAMPs. Design of Transimpedance amplifier is carefully done to include ultra low input bias current, low offset voltage and noise. The amplifier has in built test facility for calibration and on line test facility for measurement of insulation resistance (IR). The amplifier module has on board isolated DC-DC converter circuit complying MIL/STD/461C/D which generate isolated +/-15V and +12V supply to provide parameter to parameter ground isolation and independence among each module/signal.The output from the amplifier is 0V to 6V for 0 to 150%FP. The design is simulated in computer and amplifier used at TAPS-3 was modified as per new design and has been tested at TAPS-3 site. The amplifier performed satisfactorily. The results showed that the IR measurement technique adopted in the design can tolerate lower IR of SPND in existing design. (author)

  8. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...

  9. Fragmentation of atomic systems

    International Nuclear Information System (INIS)

    Bohn, J.L.; Fano, U.

    1996-01-01

    We report recent progress toward a nonperturbative formulation of many-body quantum dynamics that treats all constituent particles on an equal footing. This formulation is capable of detailing the evolution of a system toward the diverse fragments into which it can break up. We illustrate the general concept with the simple example of the simultaneous excitation of both electrons in a helium atom. copyright 1996 The American Physical Society

  10. Modelling the fragmentation mechanisms

    International Nuclear Information System (INIS)

    Bougault, R.; Durand, D.; Gulminelli, F.

    1998-01-01

    We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way

  11. Hot nuclei and fragmentation

    International Nuclear Information System (INIS)

    Guerreau, D.

    1993-01-01

    A review is made of the present status concerning the production of nuclei above 5 MeV temperature. Considerable progress has been made recently on the understanding of the formation and the fate of such hot nuclei. It appears that the nucleus seems more stable against temperature than predicted by static calculations. However, the occurrence of multifragment production at high excitation energies is now well established. The various experimental features of the fragmentation process are discussed. (author) 59 refs., 12 figs

  12. Excited nuclei fragmentation

    International Nuclear Information System (INIS)

    Ngo, C.

    1986-11-01

    Experimental indications leading to the thought of a very excited nucleus fragmentation are resumed. Theoretical approaches are briefly described; they are used to explain the phenomenon in showing off they are based on a minimum information principle. This model is based on time dependent Thomas-Fermi calculation which allows the mean field effect description, and with a site-bound percolation model which allows the fluctuation description [fr

  13. Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

    DEFF Research Database (Denmark)

    Wang, Z.; Durhuus, T.; Mikkelsen, Benny

    1994-01-01

    A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

  14. Gene Prediction in Metagenomic Fragments with Deep Learning

    Directory of Open Access Journals (Sweden)

    Shao-Wu Zhang

    2017-01-01

    Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

  15. Radiation hardening techniques for rare-earth based optical fibers and amplifiers

    International Nuclear Information System (INIS)

    Girard, Sylvain; Marcandella, Claude; Vivona, Marilena; Prudenzano, Luciano Mescia F.; Laurent, Arnaud; Robin, Thierry; Cadier, Benoit; Pinsard, Emmanuel; Ouerdane, Youcef; Boukenter, Aziz; Cannas, Marco; Boscaino, Roberto

    2012-01-01

    Er/Yb doped fibers and amplifiers have been shown to be very radiation sensitive, limiting their integration in space. We present an approach including successive hardening techniques to enhance their radiation tolerance. The efficiency of our approach is demonstrated by comparing the radiation responses of optical amplifiers made with same lengths of different rare-earth doped fibers and exposed to gamma-rays. Previous studies indicated that such amplifiers suffered significant degradation for doses exceeding 10 krad. Applying our techniques significantly enhances the amplifier radiation resistance, resulting in a very limited degradation up to 50 krad. Our optimization techniques concern the fiber composition, some possible pre-treatments and the interest of simulation tools used to harden by design the amplifiers. We showed that adding cerium inside the fiber phospho-silicate-based core strongly decreases the fiber radiation sensitivity compared to the standard fiber. For both fibers, a pre-treatment with hydrogen permits to enhance again the fiber resistance. Furthermore, simulations tools can also be used to improve the tolerance of the fiber amplifier by helping identifying the best amplifier configuration for operation in the radiative environment. (authors)

  16. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Science.gov (United States)

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  17. Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

    2014-10-21

    Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

  18. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  19. Self-pulsation in Raman fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, Martin Erland Vestergaard; Ott, Johan Raunkjær; Rottwitt, Karsten

    2009-01-01

    Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated.......Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated....

  20. Pulse amplifier with high 'common mode rejection'

    International Nuclear Information System (INIS)

    Ijlst, P.

    1987-01-01

    The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)

  1. BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER

    DEFF Research Database (Denmark)

    2010-01-01

    Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...

  2. Bevalac injector final stage RF amplifier upgrades

    International Nuclear Information System (INIS)

    Howard, D.; Calvert, J.; Dwinell, R.; Lax, J.; Lindner, A.; Richter, R.; Ridgeway, W.

    1991-01-01

    With the assistance of the DOE In-house Energy Management Program, the Bevalac injector final stage RF amplifier systems have been successfully upgraded to reduce energy consumption and operating costs. This recently completed project removed the energy-inefficient plate voltage modulator circuits that were used in conjunction with the final stage RF amplifiers. Construction, design, and operating parameters are described in detail

  3. Method for reducing snap in magnetic amplifiers

    Science.gov (United States)

    Fischer, R. L. E.; Word, J. L.

    1968-01-01

    Method of reducing snap in magnetic amplifiers uses a degenerative feedback circuit consisting of a resistor and a separate winding on a magnetic core. The feedback circuit extends amplifier range by allowing it to be used at lower values of output current.

