[Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

Science.gov (United States)

Li, Cheng-Tao; Li, Li

2008-10-01

Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

Science.gov (United States)

Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

2016-06-01

To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

Energy Technology Data Exchange (ETDEWEB)

Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

2012-09-15

Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

Science.gov (United States)

Elsheikha, H M; Schott, H C; Mansfield, L S

2006-06-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

2006-01-01

In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

2002-01-01

, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

Directory of Open Access Journals (Sweden)

Leterrier Christine

2010-07-01

Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

2002-01-01

Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

Science.gov (United States)

Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

2003-07-01

ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

Science.gov (United States)

Brouat, C; McKey, D; Douzery, E J P

2004-05-01

Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

OpenAIRE

Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

2006-01-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

TARC: Carlo Rubbia's Energy Amplifier

CERN Multimedia

Laurent Guiraud

1997-01-01

Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

OpenAIRE

Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

2002-01-01

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

Science.gov (United States)

Johnsen, G; Kruse, H; Hofshagen, M

2006-12-01

We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

International Nuclear Information System (INIS)

Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

2012-12-01

Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Application of amplified fragment length polymorphism (AFLPs) for ...

African Journals Online (AJOL)

Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

African Journals Online (AJOL)

Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

OpenAIRE

Li, Gao-De

2015-01-01

It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

Science.gov (United States)

Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

2015-12-02

Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

OpenAIRE

Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

2001-01-01

Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

Science.gov (United States)

Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

2011-01-01

A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

Directory of Open Access Journals (Sweden)

Lieschen De Vos

Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

Directory of Open Access Journals (Sweden)

Kotoka Masuyama

Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

International Nuclear Information System (INIS)

Zhao, B.; Zheng, X.Z.

2015-01-01

Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

Science.gov (United States)

Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

2008-04-01

The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Fry, N K; Bangsborg, Jette Marie; Bernander, S

2000-01-01

The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

Science.gov (United States)

Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

2017-01-01

Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

Energy Technology Data Exchange (ETDEWEB)

Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

1999-09-01

Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

Science.gov (United States)

Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

1999-09-01

Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

Science.gov (United States)

Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

2005-01-01

An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

Science.gov (United States)

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanyo, A.; Majiwa, P.W.

2006-01-01

Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

DEFF Research Database (Denmark)

Fry, N K; Bangsborg, Jette Marie; Bergmans, A

2002-01-01

The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Genetic and epigenetic diversity and structure of Phragmites australis from local habitats of the Songnen Prairie using amplified fragment length polymorphism markers.

Science.gov (United States)

Qiu, T; Jiang, L L; Yang, Y F

2016-08-19

The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.

Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

Science.gov (United States)

Nie, H-T; Li, Q; Kong, L-F

2014-06-01

Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

A revised formula for 3-body recombination that cannot exceed the unitarity limit

International Nuclear Information System (INIS)

Greene, Chris H.; Esry, B.D.; Suno, H.

2004-01-01

We discuss the recent developments in theory and experiment that bear on our understanding of three-body recombination at ultracold temperatures. Some of these predictions include the fourth-power dependence of the three-body rate on the two-body scattering lenght a, the appearance of quantum mechanical shape resonance and Feshbach resonances, and the existence of destructive interference minima at large positive scattering lenghts. At very large scattering lenghts, however, the a 4 dependence of the recombination rate eventually will exceed the unitarity limit. We propose in this paper a simple way to correct this problem, permitting an approximate extension of previous predictions to slightly higher energies above the three-body fragmentation threshold. A preliminary comparison is carried out with a very recent experiment by Grimm and coworkers, showing reasonable agreement

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

Science.gov (United States)

Al-Khalifah, Nasser S; Shanavaskhan, A E

2017-01-01

Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

Fiber Amplifiers

DEFF Research Database (Denmark)

Rottwitt, Karsten

2017-01-01

The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

Directory of Open Access Journals (Sweden)

Emma Suryati

2013-03-01

Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

Science.gov (United States)

García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

2012-05-01

Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

Science.gov (United States)

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-10-21

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

DEFF Research Database (Denmark)

Priemé, Anders; Wolsing, Martin

2004-01-01

Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Operation amplifier

NARCIS (Netherlands)

Tetsuya, Saito; Nauta, Bram

2008-01-01

To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

Science.gov (United States)

Tan, Ming-pu

2010-01-01

Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

Amplifier Distortion

Science.gov (United States)

Keeports, David

2006-12-01

By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

Science.gov (United States)

Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

2018-01-01

Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

Science.gov (United States)

Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

2003-02-01

ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

Science.gov (United States)

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

Auto-Zero Differential Amplifier

Science.gov (United States)

Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

2017-01-01

An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

Portable musical instrument amplifier

Science.gov (United States)

Christian, David E.

1990-07-24

The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

Science.gov (United States)

Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

2017-01-01

Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

Science.gov (United States)

Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

2002-04-01

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

Operation Amplifier

NARCIS (Netherlands)

Tetsuya, Saito; Nauta, Bram

2011-01-01

PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

Operation Amplifier

NARCIS (Netherlands)

Tetsuya, S.; Nauta, Bram

2007-01-01

PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

DEFF Research Database (Denmark)

Wang, Z.; Durhuus, T.; Mikkelsen, Benny

1994-01-01

A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

Antares laser power amplifier

International Nuclear Information System (INIS)

Stine, R.D.; Ross, G.F.; Silvernail, C.

1979-01-01

The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

Science.gov (United States)

Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

2006-07-01

The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

Amplification factor variable amplifier

NARCIS (Netherlands)

Akitsugu, Oshita; Nauta, Bram

2007-01-01

PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

Amplification factor variable amplifier

NARCIS (Netherlands)

Akitsugu, Oshita; Nauta, Bram

2010-01-01

PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

Explosion-evaporation model for fragment production in intermediate-energy nuclear collisions

International Nuclear Information System (INIS)

Fai, G.; Randrup, J.

1981-01-01

Nuclear collisions at intermediate energies may create transient systems of hot nuclear matter that decay into many nuclear fragments. The disassembly of such a nuclear fireball is described as a two-stage process. In the primary explosion stage the system quickly fragments into nucleons and composite nuclei according to the available phase space. The explosion produces excited nuclei with half-lives longer than the time associated with the breakup. In the secondary evaporation stage, these nuclei decay, first by sequential emission of light particles (neutrons, protons, alphas), later by electromagnetic radiation. The secondary stage in general changes the relative abundancies of the various fragment species. This general feature makes it essential to take account of the composite fragments before using d/p as a measure of the entropy of the initial source. The formation of unbound nuclei at the explosion stage also has the desirable effect of enhancing the final abundancies of particularly stable nuclei, e.g., 4 He. For neutron-excessive sources the presence of composite nuclei amplifies the ratio of observed neutrons and protons; this effect persists for heavier mirror systems. Predictions of the model are qualitatively compared to available experimental data. The model offers a convenient way to augment existing dynamical models, such as intra-nuclear cascade and nuclear fluid dynamics, to yield actual nuclear fragments rather than merely matter distributions

CMOS Current-mode Operational Amplifier

DEFF Research Database (Denmark)

Kaulberg, Thomas

1992-01-01

current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

Operational amplifiers

CERN Document Server

Dostal, Jiri

1993-01-01

This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

International Nuclear Information System (INIS)

Robinson, M.A.

1989-01-01

Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

CMOS Current-mode Operational Amplifier

OpenAIRE

Kaulberg, Thomas

1992-01-01

A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

Simplified design of IC amplifiers

CERN Document Server

Lenk, John

1996-01-01

Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

Science.gov (United States)

Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

2012-05-01

MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

Directory of Open Access Journals (Sweden)

Daniel W. H. Robarts

2014-07-01

Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

Improved-Bandwidth Transimpedance Amplifier

Science.gov (United States)

Chapsky, Jacob

2009-01-01

The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

Directory of Open Access Journals (Sweden)

Hasnain Seyed E

2006-01-01

Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

Millimeter-wave power amplifiers

CERN Document Server

du Preez, Jaco

2017-01-01

This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

Oscillators and operational amplifiers

OpenAIRE

Lindberg, Erik

2005-01-01

A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

FLUIDIC AC AMPLIFIERS.

Science.gov (United States)

Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

Science.gov (United States)

Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

2015-11-01

The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

A CMOS current-mode operational amplifier

DEFF Research Database (Denmark)

Kaulberg, Thomas

1993-01-01

current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

Science.gov (United States)

Robarts, Daniel W. H.; Wolfe, Andrea D.

2014-01-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

Science.gov (United States)

Robarts, Daniel W H; Wolfe, Andrea D

2014-07-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

Directory of Open Access Journals (Sweden)

Karlovsky Petr

2006-02-01

Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

Modeling of semiconductor optical amplifiers

DEFF Research Database (Denmark)

Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

NASA developments in solid state power amplifiers

Science.gov (United States)

Leonard, Regis F.

1990-01-01

Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

International Nuclear Information System (INIS)

2005-01-01

Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

Electrospun amplified fiber optics.

Science.gov (United States)

Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

2015-03-11

All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

Science.gov (United States)

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Fast pulse amplifier

International Nuclear Information System (INIS)

Lepetit, J.; Poussier, E.

1984-01-01

This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

A fluidic/pneumatic interface amplifier

Science.gov (United States)

Limbert, D. E.; Kegel, T. M.

The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

Amplifier for nuclear spectrometry

International Nuclear Information System (INIS)

Suarez Canner, E.

1996-01-01

The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

Modeling FWM and impairments aware amplifiers placement technique for an optical MAN/WAN: Inline amplifiers case

Science.gov (United States)

Singh, Gurpreet; Singh, Maninder Lal

2015-08-01

A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.

Semiconductor quantum-dot lasers and amplifiers

DEFF Research Database (Denmark)

Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

2002-01-01

-power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

NIF/LMJ prototype amplifier mechanical design

International Nuclear Information System (INIS)

Horvath, J.

1996-10-01

Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

Science.gov (United States)

Guo, Jiarong

2017-04-01

A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

Assembly and maintenance of full scale NIF amplifiers in the amplifier module prototype laboratory (AMPLAB)

International Nuclear Information System (INIS)

Horvath, J. A.

1998-01-01

Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

Science.gov (United States)

Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

2015-12-14

Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

Directory of Open Access Journals (Sweden)

Patrícia Carvalho de Sequeira

2005-11-01

Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

European Research on THz Vacuum Amplifiers

DEFF Research Database (Denmark)

Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

2010-01-01

The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

Integrated amplifying circuit with MOS transistors

Energy Technology Data Exchange (ETDEWEB)

Baylac, B; Merckel, G; Meunier, P

1974-01-25

The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

NARCIS (Netherlands)

Acar, M.

2011-01-01

In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

Enhanced performance CCD output amplifier

Science.gov (United States)

Dunham, Mark E.; Morley, David W.

1996-01-01

A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

Science.gov (United States)

Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

2000-01-01

Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

Transmission characteristics of acoustic amplifier in thermoacoustic engine

International Nuclear Information System (INIS)

Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

2008-01-01

Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Final amplifier design and mercury

International Nuclear Information System (INIS)

Rose, E.A.; Hanson, D.E.

1991-01-01

The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

A pulse amplifier for nuclear instrumentation

International Nuclear Information System (INIS)

Martin, D.; Cliff, P.

1987-01-01

A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM

An Implantable CMOS Amplifier for Nerve Signals

DEFF Research Database (Denmark)

Nielsen, Jannik Hammel; Lehmann, Torsten

2003-01-01

In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

Fast logarithmic amplifier

International Nuclear Information System (INIS)

Tai, I.; Hasegawa, K.

1975-01-01

This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)

Flashlamp excited fluid laser amplified

International Nuclear Information System (INIS)

1976-01-01

The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation

Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module

NARCIS (Netherlands)

Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.

2002-01-01

This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described

Challenges in higher order mode Raman amplifiers

DEFF Research Database (Denmark)

Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

2015-01-01

A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

S-band low noise amplifier and 40 kW high power amplifier subsystems of Japanese Deep Space Earth Station

Science.gov (United States)

Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.

This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.

Small signal microwave amplifier design

CERN Document Server

Grosch, Theodore

2000-01-01

This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

Science.gov (United States)

Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

2015-03-01

DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

Noise in Optical Amplifiers

DEFF Research Database (Denmark)

Jeppesen, Palle

1997-01-01

Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

International Nuclear Information System (INIS)

Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

2017-01-01

The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

Amplified spontaneous emissions in a high-gain laser amplifier

International Nuclear Information System (INIS)

Osada, Hidenori; Gamo, Hideya.

1978-01-01

The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)

Dual-range linearized transimpedance amplifier system

Science.gov (United States)

Wessendorf, Kurt O.

2010-11-02

A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

Detection of Non-Amplified Genomic DNA

CERN Document Server

Corradini, Roberto

2012-01-01

This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

Is there a role for amplifiers in sexual selection?

Science.gov (United States)

Gualla, Filippo; Cermelli, Paolo; Castellano, Sergio

2008-05-21

The amplifier hypothesis states that selection could favour the evolution of traits in signallers that improve the ability of receivers to extract honest information from other signals or cues. We provide a formal definition of amplifiers based on the receiver's mechanisms of signal perception and we present a game-theoretical model in which males advertise their quality and females use sequential-sampling tactics to choose among prospective mates. The main effect of an amplifier on the female mating strategy is to increase her mating threshold, making the female more selective as the effectiveness of the amplifier increases. The effects of the amplifier on male advertising strategy depends both on the context and on the types of the amplifier involved. We consider two different contexts for the evolution of amplifiers (when the effect of amplifiers is on signals and when it is on cues) and two types of amplifiers (the 'neutral amplifier', when it improves quality assessment without altering male attractiveness, and the 'attractive amplifier', when it improves both quality assessment and male attractiveness). The game-theoretical model provides two main results. First, neutral and attractive amplifiers represent, respectively, a conditional and an unconditional signalling strategy. In fact, at the equilibrium, neutral amplifiers are displayed only by males whose advertising level lays above the female acceptance threshold, whereas attractive amplifiers are displayed by all signalling males, independent of their quality. Second, amplifiers of signals increase the differences in advertising levels between amplifying and not-amplifying males, but they decrease the differences within each group, so that the system converges towards an 'all-or-nothing' signalling strategy. By applying concepts from information theory, we show that the increase in information transfer at the perception level due to the amplifier of signals is contrasted by a decrease in information

An Implantable CMOS Amplifier for Nerve Signals

DEFF Research Database (Denmark)

Nielsen, Jannik Hammel; Lehmann, Torsten

2001-01-01

In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...

Operational amplifiers theory and design

CERN Document Server

Huijsing, Johan

2017-01-01

This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

NARCIS (Netherlands)

Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

2005-01-01

Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

Metabolic implications of menstrual cycle length in non-hyperandrogenic women with polycystic ovarian morphology.

Science.gov (United States)

Alebić, Miro Šimun; Stojanović, Nataša; Baldani, Dinka Pavičić; Duvnjak, Lea Smirčić

2016-12-01

This cross-sectional study aimed to investigate the association between menstrual cycle lenght and metabolic parameters in non-hyperandrogenic women with polycystic ovarian morphology, n = 250. Metabolic profiles of all participants were evaluated using anthropometric parameters (body mass index, waist circumference), parameters of dyslipidemia (total cholesterol, HDL-cholesterol, triglycerides) and markers of insulin resistance (fasting insulin, homeostasis model assessment for insulin resistance index). The associations between menstrual cycle lenght and cardiometabolic risk factors such as insulin resistance, dyslipidemia, and obesity were investigated. In non-hyperandrogenic women with polycystic ovarian morphology, menstrual cycle lenght was associated with hypertriglyceridemia and insulin resistance independently of body mass index. Moreover, menstrual cycle lenght added value to body mass index in predicting hypertriglyceridemia. The optimal menstrual cycle lenght cut-off value for identifying of non-hyperandrogenic women with polycystic ovarian morphology at metabolic risk was found to be 45 days. Metabolic profile of non-hyperandrogenic women with polycystic ovarian morphology (n = 75) with menstrual cycle lenght >45 days was similar to that of hyperandrogenic women with polycystic ovarian morphology (n = 138) while metabolic profile of non-hyperandrogenic women with polycystic ovarian morphology with menstrual cycle lenght ≤45 days (n = 112) was similar to that of controls (n = 167). Non-hyperandrogenic women with polycystic ovarian morphology with menstrual cycle lenght >45 days had higher prevalence of cardiometabolic risk factors compared to those with menstrual cycle lenght ≤45 days. Non-hyperandrogenic women with polycystic ovarian morphology are not metabolically homogeneous. Menstrual cycle lenght is an easy-to-obtain clinical parameter positively associated with the probability of unfavorable metabolic status in non

Phase noise in RF and microwave amplifiers.

Science.gov (United States)

Boudot, Rodolphe; Rubiola, Enrico

2012-12-01

Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and

Enhanced Gain in Photonic Crystal Amplifiers

DEFF Research Database (Denmark)

Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

2012-01-01

We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....

A system for biasing a differential amplifier

International Nuclear Information System (INIS)

Barbier, Daniel; Ittel, J.M.; Poujois, Robert

1975-01-01

This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Solid-state disk amplifiers for fusion-laser systems

Energy Technology Data Exchange (ETDEWEB)

Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.

1981-09-01

We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.

Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations

Directory of Open Access Journals (Sweden)

DiaS Edelberto S.

1998-01-01

Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.

DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

DEFF Research Database (Denmark)

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Multi-pass amplifier architecture for high power laser systems

Science.gov (United States)

Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C

2014-04-01

A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.

Design of an 1800nm Raman amplifier

DEFF Research Database (Denmark)

Svane, Ask Sebastian; Rottwitt, Karsten

2013-01-01

We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Remote Acquisition Amplifier For 50-Ohm Cable

Science.gov (United States)

Amador, Jose J.

1995-01-01

Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

Multiple excitation regenerative amplifier inertial confinement system

International Nuclear Information System (INIS)

George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

1980-01-01

The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

Spectral hole-burning and carrier-heating dynamics in quantum-dot amplifiers: Comparison with bulk amplifiers

DEFF Research Database (Denmark)

Borri, P.; Langbein, W.; Hvam, Jørn Märcher

2001-01-01

The ultrafast gain dynamics in an electrically pumped InAs/InGaAs/GaAs quantum-dot amplifier are measured at room temperature with femtosecond resolution, and compared with results on an InGaAsP bulk amplifier. The role of spectral hole burning and carrier heating in the recovery of the gain...

The OPTHER Project: Progress toward the THz Amplifier

DEFF Research Database (Denmark)

Paoloni, C; Brunetti, F; Di Carlo, A

2011-01-01

This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....

Use of random amplified polymorphic DNA (RAPD) for generating specific DNA probes for oxyuroid species (Nematoda).

Science.gov (United States)

Jobet, E; Bougnoux, M E; Morand, S; Rivault, C; Cloarec, A; Hugot, J P

1998-03-01

Random amplified DNA markers (RAPD; Williams et al., 1990) were used to obtained specific RAPD fragments characterising different species of oxyuroids. We tested six species of worms parasitizing vertebrates or invertebrates: Passalurus ambiguus Rudolphi, 1819, parasite of Leporids; Syphacia obvelata (Rudolphi, 1802) Seurat, 1916, a parasite of rodents; Blatticola blattae (Graeffe, 1860) Chitwood, 1932 parasite of the cockroach Blattella germanica; Hammerschmidtiella diesingi (Hammerschmidt, 1838) Chitwood, 1932 and Thelastoma bulhoesi (Magalhaes, 1990) Travassos, 1929, parasites of the cockroach Periplaneta americana, and an undescribed parasite species of a passalid insect from New Caledonia. Among 15 oligonucleotides tested, nine produced several specific bands allowing the interspecific discrimination.

Spectroscopic amplifier for pin diode

International Nuclear Information System (INIS)

Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.

2014-10-01

The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)

Automatic error compensation in dc amplifiers

International Nuclear Information System (INIS)

Longden, L.L.

1976-01-01

When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Quantum electronics maser amplifiers and oscillators

CERN Document Server

Fain, V M; Sanders, J H

2013-01-01

Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma

Class-E Amplifier Design Improvements for GSM Frequencies

Directory of Open Access Journals (Sweden)

Z. Nadir

2011-06-01

Full Text Available Efficient power amplifiers are essential in portable battery-operated systems such as mobile phones. Also, the power amplifier (PA is the most power-consuming building block in the transmitter of a portable system. This paper investigates how the efficiency of the power amplifier (which is beneficial for multiple applications in communcation sector can be improved by increasing the efficiency of switching mode class E power amplifiers for frequencies of 900 MHz and 1800 MHz. The paper tackles modeling, design improvements and verification through simulation for higher efficiencies. This is the continuation of previous work by the authors. These nonlinear power amplifiers can only amplify constant-envelope RF signals without introducing significant distortion. Mobile systems such as Advanced Mobile Phone System (AMPS and Global System for Mobile communications (GSM use modulation schemes which generate constant amplitude RF outputs in order to use efficient but nonlinear power amplifiers. Improvements in designs are suggested and higher efficiencies are achieved, to the tune of 67.1% (for 900 MHz and 67.0% (1800 MHz.

Amplified OTDR Systems for Multipoint Corrosion Monitoring

Science.gov (United States)

Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.

2012-01-01

We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017

Bandwidth tunable amplifier for recording biopotential signals.

Science.gov (United States)

Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer

2010-01-01

This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER

DEFF Research Database (Denmark)

2010-01-01

Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...