  4. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  5. Genetic structure and seed-mediated dispersal rates of an endangered shrub in a fragmented landscape: a case study for Juniperus communis in northwestern Europe

    Directory of Open Access Journals (Sweden)

    Adriaenssens Sandy

    2011-08-01

    Full Text Available Abstract Background Population extinction risk in a fragmented landscape is related to the differential ability of the species to spread its genes across the landscape. The impact of landscape fragmentation on plant population dynamics will therefore vary across different spatial scales. We quantified successful seed-mediated dispersal of the dioecious shrub Juniperus communis in a fragmented landscape across northwestern Europe by using amplified fragment length polymorphism (AFLP markers. Furthermore we investigated the genetic diversity and structure on two spatial scales: across northwestern Europe and across Flanders (northern Belgium. We also studied whether seed viability and populations size were correlated with genetic diversity. Results Unexpectedly, estimated seed-mediated dispersal rates were quite high and ranged between 3% and 14%. No population differentiation and no spatial genetic structure were detected on the local, Flemish scale. A significant low to moderate genetic differentiation between populations was detected at the regional, northwest European scale (PhiPT = 0.10. In general, geographically nearby populations were also genetically related. High levels of within-population genetic diversity were detected but no correlation was found between any genetic diversity parameter and population size or seed viability. Conclusions In northwestern Europe, landscape fragmentation has lead to a weak isolation-by-distance pattern but not to genetic impoverishment of common juniper. Substantial rates of successful migration by seed-mediated gene flow indicate a high dispersal ability which could enable Juniperus communis to naturally colonize suitable habitats. However, it is not clear whether the observed levels of migration will suffice to counterbalance the effects of genetic drift in small populations on the long run.

  6. A broadband high-efficiency Doherty power amplifier using symmetrical devices

    Science.gov (United States)

    Cheng, Zhiqun; Zhang, Ming; Li, Jiangzhou; Liu, Guohua

    2018-04-01

    This paper proposes a method for broadband and high-efficiency amplification of Doherty power amplifier (DPA) using symmetric devices. In order to achieve the perfect load modulation, the carrier amplifier output circuit total power length is designed to odd multiple of 90°, and the peak amplifier output total power length is designed to even multiple of 180°. The proposed method is demonstrated by designing a broadband high-efficiency DPA using identical 10-W packaged GaN HEMT devices. Measurement results show that over 51% drain efficiency is achieved at 6-dB back-off power, over the frequency band of 1.9–2.4 GHz. Project supported by the National Natural Science Foundation of China (No. 60123456), the Zhejiang Provincial Natural Science Foundation of China (No. LZ16F010001), and the Zhejiang Provincial Public Technology Research Project (No. 2016C31070).

  7. A fluidic/pneumatic interface amplifier

    Science.gov (United States)

    Limbert, D. E.; Kegel, T. M.

    The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

  8. Amplified OTDR Systems for Multipoint Corrosion Monitoring

    Science.gov (United States)

    Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.

    2012-01-01

    We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017

  9. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2001-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...

  10. Bandwidth tunable amplifier for recording biopotential signals.

    Science.gov (United States)

    Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer

    2010-01-01

    This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.

  11. Dual-range linearized transimpedance amplifier system

    Science.gov (United States)

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  12. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  13. Ultrafast disk lasers and amplifiers

    Science.gov (United States)

    Sutter, Dirk H.; Kleinbauer, Jochen; Bauer, Dominik; Wolf, Martin; Tan, Chuong; Gebs, Raphael; Budnicki, Aleksander; Wagenblast, Philipp; Weiler, Sascha

    2012-03-01

    Disk lasers with multi-kW continuous wave (CW) output power are widely used in manufacturing, primarily for cutting and welding applications, notably in the automotive industry. The ytterbium disk technology combines high power (average and/or peak power), excellent beam quality, high efficiency, and high reliability with low investment and operating costs. Fundamental mode picosecond disk lasers are well established in micro machining at high throughput and perfect precision. Following the world's first market introduction of industrial grade 50 W picosecond lasers (TruMicro 5050) at the Photonics West 2008, the second generation of the TruMicro series 5000 now provides twice the average power (100 W at 1030 nm, or 60 W frequency doubled, green output) at a significantly reduced footprint. Mode-locked disk oscillators achieve by far the highest average power of any unamplified lasers, significantly exceeding the 100 W level in laboratory set-ups. With robust long resonators their multi-microjoule pulse energies begin to compete with typical ultrafast amplifiers. In addition, significant interest in disk technology has recently come from the extreme light laser community, aiming for ultra-high peak powers of petawatts and beyond.

  14. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  15. Compact fibre-laser-pumped Ho:YLF oscillator-amplifier system

    CSIR Research Space (South Africa)

    Bollig, C

    2009-06-01

    Full Text Available -amplifier system. 0 5 10 15 20 25 0 1 2 3 4 5 Repetition Rate [kHz] Pu lse En er gy [m J] 0 50 100 150 200 250 Pu lse Le n gt h [ns ] Simulation Results Amp Pulse Energy Osc Pulse Energy Amp Pulse Length Fig. 2 Output energy...

  16. Telomere length analysis.

    Science.gov (United States)

    Canela, Andrés; Klatt, Peter; Blasco, María A

    2007-01-01

    Most somatic cells of long-lived species undergo telomere shortening throughout life. Critically short telomeres trigger loss of cell viability in tissues, which has been related to alteration of tissue function and loss of regenerative capabilities in aging and aging-related diseases. Hence, telomere length is an important biomarker for aging and can be used in the prognosis of aging diseases. These facts highlight the importance of developing methods for telomere length determination that can be employed to evaluate telomere length during the human aging process. Telomere length quantification methods have improved greatly in accuracy and sensitivity since the development of the conventional telomeric Southern blot. Here, we describe the different methodologies recently developed for telomere length quantification, as well as their potential applications for human aging studies.

  17. An Archeology of Fragments

    Directory of Open Access Journals (Sweden)

    Gerald L. Bruns

    2014-10-01

    Full Text Available This is a short (fragmentary history of fragmentary writing from the German Romantics (F. W. Schlegel, Friedrich Hölderlin to modern and contemporary concrete or visual poetry. Such writing is (often deliberately a critique of the logic of subsumption that tries to assimilate whatever is singular and irreducible into totalities of various categorical or systematic sorts. Arguably, the fragment (parataxis is the distinctive feature of literary Modernism, which is a rejection, not of what precedes it, but of what Max Weber called “the rationalization of the world” (or Modernity whose aim is to keep everything, including all that is written, under surveillance and control.