A modular positive feedback-based gene amplifier

Directory of Open Access Journals (Sweden)

Bhalerao Kaustubh D

2010-02-01

Full Text Available Abstract Background Positive feedback is a common mechanism used in the regulation of many gene circuits as it can amplify the response to inducers and also generate binary outputs and hysteresis. In the context of electrical circuit design, positive feedback is often considered in the design of amplifiers. Similar approaches, therefore, may be used for the design of amplifiers in synthetic gene circuits with applications, for example, in cell-based sensors. Results We developed a modular positive feedback circuit that can function as a genetic signal amplifier, heightening the sensitivity to inducer signals as well as increasing maximum expression levels without the need for an external cofactor. The design utilizes a constitutively active, autoinducer-independent variant of the quorum-sensing regulator LuxR. We experimentally tested the ability of the positive feedback module to separately amplify the output of a one-component tetracycline sensor and a two-component aspartate sensor. In each case, the positive feedback module amplified the response to the respective inducers, both with regards to the dynamic range and sensitivity. Conclusions The advantage of our design is that the actual feedback mechanism depends only on a single gene and does not require any other modulation. Furthermore, this circuit can amplify any transcriptional signal, not just one encoded within the circuit or tuned by an external inducer. As our design is modular, it can potentially be used as a component in the design of more complex synthetic gene circuits.

Realization of OFCC based Transimpedance Mode Instrumentation Amplifier

Directory of Open Access Journals (Sweden)

Neeta Pandey

2016-01-01

Full Text Available The paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three Operational Floating Current Conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematicThe paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three operational floating current conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematic.

Quantum-Limited Directional Amplifiers with Optomechanics

Science.gov (United States)

Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas

2018-01-01

Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

Integrated wide-band low-background amplifiers

International Nuclear Information System (INIS)

Il'yushchenko, I.I.

1980-01-01

Ways of increasing stability and reproduction of characteristics of wide-band integral amplifiers that would to the least extent increase their background noises, are discussed. Considered are some certain flowsheets of integral wide-band amplifiers with low background noise of foreign production which differ from one another by construction of inlet cascades as well as by the applied feedback type. The principal flowsheets of the amplifiers and their main performances are presented. The analysis of the data obtained has revealed that microcircuits made of cascades with a common emitter and local combined feedback are most wide-band among all the considered microcircuits [ru

Advances in high-power rf amplifiers

International Nuclear Information System (INIS)

Tallerico, P.J.

1979-01-01

Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems

Class D audio amplifiers for high voltage capacitive transducers

DEFF Research Database (Denmark)

Nielsen, Dennis

of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...

Amplified Policymaking

Science.gov (United States)

Prince, Katherine; Woempner, Carolyn

2010-01-01

This brief examines the policy implications of two drivers of change presented in the "2020 Forecast: Creating the Future of Learning"-- Pattern Recognition and Amplified Organization. These drivers point toward a series of cultural shifts and illuminate how we are developing new ways of organizing, constructing, and managing knowledge.…

Amplified spontaneous emission spectrum and gain characteristic of a two-electrode semiconductor optical amplifier

International Nuclear Information System (INIS)

Wang Hanchao; Huang Lirong; Shi Zhongwei

2011-01-01

A two-electrode multi-quantum-well semiconductor optical amplifier is designed and fabricated. The amplified spontaneous emission (ASE) spectrum and gain were measured and analyzed. It is shown that the ASE spectrum and gain characteristic are greatly influencedby the distribution of the injection current density. By changing the injection current density of two electrodes, the full width at half maximum, peak wavelength, peak power of the ASE spectrum and the gain characteristic can be easily controlled. (semiconductor devices)

CARM and harmonic gyro-amplifier experiments at 17 GHz

International Nuclear Information System (INIS)

Menninger, W.L.; Danly, B.G.; Alberti, S.; Chen, C.; Rullier, J.L.; Temkin, R.J.

1993-01-01

Cyclotron resonance maser amplifiers are possible sources for applications such as electron cyclotron resonance heating of fusion plasmas and driving high-gradient rf linear accelerators. For accelerator drivers, amplifiers or phase locked-oscillators are required. A 17 GHz cyclotron autoresonance maser (CARM) amplifier experiment and a 17 GHz third harmonic gyro-amplifier experiment are presently underway at the MIT Plasma Fusion Center. Using the SRL/MIT SNOMAD II introduction accelerator to provide a 380 kV, 180 A, 30 ns flat top electron beam, the gyro-amplifier experiment has produced 5 MW of rf power with over 50 dB of gain at 17 GHz. The gyro-amplifier operates in the TE 31 mode using a third harmonic interaction. Because of its high power output, the gyro-amplifier will be used as the rf source for a photocathode rf electron gun experiment also taking place at MIT. Preliminary gyro-amplifier results are presented, including measurement of rf power, gain versus interaction length, and the far-field pattern. A CARM experiment designed to operate in the TE 11 mode is also discussed

Characterization of a Common-Gate Amplifier Using Ferroelectric Transistors

Science.gov (United States)

Hunt, Mitchell; Sayyah, Rana; MacLeod, Todd C.; Ho, Fat D.

2011-01-01

In this paper, the empirical data collected through experiments performed using a FeFET in the common-gate amplifier circuit is presented. The FeFET common-gate amplifier was characterized by varying all parameters in the circuit, such as load resistance, biasing of the transistor, and input voltages. Due to the polarization of the ferroelectric layer, the particular behavior of the FeFET common-gate amplifier presents interesting results. Furthermore, the differences between a FeFET common-gate amplifier and a MOSFET common-gate amplifier are examined.

Amplifiable DNA from Gram-negative and Gram-positive bacteria by a low strength pulsed electric field method

Science.gov (United States)

Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen

2000-01-01

An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214

The design of high performance weak current integrated amplifier

International Nuclear Information System (INIS)

Chen Guojie; Cao Hui

2005-01-01

A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)

Quantum Dot Semiconductor Optical Amplifiers - Physics and Applications

DEFF Research Database (Denmark)

Berg, Tommy Winther

2004-01-01

This thesis describes the physics and applications of quantum dot semiconductor optical amplifiers based on numerical simulations. These devices possess a number of unique properties compared with other types of semiconductor amplifiers, which should allow enhanced performance of semiconductor...... respects is comparable to those of fiber amplifiers. The possibility of inverting the optically active states to a large degree is essential in order to achieve this performance. Optical signal processing through cross gain modulation and four wave mixing is modeled and described. For both approaches...... and QW devices and to experiments on quantum dot amplifiers. These comparisons outline the qualitative differences between the different types of amplifiers. In all cases focus is put on the physical processes responsible the differences....

Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

Science.gov (United States)

Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

2001-01-01

Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

Analog circuit design designing high performance amplifiers

CERN Document Server

Feucht, Dennis

2010-01-01

The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.

High power X-band coaxial amplifier experiments

International Nuclear Information System (INIS)

Davis, T.J.; Nation, J.A.

1991-01-01

Studies are continuing on the development of X-band coaxial microwave amplifiers as a source for next generation linear colliders. Coaxial amplifiers employ an annular electron beam propagating between inner and outer drift tube conductors, a configuration which allows large increases in beam current over standard pencil beam amplifiers. Large average diameter systems may still be used without mode competition since TM mode cutoff frequencies are controlled by the separation between conductors. A number of amplifier configurations are being studied, all primed by a driven initial cavity which resonates around 9 GHz. Simple theory of coaxial systems and particle-in-cell simulations are presented, as well as initial experimental results using a 420 keV, 7-8 kA, 9 cm diameter annular beam

Wideband multi-element Er-doped fiber amplifier

International Nuclear Information System (INIS)

Thipparapu, N K; Jain, S; May-Smith, T C; Sahu, J K

2014-01-01

A multi-element Er-doped fiber amplifier (MEEDFA) is demonstrated in which the gain profile is extended into the S and L bands. Each fiber element of the MEEDFA is found to provide a maximum gain of 37 dB and a noise figure of < 4 dB in the C-band. The gain profile of the amplifier is shifted towards longer wavelength by cascading fiber elements. The novel geometry of the multi-element fiber (MEF) could allow for the development of a broadband amplifier in a split-band configuration. The proposed amplifier can operate in the wavelength band of 1520 to 1595 nm (75 nm), with a minimum gain of 20 dB. (letter)

A parallel input composite transimpedance amplifier

Science.gov (United States)

Kim, D. J.; Kim, C.

2018-01-01

A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.

Unconditionally stable microwave Si-IMPATT amplifiers

International Nuclear Information System (INIS)

Seddik, M.M.

1986-07-01

The purpose of this investigation has been the development of an improved understanding of the design and analysis of microwave reflection amplifiers employing the negative resistance property of the IMPATT devices. Unconditionally stable amplifier circuit using a Silicon IMPATT diode is designed. The problems associated with the design procedures and the stability criterion are discussed. A computer program is developed to perform the computations. The stable characteristics of a reflection-type Si-IMPATT amplifier, such as gain, frequency and bandwidth are examined. It was found that at large signal drive levels, 7 dB gain with bandwidth of 800 MHz at 22,5 mA was obtained. (author)

Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

Directory of Open Access Journals (Sweden)

Muylaert An

2002-07-01

Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

Low noise amplifier for ZnS(Ag) scintillation chamber

International Nuclear Information System (INIS)

Do Hoang Cuong

1998-01-01

A new pulse amplifier that can be used with standard photomultiplier tubes coupled with Zn(Ag) scintillation chamber is presented. The amplifier based on an IC operational amplifier LF 356N consists of a low-noise charge sensitive preamplifier and pulse shaping circuits for optimization of signal to noise ratio. Temperature instability is ≤ 0.05%/ o C. Dynamic range for linear output signals is equal +7 V. The presented amplifier is used in a measuring head for 0.17 L Lucas chambers developed in Department of Nuclear Instruments and Methods of the INCT in laboratory investigations aimed to develop methods and instruments for measurement of radon concentration in the air. The amplifier can also be employed for measurement of ionizing radiation by means of other scintillators coupled to PM tube. The amplifier is followed by a pulse discriminator with adjustable discrimination level. The amplifier output signal and discriminator output pulses are fed to external devices. (author)

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Transpermeance Amplifier Applied to Magnetic Bearings

Directory of Open Access Journals (Sweden)

Jossana Ferreira

2017-02-01

Full Text Available The most conventional approach of controlling magnetic forces in active magnetic bearings (AMBs is through current feedback amplifiers: transconductance. This enables the operation of the AMB to be understood in terms of a relatively simple current-based model as has been widely reported on in the literature. The alternative notion of using transpermeance amplifiers, which approximate the feedback of gap flux rather than current, has been in commercial use in some form for at least thirty years, however is only recently seeing more widespread acceptance as a commercial standard. This study explores how such alternative amplifiers should be modeled and then examines the differences in behavior between AMBs equipped with transconductance and transpermeance amplifiers. The focus of this study is on two aspects. The first is the influence of rotor displacement on AMB force, commonly modeled as a constant negative equivalent mechanical stiffness, and it is shown that either scheme actually leads to a finite bandwidth effect, but that this bandwidth is much lower when transpermeance is employed. The second aspect is the influence of eddy currents. Using a very simple model of eddy currents (a secondary short-circuited coil, it is demonstrated that transpermeance amplifiers can recover significant actuator bandwidth compared with transconductance, but at the cost of needing increased peak current headroom.

A high-power two stage traveling-wave tube amplifier

International Nuclear Information System (INIS)

Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.

1991-01-01

Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length

Photonic-band-gap gyrotron amplifier with picosecond pulses

Science.gov (United States)

Nanni, Emilio A.; Jawla, Sudheer; Lewis, Samantha M.; Shapiro, Michael A.; Temkin, Richard J.

2017-12-01

We report the amplification of 250 GHz pulses as short as 260 ps without observation of pulse broadening using a photonic-band-gap circuit gyrotron traveling-wave-amplifier. The gyrotron amplifier operates with a device gain of 38 dB and an instantaneous bandwidth of 8 GHz. The operational bandwidth of the amplifier can be tuned over 16 GHz by adjusting the operating voltage of the electron beam and the magnetic field. The amplifier uses a 30 cm long photonic-band-gap interaction circuit to confine the desired TE03-like operating mode while suppressing lower order modes which can result in undesired oscillations. The circuit gain is >55 dB for a beam voltage of 23 kV and a current of 700 mA. These results demonstrate the wide bandwidths and a high gain achievable with gyrotron amplifiers. The amplification of picosecond pulses of variable lengths, 260-800 ps, shows good agreement with the theory using the coupled dispersion relation and the gain-spectrum of the amplifier as measured with quasi-CW input pulses.

Single conversion stage amplifier - SICAM

Energy Technology Data Exchange (ETDEWEB)

Ljusev, P.

2005-12-15

This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

Characterization of a Common-Source Amplifier Using Ferroelectric Transistors

Science.gov (United States)

Hunt, Mitchell; Sayyah, Rana; MacLeond, Todd C.; Ho, Pat D.

2010-01-01

This paper presents empirical data that was collected through experiments using a FeFET in the established common-source amplifier circuit. The unique behavior of the FeFET lends itself to interesting and useful operation in this widely used common-source amplifier. The paper examines the effect of using a ferroelectric transistor for the amplifier. It also examines the effects of varying load resistance, biasing, and input voltages on the output signal and gives several examples of the output of the amplifier for a given input. The difference between a commonsource amplifier using a ferroelectric transistor and that using a MOSFET is addressed.

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Class-D audio amplifiers with negative feedback

OpenAIRE

Cox, Stephen M.; Candy, B. H.

2006-01-01

There are many different designs for audio amplifiers. Class-D, or switching, amplifiers generate their output signal in the form of a high-frequency square wave of variable duty cycle (ratio of on time to off time). The square-wave nature of the output allows a particularly efficient output stage, with minimal losses. The output is ultimately filtered to remove components of the spectrum above the audio range. Mathematical models are derived here for a variety of related class-D amplifier de...

Differential transimpedance amplifier circuit for correlated differential amplification

Science.gov (United States)

Gresham, Christopher A [Albuquerque, NM; Denton, M Bonner [Tucson, AZ; Sperline, Roger P [Tucson, AZ

2008-07-22

A differential transimpedance amplifier circuit for correlated differential amplification. The amplifier circuit increase electronic signal-to-noise ratios in charge detection circuits designed for the detection of very small quantities of electrical charge and/or very weak electromagnetic waves. A differential, integrating capacitive transimpedance amplifier integrated circuit comprising capacitor feedback loops performs time-correlated subtraction of noise.

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Ring cavity for a Raman capillary waveguide amplifier

Science.gov (United States)

Kurnit, N.A.

1981-01-27

A regenerative ring amplifier and regenerative ring oscillator are described which function to feed back a portion of the Stokes signal to complete the ring cavity. The ring cavity configuration allows the CO/sub 2/ laser pump signal and Stokes signal to copropagate through the Raman capillary waveguide amplifier. A Raman capillary waveguide amplifier is also provided in the return leg of the ring cavity to increase gain without increasing the round trip time. Additionally, the ring cavity can be designed such that the amplified Stokes signal is synchronous with the mode-locked spikes of the incoming CO/sub 2/ laser pump signal.

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

Science.gov (United States)

Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

2016-01-01

Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

Directory of Open Access Journals (Sweden)

Xiaomei Xu

Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

[Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

Science.gov (United States)

Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

2009-03-01

Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

A high-efficiency superconductor distributed amplifier

Energy Technology Data Exchange (ETDEWEB)

Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)

2010-02-15

A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)

Fundamentals of RF and microwave transistor amplifiers

CERN Document Server

Bahl, Inder J

2009-01-01

A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read

Design And Construction Of 300W Audio Power Amplifier For Classroom

Directory of Open Access Journals (Sweden)

Shune Lei Aung

2015-07-01

Full Text Available Abstract This paper describes the design and construction of 300W audio power amplifier for classroom. In the construction of this amplifier microphone preamplifier tone preamplifier equalizer line amplifier output power amplifier and sound level indicator are included. The output power amplifier is designed as O.C.L system and constructed by using Class B among many types of amplifier classes. There are two types in O.C.L system quasi system and complementary system. Between them the complementary system is used in the construction of 300W audio power amplifier. The Multisim software is utilized for the construction of audio power amplifier.

Self-pulsation in Raman fiber amplifiers

DEFF Research Database (Denmark)

Pedersen, Martin Erland Vestergaard; Ott, Johan Raunkjær; Rottwitt, Karsten

2009-01-01

Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated.......Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated....

Computer-Aided Design of Microstrip GaAs Mesfet Amplifiers

DEFF Research Database (Denmark)

Nielsen, Niels Ole

1976-01-01

Results on computer-aided design of broadband GaAs MESFET amplifiers in microstrip is presented. The analysis of an amplifier is based on measured scattering parameters and a model of the microstrip structure, which includes parasitics and junction effects. The optimized performance of one stage...... amplifiers with lossless distributed matching elements is presented. Realized amplifiers are in good agreement with the theory. One stage amplifiers with a 1 ¿m FET in chip form exhibit 5.8 dB of gain in the range 8-12 GHz, while a gain of 4.5 dB from 4-8 GHz has been obtained with a packaged 1 ¿m FET....

Note: A high dynamic range, linear response transimpedance amplifier.

Science.gov (United States)

Eckel, S; Sushkov, A O; Lamoreaux, S K

2012-02-01

We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.

Higher order mode optical fiber Raman amplifiers

DEFF Research Database (Denmark)

Rottwitt, Karsten; Friis, Søren Michael Mørk; Usuga Castaneda, Mario A.

2016-01-01

We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations.......We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations....

Stimulated Brillouin scattering threshold in fiber amplifiers

International Nuclear Information System (INIS)

Liang Liping; Chang Liping

2011-01-01

Based on the wave coupling theory and the evolution model of the critical pump power (or Brillouin threshold) for stimulated Brillouin scattering (SBS) in double-clad fiber amplifiers, the influence of signal bandwidth, fiber-core diameter and amplifier gain on SBS threshold is simulated theoretically. And experimental measurements of SBS are presented in ytterbium-doped double-clad fiber amplifiers with single-frequency hundred nanosecond pulse amplification. Under different input signal pulses, the forward amplified pulse distortion is observed when the pulse energy is up to 660 nJ and the peak power is up to 3.3 W in the pulse amplification with pulse duration of 200 ns and repetition rate of 1 Hz. And the backward SBS narrow pulse appears. The pulse peak power equals to SBS threshold. Good agreement is shown between the modeled and experimental data. (authors)

Low-cost amplifier for alpha detection with photodiode

Energy Technology Data Exchange (ETDEWEB)

Domienikan, Cláudio; Costa, Priscila; Genezini, Frederico A.; Zahn, Guilherme S., E-mail: clanikan@ipen.br, E-mail: pcosta@ipen.br, E-mail: fredzini@ipen.br, E-mail: gzahn@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

2017-07-01

A low-cost amplifier for Hamamatsu S3590-09 PIN photodiode to be used in alpha detection is presented. This amplifier consists basically of two circuits: a pulse preamplifier and a shaper-driver. The PIN photodiode is reverse-biased and connected to a charge preamplifier input. Incident alpha particles generate a small current pulse in the photodiode. The integrating circuit of the low noise preamplifier transforms current pulse into a voltage pulse with amplitude proportional to the charge carried by the current pulse. The shaper-driver consists of a differentiator and an integrator and is responsible for filtering and further amplifying the preamplifier signal, generating a NIM-compatible energy pulse. The performance of the set photodiode-amplifier was successively tested through the use of a {sup 243}Am radioactive source. The low-cost photodiode amplifier was designed and constructed at IPEN - CNEN/SP using national components and expertise. (author)

Simulations of longitudinally pumped dye laser amplifier

International Nuclear Information System (INIS)

Takehisa, Kiwamu; Takemori, Satoshi

1995-01-01

Simulations of a copper laser pumped dye laser amplifier and new designs of the longitudinally pumped dye laser amplifier are presented. The simulations take the consideration of the amplified spontaneous emission (ASE). The new designs utilize a center-hole reflector instead of a dichroic mirror. The simulation results indicate that the poor spatial overlap between the pump beam and the dye beam in the transverse pumping not only reduces the laser output power, but also generates ASE strongly. The results also indicate that the longitudinal pumping is as efficient as the transverse pumping. (author)

Pulse shaping amplifier (PSA) for nuclear spectroscopy system

International Nuclear Information System (INIS)

Lombigit, L.; Maslina Mohd Ibrahim; Nolida Yusup; Nur Aira Abdul Rahman; Yong, C.F.

2014-01-01

Pulse Shaping Amplifier (PSA) is an essential components in nuclear spectroscopy system. This networks have two functions; to shape the output pulse and performs noise filtering. In this paper, we describes procedure for design and development of a pulse shaping amplifier which can be used for nuclear spectroscopy system. This prototype was developed using high performance electronics devices and assembled on a FR4 type printed circuit board. Performance of this prototype was tested by comparing it with an equivalent commercial spectroscopy amplifier (Model SILENA 7611). The test results show that the performance of this prototype is comparable to the commercial spectroscopic amplifier. (author)

GaN-based Power amplifiers for microwave applications

Directory of Open Access Journals (Sweden)

Jorge Julián Moreno-Rubio

2016-01-01

Full Text Available This paper presents a discussion about the design strategies of different kind of power amplifiers for RF/Microwave appli- cations, such as the tuned load power amplifier, class F, class F-1 and Doherty. Furthermore, it is shown the continuous wave characterization of the amplifiers above mentioned. A comparison between the obtained results, in terms of gain, efficiency and output power is presented.

Single-mode operation of a coiled multimode fiber amplifier

International Nuclear Information System (INIS)

Koplow, Jeffrey P.; Kliner, Dahv A. V.; Goldberg, Lew

2000-01-01

We report a new approach to obtaining single-transverse-mode operation of a multimode fiber amplifier in which the gain fiber is coiled to induce significant bend loss for all but the lowest-order mode. We demonstrated this method by constructing a coiled amplifier using Yb-doped, double-clad fiber with a core diameter of 25 μm and a numerical aperture of ∼0.1 (V≅7.4) . When the amplifier was operated as an amplified-spontaneous-emission source, the output beam had an M 2 value of 1.09±0.09 ; when seeded at 1064 nm, the slope efficiency was similar to that of an uncoiled amplifier. This technique will permit scaling of pulsed fiber lasers and amplifiers to significantly higher pulse energies and peak powers and cw fiber sources to higher average powers while maintaining excellent beam quality. (c) 2000 Optical Society of America

Nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.

1989-01-01

An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

Implantable neurotechnologies: a review of integrated circuit neural amplifiers.

Science.gov (United States)

Ng, Kian Ann; Greenwald, Elliot; Xu, Yong Ping; Thakor, Nitish V

2016-01-01

Neural signal recording is critical in modern day neuroscience research and emerging neural prosthesis programs. Neural recording requires the use of precise, low-noise amplifier systems to acquire and condition the weak neural signals that are transduced through electrode interfaces. Neural amplifiers and amplifier-based systems are available commercially or can be designed in-house and fabricated using integrated circuit (IC) technologies, resulting in very large-scale integration or application-specific integrated circuit solutions. IC-based neural amplifiers are now used to acquire untethered/portable neural recordings, as they meet the requirements of a miniaturized form factor, light weight and low power consumption. Furthermore, such miniaturized and low-power IC neural amplifiers are now being used in emerging implantable neural prosthesis technologies. This review focuses on neural amplifier-based devices and is presented in two interrelated parts. First, neural signal recording is reviewed, and practical challenges are highlighted. Current amplifier designs with increased functionality and performance and without penalties in chip size and power are featured. Second, applications of IC-based neural amplifiers in basic science experiments (e.g., cortical studies using animal models), neural prostheses (e.g., brain/nerve machine interfaces) and treatment of neuronal diseases (e.g., DBS for treatment of epilepsy) are highlighted. The review concludes with future outlooks of this technology and important challenges with regard to neural signal amplification.

The Nike electron-beam-pumped KrF laser amplifiers

International Nuclear Information System (INIS)

Sethian, J.D.; Pawley, C.J.; Obenschain, S.P.

1997-01-01

Nike is a recently completed multikilojoule krypton-fluoride (KrF) laser that has been built to study the physics of direct-drive inertial confinement fusion. The two final amplifiers of the Nike laser are both electron-beam-pumped systems. This paper describes these two amplifiers, with an emphasis on the pulsed power. The smaller of the two has a 20 x 20 cm aperture, and produces an output laser beam energy in excess of 100 J. This 20 cm Amplifier uses a single 12 kJ Marx generator to inject two 300 kV, 75 kA, 140 ns flat-top electron beams into opposite sides of the laser cell. The larger amplifier in Nike has a 60 x 60 cm aperture, and amplifies the laser beam up to 5 kJ. This 60 cm amplifier has two independent electron beam systems. Each system has a 170 kJ Marx generator that produces a 670 kV, 540 kA, 240 ns flat-top electron beam. Both amplifiers are complete, fully integrated into the laser, meet the Nike system requirements, and are used routinely for laser-target experiments

msap: a tool for the statistical analysis of methylation-sensitive amplified polymorphism data.

Science.gov (United States)

Pérez-Figueroa, A

2013-05-01

In this study msap, an R package which analyses methylation-sensitive amplified polymorphism (MSAP or MS-AFLP) data is presented. The program provides a deep analysis of epigenetic variation starting from a binary data matrix indicating the banding pattern between the isoesquizomeric endonucleases HpaII and MspI, with differential sensitivity to cytosine methylation. After comparing the restriction fragments, the program determines if each fragment is susceptible to methylation (representative of epigenetic variation) or if there is no evidence of methylation (representative of genetic variation). The package provides, in a user-friendly command line interface, a pipeline of different analyses of the variation (genetic and epigenetic) among user-defined groups of samples, as well as the classification of the methylation occurrences in those groups. Statistical testing provides support to the analyses. A comprehensive report of the analyses and several useful plots could help researchers to assess the epigenetic and genetic variation in their MSAP experiments. msap is downloadable from CRAN (http://cran.r-project.org/) and its own webpage (http://msap.r-forge.R-project.org/). The package is intended to be easy to use even for those people unfamiliar with the R command line environment. Advanced users may take advantage of the available source code to adapt msap to more complex analyses. © 2013 Blackwell Publishing Ltd.

47 CFR 97.315 - Certification of external RF power amplifiers.

Science.gov (United States)

2010-10-01

.... (2) The amplifier was manufactured before April 28, 1978, and has been issued a marketing waiver by... that operator's station. (3) The amplifier is sold to an amateur radio operator or to a dealer, the amplifier is purchased in used condition by a dealer, or the amplifier is sold to an amateur radio operator...

Pump to signal noise transfer in parametric fiber amplifiers

DEFF Research Database (Denmark)

Lund-Hansen, Toke; Rottwitt, Karsten; Peucheret, Christophe

2010-01-01

Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal.......Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal....

Method for reducing snap in magnetic amplifiers

Science.gov (United States)

Fischer, R. L. E.; Word, J. L.

1968-01-01

Method of reducing snap in magnetic amplifiers uses a degenerative feedback circuit consisting of a resistor and a separate winding on a magnetic core. The feedback circuit extends amplifier range by allowing it to be used at lower values of output current.

Amplifier Design for Proportional Ionization Chambers

Energy Technology Data Exchange (ETDEWEB)

Baker, W. H.

1950-08-24

This paper presents the requirements of a nuclear amplifier of short resolving time, designed to accept pulses of widely varying amplitudes. Data are given which show that a proportional ionization chamber loaded with a 1,000-ohm resistor develops pulses of 0.5 microsecond duration and several volts amplitude. Results indicate that seven basic requirements are imposed on the amplifier when counting soft beta and gamma radiation in the presence of alpha particles, without absorbers. It should, (1) have a fast recovery time, (2) have a relatively good low frequency response, (3) accept pulses of widely varying heights without developing spurious pulsed, (4) have a limiting output stage, (5) preserve the inherently short rise time of the chamber, (6) minimize pulse integration, and (7) have sufficient gain to detect the weak pulses well below the chamber voltage at which continuous discharge takes place. The results obtained with an amplifier which meets these requirements is described. A formula is derived which indicates that redesign of the proportional ionization chamber might eliminate the need for an amplifier. This may be possible if the radioactive particles are collimated parallel to the collecting electrode.

Power Amplifier Design for E-band Wireless System Communications

DEFF Research Database (Denmark)

Hadziabdic, Dzenan; Krozer, Viktor; Johansen, Tom Keinicke

2008-01-01

E-band wireless communications will become important as the microwave backhaul for high-speed data transmission. One of the most critical components is the front-end power amplifier in this system. The paper analyzes different technologies with potential in the E-band frequency range and present...... a power amplifier design satisfying the E-band system specifications. The designed power amplifier achieves a maximum output power of ges 20 dBm with a state-of-the-art power-added efficiency of 15%. The power is realized using InP DHBT technology. To the best of our knowledge it is the highest output...... power and efficiency reported for an InP HBT power amplifier in this frequency range. The predicted power-added efficiency is higher than that of power amplifiers based on SiGe HBT and GaAs pHEMT technologies. The design shows the capabilities of InP DHBT for power amplifier applications...

A new semicustom integrated bipolar amplifier for silicon strip detectors

International Nuclear Information System (INIS)

Zimmerman, T.

1989-01-01

The QPA02 is a four channel DC coupled two stage transimpedance amplifier designed at Fermilab on a semicustom linear array (Quickchip 2S) manufactured by Tektronix. The chip was developed as a silicon strip amplifier but may have other applications as well. Each channel consists of a preamplifier and a second stage amplifier/sharper with differential output which can directly drive a transmission line (90 to 140 ohms). External bypass capacitors are the only discrete components required. QPA02 has been tested and demonstrated to be an effective silicon strip amplifier. Other applications may exist which can use this amplifier or a modified version of this amplifier. For example, another design is now in progress for a wire chamber amplifier, QPA03, to be reported later. Only a relatively small effort was required to modify the design and layout for this application. 11 figs

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

Science.gov (United States)

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

String fragmentation; La fragmentation des cordes

Energy Technology Data Exchange (ETDEWEB)

Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

1997-10-01

The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

Pulse amplifier with high 'common mode rejection'

International Nuclear Information System (INIS)

Ijlst, P.

1987-01-01

The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)

Complementary DNA-amplified fragment length polymorphism ...

African Journals Online (AJOL)

owner

2011-05-09

May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

Behavior of MOSFET Amplifier in Radiation Fields

International Nuclear Information System (INIS)

Sharshar, K.A.A.; Ashry, M.

2000-01-01

MOSFET type 2 N 3823 characteristics and its application as an amplifier are analyzed including the effects of gamma, electron beam 1.5 MeV 25 m A and neutron flux. The 1-V characteristics, transfer curve, and the frequency response of the amplifier, and the amplification factor(A v 0 are discussed with MOSFET circuit parameters. The drain current and the amplitude of the output signal decrease as the absorbed dose increases. The measured values of the amplified signal are attenuated by 30% and 6% after exposing the MOSFET to gamma radiation and electron beam at the same dose respectively. Also for exposure to 4x10 13 N/cm 3 neutrons decreased the measured value of the amplified signal by 73% of the initial values. The decrease in the gain of the MOSFET is due to the degradation of the transconductance. It is also noticed that percentage of the decrease depends on the type of radiation

Low-noise audio amplifiers and preamplifier for use with intrinsic thermocouples

International Nuclear Information System (INIS)

Langner, G.C.; Sachs, R.D.; Stewart, F.L.

1979-03-01

Two simple, low-noise audio amplifiers and one low-noise preamplifier for use with intrinsic thermocouples were designed, built, and tested. The amplifiers and the preamplifier have different front end designs. One amplifier uses ultralow-noise operational amplifiers; the other amplifier uses a hybrid component. The preamplifier uses ultralow-noise discrete components. The amplifiers' equivalent noise inputs, at maximum gain, are 4.09 nV and 50 nV; the preamplifier's input is 4.05 μV. Their bandwidths are 15 600 Hz, 550 Hz, and 174 kHz, respectively. the amplifiers' equivalent noise inputs were measured from approx. 0 to 100 Hz, whereas the preamplifier's equivalent noise input was measured from approx. 0 to 174 kHz

Free-electron laser system with Raman amplifier outcoupling

Energy Technology Data Exchange (ETDEWEB)

Linford, G.J.

1988-05-03

A free-electron laser system is described comprising: a free-electron laser pump beam generator producing a high-power optical output beam in a vacuum environement; a Raman amplifier cell located in the path of the output beam from the pump beam generator; means for generating and introducing a Stokes seed beam into the Raman amplifier cell, a pair of gaseous windows through which the output beam enters and leaves the Raman amplifier cell, each window having a stream of gas moving continuously in a direction generally perpendicular to the beam; and a mirror positioned in the path of the output beam from the Raman amplifier, the mirror functioning to reflect and further direct the output beam, but not the unwanted spectral components.

Fission fragment angular momentum

International Nuclear Information System (INIS)

Frenne, D. De

1991-01-01

Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

Modeling and design techniques for RF power amplifiers

CERN Document Server

Raghavan, Arvind; Laskar, Joy

2008-01-01

The book covers RF power amplifier design, from device and modeling considerations to advanced circuit design architectures and techniques. It focuses on recent developments and advanced topics in this area, including numerous practical designs to back the theoretical considerations. It presents the challenges in designing power amplifiers in silicon and helps the reader improve the efficiency of linear power amplifiers, and design more accurate compact device models, with faster extraction routines, to create cost effective and reliable circuits.

Efficient trigger signal generation from wasted backward amplified stimulated emission at optical amplifiers for optical coherence tomography

Directory of Open Access Journals (Sweden)

Kim Seung Taek

2015-01-01

Full Text Available This paper propose an optical structure to generate trigger signals for optical coherence tomography (OCT using backward light which is usually disposed. The backward light is called backward amplified stimulated emission generated from semiconductor optical amplifier (SOA when using swept wavelength tunable laser (SWTL. A circulator is applied to block undesirable lights in the SWTL instead of an isolator in common SWTL. The circulator also diverts backward amplified spontaneous lights, which finally bring out trigger signals for a high speed digitizer. The spectra of the forward lights at SOA and the waveform of the backward lights were measured to check the procedure of the trigger formation in the experiment. The results showed that the trigger signals from the proposed SWTL with the circulator was quite usable in OCT.

Amplifying genetic logic gates.

Science.gov (United States)

Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

2013-05-03

Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

SPS RF System Amplifier plant

CERN Multimedia

1977-01-01

The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

Identification, genetic localization, and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.).

Science.gov (United States)

Witsenboer, H; Michelmore, R W; Vogel, J

1997-12-01

Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.

Wideband pulse amplifiers for the NECTAr chip

International Nuclear Information System (INIS)

Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J-F.; Naumann, C.L.; Nayman, P.; Ribó, M.

2012-01-01

The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1–3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

Wideband pulse amplifiers for the NECTAr chip

Science.gov (United States)

Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Ribó, M.; Tavernet, J.-P.; Toussenel, F.; Vincent, P.; Vorobiov, S.

2012-12-01

The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

High-power piezo drive amplifier for large stack and PFC applications

Science.gov (United States)

Clingman, Dan J.; Gamble, Mike

2001-08-01

This paper describes the continuing development of Boeing High Power Piezo Drive Amplifiers. Described is the development and testing of a 1500 Vpp, 8 amp switching amplifier. This amplifier is used to drive a piezo stack driven rotor blade trailing edge flap on a full size helicopter. Also discuss is a switching amplifier designed to drive a Piezo Fiber Composite (PFC) active twist rotor blade. This amplifier was designed to drive the PFC material at 2000 Vpp and 0.5 amps. These amplifiers recycle reactive energy, allowing for a power and weight efficient amplifier design. This work was done in conjunction with the DARPA sponsored Phase II Smart Rotor Blade program and the NASA Langley Research Center sponsored Active Twist Rotor (ATR) blade program.

Azimuthal Anisotropies in Nuclear Fragmentation

International Nuclear Information System (INIS)

Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

2002-01-01

The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

Traveling-Wave Tube Amplifier for THz Frequencies

DEFF Research Database (Denmark)

Kotiranta, Mikko; Krozer, Viktor; Zhurbenko, Vitaliy

tubes and gas lasers, but the ones available are too expensive or large for many applications. This work is related to the European project OPTHER (Optically driven terahertz amplifiers) which aims to realise a compact, powerful and efficient vacuum tube amplifier for the frequency range of 0.3 – 2...

[Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

Science.gov (United States)

Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

2015-08-01

To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

Energy Technology Data Exchange (ETDEWEB)

Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-11-15

The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

Introduction to RF power amplifier design and simulation

CERN Document Server

Eroglu, Abdullah

2015-01-01

Introduction to RF Power Amplifier Design and Simulation fills a gap in the existing literature by providing step-by-step guidance for the design of radio frequency (RF) power amplifiers, from analytical formulation to simulation, implementation, and measurement. Featuring numerous illustrations and examples of real-world engineering applications, this book:Gives an overview of intermodulation and elaborates on the difference between linear and nonlinear amplifiersDescribes the high-frequency model and transient characteristics of metal-oxide-semiconductor field-effect transistorsDetails activ

Distributed CMOS Bidirectional Amplifiers Broadbanding and Linearization Techniques

CERN Document Server

El-Khatib, Ziad; Mahmoud, Samy A

2012-01-01

This book describes methods to design distributed amplifiers useful for performing circuit functions such as duplexing, paraphrase amplification, phase shifting power splitting and power combiner applications.  A CMOS bidirectional distributed amplifier is presented that combines for the first time device-level with circuit-level linearization, suppressing the third-order intermodulation distortion. It is implemented in 0.13μm RF CMOS technology for use in highly linear, low-cost UWB Radio-over-Fiber communication systems. Describes CMOS distributed amplifiers for optoelectronic applications such as Radio-over-Fiber systems, base station transceivers and picocells; Presents most recent techniques for linearization of CMOS distributed amplifiers; Includes coverage of CMOS I-V transconductors, as well as CMOS on-chip inductor integration and modeling; Includes circuit applications for UWB Radio-over-Fiber networks.

Resistor-less charge sensitive amplifier for semiconductor detectors

Energy Technology Data Exchange (ETDEWEB)

Pelczar, K., E-mail: krzysztof.pelczar@doctoral.uj.edu.pl; Panas, K.; Zuzel, G.

2016-11-01

A new concept of a Charge Sensitive Amplifier without a high-value resistor in the feedback loop is presented. Basic spectroscopic parameters of the amplifier coupled to a coaxial High Purity Germanium detector (HPGe) are discussed. The amplifier signal input is realized with an n-channel J-FET transistor. The feedback capacitor is discharged continuously by the second, forward biased n-channel J-FET, driven by an RC low–pass filter. Both the analog—with a standard spectroscopy amplifier and a multi-channel analyzer—and the digital—by applying a Flash Analog to Digital Converter—signal readouts were tested. The achieved resolution in the analog and the digital readouts was 0.17% and 0.21%, respectively, at the Full Width at Half Maximum of the registered {sup 60}Co 1332.5 keV gamma line.

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

Science.gov (United States)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Gyrocon: a deflection-modulated, high-power microwave amplifier

International Nuclear Information System (INIS)

Tallerico, P.J.

1977-10-01

A large-signal, relativistic theory of the electron-field interaction in a new class of microwave amplifiers is presented and applied to the analysis of a high-power, 450-MHz amplifier for accelerator applications. The analysis indicates that electronic efficiencies in excess of 90 percent are obtainable and that overall efficiencies of 90 percent are possible. The amplifier is unique in several respects; the electron velocity is perpendicular to the circuit energy flow, the device uses a fast-wave circuit, and the electron beam is deflection modulated

External Peltier Cooler For Low-Noise Amplifier

Science.gov (United States)

Soper, Terry A.

1990-01-01

Inexpensive Peltier-effect cooling module made of few commercially available parts used to reduce thermal noise in microwave amplifier. Retrofitted to almost any microwave low-noise amplifier or receiver preamplifier used in communication, telemetry, or radar. Includes copper or aluminum cold plate held tightly against unit to be cooled by strap-type worm-gear clamps.

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

Conversion of the random amplified polymorphic DNA (RAPD ...

African Journals Online (AJOL)

Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.

Efficiency Optimization in Class-D Audio Amplifiers

DEFF Research Database (Denmark)

Yamauchi, Akira; Knott, Arnold; Jørgensen, Ivan Harald Holger

2015-01-01

This paper presents a new power efficiency optimization routine for designing Class-D audio amplifiers. The proposed optimization procedure finds design parameters for the power stage and the output filter, and the optimum switching frequency such that the weighted power losses are minimized under...... the given constraints. The optimization routine is applied to minimize the power losses in a 130 W class-D audio amplifier based on consumer behavior investigations, where the amplifier operates at idle and low power levels most of the time. Experimental results demonstrate that the optimization method can...... lead to around 30 % of efficiency improvement at 1.3 W output power without significant effects on both audio performance and the efficiency at high power levels....

Wideband pulse amplifiers for the NECTAr chip

Energy Technology Data Exchange (ETDEWEB)

Sanuy, A., E-mail: asanuy@ecm.ub.es [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Delagnes, E. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Gascon, D. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Sieiro, X. [Departament d' Electronica, Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Bolmont, J.; Corona, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Feinstein, F. [LUPM, Universite Montpellier II and IN2P3/CNRS, CC072, bat. 13, place Eugene Bataillon, 34095 Montpellier (France); Glicenstein, J-F. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Naumann, C.L.; Nayman, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Ribo, M. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); and others

2012-12-11

The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

The Dynamics of Semiconductor Optical Amplifiers – Modeling and Applications

DEFF Research Database (Denmark)

Mørk, Jesper; Nielsen, Mads Lønstrup; Berg, Tommy Winther

2003-01-01

The importance of semiconductor optical amplifiers is discussed. A semiconductor optical amplifier (SOA) is a semiconductor laser with anti-reflection coated facets that amplifies an injected light signal by means of stimulated emission. SOAs have a number of unique properties that open up...

Noise and saturation properties of semiconductor quantum dot optical amplifiers

DEFF Research Database (Denmark)

Berg, Tommy Winther; Mørk, Jesper

2002-01-01

We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved.......We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved....

Manhattan equation for the operational amplifier

OpenAIRE

Mishonov, Todor M.; Danchev, Victor I.; Petkov, Emil G.; Gourev, Vassil N.; Dimitrova, Iglika M.; Varonov, Albert M.

2018-01-01

A differential equation relating the voltage at the output of an operational amplifier $U_0$ and the difference between the input voltages ($U_{+}$ and $U_{-}$) has been derived. The crossover frequency $f_0$ is a parameter in this operational amplifier master equation. The formulas derived as a consequence of this equation find applications in thousands of specifications for electronic devices but as far as we know, the equation has never been published. Actually, the master equation of oper...