  18. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  19. Fragmentation of random trees

    International Nuclear Information System (INIS)

    Kalay, Z; Ben-Naim, E

    2015-01-01

    We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

  20. Phase noise in RF and microwave amplifiers.

    Science.gov (United States)

    Boudot, Rodolphe; Rubiola, Enrico

    2012-12-01

    Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and

  1. Simulations of longitudinally pumped dye laser amplifier

    International Nuclear Information System (INIS)

    Takehisa, Kiwamu; Takemori, Satoshi

    1995-01-01

    Simulations of a copper laser pumped dye laser amplifier and new designs of the longitudinally pumped dye laser amplifier are presented. The simulations take the consideration of the amplified spontaneous emission (ASE). The new designs utilize a center-hole reflector instead of a dichroic mirror. The simulation results indicate that the poor spatial overlap between the pump beam and the dye beam in the transverse pumping not only reduces the laser output power, but also generates ASE strongly. The results also indicate that the longitudinal pumping is as efficient as the transverse pumping. (author)

  2. A parallel input composite transimpedance amplifier

    Science.gov (United States)

    Kim, D. J.; Kim, C.

    2018-01-01

    A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.

  3. Fundamentals of RF and microwave transistor amplifiers

    CERN Document Server

    Bahl, Inder J

    2009-01-01

    A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read

  4. Quantum electronics maser amplifiers and oscillators

    CERN Document Server

    Fain, V M; Sanders, J H

    2013-01-01

    Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma

  5. Unconditionally stable microwave Si-IMPATT amplifiers

    International Nuclear Information System (INIS)

    Seddik, M.M.

    1986-07-01

    The purpose of this investigation has been the development of an improved understanding of the design and analysis of microwave reflection amplifiers employing the negative resistance property of the IMPATT devices. Unconditionally stable amplifier circuit using a Silicon IMPATT diode is designed. The problems associated with the design procedures and the stability criterion are discussed. A computer program is developed to perform the computations. The stable characteristics of a reflection-type Si-IMPATT amplifier, such as gain, frequency and bandwidth are examined. It was found that at large signal drive levels, 7 dB gain with bandwidth of 800 MHz at 22,5 mA was obtained. (author)

  6. Telomere length and depression

    DEFF Research Database (Denmark)

    Wium-Andersen, Marie Kim; Ørsted, David Dynnes; Rode, Line

    2017-01-01

    BACKGROUND: Depression has been cross-sectionally associated with short telomeres as a measure of biological age. However, the direction and nature of the association is currently unclear. AIMS: We examined whether short telomere length is associated with depression cross-sectionally as well...... as prospectively and genetically. METHOD: Telomere length and three polymorphisms, TERT, TERC and OBFC1, were measured in 67 306 individuals aged 20-100 years from the Danish general population and associated with register-based attendance at hospital for depression and purchase of antidepressant medication....... RESULTS: Attendance at hospital for depression was associated with short telomere length cross-sectionally, but not prospectively. Further, purchase of antidepressant medication was not associated with short telomere length cross-sectionally or prospectively. Mean follow-up was 7.6 years (range 0...

  7. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  8. Saturating representation of loop conformational fragments in structure databanks

    Directory of Open Access Journals (Sweden)

    Fiser András

    2006-07-01

    Full Text Available Abstract Background Short fragments of proteins are fundamental starting points in various structure prediction applications, such as in fragment based loop modeling methods but also in various full structure build-up procedures. The applicability and performance of these approaches depend on the availability of short fragments in structure databanks. Results We studied the representation of protein loop fragments up to 14 residues in length. All possible query fragments found in sequence databases (Sequence Space were clustered and cross referenced with available structural fragments in Protein Data Bank (Structure Space. We found that the expansion of PDB in the last few years resulted in a dense coverage of loop conformational fragments. For each loops of length 8 in the current Sequence Space there is at least one loop in Structure Space with 50% or higher sequence identity. By correlating sequence and structure clusters of loops we found that a 50% sequence identity generally guarantees structural similarity. These percentages of coverage at 50% sequence cutoff drop to 96, 94, 68, 53, 33 and 13% for loops of length 9, 10, 11, 12, 13, and 14, respectively. There is not a single loop in the current Sequence Space at any length up to 14 residues that is not matched with a conformational segment that shares at least 20% sequence identity. This minimum observed identity is 40% for loops of 12 residues or shorter and is as high as 50% for 10 residue or shorter loops. We also assessed the impact of rapidly growing sequence databanks on the estimated number of new loop conformations and found that while the number of sequentially unique sequence segments increased about six folds during the last five years there are almost no unique conformational segments among these up to 12 residues long fragments. Conclusion The results suggest that fragment based prediction approaches are not limited any more by the completeness of fragments in databanks but

  9. Gain measurement in a CW medium-power diode pumped Nd:YAG laser amplifier by ASE analysis

    International Nuclear Information System (INIS)

    Razzaghi, D; Hajiesmaeilbaigi, F; Ruzbehani, M

    2014-01-01

    Using the relation between amplified spontaneous emission intensity and gain, a set of formulas is derived for gain evaluation by comparing fluorescence yield in two different lengths of the active medium. Experimental measurements are carried out and gain is calculated by solving the derived formula. For comparison, measurements are also carried out using the probe beam method, which shows good agreement between the two methods in a typical CW medium-power diode pumped Nd:YAG amplifier. (paper)

  10. Automatic error compensation in dc amplifiers

    International Nuclear Information System (INIS)

    Longden, L.L.