Integrated circuit amplifiers for multi-electrode intracortical recording.

Science.gov (United States)

Jochum, Thomas; Denison, Timothy; Wolf, Patrick

2009-02-01

Significant progress has been made in systems that interpret the electrical signals of the brain in order to control an actuator. One version of these systems senses neuronal extracellular action potentials with an array of up to 100 miniature probes inserted into the cortex. The impedance of each probe is high, so environmental electrical noise is readily coupled to the neuronal signal. To minimize this noise, an amplifier is placed close to each probe. Thus, the need has arisen for many amplifiers to be placed near the cortex. Commercially available integrated circuits do not satisfy the area, power and noise requirements of this application, so researchers have designed custom integrated-circuit amplifiers. This paper presents a comprehensive survey of the neural amplifiers described in publications prior to 2008. Methods to achieve high input impedance, low noise and a large time-constant high-pass filter are reviewed. A tutorial on the biological, electrochemical, mechanical and electromagnetic phenomena that influence amplifier design is provided. Areas for additional research, including sub-nanoampere electrolysis and chronic cortical heating, are discussed. Unresolved design concerns, including teraohm circuitry, electrical overstress and component failure, are identified.

Series-Tuned High Efficiency RF-Power Amplifiers

DEFF Research Database (Denmark)

Vidkjær, Jens

2008-01-01

An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits.......An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits....

Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

Directory of Open Access Journals (Sweden)

R. Sarman

1997-04-01

Full Text Available The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

OpenAIRE

R. Sarman; R. Prokop; T. Dostal

1997-01-01

The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

Directory of Open Access Journals (Sweden)

S. C. Oukouomi Noutchie

2014-01-01

Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

Land fragmentation and production diversification

NARCIS (Netherlands)

Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

2018-01-01

We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

Using MEMS Capacitive Switches in Tunable RF Amplifiers

OpenAIRE

Danson John; Plett Calvin; Tait Niall

2006-01-01

A MEMS capacitive switch suitable for use in tunable RF amplifiers is described. A MEMS switch is designed, fabricated, and characterized with physical and RF measurements for inclusion in simulations. Using the MEMS switch models, a dual-band low-noise amplifier (LNA) operating at GHz and GHz, and a tunable power amplifier (PA) at GHz are simulated in m CMOS. MEMS switches allow the LNA to operate with 11 dB of isolation between the two bands while maintaining dB of gain and sub- dB no...

Criterion of transverse coherence of self-amplified spontaneous emission in high gain free electron laser amplifiers

International Nuclear Information System (INIS)

Xie, M.; Kim, K.J.

1995-01-01

In a high gain free electron laser amplifier based on Self-Amplified Spontaneous Emission (SASE) the spontaneous radiation generated by an electron beam near the undulator entrance is amplified many orders of magnitude along the undulator. The transverse coherence properties of the amplified radiation depends on both the amplification process and the coherence of the seed radiation (the undulator radiation generated in the first gain length or so). The evolution of the transverse coherence in the amplification process is studied based on the solution of the coupled Maxwell-Vlasov equations including higher order transverse modes. The coherence of the seed radiation is determined by the number of coherent modes in the phase space area of the undulator radiation. We discuss the criterion of transverse coherence and identify governing parameters over a broad range of parameters. In particular we re-examine the well known emittance criterion for the undulator radiation, which states that full transverse coherence is guaranteed if the rms emittance is smaller than the wavelength divided by 4π. It is found that this criterion is modified for SASE because of the different optimization conditions required for the electron beam. Our analysis is a generalization of the previous study by Yu and Krinsky for the case of vanishing emittance with parallel electron beam. Understanding the transverse coherence of SASE is important for the X-ray free electron laser projects now under consideration at SLAC and DESY

Fragmentation processes in nuclear reactions

International Nuclear Information System (INIS)

Legrain, R.

1984-08-01

Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

Self-amplifying mRNA vaccines.

Science.gov (United States)

Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

2015-01-01

This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

Pulsed hydrogen fluoride laser oscillator-amplifier experiments

International Nuclear Information System (INIS)

Schott, G.L.

1975-01-01

Pulsed HF chemical laser oscillator energies were scaled from millijoules to several kilojoules over the period 1970-1974, reaching approximately 10 J with SF 6 and transverse discharges, and using electron-beam initiation and elemental F 2 above 1000J. This demonstrated scalability to large energy with acceptable electrical efficiency is only one prerequisite for application of this gas laser in fusion; equally important matters are achievement of focusable, approximately 1 ns pulses, couplable to light-element targets, all from an affordable system. Exploratory MOPA experiments are reported which address control of HF laser beam focusability and pulse duration, using SF 6 -based experimental oscillator--amplifier sequences and Pockels' cell switching. Simultaneous multiline lasing with 2.6 less than or equal to lambda less than or equal to 3.1 μm and high specific gain and energy density are particularly important factors encountered with HF, where amplifier pumping and lasing occur in a substantially cw temporal relationship, even in less than 100 ns bursts. Time-resolved SF 6 --HI oscillator spectra contain 27 simultaneous lines from six vibrational bands. An apertured, SF 6 -hydrocarbon pin-discharge oscillator generates approximately 10 mJ of TEM 00 radiation, which is amplified to approximately 1 J in approximately 150 ns by a TEA amplifier and p []opagated tens of meters. A three-stage system coupling these elements through an approximately 1 ns electrooptic gate to a greater than 10 J, e-beam energized amplifier is under development. (auth)

Cascade energy amplifier

International Nuclear Information System (INIS)

Barzilov, A.P.; Gulevich, A.V.; Kukharchuk, O.F.

2000-01-01

The technical problem of long-life fission product and minor actinide incineration and production of plutonium fuel in the prospective nuclear systems will arise at significant scales of nuclear power industry development. Subcritical nuclear reactors driven by extemal neutron sources (energy amplifiers) are considered as incinerators of toxicity of complete nuclear industry. In the frames of this concept, the subcritical reactor part consisting of two coupled blanket regions (inner fast neutron spectrum core and outer thermal core) driven by extemal neutron source is discussed. Two types of source are studied: spallation target and 14-MeV fusion bum of micropellets. Liquid metal Pb-Bi is considered as target material and coolant of inner fast core. Thermal core is a heavy-water subcritical reactor of the Candu-type. The fast core is protected from thermal neutrons influence with the boron shield. All reactor technologies used in this concept are tested during years of operation and commercially available. Thus, the cascade energy amplifiers have a set of advantages in comparison with traditional concepts: in energy production, in transmutation efficiency, and in economics. (authors)

Flying between sky islands: the effect of naturally fragmented habitat on butterfly population structure.

Science.gov (United States)

Sekar, Sandhya; Karanth, Praveen

2013-01-01

High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.

Power neodymium-glass amplifier of a repetitively pulsed laser

Energy Technology Data Exchange (ETDEWEB)

Vinogradov, Aleksandr V; Gaganov, V E; Garanin, Sergey G; Zhidkov, N V; Krotov, V A; Martynenko, S P; Pozdnyakov, E V; Solomatin, I I [Russian Federal Nuclear Center ' All-Russian Research Institute of Experimental Physics' , Sarov, Nizhnii Novgorod region (Russian Federation)

2011-11-30

A neodymium-glass diode-pumped amplifier with a zigzag laser beam propagation through the active medium was elaborated; the amplifier is intended for operation in a repetitively pulsed laser. An amplifier unit with an aperture of 20 Multiplication-Sign 25 mm and a {approx}40-cm long active medium was put to a test. The energy of pump radiation amounts to 140 J at a wavelength of 806 nm for a pump duration of 550 {mu}s. The energy parameters of the amplifier were experimentally determined: the small-signal gain per pass {approx}3.2, the linear gain {approx}0.031 cm{sup -1} with a nonuniformity of its distribution over the aperture within 15%, the stored energy of 0.16 - 0.21 J cm{sup -3}. The wavefront distortions in the zigzag laser-beam propagation through the active element of the amplifier did not exceed 0.4{lambda} ({lambda} = 0.63 {mu}m is the probing radiation wavelength).

Power neodymium-glass amplifier of a repetitively pulsed laser

International Nuclear Information System (INIS)

Vinogradov, Aleksandr V; Gaganov, V E; Garanin, Sergey G; Zhidkov, N V; Krotov, V A; Martynenko, S P; Pozdnyakov, E V; Solomatin, I I

2011-01-01

A neodymium-glass diode-pumped amplifier with a zigzag laser beam propagation through the active medium was elaborated; the amplifier is intended for operation in a repetitively pulsed laser. An amplifier unit with an aperture of 20 × 25 mm and a ∼40-cm long active medium was put to a test. The energy of pump radiation amounts to 140 J at a wavelength of 806 nm for a pump duration of 550 μs. The energy parameters of the amplifier were experimentally determined: the small-signal gain per pass ∼3.2, the linear gain ∼0.031 cm -1 with a nonuniformity of its distribution over the aperture within 15%, the stored energy of 0.16 - 0.21 J cm -3 . The wavefront distortions in the zigzag laser-beam propagation through the active element of the amplifier did not exceed 0.4λ (λ = 0.63 μm is the probing radiation wavelength).

GAME EDUKASI PERAKITAN AMPLIFIER BERBASIS ANDROID UNTUK USER UMUM

Directory of Open Access Journals (Sweden)

Fundhi Fanju Hafili

2015-04-01

Full Text Available ABSTRAK Seiring dengan perkembangan dan kebutuhan teknologi saat ini pembelajaran elektro dapat dibuat menjadi lebih praktis dan menarik di ponsel berbasis android Mempelajari elektronika juga memerlukan usaha-usaha nyata yang ber-kesinambungan dan mengarah kepada tumbuhnya kesadaran untuk menjadikan elektronika sebagai perkembangan teknologi. Dengan adanya metode game, merupakan salah satu metode belajar merakit amplifier yang disusun secara praktis dan sistematis sehingga memudahkan setiap orang untuk belajar maupun mengajarkan merancang amplifier. Sementara itu metode pembelajaran yang ada saat ini yaitu melalui buku maupun dengan cara bertatap muka langsung dengan tentor dirasa masih kurang efektif. Untuk mengatasi masalah tersebut maka penulis membuat game edukasi elektro merancang amplifier, karena mudah dipahami dan memudahkan para calon teknisi elektro dalam belajar merancang amplifier. Perancangan ini dilakukan dengan pendekatan metode Research and Development adalah metode penelitian yang digunakan untuk menghasilkan produk tertentu dan menguji keefektifan produk tersebut. Dengan aplikasi ini diharapkan dapat membantu para pengguna yang ingin belajar merakit amplifier berbasis android. . Kata kunci: elektro, game, research and development.

InP Heterojunction Bipolar Transistor Amplifiers to 255 GHz

Science.gov (United States)

Radisic, Vesna; Sawdai, Donald; Scott, Dennis; Deal, William; Dang, Linh; Li, Danny; Cavus, Abdullah; To, Richard; Lai, Richard

2009-01-01

Two single-stage InP heterojunction bipolar transistor (HBT) amplifiers operate at 184 and 255 GHz, using Northrop Grumman Corporation s InP HBT MMIC (monolithic microwave integrated circuit) technology. At the time of this reporting, these are reported to be the highest HBT amplifiers ever created. The purpose of the amplifier design is to evaluate the technology capability for high-frequency designs and verify the model for future development work.

Bevalac injector final stage RF amplifier upgrades

International Nuclear Information System (INIS)

Howard, D.; Calvert, J.; Dwinell, R.; Lax, J.; Lindner, A.; Richter, R.; Ridgeway, W.

1991-01-01

With the assistance of the DOE In-house Energy Management Program, the Bevalac injector final stage RF amplifier systems have been successfully upgraded to reduce energy consumption and operating costs. This recently completed project removed the energy-inefficient plate voltage modulator circuits that were used in conjunction with the final stage RF amplifiers. Construction, design, and operating parameters are described in detail

Effects of entanglement in an ideal optical amplifier

Science.gov (United States)

Franson, J. D.; Brewster, R. A.

2018-04-01

In an ideal linear amplifier, the output signal is linearly related to the input signal with an additive noise that is independent of the input. The decoherence of a quantum-mechanical state as a result of optical amplification is usually assumed to be due to the addition of quantum noise. Here we show that entanglement between the input signal and the amplifying medium can produce an exponentially-large amount of decoherence in an ideal optical amplifier even when the gain is arbitrarily close to unity and the added noise is negligible. These effects occur for macroscopic superposition states, where even a small amount of gain can leave a significant amount of which-path information in the environment. Our results show that the usual input/output relation of a linear amplifier does not provide a complete description of the output state when post-selection is used.

Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

Science.gov (United States)

Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

2015-06-01

A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

Science.gov (United States)

Kline, Margaret C; Romsos, Erica L; Duewer, David L

2016-02-16

Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

Design of a high-gain laser diode-array pumped Nd:YAG Alternating Precessive Slab Amplifier (APS-Amplifier)

Science.gov (United States)

Coyle, D. Barry

1991-01-01

In the design of space qualifiable laser systems for ranging and altimetry, such as NASA's Geodynamic Laser Ranging System (GLRS), the transmitter must be kept small, powerful yet efficient, and must consist of as few components as possible. A novel preamplifier design is examined which requires no external beam steering optics, yielding a compact component with simple alignment procedures. The gains achieved are comparable to multipass zigzag amplifiers using two or more sets of external optics for extra passes through the amplifying medium.

Design of a high-gain laser diode-array pumped Nd:YAG alternating precessive slab amplifier (APS amplifier)

Science.gov (United States)

Coyle, D. B.

1991-01-01

In the design of space-qualifiable laser systems for ranging and altimetry, such as NASA's Geodynamic Laser Ranging System (GLRS), the transmitter must be kept small, powerful yet efficient, and must consist of as few components as possible. A novel preamplifier design is examined which requires no external beam steering optics, yielding a compact component with simple alignment procedures. The gains achieved are comparable to multipass zigzag amplifiers using two or more sets of external optics for extra passes through the amplifying medium.

A CMOS Integrating Amplifier for the PHENIX Ring Imaging Cherenkov detector

International Nuclear Information System (INIS)

Wintenberg, A.L.; Jones, J.P. Jr.; Young, G.R.; Moscone, C.G.

1997-11-01

A CMOS integrating amplifier has been developed for use in the PHENIX Ring Imaging Cherenkov (RICH) detector. The amplifier, consisting of a charge-integrating amplifier followed by a variable gain amplifier (VGA), is an element of a photon measurement system comprising a photomultiplier tube, a wideband, gain of 10 amplifier, the integrating amplifier, and an analog memory followed by an ADC and double correlated sampling implemented in software. The integrating amplifier is designed for a nominal full scale input of 160 pC with a gain of 20 mV/pC and a dynamic range of 1000:1. The VGA is used for equalizing gains prior to forming analog sums for trigger purposes. The gain of the VGA is variable over a 3:1 range using a 5 bits digital control, and the risetime is held to approximately 20 ns using switched compensation in the VGA. Details of the design and results from several prototype devices fabricated in 1.2 microm Orbit CMOS are presented. A complete noise analysis of the integrating amplifier and the correlated sampling process is included as well as a comparison of calculated, simulated and measured results

A CMOS Integrating Amplifier for the PHENIX Ring Imaging Cherenkov detector

Energy Technology Data Exchange (ETDEWEB)

Wintenberg, A.L.; Jones, J.P. Jr.; Young, G.R. [Oak Ridge National Lab., TN (United States); Moscone, C.G. [Tennessee Univ., Knoxville, TN (United States)

1997-11-01

A CMOS integrating amplifier has been developed for use in the PHENIX Ring Imaging Cherenkov (RICH) detector. The amplifier, consisting of a charge-integrating amplifier followed by a variable gain amplifier (VGA), is an element of a photon measurement system comprising a photomultiplier tube, a wideband, gain of 10 amplifier, the integrating amplifier, and an analog memory followed by an ADC and double correlated sampling implemented in software. The integrating amplifier is designed for a nominal full scale input of 160 pC with a gain of 20 mV/pC and a dynamic range of 1000:1. The VGA is used for equalizing gains prior to forming analog sums for trigger purposes. The gain of the VGA is variable over a 3:1 range using a 5 bits digital control, and the risetime is held to approximately 20 ns using switched compensation in the VGA. Details of the design and results from several prototype devices fabricated in 1.2 {micro}m Orbit CMOS are presented. A complete noise analysis of the integrating amplifier and the correlated sampling process is included as well as a comparison of calculated, simulated and measured results.

Fragment-based drug design.

Science.gov (United States)

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

Amplified spontaneous emission in solar-pumped iodine laser

Science.gov (United States)

Cho, Yong S.; Hwang, In H.; Han, Kwang S.; Lee, Ja H.

1992-01-01

The amplified spontaneous emission (ASE) from a long pulse, solar-simulating radiation pumped iodine laser amplifier is studied. The ASE threshold pump intensity is almost proportional to the inverse of the laser gain length when the gas pressure is constant in the laser tube.

Ultrafast Dynamics of Quantum-Dot Semiconductor Optical Amplifiers

DEFF Research Database (Denmark)

Poel, Mike van der; Hvam, Jørn Märcher

2007-01-01

We report on a series of experiments on the dynamical properties of quantum-dot semiconductor optical amplifiers. We show how the amplifier responds to one or several ultrafast (170 fs) pulses in rapid succession and our results demonstrate applicability and ultimate limitations to application...

Fragment informatics and computational fragment-based drug design: an overview and update.

Science.gov (United States)

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

Self-oscillating modulators for direct energy conversion audio power amplifiers

Energy Technology Data Exchange (ETDEWEB)

Ljusev, P.; Andersen, Michael A.E.

2005-07-01

Direct energy conversion audio power amplifier represents total integration of switching-mode power supply and Class D audio power amplifier into one compact stage, achieving high efficiency, high level of integration, low component count and eventually low cost. This paper presents how self-oscillating modulators can be used with the direct switching-mode audio power amplifier to improve its performance by providing fast hysteretic control with high power supply rejection ratio, open-loop stability and high bandwidth. Its operation is thoroughly analyzed and simulated waveforms of a prototype amplifier are presented. (au)

Design and development of digital seismic amplifier recorder

Energy Technology Data Exchange (ETDEWEB)

Samsidar, Siti Alaa; Afuar, Waldy; Handayani, Gunawan, E-mail: gunawanhandayani@gmail.com [Department of Physics, ITB (Indonesia)

2015-04-16

A digital seismic recording is a recording technique of seismic data in digital systems. This method is more convenient because it is more accurate than other methods of seismic recorders. To improve the quality of the results of seismic measurements, the signal needs to be amplified to obtain better subsurface images. The purpose of this study is to improve the accuracy of measurement by amplifying the input signal. We use seismic sensors/geophones with a frequency of 4.5 Hz. The signal is amplified by means of 12 units of non-inverting amplifier. The non-inverting amplifier using IC 741 with the resistor values 1KΩ and 1MΩ. The amplification results were 1,000 times. The results of signal amplification converted into digital by using the Analog Digital Converter (ADC). Quantitative analysis in this study was performed using the software Lab VIEW 8.6. The Lab VIEW 8.6 program was used to control the ADC. The results of qualitative analysis showed that the seismic conditioning can produce a large output, so that the data obtained is better than conventional data. This application can be used for geophysical methods that have low input voltage such as microtremor application.

Operational amplifier circuits analysis and design

CERN Document Server

Nelson, J C C

1995-01-01

This book, a revised and updated version of the author's Basic Operational Amplifiers (Butterworths 1986), enables the non-specialist to make effective use of readily available integrated circuit operational amplifiers for a range of applications, including instrumentation, signal generation and processing.It is assumed the reader has a background in the basic techniques of circuit analysis, particularly the use of j notation for reactive circuits, with a corresponding level of mathematical ability. The underlying theory is explained with sufficient but not excessive, detail. A range of compu

The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

Directory of Open Access Journals (Sweden)

Shumeng Kou

2018-03-01

Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

Science.gov (United States)

Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

2018-01-01

Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

Spaceflight 2 um Tm Fiber MOPA Amplifier, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — Fibertek proposes to design, develop, and test a spaceflight prototype 2051 nm thulium (Tm)-doped fiber amplifier (TDFA) optical master oscillator power amplifier...

Compact solid state radio frequency amplifiers in kW regime for ...

Indian Academy of Sciences (India)

RF amplifier; solid state amplifier; power combiner and divider; .... was designed using planar and coaxial transmission line baluns with minimum lumped variable ..... Cripps S C 1999 RF power amplifiers for wireless communication. Norwood: ...

Distributed amplifier using Josephson vortex flow transistors

International Nuclear Information System (INIS)

McGinnis, D.P.; Beyer, J.B.; Nordman, J.E.

1986-01-01

A wide-band traveling wave amplifier using vortex flow transistors is proposed. A vortex flow transistor is a long Josephson junction used as a current controlled voltage source. The dual nature of this device to the field effect transistor is exploited. A circuit model of this device is proposed and a distributed amplifier utilizing 50 vortex flow transistors is predicted to have useful gain to 100 GHz

PHEMT Distributed Power Amplifier Adopting Broadband Impedance Transformer

DEFF Research Database (Denmark)

Narendra, K.; Limiti, E.; Paoloni, C.