    1976-01-01

    When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks

  11. Stimulated Brillouin scattering threshold in fiber amplifiers

    International Nuclear Information System (INIS)

    Liang Liping; Chang Liping

    2011-01-01

    Based on the wave coupling theory and the evolution model of the critical pump power (or Brillouin threshold) for stimulated Brillouin scattering (SBS) in double-clad fiber amplifiers, the influence of signal bandwidth, fiber-core diameter and amplifier gain on SBS threshold is simulated theoretically. And experimental measurements of SBS are presented in ytterbium-doped double-clad fiber amplifiers with single-frequency hundred nanosecond pulse amplification. Under different input signal pulses, the forward amplified pulse distortion is observed when the pulse energy is up to 660 nJ and the peak power is up to 3.3 W in the pulse amplification with pulse duration of 200 ns and repetition rate of 1 Hz. And the backward SBS narrow pulse appears. The pulse peak power equals to SBS threshold. Good agreement is shown between the modeled and experimental data. (authors)

  12. Behavior of MOSFET Amplifier in Radiation Fields

    International Nuclear Information System (INIS)

    Sharshar, K.A.A.; Ashry, M.

    2000-01-01

    MOSFET type 2 N 3823 characteristics and its application as an amplifier are analyzed including the effects of gamma, electron beam 1.5 MeV 25 m A and neutron flux. The 1-V characteristics, transfer curve, and the frequency response of the amplifier, and the amplification factor(A v 0 are discussed with MOSFET circuit parameters. The drain current and the amplitude of the output signal decrease as the absorbed dose increases. The measured values of the amplified signal are attenuated by 30% and 6% after exposing the MOSFET to gamma radiation and electron beam at the same dose respectively. Also for exposure to 4x10 13 N/cm 3 neutrons decreased the measured value of the amplified signal by 73% of the initial values. The decrease in the gain of the MOSFET is due to the degradation of the transconductance. It is also noticed that percentage of the decrease depends on the type of radiation

  13. Quantum-Limited Directional Amplifiers with Optomechanics

    Science.gov (United States)

    Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas

    2018-01-01

    Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.

  14. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  15. Manhattan equation for the operational amplifier

    OpenAIRE

    Mishonov, Todor M.; Danchev, Victor I.; Petkov, Emil G.; Gourev, Vassil N.; Dimitrova, Iglika M.; Varonov, Albert M.

    2018-01-01

    A differential equation relating the voltage at the output of an operational amplifier $U_0$ and the difference between the input voltages ($U_{+}$ and $U_{-}$) has been derived. The crossover frequency $f_0$ is a parameter in this operational amplifier master equation. The formulas derived as a consequence of this equation find applications in thousands of specifications for electronic devices but as far as we know, the equation has never been published. Actually, the master equation of oper...

  16. Distributed amplifier using Josephson vortex flow transistors

    International Nuclear Information System (INIS)

    McGinnis, D.P.; Beyer, J.B.; Nordman, J.E.

    1986-01-01

    A wide-band traveling wave amplifier using vortex flow transistors is proposed. A vortex flow transistor is a long Josephson junction used as a current controlled voltage source. The dual nature of this device to the field effect transistor is exploited. A circuit model of this device is proposed and a distributed amplifier utilizing 50 vortex flow transistors is predicted to have useful gain to 100 GHz

  17. The vulnerability of electric equipment to carbon fibers of mixed lengths: An analysis

    Science.gov (United States)

    Elber, W.

    1980-01-01

    The susceptibility of a stereo amplifier to damage from a spectrum of lengths of graphite fibers was calculated. A simple analysis was developed by which such calculations can be based on test results with fibers of uniform lengths. A statistical analysis was applied for the conversation of data for various logical failure criteria.

  18. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  19. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  20. Multiple excitation regenerative amplifier inertial confinement system

    International Nuclear Information System (INIS)

    George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

    1980-01-01

    The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

  1. Effect of Stemming to Burden Ratio and Powder Factor on Blast Induced Rock Fragmentation- A Case Study

    Science.gov (United States)

    Prasad, Sandeep; Choudhary, B. S.; Mishra, A. K.

    2017-08-01

    Rock fragmentation size is very important parameters for economical point of view in any surface mining. Rock fragment size direct effects on the costs of drilling, blasting, loading, secondary blasting and crushing. The main purpose of this study is to investigate effect of blast design parameters such as burden, blast hole length, stemming length, and powder factor on rock fragmentation. The fragment sizes (MFS, K50, m), and maximum fragment size (K95, m) of rock were determined by using the computer software. For every blast, after blasting operation, the images of whole muck pile are captured and there images were used for fragmentation analysis by using the Fragalyst software. It was observed that the optimal fragment size (MFS, K50, m and maximum fragment size, K95, m) of rock depends strongly on the blast design parameters and explosive parameters.

  2. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  3. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  4. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  5. MRI of displaced meniscal fragments

    Energy Technology Data Exchange (ETDEWEB)

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  6. Compact fibre-laser-pumped Ho:YLF oscillator–amplifier system

    CSIR Research Space (South Africa)

    Koen, W

    2010-04-01

    Full Text Available of the amplifier crystal L and the pump spot radius wp ( Ω = 2pi · (1 − cosβ), with β = tan−1(wpL )). Calculating the local population in (3) and iterating (6) and (11) along the length of the amplifier crystal, we obtain the extracted photon densities...-pumped tunable Tm: silica- fibre laser. Appl. Phys. B 79, 559 (2004) 6. E. Lippert, S. Nicolas, G. Arisholm, K. Stenersen, G. Rustad, Mid- infrared laser source with high power and beam quality. Appl. Opt. 45, 3839 (2006) 7. S.A. Payne, L.L. Chase, L...