2013-01-01

A non-uniform drain line distributed power amplifier (DPA) employing a broadband impedance transformer is presented. The DPA is based on GaAs PHEMT technology. The impedance transformer employs asymmetric coupled lines and transforms a low output impedance of the amplifier to a standard 50 Ω...

Development and energization of IOT based RF amplifier

International Nuclear Information System (INIS)

Mandal, A.; Som, S.; Raj, P.R.; Manna, S.K.; Ghosh, S.; Seth, S.; Thakurta, S.; Thakur, S.K.; Saha, S.; Panda, U.S.

2013-01-01

A 704 MHz IOT based CW RF amplifier has been developed in VECC. It can also be used with proper tuning to power cavity modules operating at 650 MHz in high energy high intensity proton linear accelerator proposed to be built for ADSS/SNS programme in India and Project-X at Fermilab, USA. This IOT based amplifier provides up to 60 kW continuous wave RF power at 700 MHz. It required various power supplies, LCW cooling and forced air cooling for its operation. The auxiliary power supplies like Grid, Filament and Ion-pump, are floated and mounted on an isolated frame, i.e., HV deck. The mains inputs are electrically isolated by means of isolation transformer. Also, a Programmable Logic Controller (PLC) based interlocks along with high voltage collector power supply has been designed and developed for the safe operation of the RF amplifier. This paper discusses about various developments and energization of the IOT based RF amplifier with high power dummy load. (author)

Amplifiers dedicated for large area SiC photodiodes

Science.gov (United States)

Doroz, P.; Duk, M.; Korwin-Pawlowski, M. L.; Borecki, M.

2016-09-01

Large area SiC photodiodes find applications in optoelectronic sensors working at special conditions. These conditions include detection of UV radiation in harsh environment. Moreover, the mentioned sensors have to be selective and resistant to unwanted signals. For this purpose, the modulation of light at source unit and the rejection of constant current and low frequency component of signal at detector unit are used. The popular frequency used for modulation in such sensor is 1kHz. The large area photodiodes are characterized by a large capacitance and low shunt resistance that varies with polarization of the photodiode and can significantly modify the conditions of signal pre-amplification. In this paper two pre-amplifiers topology are analyzed: the transimpedance amplifier and the non-inverting voltage to voltage amplifier with negative feedback. The feedback loops of both pre-amplifiers are equipped with elements used for initial constant current and low frequency signals rejections. Both circuits are analyzed and compared using simulation and experimental approaches.

Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

Science.gov (United States)

Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

2014-08-30

The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

Knowledge-based Fragment Binding Prediction

Science.gov (United States)

Tang, Grace W.; Altman, Russ B.

2014-01-01

Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

Directory of Open Access Journals (Sweden)

Bartoš Jan

2008-06-01

Full Text Available Abstract Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA. Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which

Spatial chirp in Ti:sapphire multipass amplifier

International Nuclear Information System (INIS)

Li Wenkai; Lu Jun; Li Yanyan; Guo Xiaoyang; Wu Fenxiang; Yu Linpeng; Wang Pengfei; Xu Yi; Leng Yuxin

2017-01-01

The spatial chirp generated in the Ti:sapphire multipass amplifier is numerically investigated based on the one-dimensional (1D) and two-dimensional (2D) Frantz–Nodvik equations. The simulation indicates that the spatial chirp is induced by the spatially inhomogeneous gain, and it can be almost eliminated by utilization of proper beam profiles and spot sizes of the signal and pump pulses, for example, the pump pulse has a top-hatted beam profile and the signal pulse has a super-Gaussian beam profile with a relatively larger spot size. In this way, a clear understanding of spatial chirp mechanisms in the Ti:sapphire multipass amplifier is proposed, therefore we can effectively almost eliminate the spatial chirp and improve the beam quality of a high-power Ti:sapphire chirped pulse amplifier system. (paper)

An automated test facility for neutronic amplifiers

International Nuclear Information System (INIS)

Beattie, W.J.

1997-01-01

Neutronic amplifiers are used at the Chalk River Laboratory in applications such as neutron flux monitoring and reactor control systems. Routine preventive maintenance of control and safety systems included annual calibration and characterization of the neutronic amplifiers. An investigation into the traditional methods of annual routine maintenance of amplifiers concluded that frequency and phase response measurements in particular were labour intensive and subject to non-repeatable errors. A decision was made to upgrade testing methods and facilities by using programmable test equipment under the control of a computer. In order to verify the results of the routine measurements, expressions for the transfer functions were derived from the circuit diagrams. Frequency and phase responses were then calculated and plotted thus providing a bench-mark to which the test results can be compared. (author)

Dynamic range meter for radiofrequency amplifiers

Directory of Open Access Journals (Sweden)

Drozd S. S.

2009-04-01

Full Text Available The new measurement setup having increased on 20…30 dB the own dynamic range in comparison with the standard circuit of the dynamic range meter is offered and the rated value of an error bringing by setup in the worst case does not exceed ± 2,8 dB. The measurement setup can be applied also to determinate levels of intermodulation components average power amplifiers and powerful amplifiers of a low-frequency at replacement of the quartz filter on meeting low-frequency the LC-filter and the spectrum analyzer.

Cavity enhanced rephased amplified spontaneous emission

International Nuclear Information System (INIS)

A Williamson, Lewis; J Longdell, Jevon

2014-01-01

Amplified spontaneous emission is usually treated as an incoherent noise process. Recent theoretical and experimental work using rephasing optical pulses has shown that rephased amplified spontaneous emission (RASE) is a potential source of wide bandwidth time-delayed entanglement. Due to poor echo efficiency the plain RASE protocol does not in theory achieve perfect entanglement. Experiments done to date show a very small amount of entanglement at best. Here we show that RASE can, in principle, produce perfect multimode time-delayed two mode squeezing when the active medium is placed inside a Q-switched cavity. (paper)

Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

Science.gov (United States)

Lirman

2000-08-23

Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Fractal statistics of brittle fragmentation

Directory of Open Access Journals (Sweden)

M. Davydova

2013-04-01

Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

Pulse GaAs field transistor amplifier with subnanosecond time transient

International Nuclear Information System (INIS)

Sidnev, A.N.

1987-01-01

Pulse amplifier on fast field effect GaAs transistors with Schottky barrier is described. The amplifier contains four cascades, the first three of which are made on combined transistors on the common-drain circuit. The last cascade is made on high-power field effect GaAs transistor for coordination with 50 ohm load. The amplifier operates within the range of input signals from 0.5 up to 100 mV with repetition frequency up to 16 Hz, The gain of the amplifier is ≅ 20 dB. The setting time at output pulses amplitude up to 1 V constitutes ∼ 0.2 ns

Designing and development of a synchronous analogic amplifier

International Nuclear Information System (INIS)

De la Hoz, E.; Ortiz, A.

1989-01-01

A large number of electronic systems used in the measurement and analysis of weak signals involve a ''lock-in'' amplifier, because it provides an effective method for the recovery of signals buried below a considerable high level of noise. The use of the ''lock-in'' amplifier in our institutions is very limited due to the high expense and the lack of warranties for its maintenance. The purpose of the present work is to design and build a low cost ''lock-in'' amplifier using components available in the local market. Its optimization has allowed us to increase the sensitivity and linearity of the systems, making it very versatile for dedicated applications

On the unlimited gain of a nonlinear parametric amplifier

DEFF Research Database (Denmark)

Sorokin, Vladislav

2014-01-01

The present paper is concerned with analysis of the response of a nonlinear parametric amplifier in abroad range of system parameters, particularly beyond resonance. Such analysis is of particular interestfor micro- and nanosystems, since many small-scale parametric amplifiers exhibit a distinctly...... nonlinearbehavior when amplitude of their response is sufficiently large. The modified method of direct separa-tion of motions is employed to study the considered system. As the result it is obtained that steady-stateamplitude of the nonlinear parametric amplifier response can reach large values in the case...... of arbitrarilysmall amplitude of external excitation, so that the amplifier gain tends to infinity. Very large amplifiergain can be achieved in a broad range of system parameters, in particular when the amplitude of para-metric excitation is comparatively small. The obtained results clearly demonstrate that very...

Rare-Earth Doped Photonic Crystal Fibre Lasers and Amplifiers

DEFF Research Database (Denmark)

Hougaard, Kristian G.

2005-01-01

In this thesis, a theoretical and numerical study of the use of rare-earthdoped photonic crystal fibres as optical amplifiers and lasers, has been performed. Photonic crystal fibres or microstructured optical fibres is a new kind of optical fibre in which the cladding region typically consist....... Their novel properties allow for design of optical fibre amplifiers and fibre lasers with superior performance, compared to solutions based on conventional fibres. The primary applications considered are high efficiency fibre amplifiers based on index guiding photonic crystal fibres, and cladding pumped....... The thesis also presents the basic properties of optical amplification, and describes the numerical model developed to model the behaviour of lasers and amplifiers based on photonic crystal fibres. The developed numerical tools are then used to investigate specific applications of photonic crystal fibres...

BET bromodomain inhibition of MYC-amplified medulloblastoma.

Science.gov (United States)

Bandopadhayay, Pratiti; Bergthold, Guillaume; Nguyen, Brian; Schubert, Simone; Gholamin, Sharareh; Tang, Yujie; Bolin, Sara; Schumacher, Steven E; Zeid, Rhamy; Masoud, Sabran; Yu, Furong; Vue, Nujsaubnusi; Gibson, William J; Paolella, Brenton R; Mitra, Siddhartha S; Cheshier, Samuel H; Qi, Jun; Liu, Kun-Wei; Wechsler-Reya, Robert; Weiss, William A; Swartling, Fredrik J; Kieran, Mark W; Bradner, James E; Beroukhim, Rameen; Cho, Yoon-Jae

2014-02-15

MYC-amplified medulloblastomas are highly lethal tumors. Bromodomain and extraterminal (BET) bromodomain inhibition has recently been shown to suppress MYC-associated transcriptional activity in other cancers. The compound JQ1 inhibits BET bromodomain-containing proteins, including BRD4. Here, we investigate BET bromodomain targeting for the treatment of MYC-amplified medulloblastoma. We evaluated the effects of genetic and pharmacologic inhibition of BET bromodomains on proliferation, cell cycle, and apoptosis in established and newly generated patient- and genetically engineered mouse model (GEMM)-derived medulloblastoma cell lines and xenografts that harbored amplifications of MYC or MYCN. We also assessed the effect of JQ1 on MYC expression and global MYC-associated transcriptional activity. We assessed the in vivo efficacy of JQ1 in orthotopic xenografts established in immunocompromised mice. Treatment of MYC-amplified medulloblastoma cells with JQ1 decreased cell viability associated with arrest at G1 and apoptosis. We observed downregulation of MYC expression and confirmed the inhibition of MYC-associated transcriptional targets. The exogenous expression of MYC from a retroviral promoter reduced the effect of JQ1 on cell viability, suggesting that attenuated levels of MYC contribute to the functional effects of JQ1. JQ1 significantly prolonged the survival of orthotopic xenograft models of MYC-amplified medulloblastoma (P < 0.001). Xenografts harvested from mice after five doses of JQ1 had reduced the expression of MYC mRNA and a reduced proliferative index. JQ1 suppresses MYC expression and MYC-associated transcriptional activity in medulloblastomas, resulting in an overall decrease in medulloblastoma cell viability. These preclinical findings highlight the promise of BET bromodomain inhibitors as novel agents for MYC-amplified medulloblastoma. ©2013 AACR

Chameleon fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

2014-02-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

Chameleon fragmentation

International Nuclear Information System (INIS)

Brax, Philippe; Upadhye, Amol

2014-01-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

Investigation of switching frequency variations in self-oscillating class D amplifiers

OpenAIRE

Nielsen, Dennis; Knott, Arnold; Pfaffinger, Gerhard; Andersen, Michael A. E.

2009-01-01

Class D audio amplifiers have gained significant influence in sound reproduction due to their high efficiency. One of the most commonly used control methods in class D amplifiers is known as self-oscillation. An parameter of key interest in self-oscillating class D amplifiers is the switching frequency, which can be directly related to the performance of the amplifier. This paper will clearify the myth of the switching frequency through investigation of its dependency on modulation index and ...

Model of pulse extraction from a copper laser amplifier

International Nuclear Information System (INIS)

Boley, C.D.; Warner, B.E.

1997-03-01

A computational model of pulse propagation through a copper laser amplifier has been developed. The model contains a system of 1-D (in the axial direction), time-dependent equations for the laser intensity and amplified spontaneous emission (ASE), coupled to rate equations for the atomic levels. Detailed calculations are presented for a high-power amplifier at Lawrence Livermore National Laboratory. The extracted power agrees with experiment near saturation. At lower input power the calculation overestimates experiment, probably because of increased ASE effects. 6 refs., 6 figs

Efficient performance simulation of class D amplifier output stages

DEFF Research Database (Denmark)

Nyboe, Flemming; Risbo, Lars; Andreani, Pietro

2005-01-01

Straightforward simulation of amplifier distortion involves transient simulation of operation on a sine wave input signal, and a subsequent FFT of the output voltage. This approach is very slow on class D amplifiers, since the switching behavior forces simulation time steps that are many orders...... of magnitude smaller than the duration of one period of an audio sine wave. This work presents a method of simulating the amplifier transfer characteristic using a minimum amount of simulation time, and then deriving THD from the results....

Ripple compensation for a class-D amplifier

OpenAIRE

Cox, Stephen M.; du Toit Mouton, Hendrik

2015-01-01

This paper presents the first detailed mathematical analysis of the ripple compensation technique for reducing audio distortion in a class-D amplifier with negative feedback. The amplifier converts a relatively low-frequency audio signal to a high-frequency train of rectangular pulses whose widths are slowly modulated according to the audio signal (pulse-width modulation, PWM). Distortion manifests itself through unwanted audio-frequency harmonics that arise in the output due to nonlinearitie...

Progress on the gyrocon deflection-modulated amplifier

International Nuclear Information System (INIS)

Tallerico, P.J.

1982-01-01

The gyrocon is a high-power deflection-modulated amplifier that can have excellent spatial bunching and, hence, high dc-to-rf conversion efficiency. A program to design and build a prototype amplifier at 450 MHz is discussed. Peak powers of 150 kW and conversion efficiencies of 23% have been measured; the testing program is being pursued to improve this performance. Some possible mechanisms for the difference between the experimental and calculated performance are discussed

A high-power compact regenerative amplifier FEL

International Nuclear Information System (INIS)

Nguyen, D.C.; Sheffield, R.L.; Fortgang, C.M.; Kinross-Wright, J.M.; Ebrahim, N.A.; Goldstein, J.C.

1997-01-01

The Regenerative Amplifier FEL (RAFEL) is a new FEL approach aimed at achieving the highest optical power from a compact rf-linac FEL. The key idea is to feed back a small fraction ( 5 in single pass) wiggler to enable the FEL to reach saturation in a few passes. This paper summarizes the design of a high-power compact regenerative amplifier FEL and describes the first experimental demonstration of the RAFEL concept

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

Radiation hardening techniques for rare-earth based optical fibers and amplifiers

International Nuclear Information System (INIS)

Girard, Sylvain; Marcandella, Claude; Vivona, Marilena; Prudenzano, Luciano Mescia F.; Laurent, Arnaud; Robin, Thierry; Cadier, Benoit; Pinsard, Emmanuel; Ouerdane, Youcef; Boukenter, Aziz; Cannas, Marco; Boscaino, Roberto

2012-01-01

Er/Yb doped fibers and amplifiers have been shown to be very radiation sensitive, limiting their integration in space. We present an approach including successive hardening techniques to enhance their radiation tolerance. The efficiency of our approach is demonstrated by comparing the radiation responses of optical amplifiers made with same lengths of different rare-earth doped fibers and exposed to gamma-rays. Previous studies indicated that such amplifiers suffered significant degradation for doses exceeding 10 krad. Applying our techniques significantly enhances the amplifier radiation resistance, resulting in a very limited degradation up to 50 krad. Our optimization techniques concern the fiber composition, some possible pre-treatments and the interest of simulation tools used to harden by design the amplifiers. We showed that adding cerium inside the fiber phospho-silicate-based core strongly decreases the fiber radiation sensitivity compared to the standard fiber. For both fibers, a pre-treatment with hydrogen permits to enhance again the fiber resistance. Furthermore, simulations tools can also be used to improve the tolerance of the fiber amplifier by helping identifying the best amplifier configuration for operation in the radiative environment. (authors)

Effects of gamma radiation on commercial operational amplifiers

International Nuclear Information System (INIS)

Claro, Luiz H.; Santos, Jose A. dos

2009-01-01

The operational amplifiers are widely used in nuclear instrumentation. Their applications span the signal conditioning circuits, analog instrumentation, amplifiers, converters, oscillators and others. If an operational amplifier is used to work in a radiation environment, the device suffers degradation in its performance leading to the bad work in the systems. Some of these devices are designed as rad-hard components and therefore the effects of radiation damage are minimized, however its main disadvantage is the high cost and difficult to find in the market. As an alternative one can use the conventional electronic components available in the market and named COTS (Commercially Available Off-The-Shelf) but they must be tested under a radiation environment. In this work the effect of the radiation damage is studied in two typical operational amplifiers. Some electric parameters of these devices were measured for different gamma radiation doses and they were working at different input signal frequencies. A 60 Co isotopic radiation source was used and the results show that there is a certain degradation of the device depending on the radiation absorbed dose. (author)

Bandwidth limitations in current mode and voltage mode integrated feedback amplifiers

DEFF Research Database (Denmark)

Bruun, Erik

1995-01-01

loop bandwidth remains constant for a feedback amplifier. The constant-bandwidth relations of such amplifier designs are reviewed in this paper and they are combined with the constraints imposed by technology when the feedback amplifier is to be designed in an integrated technology. From this analysis...

Using MEMS Capacitive Switches in Tunable RF Amplifiers

Directory of Open Access Journals (Sweden)

Danson John

2006-01-01

Full Text Available A MEMS capacitive switch suitable for use in tunable RF amplifiers is described. A MEMS switch is designed, fabricated, and characterized with physical and RF measurements for inclusion in simulations. Using the MEMS switch models, a dual-band low-noise amplifier (LNA operating at GHz and GHz, and a tunable power amplifier (PA at GHz are simulated in m CMOS. MEMS switches allow the LNA to operate with 11 dB of isolation between the two bands while maintaining dB of gain and sub- dB noise figure. MEMS switches are used to implement a variable matching network that allows the PA to realize up to 37% PAE improvement at low input powers.

Electronically Tunable Transimpedance Instrumentation Amplifier Based on OTRA

Directory of Open Access Journals (Sweden)

Rajeshwari Pandey

2013-01-01

Full Text Available Operational transresistance amplifier (OTRA is the most suitable analog building block (ABB for transimpedance type signal processing due to its very nature of current input and voltage output. In this paper, OTRA-based transimpedance instrumentation amplifier (TIA is presented. It provides high differential gain and bandwidth, which is independent of gain. It also offers high common-mode rejection ratio (CMRR. The amplifier gain can be controlled electronically by implementing resistors using MOS transistors operating in linear region. The circuit can be made fully integrated. The proposed circuit is insensitive to parasitic input capacitances and input resistances due to the internally grounded input terminals of OTRA. Theoretical analysis is verified through PSPICE simulations and experimentation.

Universality of projectile fragmentation model

International Nuclear Information System (INIS)

Chaudhuri, G.; Mallik, S.; Das Gupta, S.

2012-01-01

Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

Science.gov (United States)

Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

2017-10-23

The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

[Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

Science.gov (United States)

Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

2015-08-01

In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

Microwave amplifier and active circuit design using the real frequency technique

CERN Document Server

Jarry, Pierre

2016-01-01

This book focuses on the authors' Real Frequency Technique (RFT) and its application to a wide variety of multi-stage microwave amplifiers and active filters, and passive equalizers for radar pulse shaping and antenna return loss applications. The first two chapters review the fundamentals of microwave amplifier design and provide a description of the RFT. Each subsequent chapter introduces a new type of amplifier or circuit design, reviews its design problems, and explains how the RFT can be adapted to solve these problems. The authors take a practical approach by summarizing the design steps and giving numerous examples of amplifier realizations and measured responses. Provides a complete description of the RFT as it is first used to design multistage lumped amplifiers using a progressive optimization of the equalizers, leading to a small umber of parameters to optimize simultaneously Presents modifications to the RFT to design trans-impedance microwave amplifiers that are used for photodiodes acti...

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

Science.gov (United States)

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Investigation of switching frequency variations in self-oscillating class D amplifiers

DEFF Research Database (Denmark)

Nielsen, Dennis; Knott, Arnold; Pfaffinger, Gerhard

2009-01-01

Class D audio amplifiers have gained significant influence in sound reproduction due to their high efficiency. One of the most commonly used control methods in class D amplifiers is known as self-oscillation. An parameter of key interest in self-oscillating class D amplifiers is the switching fre...

Empirical multichannel power consumption model for erbium-doped fiber amplifiers

DEFF Research Database (Denmark)

Saldaña Cercos, Silvia; de Paiva, Getulio E. R.; Argentato, Marcio Colazza

2015-01-01

In this paper we report on the first experimental power consumption analysis and model of single and multi-stage booster erbium-doped fiber amplifiers (EDFAs) with automatic gain control (AGC), accounting for channel number dependency. Results show that the amount of channels being amplified simu......-users, it is relevant to study channel number dependent power consumption for devising EDFA power efficient control and design.......In this paper we report on the first experimental power consumption analysis and model of single and multi-stage booster erbium-doped fiber amplifiers (EDFAs) with automatic gain control (AGC), accounting for channel number dependency. Results show that the amount of channels being amplified...... simultaneously contributes significantly, up to 48%, to the total power consumption due to the circuitry used for controlling the EDFA. As the number of simultaneous amplified WDM channels in high capacity long and medium reach transmission links reflects closely traffic patterns generated by end...