  7. Broadband spectral shaping in regenerative amplifier based on modified polarization-encoded chirped pulse amplification

    Science.gov (United States)

    Wang, Xinliang; Lu, Xiaoming; Liu, Yanqi; Xu, Yi; Wang, Cheng; Li, Shuai; Yu, Linpeng; Liu, Xingyan; Liu, Keyang; Xu, Rongjie; Leng, Yuxin

    2018-06-01

    We present an intra-cavity spectral shaping method to suppress the spectral narrowing in a Ti:sapphire (Ti:Sa) regenerative amplifier. The spectral shaping is realized by manipulating the stored energies of two Ti:Sa crystals with orthogonal c-axes, changing the length of a quartz plate, and rotating a broadband achromatic half-wave plate. Using this method, in our proof-of-concept experiment, an 84-nm-(FWHM)-broadband amplified pulse with an energy gain larger than 106 is obtained, which supports a 17.8 fs Fourier-transform-limited pulse duration. The pulse is compressed to 18.9 fs.

  8. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  9. Extended fuel cycle length

    International Nuclear Information System (INIS)

    Bruyere, M.; Vallee, A.; Collette, C.

    1986-09-01

    Extended fuel cycle length and burnup are currently offered by Framatome and Fragema in order to satisfy the needs of the utilities in terms of fuel cycle cost and of overall systems cost optimization. We intend to point out the consequences of an increased fuel cycle length and burnup on reactor safety, in order to determine whether the bounding safety analyses presented in the Safety Analysis Report are applicable and to evaluate the effect on plant licensing. This paper presents the results of this examination. The first part indicates the consequences of increased fuel cycle length and burnup on the nuclear data used in the bounding accident analyses. In the second part of this paper, the required safety reanalyses are presented and the impact on the safety margins of different fuel management strategies is examined. In addition, systems modifications which can be required are indicated

  10. Relativistic distances, sizes, lengths

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1992-01-01

    Such notion as light or retarded distance, field size, formation way, visible size of a body, relativistic or radar length and wave length of light from a moving atom are considered. The relation between these notions is cleared up, their classification is given. It is stressed that the formation way is defined by the field size of a moving particle. In the case of the electromagnetic field, longitudinal sizes increase proportionally γ 2 with growing charge velocity (γ is the Lorentz-factor). 18 refs

  11. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  12. Thermodynamical string fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)

    2017-01-31

    The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.

  13. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  14. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

  15. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  16. Corridor Length and Patch Colonization by a Butterfly Junonia coenia

    Energy Technology Data Exchange (ETDEWEB)

    Nick Haddad

    2000-06-01

    Habitat corridors have been proposed to reduce patch isolation and increase population persistence in fragmented landscapes. This study tested whether patch colonization was increased by the presence and various length corridors. The specific butterfly species tested has been shown to use corridors, however, the results indicate that neither the distance between patches or the presence of a corridor influenced colonization.

  17. Multimegawatt relativistic harmonic gyrotron traveling-wave tube amplifier experiments

    International Nuclear Information System (INIS)

    Menninger, W.L.; Danly, B.G.; Temkin, R.J.

    1996-01-01

    The first multimegawatt harmonic relativistic gyrotron traveling-wave tube (gyro-twt) amplifier experiment has been designed, built, and tested. Results from this experimental setup, including the first ever reported third-harmonic gyro-twt results, are presented. Operation frequency is 17.1 GHz. Detailed phase measurements are also presented. The electron beam source is SNOMAD-II, a solid-state nonlinear magnetic accelerator driver with nominal parameters of 400 kV and 350 A. The flat-top pulsewidth is 30 ns. The electron beam is focused using a Pierce geometry and then imparted with transverse momentum using a bifilar helical wiggler magnet. Experimental operation involving both a second-harmonic interaction with the TE 21 mode and a third-harmonic interaction with the TE 31 mode, both at 17 GHz, has been characterized. The third-harmonic interaction resulted in 4-MW output power and 50-dB single-pass gain, with an efficiency of up to ∼8%. The best measured phase stability of the TE 31 amplified pulse was ±10 degree over a 9-ns period. The phase stability was limited because the maximum RF power was attained when operating far from wiggler resonance. The second harmonic, TE 21 had a peak amplified power of 2 MW corresponding to 40-dB single-pass gain and 4% efficiency. The second-harmonic interaction showed stronger superradiant emission than the third-harmonic interaction. Characterizations of the second- and third-harmonic gyro-twt experiments presented here include measurement of far-field radiation patterns, gain and phase versus interaction length, phase stability, and output power versus input power

  18. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  19. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  20. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  1. Advances in high-power rf amplifiers

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1979-01-01

    Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems

  2. Transpermeance Amplifier Applied to Magnetic Bearings

    Directory of Open Access Journals (Sweden)

    Jossana Ferreira

    2017-02-01

    Full Text Available The most conventional approach of controlling magnetic forces in active magnetic bearings (AMBs is through current feedback amplifiers: transconductance. This enables the operation of the AMB to be understood in terms of a relatively simple current-based model as has been widely reported on in the literature. The alternative notion of using transpermeance amplifiers, which approximate the feedback of gap flux rather than current, has been in commercial use in some form for at least thirty years, however is only recently seeing more widespread acceptance as a commercial standard. This study explores how such alternative amplifiers should be modeled and then examines the differences in behavior between AMBs equipped with transconductance and transpermeance amplifiers. The focus of this study is on two aspects. The first is the influence of rotor displacement on AMB force, commonly modeled as a constant negative equivalent mechanical stiffness, and it is shown that either scheme actually leads to a finite bandwidth effect, but that this bandwidth is much lower when transpermeance is employed. The second aspect is the influence of eddy currents. Using a very simple model of eddy currents (a secondary short-circuited coil, it is demonstrated that transpermeance amplifiers can recover significant actuator bandwidth compared with transconductance, but at the cost of needing increased peak current headroom.

  3. Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

    NARCIS (Netherlands)

    Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

    2005-01-01

    Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

  4. Solid-state disk amplifiers for fusion-laser systems

    Energy Technology Data Exchange (ETDEWEB)

    Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.

    1981-09-01

    We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.

  5. The design of high performance weak current integrated amplifier

    International Nuclear Information System (INIS)

    Chen Guojie; Cao Hui

    2005-01-01

    A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)

  6. Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

    NARCIS (Netherlands)

    Acar, M.