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Analysis and evaluation of the power amplifier device

Energy Technology Data Exchange (ETDEWEB)

Kim, Y. K.; Ryu, J. W. [Kongju National University, Gongju (Korea, Republic of)

2011-11-15

We developed a master oscillator power amplifier (MOPA) type fiber amplifier for the separation of the Ca-48 isotope by using a fiber laser. The ytterbium (Yb)-doped end-capped rod-type photonic crystal fiber (PCF) was used as a gain medium of MOPA amplifier. The PCFs used in our experiments were a 56-cm and an 81-cm rod-type end-capped Yb-doped double-clad PM fibers 'DC-285/100-PM-Yb-Rod', with a 100-{mu}m core (NA 0.02) and a 285-{mu}m cladding (NA 0.6) fabricated by NKT Photonics. The mode field diameter (MFD) of the rod-type PCF was 75-{mu}m, and an absorption efficiency of 30 dB/m at 976 nm and a low NA 0.02 helped to sustain the excellent lasing beam quality. We obtained an output power of 112 W at a pump power of 380 W with a repetition rate of 150 kHz. The measured pulse width was 13 ns at 150 kHz, 1056 nm. The laser beam quality shows a single mode amplification characteristics with a beam quality factor values of M2 are 2 -3. The PCF launching efficiency reached a maximum value of 86.7% with an average efficiencies of above 80%. At a pump power of 250 W and seed power input of 4 W, the CW PCF amplifier was found to generate average output powers of 138 W, 110 W, and 82 W at 1056-nm, 1070-nm, and 1089-nm wavelengths, respectively. The amplified PCF output beam had a line width of 70 MHz full width at half maximum (FWHM). These PCF amplified beams had good beam qualities with M2values of less than 1.8 at all three wavelengths. The gain saturation seed input power in the 81-cm PCF was found to be {approx}6 W at 1056 nm. The temperature of the PCF core reached over 230 .deg. C at the pumping section of the PCF. The temperatures of the end-cap heads on both the pumping and the output end-cap sides were 81.4 .deg. C and 35.7 .deg. C, respectively. The PCF amplifier maintained good polarization mode characteristics with an average DOP of over 87%. The slight decrease in the DOP oat output powers over 170 W output power may have been caused by a

Development of microwave amplifier based on gallium nitride semiconductor structures

International Nuclear Information System (INIS)

Pavlov, D.Yi.; Prokopenko, O.V.; Tsvyirko, Yu.A.; Pavlov, Yi.L.

2014-01-01

Microwave properties of microwave amplifier based on gallium nitride (GN) semiconductor structures has been calculated numerically. We proposed the method of numerical calculation of device. This method is accurately sets the value of its characteristics depending on the elements that are used in design of amplifier. It is shown that the device based on GN HEMT-transistors could have amplification factor about 50 dB, while its sizes are 27x18x5.5 mm 3 . Also was provided the absolute stability an amplifier in the whole operating frequency range. It is quite important when using this type of amplifiers in different conditions of exploitation and various fields of use the radioelectronic equipment

Self-organized criticality in fragmenting

DEFF Research Database (Denmark)

Oddershede, L.; Dimon, P.; Bohr, J.

1993-01-01

The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

New Packaging for Amplifier Slabs

Energy Technology Data Exchange (ETDEWEB)

Riley, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Thorsness, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Suratwala, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Steele, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rogowski, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2015-03-18

The following memo provides a discussion and detailed procedure for a new finished amplifier slab shipping and storage container. The new package is designed to maintain an environment of <5% RH to minimize weathering.

Energy production using fission fragment rockets

International Nuclear Information System (INIS)

Chapline, G.; Matsuda, Y.

1991-08-01

Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

Directional amplifier in an optomechanical system with optical gain

Science.gov (United States)

Jiang, Cheng; Song, L. N.; Li, Yong

2018-05-01

Directional amplifiers are crucial nonreciprocal devices in both classical and quantum information processing. Here we propose a scheme for realizing a directional amplifier between optical and microwave fields based on an optomechanical system with optical gain, where an active optical cavity and two passive microwave cavities are coupled to a common mechanical resonator via radiation pressure. The two passive cavities are coupled via hopping interaction to facilitate the directional amplification between the active and passive cavities. We obtain the condition of achieving optical directional amplification and find that the direction of amplification can be controlled by the phase differences between the effective optomechanical couplings. The effects of the gain rate of the active cavity and the effective coupling strengths on the maximum gain of the amplifier are discussed. We show that the noise added to this amplifier can be greatly suppressed in the large cooperativity limit.

Deep UV light generation by a fiber/bulk hybrid amplifier at 199 nm

International Nuclear Information System (INIS)

Urata, Yoshiharu; Shinozaki, Tatsuya; Wada, Yoshio; Kaneda, Yushi; Wada, Satoshi; Imai, Shinichi

2009-01-01

A high-pulse-repetition-frequency (PRF) pulsed light source in the deep ultraviolet region has been realized by a multiple wavelength conversion technique using a hybrid fiber/bulk amplifier system. Output of 199 nm with a power of 50 mW was achieved at 2.4 MHz PRF. The 1 μm amplifier consisted of a Yb-doped fiber amplifier and a Nd-doped YVO4 amplifier. A 1.5 μm fiber master-oscillator power amplifier was employed as the other fundamental source. The amplifiers exhibited good amplification properties in pulse energy, polarization extinction ratio, and spectrum for nonlinear wavelength conversion

Fragmentation of relativistic nuclei

International Nuclear Information System (INIS)

Cork, B.

1975-06-01

Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

A high performance electrometer amplifier of hybrid design

International Nuclear Information System (INIS)

Rao, N.V.; Nazare, C.K.

1979-01-01

A high performance, reliable, electrometer amplifier of hybrid design for low current measurements in mass spectrometers has been developed. The short term instability with a 5 x 10 11 ohms input resistor is less than 1 x 10sup(-15) Amp. The drift is better than 1 mV/hour. The design steps are illustrated with a typical amplifier performance details. (auth.)

Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

Energy Technology Data Exchange (ETDEWEB)

Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1965-07-01

This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

Thermodynamics of the fuel fragmentation gas

International Nuclear Information System (INIS)

Perez, R.B.; Alsmiller, R.G. Jr.

1977-01-01

In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

Embedded control system for high power RF amplifiers

International Nuclear Information System (INIS)

Sharma, Deepak Kumar; Gupta, Alok Kumar; Jain, Akhilesh; Hannurkar, P.R.

2011-01-01

RF power devices are usually very sensitive to overheat and reflected RF power; hence a protective interlock system is required to be embedded with high power solid state RF amplifiers. The solid state RF amplifiers have salient features of graceful degradation and very low mean time to repair (MTTR). In order to exploit these features in favour of lowest system downtime, a real-time control system is embedded with high power RF amplifiers. The control system is developed with the features of monitoring, measurement and network publishing of various parameters, historical data logging, alarm generation, displaying data to the operator and tripping the system in case of any interlock failure. This paper discusses the design philosophy, features, functions and implementation details of the embedded control system. (author)

A second-order class-D audio amplifier

OpenAIRE

Cox, Stephen M.; Tan, M.T.; Yu, J.

2011-01-01

Class-D audio amplifiers are particularly efficient, and this efficiency has led to their ubiquity in a wide range of modern electronic appliances. Their output takes the form of a high-frequency square wave whose duty cycle (ratio of on-time to off-time) is modulated at low frequency according to the audio signal. A mathematical model is developed here for a second-order class-D amplifier design (i.e., containing one second-order integrator) with negative feedback. We derive exact expression...

Modeling Distortion Effects in Class-D Amplifier Filter Inductors

DEFF Research Database (Denmark)

Knott, Arnold; Stegenborg-Andersen, Tore; Thomsen, Ole Cornelius

2010-01-01

Distortion is generally accepted as a quantifier to judge the quality of audio power amplifiers. In switchmode power amplifiers various mechanisms influence this performance measure. After giving an overview of those, this paper focuses on the particular effect of the nonlinearity of the output f...

Switching-mode Audio Power Amplifiers with Direct Energy Conversion

DEFF Research Database (Denmark)

Ljusev, Petar; Andersen, Michael Andreas E.

2005-01-01

has been replaced with a high frequency AC link. When compared to the conventional Class D amplifiers with a separate DC power supply, the proposed single conversion stage amplifier provides simple and compact solution with better efficiency and higher level of integration, leading to reduced...

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Models of fragmentation with composite power laws

Science.gov (United States)

Tavassoli, Z.; Rodgers, G. J.

1999-06-01

Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

Kinetics of fragmentation-annihilation processes

OpenAIRE

Filipe, JAN; Rodgers, GJ

1996-01-01

We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

Fission fragment spins and spectroscopy

International Nuclear Information System (INIS)

Durell, J.L.

1988-01-01

Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

MODEL ZA POVEĆANJE IZDRŽLJIVOSTI KANDIDATKINJA ZA PRIJEMNI ISPIT FAKULTETA SPORTA I FIZIČKOG VASPITANJA

Directory of Open Access Journals (Sweden)

Milan Šolaja

2008-08-01

Full Text Available In order to increase aerobic capacity and the level of endurance while running it is neccessary to apply efficient methods for increasing abilities already mentioned. One of the ways which gradually introduces those who exercise into the practise is to set the tempo of running at a level 20% higher than the current abilities for the whole lenght of a distance , and the lenght of the running sections should be about 20 % of the entire lenght of the distance. Total amount of the running sections should be 20 % longer than the lenght of the entire distance. The lenght of each section should be gradually increased , and breakes should be gradually decreased. The speed of running is obtained and those who exercise are adapted to the tempo of running , which results in rapid development of the adaptation to increased efforts. This makes possible to achieve statisticly significant increasement of endurance in running 800 meters in a short period of time , in just four weeks , with three trainings per week. The advantage of this model is that it could be used for rapid increasement of running endurance in number of sport disciplines.

Amplifying mirrors with saturated gain without and with a resonator

DEFF Research Database (Denmark)

Skettrup, Torben

2007-01-01

An investigation of amplifying mirrors with a view to their use in resonator structures has been performed. Both non-saturated and saturated amplifying mirrors are demonstrated. It was found that relatively high values of gain (typical 5-10 times) can be obtained even when saturation is taken...... into account. Several resonator structures containing from two up to four mirrors, some including beamsplitters, are investigated. It was found that the gain to a first approximation depends only on the ratio between the pumping power and the input power on the amplifying mirror. It was also found...... that the configuration with four mirrors is well suited as an amplifier device working as an optical transistor since high values of gain up to 40 times could be obtained....

Development of high sensitivity transimpedance amplifier module for self powered neutron detectors

International Nuclear Information System (INIS)

Khan, T.K.; Tamboli, P.K.; Antony, J.; Balasubramanian, R.; Agilandaeswari, K.; Pramanik, M.

2010-01-01

This paper describes design and development of a Transimpedance Amplifier for amplification of very low current from in core Self Powered Neutron Detectors (SPND). Measurement of neutron flux is very important for operation, control and protection of Nuclear Power Plant (NPP). SPND is used to measure Reactor incore flux/power. Based on sensitivity of emitter material used in SPND, pitch length and neutron flux (power level); the current output from SPND varies from few pA to few μA. The described amplifier is suitable to use for this current range. The amplifier provides a very high gain using a resistive T network feedback topology. The amplifier is designed in two stages using ultra low bias current FET OPAMPs. Design of Transimpedance amplifier is carefully done to include ultra low input bias current, low offset voltage and noise. The amplifier has in built test facility for calibration and on line test facility for measurement of insulation resistance (IR). The amplifier module has on board isolated DC-DC converter circuit complying MIL/STD/461C/D which generate isolated +/-15V and +12V supply to provide parameter to parameter ground isolation and independence among each module/signal.The output from the amplifier is 0V to 6V for 0 to 150%FP. The design is simulated in computer and amplifier used at TAPS-3 was modified as per new design and has been tested at TAPS-3 site. The amplifier performed satisfactorily. The results showed that the IR measurement technique adopted in the design can tolerate lower IR of SPND in existing design. (author)

DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

African Journals Online (AJOL)

We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

Transimpedance Amplifier for MEMS SAW Oscillator in 1.4GHz

Science.gov (United States)

Kamarudin, N.; Karim, J.; Hussin, H.

2018-03-01

This work is to design a transimpedance amplifier for MEMS SAW resonator to achieve low power consumption at desired frequency. A transimpedance amplifier is designed and characterized for MEMS SAW resonator in 0.18μm CMOS process. The transimpedance amplifier achieves gain is 31 dBΩ at 176°. The power consume by oscillator is 0.6mW at VDD 1.8V while phase noise at -133.97dBc/Hz at 10kHz.

C.A.D for broad-band multistage microwave transimpedance amplifier.

OpenAIRE

Olomo Ngongo, A.; Perennec, A.; Soares, R.; Jarry, P.

1992-01-01

In high data rate optical-fiber, it is necessary to employ an ultra broad-band transimpedance amplifier. In this paper, we present a technique for the design of a transimpedance amplifiers. It can be applied as well to the design of interstage equalizers for microwave transimpedance amplifiers. In the version described in this paper, the optimisation process is applied to the transimpedance gain and noise which is adjusted. Based on the load charge matching technique, a sequential procedure t...

Linear Distributed GaN MMIC Power Amplifier with Improved Power-added Efficiency

Science.gov (United States)

2017-03-01

QPSK LTE waveform, the ACPR1improved by ~10 dBc at average output power of 23 dBm, without digital pre-distortion. Keywords: GaN, linear amplifiers...wideband amplifier, OIP3, LTE Introduction RF communications with spectral efficiency utilizes complex modulation schemes that require amplifier...wideband amplifiers remain. In this paper, we report on the measured CW performance of a multi-octave (100 MHz ‒ 8 GHz) GaN MMIC NDPA fabricated with

Nuclear magnetic resonance experiments with dc SQUID amplifiers

International Nuclear Information System (INIS)

Heaney, M.B.

1990-11-01

The development and fabrication of dc SQUIDs (Superconducting QUantum Interference Devices) with Nb/Al 2 O 3 /Nb Josephson junctions is described. A theory of the dc SQUID as a radio-frequency amplifier is presented, with an optimization strategy that accounts for the loading and noise contributions of the postamplifier and maximizes the signal-to-noise ratio of the total system. The high sensitivity of the dc SQUID is extended to high field NMR. A dc SQUID is used as a tuned radio-frequency amplifier to detect pulsed nuclear magnetic resonance at 32 MHz from a metal film in a 3.5 Tesla static field. A total system noise temperature of 11 K has been achieved, at a bath temperature of 4.2 K. The minimum number of nuclear Bohr magnetons observable from a free precession signal after a single pulse is about 2 x 10 17 in a bandwidth of 25 kHz. In a separate experiment, a dc SQUID is used as a rf amplifier in a NQR experiment to observe a new resonance response mechanism. The net electric polarization of a NaClO 3 crystal due to the precessing electric quadrupole moments of the Cl nuclei is detected at 30 MHz. The sensitivity of NMR and NQR spectrometers using dc SQUID amplifiers is compared to the sensitivity of spectrometers using conventional rf amplifiers. A SQUID-based spectrometer has a voltage sensitivity which is comparable to the best achieved by a FET-based spectrometer, at these temperatures and operating frequencies

Design of a transimpedance amplifier for a bio-optical fiber sensor

International Nuclear Information System (INIS)

Pola, L.; Camasa, J.; Gomez B, J.

2012-01-01

In this work we present a fairly detailed model for a photodiode coupled to an operational amplifier in the trans impedance circuit configuration, for the applications in Biotechnology. An optical signal of the fiber optic biosensor is detected by a photodiode and its photocurrent generated is introduced in the trans impedance amplifier. The proposed design uses a photodiode in photovoltaic mode, and its photocurrent is coupled to an amplifier with positive output. Finally, the trans impedance amplifier presents reliable design characteristics such as accuracy, stability, low noise, and the ability to measure photocurrent from 1nA to 100μA. (Author)

Fragmentation of atomic clusters: A theoretical study

International Nuclear Information System (INIS)

Lopez, M.J.; Jellinek, J.

1994-01-01

Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

Current-Driven Switch-Mode Audio Power Amplifiers

DEFF Research Database (Denmark)

Knott, Arnold; Buhl, Niels Christian; Andersen, Michael A. E.

2012-01-01

The conversion of electrical energy into sound waves by electromechanical transducers is proportional to the current through the coil of the transducer. However virtually all audio power amplifiers provide a controlled voltage through the interface to the transducer. This paper is presenting...... a switch-mode audio power amplifier not only providing controlled current but also being supplied by current. This results in an output filter size reduction by a factor of 6. The implemented prototype shows decent audio performance with THD + N below 0.1 %....

Reflection amplifiers in self-regulated learning

NARCIS (Netherlands)

Verpoorten, Dominique

2012-01-01

Verpoorten, D. (2012). Reflection amplifiers in self-regulated learning. Doctoral thesis. November, 9, 2012, Heerlen, The Netherlands: Open Universiteit (CELSTEC). Datawyse / Universitaire Pers Maastricht.

A digitally assisted, signal folding neural recording amplifier.

Science.gov (United States)

Chen, Yi; Basu, Arindam; Liu, Lei; Zou, Xiaodan; Rajkumar, Ramamoorthy; Dawe, Gavin Stewart; Je, Minkyu

2014-08-01

A novel signal folding and reconstruction scheme for neural recording applications that exploits the 1/f(n) characteristics of neural signals is described in this paper. The amplified output is 'folded' into a predefined range of voltages by using comparison and reset circuits along with the core amplifier. After this output signal is digitized and transmitted, a reconstruction algorithm can be applied in the digital domain to recover the amplified signal from the folded waveform. This scheme enables the use of an analog-to-digital convertor with less number of bits for the same effective dynamic range. It also reduces the transmission data rate of the recording chip. Both of these features allow power and area savings at the system level. Other advantages of the proposed topology are increased reliability due to the removal of pseudo-resistors, lower harmonic distortion and low-voltage operation. An analysis of the reconstruction error introduced by this scheme is presented along with a behavioral model to provide a quick estimate of the post reconstruction dynamic range. Measurement results from two different core amplifier designs in 65 nm and 180 nm CMOS processes are presented to prove the generality of the proposed scheme in the neural recording applications. Operating from a 1 V power supply, the amplifier in 180 nm CMOS has a gain of 54.2 dB, bandwidth of 5.7 kHz, input referred noise of 3.8 μVrms and power dissipation of 2.52 μW leading to a NEF of 3.1 in spike band. It exhibits a dynamic range of 66 dB and maximum SNDR of 43 dB in LFP band. It also reduces system level power (by reducing the number of bits in the ADC by 2) as well as data rate to 80% of a conventional design. In vivo measurements validate the ability of this amplifier to simultaneously record spike and LFP signals.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

Science.gov (United States)

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2014-10-01

Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

Science.gov (United States)

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Subjective test of class D amplifiers without output filter

DEFF Research Database (Denmark)

Agerkvist, Finn T.; Fenger, Lars M.

2004-01-01

This paper presents the results of subjective listening tests designed to determine whether the output filter on class D amplifiers used in active loudspeakers can be omitted without audible errors occurring. The frequency range of the amplifiers was limited to 0-3 kHz corresponding to a woofer...

47 CFR 2.815 - External radio frequency power amplifiers.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false External radio frequency power amplifiers. 2... AND RADIO TREATY MATTERS; GENERAL RULES AND REGULATIONS Marketing of Radio-frequency Devices § 2.815 External radio frequency power amplifiers. (a) As used in this part, an external radio frequency power...

Gain characteristics of a saturated fiber optic parametric amplifier

DEFF Research Database (Denmark)

Rottwitt, Karsten; Lorenzen, Michael Rodas; Noordegraaf, Danny

2008-01-01

In this work we discuss saturation performance of a fiber optic parametric amplifier. A simple numerical model is described and applied to specific cases. A system experiment using a saturated amplifier illustrates a 4 dB improvement in required signal to noise ratio for a fixed bit error ratio....

Amplified fragment length polymorphism (AFLP) and genealogy ...

African Journals Online (AJOL)

STORAGESEVER

2010-06-07

Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

Design and performance of the main amplifier system for the National Ignition Facility

International Nuclear Information System (INIS)

Beullier, J; Erlandson, A; Grebot, E; Guenet, J; Guenet, M; Horvath, J; Jancaitis, K; Larson, D; Lawson, J; LeTouze, G; Maille, X; Manes, K; Marshall, C; Mengue, T; Moor, E; Payne, S; Pedrotti, L; Rotter, M; Seznec, S; Sutton, S; Zapata, L.