    2011-01-01

    In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

  7. Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module

    NARCIS (Netherlands)

    Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.

    2002-01-01

    This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described

  8. Medium Power 352 MHZ solid state pulsed RF amplifiers for the CERN LINAC4 Project

    CERN Document Server

    Broere, J; Gómez Martínez, Y; Rossi, M

    2011-01-01

    Economic, modular and highly linear pulsed RF amplifiers have recently been developed to be used for the three buncher cavities in the CERN Linac4. The amplifiers are water-cooled and can provide up to 33 kW pulsed RF Power, 1.5 ms pulse length and 50 Hz repetition rate. Furthermore a 60 kW unit is under construction to provide the required RF Power for the debuncher cavity. The concept is based on 1.2 kW RF power modules using the latest 6th generation LDMOS technology. For integration into the CERN control environment the amplifiers have an internal industrial controller, which will provide easy control and extended diagnostic functions. This paper describes the construction, performance, including linearity, phase stability and EMC compliance tests

  9. Regime for a Self-ionizing Raman Laser Amplifier

    International Nuclear Information System (INIS)

    Clark, D.S.; Fisch, N.J.

    2001-01-01

    Backward Raman amplification and compression at high power might occur if a long pumping laser pulse is passed through a plasma to interact resonantly with a counter-propagating short seed pulse [V.M. Malkin, et al., Phys. Rev. Lett. 82 (1999) 4448-4451]. One critical issue, however, is that the pump may be unacceptably depleted due to spontaneous Raman backscatter from intrinsic fluctuations in the amplifying plasma medium prior to its useful interaction with the seed. Premature backscatter may be avoided, however, by employing a gaseous medium with pump intensities too low to ionize the medium, and using the intense seed to produce the plasma by rapid photoionization as it is being amplified [V.M. Malkin, et al., Phys. Plasmas (2001)]. In addition to allowing that only rather low power pumps be used, photoionization introduces a damping of the short pulse which must be overcome by the Raman growth rate for net amplification to occur. The parameter space of gas densities, laser wavelengths, and laser intensities is surveyed to identify favorable regimes for this effect. Output laser intensities of 10(superscript ''17'') W/cm(superscript ''2'') for 0.5 mm radiation are found to be feasible for such a scheme using a pump of 10(superscript ''13'') W/cm(superscript ''2'') and an initial seed of 5 x 10(superscript ''14'') W/cm(superscript ''2'') over an amplification length of 5.6 cm in hydrogen gas

  10. A reflexing electron microwave amplifier for rf particle accelerator applications

    International Nuclear Information System (INIS)

    Fazio, M.V.; Hoeberling, R.F.

    1988-01-01

    The evolution of rf-accelerator technology toward high-power, high-current, low-emittance beams produces an ever-increasing demand for efficient, very high power microwave power sources. The present klystron technology has performed very well but is not expected to produce reliable gigawatt peak-power units in the 1- to 10-GHz regime. Further major advancements must involve other types of sources. The reflexing-electron class of sources can produce microwave powers at the gigawatt level and has demonstrated operation from 800-MHz to 40-GHz. The pulse length appears to be limited by diode closure, and reflexing-electron devices have been operated in a repetitively pulsed mode. A design is presented for a reflexing electron microwave amplifier that is frequency and phase locked. In this design, the generated microwave power can be efficiently coupled to one or several accelerator loads. Frequency and phase-locking capability may permit parallel-source operation for higher power. The low-frequency (500-MHz to 10-GHz) operation at very high power required by present and proposed microwave particle accelerators makes an amplifier, based on reflexing electron phenomena, a candidate for the development of new accelerator power sources. (author)

  11. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  12. Wideband pulse amplifiers for the NECTAr chip

    Science.gov (United States)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Ribó, M.; Tavernet, J.-P.; Toussenel, F.; Vincent, P.; Vorobiov, S.

    2012-12-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  13. Wideband pulse amplifiers for the NECTAr chip

    International Nuclear Information System (INIS)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J-F.; Naumann, C.L.; Nayman, P.; Ribó, M.

    2012-01-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1–3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  14. Wideband pulse amplifiers for the NECTAr chip

    Energy Technology Data Exchange (ETDEWEB)

    Sanuy, A., E-mail: asanuy@ecm.ub.es [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Delagnes, E. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Gascon, D. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Sieiro, X. [Departament d' Electronica, Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Bolmont, J.; Corona, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Feinstein, F. [LUPM, Universite Montpellier II and IN2P3/CNRS, CC072, bat. 13, place Eugene Bataillon, 34095 Montpellier (France); Glicenstein, J-F. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Naumann, C.L.; Nayman, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Ribo, M. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); and others

    2012-12-11

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  15. An automated test facility for neutronic amplifiers

    International Nuclear Information System (INIS)

    Beattie, W.J.

    1997-01-01

    Neutronic amplifiers are used at the Chalk River Laboratory in applications such as neutron flux monitoring and reactor control systems. Routine preventive maintenance of control and safety systems included annual calibration and characterization of the neutronic amplifiers. An investigation into the traditional methods of annual routine maintenance of amplifiers concluded that frequency and phase response measurements in particular were labour intensive and subject to non-repeatable errors. A decision was made to upgrade testing methods and facilities by using programmable test equipment under the control of a computer. In order to verify the results of the routine measurements, expressions for the transfer functions were derived from the circuit diagrams. Frequency and phase responses were then calculated and plotted thus providing a bench-mark to which the test results can be compared. (author)

  16. A high-efficiency superconductor distributed amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)

    2010-02-15

    A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)

  17. Computer-aided design of broad band reflection type amplifiers

    DEFF Research Database (Denmark)

    Hammershaimb, Edgar; Jeppesen, Palle; Schjær-Jacobsen, Hans

    1974-01-01

    Microwave negative resistance reflection type amplifiers using stable transferred electron devices (TED's) are optimized by numerical optimization techniques programmed for an interactive graphic datascreen. The small signal impedance of packaged TED's is measured on an automatic network analyzer....... At the same time the impedance of unpackaged devices are obtained by on-line correction for the package parasitics. The microwave circuit chosen is a multiple slug coaxial cavity, that is modelled by sections of lossy transmission lines including step susceptances. The measured small signal impedance...... of the packaged TED's and the cavity model are used in a direct optimization procedure, in which the calculated minimum gain in the prescribed frequency range is progressively maximized by adjusting the lengths, characteristic impedances and positions of the slugs. The computed results are displayed...