1999-01-01

This paper describes the design and performance of flashlamp-pumped, Nd:glass. Brewster-angle slab amplifiers intended to be deployed in the National Ignition Facility (NIF). To verify performance, we tested a full-size, three-slab-long, NIF prototype amplifier, which we believe to be the largest flashlamp-pumped Nd:glass amplifier ever assembled. Like the NIF amplifier design, this prototype amplifier had eight 40-cm-square apertures combined in a four-aperture-high by two-aperture-wide matrix. Specially-shaped reflectors, anti-reflective coatings on the blastshields, and preionized flashlamps were used to increase storage efficiency. Cooling gas was flowed over the flashlamps to remove waste pump heat and to accelerate thermal wavefront recovery. The prototype gain results are consistent with model predictions and provide high confidence in the final engineering design of the NIF amplifiers. Although the dimensions, internal positions, and shapes of the components in the NIF amplifiers will be slightly different from the prototype, these differences are small and should produce only slight differences in amplifier performance

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

Detection of weak optical signals with a laser amplifier

International Nuclear Information System (INIS)

Kozlovskii, A. V.

2006-01-01

Detection of weak and extremely weak light signals amplified by linear and four-wave mixing laser amplifiers is analyzed. Photoelectron distributions are found for different input photon statistics over a wide range of gain. Signal-to-noise ratios are calculated and analyzed for preamplification schemes using linear and four-wave mixing amplifiers. Calculations show that the high signal-to-noise ratio (much higher than unity), ensuring reliable detection of weak input signals, can be attained only with a four-wave mixing preamplification scheme. Qualitative dependence of the signal-to-noise ratio on the quantum statistical properties of both signal and idler waves is demonstrated

Photon-hadron fragmentation: theoretical situation

International Nuclear Information System (INIS)

Peschanski, R.

1983-07-01

Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

Cryogenic transimpedance amplifier for micromechanical capacitive sensors.

Science.gov (United States)

Antonio, D; Pastoriza, H; Julián, P; Mandolesi, P

2008-08-01

We developed a cryogenic transimpedance amplifier that works at a broad range of temperatures, from room temperature down to 4 K. The device was realized with a standard complementary metal oxide semiconductor 1.5 mum process. Measurements of current-voltage characteristics, open-loop gain, input referred noise current, and power consumption are presented as a function of temperature. The transimpedance amplifier has been successfully applied to sense the motion of a polysilicon micromechanical oscillator at low temperatures. The whole device is intended to serve as a magnetometer for microscopic superconducting samples.

Recent progress on perturbative QCD fragmentation functions

International Nuclear Information System (INIS)

Cheung, K.

1995-05-01

The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

Low Loss Nanostructured Polymers for Chip-scale Waveguide Amplifiers.

Science.gov (United States)

Chen, George F R; Zhao, Xinyu; Sun, Yang; He, Chaobin; Tan, Mei Chee; Tan, Dawn T H

2017-06-13

On-chip waveguide amplifiers offer higher gain in small device sizes and better integration with photonic devices than the commonly available fiber amplifiers. However, on-chip amplifiers have yet to make its way into the mainstream due to the limited availability of materials with ideal light guiding and amplification properties. A low-loss nanostructured on-chip channel polymeric waveguide amplifier was designed, characterized, fabricated and its gain experimentally measured at telecommunication wavelength. The active polymeric waveguide core comprises of NaYF 4 :Yb,Er,Ce core-shell nanocrystals dispersed within a SU8 polymer, where the nanoparticle interfacial characteristics were tailored using hydrolyzed polyhedral oligomeric silsesquioxane-graft-poly(methyl methacrylate) to improve particle dispersion. Both the enhanced IR emission intensity from our nanocrystals using a tri-dopant scheme and the reduced scattering losses from our excellent particle dispersion at a high solid loading of 6.0 vol% contributed to the outstanding optical performance of our polymeric waveguide. We achieved one of the highest reported gain of 6.6 dB/cm using a relatively low coupled pump power of 80 mW. These polymeric waveguide amplifiers offer greater promise for integrated optical circuits due to their processability and integration advantages which will play a key role in the emerging areas of flexible communication and optoelectronic devices.

Fragmentation and flow in central collisions

International Nuclear Information System (INIS)

Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

1987-01-01

Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

Science.gov (United States)

David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

2010-01-01

Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

Mass spectrometry for fragment screening.

Science.gov (United States)

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

Science.gov (United States)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

Two-section semiconductor optical amplifier used as an efficient channel dropping node

DEFF Research Database (Denmark)

Jørgensen, Carsten; Storkfelt, Niels; Durhuus, T.

1992-01-01

High responsivity in a two-section semiconductor optical amplifier/detector, serving as a channel dropping mode is described. A simple receiver constructed using a 50 Ω amplifier with a sensitivity of -30.2 dBm at 140 Mb/s is demonstrated......High responsivity in a two-section semiconductor optical amplifier/detector, serving as a channel dropping mode is described. A simple receiver constructed using a 50 Ω amplifier with a sensitivity of -30.2 dBm at 140 Mb/s is demonstrated...

Diode-pumped laser amplifiers: application to 0.946 {mu}m Nd:YAG

Energy Technology Data Exchange (ETDEWEB)

Barnes, Norman P [NASA Langley Research Center, Hampton, VA 23681 (United States); Axenson, Theresa J [Science and Technology Corporation, 10 Basil Sawyer Drive, Hampton, VA 23666 (United States); Jr, Donald J Reichle [NASA Langley Research Center, Hampton, VA 23681 (United States); Walsh, Brian M [NASA Langley Research Center, Hampton, VA 23681 (United States)

2003-03-14

A diode-pumped laser amplifier model is derived from first principles and applied to a Nd:YAG amplifier operating on the {sup 4}F{sub 3/2} to {sup 4}I{sub 9/2} transition at 0.946 {mu}m. The effects of amplified spontaneous emission are included in the model and the addition of this effect is shown to produce better agreement with the data. The amplifier model includes effects of the transverse and longitudinal variation of the pump beam, transverse and longitudinal variation of the probe beam, and multiple passes of the probe beam. Experimental results obtained with a quasi four-level Nd:YAG amplifier operating at 0.946 {mu}m are used to validate the model. The amplifier was evaluated as a function of the pump energy, the probe energy, the probe beam radius, the pulse repetition frequency and the temperature. For all of the experimental conditions, the experimental results and the model agree.

High efficiency class-I audio power amplifier using a single adaptive supply

International Nuclear Information System (INIS)

Peng Zhenfei; Yang Shanshand; Feng Yong; Hong Zhiliang; Liu Yang

2012-01-01

A high efficiency class-I linear audio power amplifier (PA) with an adaptive supply is presented. Its efficiency is improved by a dynamic supply to reduce the power transistors' voltage drop. A gain compression technique is adopted to make the amplifier accommodate a single positive supply. Circuit complicity and chip area are reduced because no charge pump is necessary for the negative supply. A common shared mode voltage and a symmetric layout pattern are used to minimize the non-linearity. A peak efficiency of 80% is reached at peak output power. The measured THD+N before and after the supply switching point are 0.01% and 0.05%, respectively. The maximum output power is 410 mW for an 8 Ω speaker load. Unlike switching amplifiers, the class-I amplifier operates as a linear amplifier and hence has a low EMI. The advantage of a high efficiency and low EMI makes the class-I amplifier suitable for portable and RF sensitive applications. (semiconductor integrated circuits)

Physics of projectile fragments

International Nuclear Information System (INIS)

Minamisono, Tadanori

1982-01-01

This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

New Research on Bronze Age Textile Production

DEFF Research Database (Denmark)

Andersson, Eva Birgitta; Mårtensson, Linda; Nosch, Marie-Louise Bech

2008-01-01

presentation of the results from the systematic tests with Bronze Age textile tools. results concerning mesurements of lenght and time consumed.......presentation of the results from the systematic tests with Bronze Age textile tools. results concerning mesurements of lenght and time consumed....

Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

Science.gov (United States)

Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

2015-01-01

Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

Asymmetric gain-saturated spectrum in fiber optical parametric amplifiers

DEFF Research Database (Denmark)

Lali-Dastjerdi, Zohreh; Rottwitt, Karsten; Galili, Michael

2012-01-01

We demonstrate experimentally and numerically an unexpected spectral asymmetry in the saturated-gain spectrum of single-pump fiber optical parametric amplifiers. The interaction between higher-order four-wave mixing products and dispersive waves radiated as an effect of third-order dispersion inf...... characteristics of the amplifier and shows local maxima for specific dispersion values....

KrF laser amplifier with phase-conjugate Brillouin retroreflectors.

Science.gov (United States)

Gower, M C

1982-09-01

We have demonstrated the use of phase-conjugate stimulated Brillouin scattering mirrors to produce high-quality, short-pulse KrF laser beams from angular multiplexed and regenerative amplifiers. The mirror was also shown to isolate systems optically from amplifier spontaneous emission. Automatic alignment of targets using this mirror as a retroreflector was also demonstrated.

Prototype disc amplifier for Iskra-6 facility

International Nuclear Information System (INIS)

Grigorovich, S.V.; Eroshenko, V.F.; Krotov, V.A.; Demidov, V.L.; Kalinin, N.V.; Kurunov, R.F.; Smirnov, V.G.; Fomin, V.M.

2006-01-01

Eight-channel disk amplifiers of the ISKRA-6 facility are made up of sections. An amplifier section consists of eight active elements (2*4) made of KGSS-0180/35-grade neodymium phosphate glass 400*690*40 mm in size located in frames at the Brewster angle. Twenty flash-lamps are arranged in one amplifier module. The flash-lamps have an inter electrode distance of 1600 mm, the tube is 40 mm in inner diameter. The results of numerical investigations into the dynamics of high-current pulse radiation discharge are presented. The investigations were carried out by the 1-dimensional RMHD-model. This model takes into account the transient processes in the electric circuit and the physical processes in the discharge plasma: ionization, Joule heating, thermal conductivity, radiation transfer and plasma motion caused by the non-uniformity of energy introduction into the discharge in case of a non-uniform initial ionization of gas in the pumping lamp. The experimental results of spectral measurements and light efficiency of the flash-lamps depending on specific power and value of energy contribution are presented

Influence of mode competition on beam quality of fiber amplifier

International Nuclear Information System (INIS)

Xiao Qi-Rong; Yan Ping; Sun Jun-Yi; Chen Xiao; Ren Hai-Cui; Gong Ma-Li

2014-01-01

Theoretical and experimental studies of the influence of the mode competition on the output beam quality of fiber amplifiers are presented. Rate equations and modal decomposition method are used in the theoretical model. In the experiment, the output beam-quality factor of a fiber amplifier, which is based on a Yb-doped double-clad large mode area fiber as a function of the seed beam quality and the pump power of the amplifier, is measured. The experimental results are consistent with the theoretical analysis. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Minimizing Crosstalk in Self Oscillating Switch Mode Audio Power Amplifiers

DEFF Research Database (Denmark)

Knott, Arnold; Ploug, Rasmus Overgaard

2012-01-01

a method to minimize this phenomenon by improving the integrity of the various power distribution systems of the amplifier. The method is then applied to an amplifier built for this investigation. The results show that the crosstalk is suppressed with 30 dB, but is not entirely eliminated......The varying switching frequencies of self oscillating switch mode audio amplifiers have been known to cause interchannel intermodulation disturbances in multi channel configurations. This crosstalk phenomenon has a negative impact on the audio performance. The goal of this paper is to present...

Research on disk amplifiers as polarizer of electro-optical switch

CERN Document Server

Zheng Kui Xing; Feng Bin; Zheng Jian; Dong Yun; Peng Zhi Tao; Lu Jing Ping; Jing Feng; Wei Xiao Feng

2002-01-01

It benefits to decrease the engineering cost and to debase the technical crisis by the polarizer composed of amplifier Nd sup 3 sup + : glass slabs located with the Brewster angle in large scale multi-passes laser facility. The relationships of the isolation efficiency with the numbers of slab, the growth of the amplifier and the switch efficiency of Pockels cell are calculated theoretically. The experimental results indicated that the output energy ratio of this Pockels cell-amplifier isolation system is 1 : 8 while Pockels cell is on and off

MRI of displaced meniscal fragments

International Nuclear Information System (INIS)

Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

2012-01-01

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

MRI of displaced meniscal fragments

Energy Technology Data Exchange (ETDEWEB)

Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

2012-01-15

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

Dimensional crossover in fragmentation

Science.gov (United States)

Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

2000-11-01

Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

A Review of High Voltage Drive Amplifiers for Capacitive Actuators

DEFF Research Database (Denmark)

Huang, Lina; Zhang, Zhe; Andersen, Michael A. E.

2012-01-01

This paper gives an overview of the high voltage amplifiers, which are used to drive capacitive actuators. The amplifiers for both piezoelectric and DEAP (dielectric electroactive polymer) actuator are discussed. The suitable topologies for driving capacitive actuators are illustrated in detail...

Design optimization of single-main-amplifier KrF laser-fusion systems

International Nuclear Information System (INIS)

Harris, D.B.; Pendergrass, J.H.

1985-01-01

KrF lasers appear to be a very promising laser fusion driver for commercial applications. The Large Amplifier Module for the Aurora Laser System at Los Alamos is the largest KrF laser in the world and is currently operating at 5 kJ with 10 to 15 kJ eventually expected. The next generation system is anticipated to be a single-main-amplifier system that generates approximately 100 kJ. This paper examines the cost and efficiency tradeoffs for a complete single-main-amplifier KrF laser fusion experimental facility. It has been found that a 7% efficient $310/joule complete laser-fusion system is possible by using large amplifier modules and high optical fluences

A numerical design approach for single amplifier, Active-RC Butterworth filter of order 5

DEFF Research Database (Denmark)

Gaunholt, Hans

2007-01-01

filter applying just one operational amplifier coupled as a unity gain amplifier. It is shown that the influence from the real operational amplifier may be reduced by trimming just one resistor in the circuit. The unity gain amplifiers have the advantage of providing low power consumption, yielding...

A Transimpedance Amplifier for Remotely Located Quartz Tuning Forks

OpenAIRE

Kleinbaum, Ethan; Csathy, Gabor

2012-01-01

The cable capacitance in cryogenic and high vacuum applications of quartz tuning forks imposes severe constraints on the bandwidth and noise performance of the measurement. We present a single stage low noise transimpedance amplifier with a bandwidth exceeding 1 MHz and provide an in-depth analysis of the dependence of the amplifier parameters on the cable capacitance.

High peak power picosecond hybrid fiber and solid-state amplifier system

International Nuclear Information System (INIS)

Wushouer, X; Yan, P; Yu, H; Liu, Q; Fu, X; Yan, X; Gong, M

2010-01-01

We report the high peak power picosecond hybrid fiber and solid-state laser amplifier system. The passively mode-locked solid-state seed source produced an average power of 1.8 W with pulse width of 14 ps and repetition rate of 86 MHz. It was directly coupled into the first Yb-doped polarized photonic crystal fiber amplifier stage. To avoid the nonlinear effects in fiber, the output power from the first stage was merely amplified to 24 W with the narrow spectra broadening of 0.21 nm. For the improvement of the peak power, the dual-end pumped composite Nd:YVO 4 amplifier system has been chosen at the second stage. To reduce the serious thermal effect, the thermally bonded composite YVO 4 – Nd:YVO 4 – YVO 4 rod crystal was used as the gain medium. The 53 W TEM 00 mode with the peak power of 40 kW, beam quality of M 2 < 1.15, corresponding to the optical-optical efficiency of 42.4% was obtained at the hybrid amplifier laser system. The system allows using a low power seed source and demonstrates an increase in the peak power beyond a fiber master oscillator power amplifier's (MOPA's) limit

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

Energy Technology Data Exchange (ETDEWEB)

Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

2013-09-21

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

International Nuclear Information System (INIS)

Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

2013-01-01

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

RAPD analysis of alfalfa DNA mutation via N+ implantation

International Nuclear Information System (INIS)

Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

2003-01-01

Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

Science.gov (United States)

Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

2006-01-01

Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

Predistortion of a Bidirectional Cuk Audio Amplifier

DEFF Research Database (Denmark)

Birch, Thomas Hagen; Nielsen, Dennis; Knott, Arnold

2014-01-01

Some non-linear amplifier topologies are capable of providing a larger voltage gain than one from a DC source, which could make them suitable for various applications. However, the non-linearities introduce a significant amount of harmonic distortion (THD). Some of this distortion could be reduced...... using predistortion. This paper suggests linearizing a nonlinear bidirectional Cuk audio amplifier using an analog predistortion approach. A prototype power stage was built and results show that a voltage gain of up to 9 dB and reduction in THD from 6% down to 3% was obtainable using this approach....

Optimization of a high efficiency FEL amplifier

International Nuclear Information System (INIS)

Schneidmiller, E.A.; Yurkov, M.V.

2014-10-01

The problem of an efficiency increase of an FEL amplifier is now of great practical importance. Technique of undulator tapering in the post-saturation regime is used at the existing X-ray FELs LCLS and SACLA, and is planned for use at the European XFEL, Swiss FEL, and PAL XFEL. There are also discussions on the future of high peak and average power FELs for scientific and industrial applications. In this paper we perform detailed analysis of the tapering strategies for high power seeded FEL amplifiers. Application of similarity techniques allows us to derive universal law of the undulator tapering.

Tapered amplifier laser with frequency-shifted feedback

Directory of Open Access Journals (Sweden)

A. Bayerle, S. Tzanova, P. Vlaar, B. Pasquiou, F. Schreck

2016-10-01

Full Text Available We present a frequency-shifted feedback (FSF laser based on a tapered amplifier. The laser operates as a coherent broadband source with up to 370GHz spectral width and 2.3us coherence time. If the FSF laser is seeded by a continuous-wave laser a frequency comb spanning the output spectrum appears in addition to the broadband emission. The laser has an output power of 280mW and a center wavelength of 780nm. The ease and flexibility of use of tapered amplifiers makes our FSF laser attractive for a wide range of applications, especially in metrology.

Fragment-based quantitative structure-activity relationship (FB-QSAR) for fragment-based drug design.

Science.gov (United States)

Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen

2009-01-30

In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.

A high efficiency PWM CMOS class-D audio power amplifier

Energy Technology Data Exchange (ETDEWEB)

Zhu Zhangming; Liu Lianxi; Yang Yintang [Institute of Microelectronics, Xidian University, Xi' an 710071 (China); Lei Han, E-mail: zmyh@263.ne [Xi' an Power-Rail Micro Co., Ltd, Xi' an 710075 (China)

2009-02-15

Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 mum CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 muA. The active area of the class-D audio power amplifier is about 1.47 x 1.52 mm{sup 2}. With the good performance, the class-D audio power amplifier can be applied to several audio power systems.

A high efficiency PWM CMOS class-D audio power amplifier

International Nuclear Information System (INIS)

Zhu Zhangming; Liu Lianxi; Yang Yintang; Lei Han

2009-01-01

Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 μm CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 μA. The active area of the class-D audio power amplifier is about 1.47 x 1.52 mm 2 . With the good performance, the class-D audio power amplifier can be applied to several audio power systems.

A high efficiency PWM CMOS class-D audio power amplifier

Science.gov (United States)

Zhangming, Zhu; Lianxi, Liu; Yintang, Yang; Han, Lei

2009-02-01

Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 μm CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 μA. The active area of the class-D audio power amplifier is about 1.47 × 1.52 mm2. With the good performance, the class-D audio power amplifier can be applied to several audio power systems.

Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

Science.gov (United States)

Qu, Xinshun; Christ, Barbara J

2006-10-01

ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

Development of 650 MHz solid state RF amplifier for proton accelerator

International Nuclear Information System (INIS)

Jain, Akhilesh; Sharma, Deepak; Gupta, Alok; Tiwari, Ashish; Rao, Nageswar; Sekar, Vasanthi; Lad, M.; Hannurkar, P.R.; Gupta, P.D.

2011-01-01

Design and development of 30 kW high powers RF source at 650 MHz, using solid RF state technology, has been initiated at RRCAT. The indigenous technology development efforts will be useful for the proposed high power proton accelerators for SNS/ADS applications. In this 650 MHz amplifier scheme, 30 kW CW RF power will be generated using modular combination of 8 kW amplifier units. Necessary studies were carried out for device selection, choice of amplifier architecture and design of high power combiners and dividers. Presently RF amplifier delivering 250 W at 650 MHz has been fabricated and tested. Towards development of high power RF components, design and engineering prototyping of 16-port power combiner, directional coupler and RF dummy loads has been completed. The basic 8 kW amplifier unit is designed to provide power gain of 50 dB, bandwidth of 20 MHz and spurious response below 30 dB from fundamental signal. Based on the results of circuit simulation studies and engineering prototyping of amplifier module, two RF transistor viz. MRF3450 and MRF 61K were selected as solid state active devices. Impedance matching network in amplifier module is designed using balanced push pull configuration with transmission line BALUN. Due to high circulating current near drain side, metal clad RF capacitors were selected which helps in avoiding hot spot from output transmission path, ensuring continuous operation at rated RF power without damage to RF board. 350 W circulator is used to protect the RF devices from reflected power. Based on the prototype design and measured performance, one of these RF transistors will be selected to be used as workhorse for all amplifier modules. Two amplifier modules are mounted on water cooled copper heat-sink ensuring proper operating temperature for reliable and safe operation of amplifier. Also real time control system and data logger has been developed to provide DAQ and controls in each rack. For power combining and power measurement

Reframing landscape fragmentation's effects on ecosystem services.

Science.gov (United States)

Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

2015-04-01

Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fragment Size Distribution of Blasted Rock Mass

Science.gov (United States)

Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

2017-12-01

Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

A low noise charge sensitive amplifier for use in vacuum photo diode readout

International Nuclear Information System (INIS)

Stephenson, R.