  18. Pion nucleus scattering lengths

    International Nuclear Information System (INIS)

    Huang, W.T.; Levinson, C.A.; Banerjee, M.K.

    1971-09-01

    Soft pion theory and the Fubini-Furlan mass dispersion relations have been used to analyze the pion nucleon scattering lengths and obtain a value for the sigma commutator term. With this value and using the same principles, scattering lengths have been predicted for nuclei with mass number ranging from 6 to 23. Agreement with experiment is very good. For those who believe in the Gell-Mann-Levy sigma model, the evaluation of the commutator yields the value 0.26(m/sub σ//m/sub π/) 2 for the sigma nucleon coupling constant. The large dispersive corrections for the isosymmetric case implies that the basic idea behind many of the soft pion calculations, namely, slow variation of matrix elements from the soft pion limit to the physical pion mass, is not correct. 11 refs., 1 fig., 3 tabs

  19. Gap length distributions by PEPR

    International Nuclear Information System (INIS)

    Warszawer, T.N.

    1980-01-01

    Conditions guaranteeing exponential gap length distributions are formulated and discussed. Exponential gap length distributions of bubble chamber tracks first obtained on a CRT device are presented. Distributions of resulting average gap lengths and their velocity dependence are discussed. (orig.)

  20. Relativistic length agony continued

    Directory of Open Access Journals (Sweden)

    Redžić D.V.

    2014-01-01

    Full Text Available We made an attempt to remedy recent confusing treatments of some basic relativistic concepts and results. Following the argument presented in an earlier paper (Redžić 2008b, we discussed the misconceptions that are recurrent points in the literature devoted to teaching relativity such as: there is no change in the object in Special Relativity, illusory character of relativistic length contraction, stresses and strains induced by Lorentz contraction, and related issues. We gave several examples of the traps of everyday language that lurk in Special Relativity. To remove a possible conceptual and terminological muddle, we made a distinction between the relativistic length reduction and relativistic FitzGerald-Lorentz contraction, corresponding to a passive and an active aspect of length contraction, respectively; we pointed out that both aspects have fundamental dynamical contents. As an illustration of our considerations, we discussed briefly the Dewan-Beran-Bell spaceship paradox and the ‘pole in a barn’ paradox. [Projekat Ministarstva nauke Republike Srbije, br. 171028

  1. Noise figure of amplified dispersive Fourier transformation

    International Nuclear Information System (INIS)

    Goda, Keisuke; Jalali, Bahram

    2010-01-01

    Amplified dispersive Fourier transformation (ADFT) is a powerful tool for fast real-time spectroscopy as it overcomes the limitations of traditional optical spectrometers. ADFT maps the spectrum of an optical pulse into a temporal waveform using group-velocity dispersion and simultaneously amplifies it in the optical domain. It greatly simplifies spectroscopy by replacing the diffraction grating and detector array in the conventional spectrometer with a dispersive fiber and single-pixel photodetector, enabling ultrafast real-time spectroscopic measurements. Following our earlier work on the theory of ADFT, here we study the effect of noise on ADFT. We derive the noise figure of ADFT and discuss its dependence on various parameters.

  2. Predistortion of a Bidirectional Cuk Audio Amplifier

    DEFF Research Database (Denmark)

    Birch, Thomas Hagen; Nielsen, Dennis; Knott, Arnold

    2014-01-01

    Some non-linear amplifier topologies are capable of providing a larger voltage gain than one from a DC source, which could make them suitable for various applications. However, the non-linearities introduce a significant amount of harmonic distortion (THD). Some of this distortion could be reduced...... using predistortion. This paper suggests linearizing a nonlinear bidirectional Cuk audio amplifier using an analog predistortion approach. A prototype power stage was built and results show that a voltage gain of up to 9 dB and reduction in THD from 6% down to 3% was obtainable using this approach....

  3. Cryogenic transimpedance amplifier for micromechanical capacitive sensors.

    Science.gov (United States)

    Antonio, D; Pastoriza, H; Julián, P; Mandolesi, P

    2008-08-01

    We developed a cryogenic transimpedance amplifier that works at a broad range of temperatures, from room temperature down to 4 K. The device was realized with a standard complementary metal oxide semiconductor 1.5 mum process. Measurements of current-voltage characteristics, open-loop gain, input referred noise current, and power consumption are presented as a function of temperature. The transimpedance amplifier has been successfully applied to sense the motion of a polysilicon micromechanical oscillator at low temperatures. The whole device is intended to serve as a magnetometer for microscopic superconducting samples.

  4. Dynamic range meter for radiofrequency amplifiers

    Directory of Open Access Journals (Sweden)

    Drozd S. S.

    2009-04-01

    Full Text Available The new measurement setup having increased on 20…30 dB the own dynamic range in comparison with the standard circuit of the dynamic range meter is offered and the rated value of an error bringing by setup in the worst case does not exceed ± 2,8 dB. The measurement setup can be applied also to determinate levels of intermodulation components average power amplifiers and powerful amplifiers of a low-frequency at replacement of the quartz filter on meeting low-frequency the LC-filter and the spectrum analyzer.

  5. Optimization of a high efficiency FEL amplifier

    International Nuclear Information System (INIS)

    Schneidmiller, E.A.; Yurkov, M.V.

    2014-10-01

    The problem of an efficiency increase of an FEL amplifier is now of great practical importance. Technique of undulator tapering in the post-saturation regime is used at the existing X-ray FELs LCLS and SACLA, and is planned for use at the European XFEL, Swiss FEL, and PAL XFEL. There are also discussions on the future of high peak and average power FELs for scientific and industrial applications. In this paper we perform detailed analysis of the tapering strategies for high power seeded FEL amplifiers. Application of similarity techniques allows us to derive universal law of the undulator tapering.

  6. Operational amplifier circuits analysis and design

    CERN Document Server

    Nelson, J C C

    1995-01-01

    This book, a revised and updated version of the author's Basic Operational Amplifiers (Butterworths 1986), enables the non-specialist to make effective use of readily available integrated circuit operational amplifiers for a range of applications, including instrumentation, signal generation and processing.It is assumed the reader has a background in the basic techniques of circuit analysis, particularly the use of j notation for reactive circuits, with a corresponding level of mathematical ability. The underlying theory is explained with sufficient but not excessive, detail. A range of compu

  7. Cavity enhanced rephased amplified spontaneous emission

    International Nuclear Information System (INIS)

    A Williamson, Lewis; J Longdell, Jevon

    2014-01-01

    Amplified spontaneous emission is usually treated as an incoherent noise process. Recent theoretical and experimental work using rephasing optical pulses has shown that rephased amplified spontaneous emission (RASE) is a potential source of wide bandwidth time-delayed entanglement. Due to poor echo efficiency the plain RASE protocol does not in theory achieve perfect entanglement. Experiments done to date show a very small amount of entanglement at best. Here we show that RASE can, in principle, produce perfect multimode time-delayed two mode squeezing when the active medium is placed inside a Q-switched cavity. (paper)

  8. Fragmentation functions approach in pQCD fragmentation phenomena

    International Nuclear Information System (INIS)

    Rolli, S.

    1996-07-01

    Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

  9. A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

    Directory of Open Access Journals (Sweden)

    Dolores González

    2012-12-01

    Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

  10. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  11. Gamma Radiation from Fission Fragments

    International Nuclear Information System (INIS)

    Higbie, Jack

    1969-10-01

    The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

  12. Gamma Radiation from Fission Fragments

    Energy Technology Data Exchange (ETDEWEB)

    Higbie, Jack

    1969-10-15

    The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

  13. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  14. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  15. Modified stochastic fragmentation of an interval as an ageing process

    Science.gov (United States)

    Fortin, Jean-Yves

    2018-02-01

    We study a stochastic model based on modified fragmentation of a finite interval. The mechanism consists of cutting the interval at a random location and substituting a unique fragment on the right of the cut to regenerate and preserve the interval length. This leads to a set of segments of random sizes, with the accumulation of small fragments near the origin. This model is an example of record dynamics, with the presence of ‘quakes’ and slow dynamics. The fragment size distribution is a universal inverse power law with logarithmic corrections. The exact distribution for the fragment number as function of time is simply related to the unsigned Stirling numbers of the first kind. Two-time correlation functions are defined, and computed exactly. They satisfy scaling relations, and exhibit aging phenomena. In particular, the probability that the same number of fragments is found at two different times t>s is asymptotically equal to [4πlog(s)]-1/2 when s\\gg 1 and the ratio t/s is fixed, in agreement with the numerical simulations. The same process with a reset impedes the aging phenomenon-beyond a typical time scale defined by the reset parameter.

  16. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  17. A megajoule class krypton fluoride amplifier for single shot, high gain ICF application

    International Nuclear Information System (INIS)

    Rose, E.; Hanson, D.; Krohn, B.; McLeod, J.; Kang, M.

    1988-01-01

    A design study is underway to define the optimal architecture for a KrF laser system which will deliver 10 MJ of 248-nm light to an ICF target. We present one approach which incorporates final power amplifiers in the megajoule class, achieving 10 MJ with four final amplifiers. Each double-pass laser amplifier employs two-sided electron-beam pumping of the laser gas medium. Details of the design are based on a Monte-Carlo electron-beam deposition code, a one-dimensional, time-dependent kinetics code, and pulsed power circuit modeling. Linear dimensions of the amplifier's extracted gain volume are 6.25 m in height and length and 5.12 m in width. Each amplifier handles 160 angularly multiplexed laser channels. The one-amagat, krypton-rich laser medium is e-beam pumped at 60-kW cm/sup /minus/3/ (4-MA at3.3-MV) over the 2-microsecond duration of the laser beam pulse train. 5 refs., 4 figs

  18. Hydrodynamic evolution of plasma waveguides for soft-x-ray amplifiers

    Science.gov (United States)

    Oliva, Eduardo; Depresseux, Adrien; Cotelo, Manuel; Lifschitz, Agustín; Tissandier, Fabien; Gautier, Julien; Maynard, Gilles; Velarde, Pedro; Sebban, Stéphane

    2018-02-01

    High-density, collisionally pumped plasma-based soft-x-ray lasers have recently delivered hundreds of femtosecond pulses, breaking the longstanding barrier of one picosecond. To pump these amplifiers an intense infrared pulse must propagate focused throughout all the length of the amplifier, which spans several Rayleigh lengths. However, strong nonlinear effects hinder the propagation of the laser beam. The use of a plasma waveguide allows us to overcome these drawbacks provided the hydrodynamic processes that dominate the creation and posterior evolution of the waveguide are controlled and optimized. In this paper we present experimental measurements of the radial density profile and transmittance of such waveguide, and we compare them with numerical calculations using hydrodynamic and particle-in-cell codes. Controlling the properties (electron density value and radial gradient) of the waveguide with the help of numerical codes promises the delivery of ultrashort (tens of femtoseconds), coherent soft-x-ray pulses.

  19. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  20. Hybrid amplifier for calorimetry with photodiode readout

    Energy Technology Data Exchange (ETDEWEB)

    Sushkov, V V

    1994-12-31

    A hybrid surface mounted amplifier for the photodiode readout of the EM calorimeter has been developed. The main technical characteristics of the design are presented. The design able to math readout constraints for a high luminosity collider experiment is discussed. 10 refs., 2 tabs., 8 figs.