1982-08-01

The amplifier described consists of a charge sensitive pre-amplifier optimised for low noise with low values of input shunt capacitance, and a shaping amplifier providing both differentiation and integration. Amplifier gain is adjustable up to a maximum of approximately 100 μV/electron with a rise time of 2 μS to the peak of the output voltage, and with an open circuit input noise level of 150 electrons RMS. (author)

A numerical design approach for single amplifier, Active-RC Butterworth filter of order 5

OpenAIRE

Gaunholt, Hans

2007-01-01

A design method is presented for the design of all pole lowpass active-RC filters applying operational amplifiers. The operational amplifier model used is the integrator model: omegat/s where omegat is the unity gain frequency. The design method is used for the design of a fifth order Butterworth filter applying just one operational amplifier coupled as a unity gain amplifier. It is shown that the influence from the real operational amplifier may be reduced by trimming just one resistor in th...

Self-oscillating modulators for direct energy conversion audio power amplifiers

DEFF Research Database (Denmark)

Ljusev, Petar; Andersen, Michael Andreas E.

2005-01-01

Direct energy conversion audio power amplifier represents total integration of switching-mode power supply and Class D audio power amplifier into one compact stage, achieving high efficiency, high level of integration, low component count and eventually low cost. This paper presents how self-oscillating...

A Power Efficient Audio Amplifier Combining Switching and Linear Techniques

NARCIS (Netherlands)

van der Zee, Ronan A.R.; van Tuijl, Adrianus Johannes Maria

1998-01-01

Integrated Class D audio amplifiers are very power efficient, but require an external filter which prevents further integration. Also due to this filter, large feedback factors are hard to realise, so that the load influences the distortion- and transfer characteristics. The amplifier presented in

Low-power, enhanced-gain adaptive-biasing-based Operational Transconductance Amplifiers

DEFF Research Database (Denmark)

Moradi, Farshad

A symmetrical PMOS OTA (Operational Transconductance Amplifier) is used to build an advanced rail-to-rail amplifier with improved DC-gain and reduced power consumption. By using the adaptive biasing circuit for two differential inputs, a low stand-by current can be achieved, reducing power...

A real-time control system architecture for industrial power amplifiers

NARCIS (Netherlands)

Qureshi, F.; Spinu, V.; Wijnands, C.G.E.; Lazar, M.

2013-01-01

Power amplifiers are a highly important component in a range of industrial applications, such as, servo-drives, magnetic resonance imaging, energy systems, and audio. The control system for power amplifiers should satisfy a range of requirements, e.g., offset free tracking, stability margins, and

Combined Yb/Nd driver for optical parametric chirped pulse amplifiers.

Science.gov (United States)

Michailovas, Kirilas; Baltuska, Andrius; Pugzlys, Audrius; Smilgevicius, Valerijus; Michailovas, Andrejus; Zaukevicius, Audrius; Danilevicius, Rokas; Frankinas, Saulius; Rusteika, Nerijus

2016-09-19

We report on the developed front-end/pump system for optical parametric chirped pulse amplifiers. The system is based on a dual output fiber oscillator/power amplifier which seeds and assures all-optical synchronization of femtosecond Yb and picosecond Nd laser amplifiers operating at a central wavelength of 1030 nm and 1064 nm, respectively. At the central wavelength of 1030 nm, the fiber oscillator generates partially stretched 4 ps pulses with the spectrum supporting a scaling currently is prevented by limited dimensions of the diffraction gratings, which, because of the fast progress in MLD grating manufacturing technologies is only a temporary obstacle.

Design and Fabrication of a 1 THz Backward Wave Amplifier

DEFF Research Database (Denmark)

Paoloni, Claudio; Di Carlo, Aldo; Brunetti, Francesca

2011-01-01

, to get a level of output power to enable applications at these frequencies. The OPTHER (Optically driven THz amplifier) project, funded by the European Community, is on the road to realize the first 1 THz vacuum tube amplifier. Technology at the state of the art has been used for the realization...... of the parts with dimensions supporting THz frequencies. A backward wave amplifier configuration is chosen to make the parts realizable. A carbon nanotube cold cathode has been considered for electron generation. A thermionic micro electron gun is designed to test the tube. A novel slow-wave structure (SWS...

Methylation-sensitive amplified polymorphism-based genome-wide analysis of cytosine methylation profiles in Nicotiana tabacum cultivars.

Science.gov (United States)

Jiao, J; Wu, J; Lv, Z; Sun, C; Gao, L; Yan, X; Cui, L; Tang, Z; Yan, B; Jia, Y

2015-11-26

This study aimed to investigate cytosine methylation profiles in different tobacco (Nicotiana tabacum) cultivars grown in China. Methylation-sensitive amplified polymorphism was used to analyze genome-wide global methylation profiles in four tobacco cultivars (Yunyan 85, NC89, K326, and Yunyan 87). Amplicons with methylated C motifs were cloned by reamplified polymerase chain reaction, sequenced, and analyzed. The results show that geographical location had a greater effect on methylation patterns in the tobacco genome than did sampling time. Analysis of the CG dinucleotide distribution in methylation-sensitive polymorphic restriction fragments suggested that a CpG dinucleotide cluster-enriched area is a possible site of cytosine methylation in the tobacco genome. The sequence alignments of the Nia1 gene (that encodes nitrate reductase) in Yunyan 87 in different regions indicate that a C-T transition might be responsible for the tobacco phenotype. T-C nucleotide replacement might also be responsible for the tobacco phenotype and may be influenced by geographical location.

1-MHz high power femtosecond Yb-doped fiber chirped-pulse amplifier

Science.gov (United States)

Hu, Zhong-Qi; Yang, Pei-Long; Teng, Hao; Zhu, Jiang-Feng; Wei, Zhi-Yi

2018-01-01

A practical femtosecond polarization-maintaining Yb-doped fiber amplifier enabling 153 fs transform-limited pulse duration with 32 μJ pulse energy at 1 MHz repetition rate corresponding to a peak power of 0.21 GW is demonstrated. The laser system based on chirped-pulse amplification (CPA) technique is seeded by a dispersion managed, nonlinear polarization evolution (NPE) mode-locked oscillator with spectrum bandwidth of 31 nm at 1040 nm and amplified by three fiber pre-amplifying stages and a rod type fiber main amplifying stage. The laser works with beam quality of M2 of 1.3 and power stability of 0.63% (root mean square, RMS) over 24 hours will be stable sources for industrial micromachining, medical therapy and scientific research.

Static thermo-optic instability in double-pass fiber amplifiers

DEFF Research Database (Denmark)

Lægsgaard, Jesper

2016-01-01

A coupled-mode formalism, earlier used to describe transverse mode instabilities in single-pass optical fiber amplifiers, is extended to the case of double-pass amplifiers. Contrary to the single-pass case, it is shown that the thermo-optic nonlinearity can couple light at the same frequency...... between the LP01 and LP11 modes, leading to a static deformation of the output beam profile. This novel phenomenon is caused by the interaction of light propagating in either direction with thermo-optic index perturbations caused by light propagating in the opposite direction. The threshold power...... for the static deformation is found to be several times lower than what is typically found for the dynamic modal instabilities observed in single-pass amplifiers. (C) 2016 Optical Society of America...

Medium-scale melt-sodium fragmentation experiments

International Nuclear Information System (INIS)

Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.

1979-01-01

The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments

Class H power amplifier for power saving in fluxgate current transducers

OpenAIRE

Velasco Quesada, Guillermo; Román Lumbreras, Manuel; Pérez Delgado, Raul; Conesa Roca, Alfons

2016-01-01

This paper presents a new improvement in the design of a fluxgate-based current transducer in order to reduce the power consumption of control electronics. The proposed improvement involves the replacement of the output linear amplifier of the transducer by a class H amplifier. The output amplifier is devoted to the magnetic flux compensation and generates the transducer output current, which is proportional to the current to be measured. In this way, it is possible to reduce significantly th...

Dual Fragment Impact of PBX Charges

Science.gov (United States)

Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

2017-06-01

Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

Amplifying Islam : Pluralism, Secularism, and Religious Sounds in The Netherlands

NARCIS (Netherlands)

Tamimi Arab, P.

2015-01-01

This dissertation is an ethnographic study of the amplified azan, the Islamic call to prayer, in the Netherlands, adding a sonic dimension to analyses of the politics of Islamic aesthetics in the western world. Often rejected by opponents as noise pollution, facilitating the amplified azan is an

Detailed dynamic model for semiconductor optical amplifiers and their crosstalk and intermodulation distortion

DEFF Research Database (Denmark)

Durhuus, Terji; Mikkelsen, Benny; Stubkjær, Kristian

1992-01-01

. The model is used to assess intermodulation distortion and crosstalk. Cascaded amplifiers are considered, and the crosstalk and intermodulation distortion due to cascaded amplifiers are found to accumulate by adding together in amplitude; this may limit the number or cascaded amplifiers in multichannel...

A Reduced Switch Voltage Stress Class E Power Amplifier Using Harmonic Control Network

OpenAIRE

Ali Reza Zirak; Sobhan Roshani

2016-01-01

In this paper, a harmonic control network (HCN) is presented to reduce the voltage stress (maximum MOSFET voltage) of the class E power amplifier (PA). Effects of the HCN on the amplifier specifications are investigated. The results show that the proposed HCN affects several specifications of the amplifier, such as drain voltage, switch current, output power capability (Cp factor), and drain impedance. The output power capability of the presented amplifier is also improved, compared with the ...

Dielectric waveguide amplifiers and lasers

NARCIS (Netherlands)

Pollnau, Markus

The performance of semiconductor amplifiers and lasers has made them the preferred choice for optical gain on a micro-chip. In the past few years, we have demonstrated that also rare-earth-ion-doped dielectric waveguides show remarkable performance, ranging from a small-signal gain per unit length

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

International Nuclear Information System (INIS)

Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

2014-01-01

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

Energy Technology Data Exchange (ETDEWEB)

Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

2014-04-10

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Large area electron beam pumped krypton fluoride laser amplifier

International Nuclear Information System (INIS)

Sethian, J.D.; Obenschain, S.P.; Gerber, K.A.; Pawley, C.J.; Serlin, V.; Sullivan, C.A.; Webster, W.; Deniz, A.V.; Lehecka, T.; McGeoch, M.W.; Altes, R.A.; Corcoran, P.A.; Smith, I.D.; Barr, O.C.

1997-01-01

Nike is a recently completed multi-kilojoule krypton fluoride (KrF) laser that has been built to study the physics of direct drive inertial confinement fusion. This paper describes in detail both the pulsed power and optical performance of the largest amplifier in the Nike laser, the 60 cm amplifier. This is a double pass, double sided, electron beam-pumped system that amplifies the laser beam from an input of 50 J to an output of up to 5 kJ. It has an optical aperture of 60 cm x 60 cm and a gain length of 200 cm. The two electron beams are 60 cm high x 200 cm wide, have a voltage of 640 kV, a current of 540 kA, and a flat top power pulse duration of 250 ns. A 2 kG magnetic field is used to guide the beams and prevent self-pinching. Each electron beam is produced by its own Marx/pulse forming line system. The amplifier has been fully integrated into the Nike system and is used on a daily basis for laser-target experiments. copyright 1997 American Institute of Physics

Gallstone fragmentation by control electrohydraulic lithotripsy

International Nuclear Information System (INIS)

Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

1989-01-01

The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

Fragmentation functions approach in pQCD fragmentation phenomena

International Nuclear Information System (INIS)

Rolli, S.

1996-07-01

Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

Fragmentation of neck-like structures

International Nuclear Information System (INIS)

Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

1994-01-01

Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

Directory of Open Access Journals (Sweden)

Paula Eveline Ribeiro D’Anunciação

2013-01-01

Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

Charge sensitive amplifies. The state of arts

Energy Technology Data Exchange (ETDEWEB)

Mori, Kunishiro [Clear Pulse Co., Tokyo (Japan)

1996-07-01

In the radiation detectors, signals are essentially brought with charges produced by radiation, then it is naturally the best way to use a charge sensitive amplifier (CSA) system to extract those signals. The CSA is thought to be the best amplifier suitable to almost all the radiation detectors, if neglecting economical points of view. The CSA has been only applied to special fields like radiation detection because the concept of `charges` is not so universal against the concepts of `voltage` and `current`. The CSA, however, is low in noise and a high speed amplifier and may be applicable not only to radiation measurement but also piezoelectric devices and also bolometers. In this article, noise in the CSA, basic circuit on the CSA, concepts of `equivalent noise charge` (ENC), a method for the ENC, and importance of the `open-loop gain` in the CSA to achieve better performance of it and how to realize in a practical CSA were described. And, characteristics on a counting rate of the CSA, various circuit used in the CSA, and CSAs which are commercially available at present and special purpose CSAs were also introduced. (G.K.)

Wideband amplifier design

CERN Document Server

Hollister, Allen L

2007-01-01

In this book, the theory needed to understand wideband amplifier design using the simplest models possible will be developed. This theory will be used to develop algebraic equations that describe particular circuits used in high frequency design so that the reader develops a ""gut level"" understanding of the process and circuit. SPICE and Genesys simulations will be performed to show the accuracy of the algebraic models. By looking at differences between the algebraic equations and the simulations, new algebraic models will be developed that include parameters originally left out of the model

Building valve amplifiers

CERN Document Server

Jones, Morgan

2013-01-01

Building Valve Amplifiers is a unique hands-on guide for anyone working with tube audio equipment--as an electronics hobbyist, audiophile or audio engineer. This 2nd Edition builds on the success of the first with technology and technique revisions throughout and, significantly, a major new self-build project, worked through step-by-step, which puts into practice the principles and techniques introduced throughout the book. Particular attention has been paid to answering questions commonly asked by newcomers to the world of the valve, whether audio enthusiasts tackling their first build or

Analysis and simulation of nonlinearity and effects of spontaneous emission in Schottky-junction-based plasmonic amplifiers.

Science.gov (United States)

Livani, Abdolber Mallah; Kaatuzian, Hassan

2015-07-01

An amplifier that operates on surface plasmon polaritons has been analyzed and simulated. Nonlinearity behavior and the spontaneous emission effects of the plasmonic amplifier are investigated in this paper. A rate equations approach has been used in which parameters are derived from simulation results of the plasmonic amplifier (Silvaco/ATLAS). Details on the method of this derivation are included, which were not previously reported. Rate equations are solved numerically by MATLAB codes. These codes verify the Silvaco results. The plasmonic amplifier operates on surface plasmons with a free-space wavelength of 1550 nm. Results show that, even without the effect of spontaneous emission, gain of the plasmonic amplifier saturates in high input levels. Saturation power, which can be used for comparing nonlinearity of different amplifiers, is 2.1 dBm for this amplifier. Amplified spontaneous emission reduces the gain of the amplifiers, which is long. There is an optimum value for the length of the amplifier. For the amplifier of this work, the optimum length for the small signal condition is 265 μm.

Fragmentation of Ceramics in Rapid Expansion Mode

Science.gov (United States)

Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

Ultrafast optical signal processing using semiconductor quantum dot amplifiers

DEFF Research Database (Denmark)

Berg, Tommy Winther; Mørk, Jesper

2002-01-01

The linear and nonlinear properties of quantum dot amplifiers are discussed on the basis of an extensive theoretical model. These devices show great potential for linear amplification as well as ultrafast signal processing.......The linear and nonlinear properties of quantum dot amplifiers are discussed on the basis of an extensive theoretical model. These devices show great potential for linear amplification as well as ultrafast signal processing....

Percolation versus microcanonical fragmentation - comparison of fragment size distribution: Where is the liquid-gas transition in nuclei?

International Nuclear Information System (INIS)

Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin

1990-01-01

The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)

Noise figure of amplified dispersive Fourier transformation

International Nuclear Information System (INIS)

Goda, Keisuke; Jalali, Bahram

2010-01-01

Amplified dispersive Fourier transformation (ADFT) is a powerful tool for fast real-time spectroscopy as it overcomes the limitations of traditional optical spectrometers. ADFT maps the spectrum of an optical pulse into a temporal waveform using group-velocity dispersion and simultaneously amplifies it in the optical domain. It greatly simplifies spectroscopy by replacing the diffraction grating and detector array in the conventional spectrometer with a dispersive fiber and single-pixel photodetector, enabling ultrafast real-time spectroscopic measurements. Following our earlier work on the theory of ADFT, here we study the effect of noise on ADFT. We derive the noise figure of ADFT and discuss its dependence on various parameters.

The formation of planets by disc fragmentation

Directory of Open Access Journals (Sweden)

Stamatellos Dimitris

2013-04-01

Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

Extraction of 16th Century Calender Fragments

DEFF Research Database (Denmark)

Holck, Jakob Povl; Etheridge, Christian

at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

R Mirnejad

2011-01-01

Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

M.V.A. amplifier for plasma position control by vertical magnetic field

International Nuclear Information System (INIS)

Schenk, G.

1978-01-01

The radial plasma position in the WEGA torus is controlled by a power amplifier, acting on the vertical magnetic field. Up to now the feedback loop contains, as amplifying elements, two 90 kW DC-transistor amplifiers, acting in push-pull operation. As increased plasma stability and lifetime is desirable, we have to increase the power amplifier to about 1 Megawatt. Industry offered a thyristor rectifier, operating at 50 or 300 Hz, and alternatively a thyristor chopper amplifier at a few kHz frequency response. Theses offers did not correspond to our demand, as far as response time, price and primary power requirements are concerned. We have implemented a bipolar switching-type amplifier (also called H-bridge converter) with the characteristics: time response < 0,05 ms., pulsed power = 1 MW (400 V, 2500 A), primary power = 2,5 kW. As power switch, a network of parallel high voltage transistors, driven by three transistor stages, has been chosen, to control a vertical magnetic field or +/- 180 G, with a precision of about one per cent. Precautions for transistor switches concerning mainly critical voltage, current, instantaneous power and selfoscillating behaviour have been taken. This systems corresponds to our demands

Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

Science.gov (United States)

Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

2017-02-01

A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

Dispersion-Engineered Traveling Wave Kinetic Inductance Parametric Amplifier

Science.gov (United States)

Zmuidzinas, Jonas (Inventor); Day, Peter K. (Inventor)

2014-01-01

A traveling wave kinetic inductance parametric amplifier comprises a superconducting transmission line and a dispersion control element. The transmission line can include periodic variations of its dimension along its length. The superconducting material can include a high normal state resistivity material. In some instances the high normal state resistivity material includes nitrogen and a metal selected from the group consisting of titanium, niobium and vanadium. The traveling wave kinetic inductance parametric amplifier is expected to exhibit a noise temperature below 100 mK/GHz.

Power amplifiers for the S-, C-, X- and Ku-bands an EDA perspective

CERN Document Server

Božanić, Mladen

2016-01-01

This book provides a detailed review of power amplifiers, including classes and topologies rarely covered in books, and supplies sufficient information to allow the reader to design an entire amplifier system, and not just the power amplification stage. A central aim is to furnish readers with ideas on how to simplify the design process for a preferred power amplifier stage by introducing software-based routines in a programming language of their choice. The book is in two parts, the first focusing on power amplifier theory and the second on EDA concepts. Readers will gain enough knowledge of RF and microwave transmission theory, principles of active and passive device design and manufacturing, and power amplifier design concepts to allow them to quickly create their own programs, which will help to accelerate the transceiver design process. All circuit designers facing the challenge of designing an RF or microwave power amplifier for frequencies from 2 to 18 GHz will find this book to be a valuable asset.

Gain measurements on a prototype NIF/LMJ amplifier pump cavity

International Nuclear Information System (INIS)

Rotter, M.D.; McCracken, R.; Erlandson, A.; Guenet, M.

1996-12-01

We are currently developing large-aperture amplifiers for the National Ignition Facility (NIF) and Laser Megajoules (LMJ) lasers. These multisegment amplifiers are of the flashlamp-pumped, Nd:Glass qW and are designed to propagate a nominally 36 cm square beam. The apertures within a particular amplifier bundle are arranged in a four-high by two-wide configuration and utilize two side lamp arrays and a central flashlamp array for pumping. The configuration is very similar to that used in the Beamlet laser, a single-beam prototype for the NIF/LMJ lasers, which has four apertures arranged in a two- high by two-wide configuration

Radiofrequency amplifier based on a DC superconducting quantum interference device

International Nuclear Information System (INIS)

Martinis, J.M.; Hilbert, C.; Clarke, J.

1986-01-01

A method is described of amplifying a radiofrequency signal consisting of: disposing a single symmetrically biased dc SQUID and an input coil within a superconducting shield, the dc SQUID having a superconducting ring interrupted by two shunted Josephson junctions, and the input coil being inductively coupled solely to the ring of the single SQUID, establishing a constant magnetic flux threading the SQUID ring, applying the radiofrequency signal to the input coil from outside of the superconducting shield, obtaining an amplified radiofrequency signal solely from across the ring of the single SQUID, transmitting the amplified radiofrequency signal from across the SQUID ring to the outside of the superconducting shield

Fluctuations in the fragmentation process

International Nuclear Information System (INIS)

Botet, R.; Ploszajczak, M.

1993-01-01

Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

The spectroscopy of fission fragments

International Nuclear Information System (INIS)

Phillips, W.R.

1998-01-01

High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

Directory of Open Access Journals (Sweden)

Dolores González

2012-12-01

Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

[Fragment-based drug discovery: concept and aim].

Science.gov (United States)

Tanaka, Daisuke

2010-03-01

Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.

[Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

Science.gov (United States)

Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

2016-09-01

Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

High-performace cladding-pumped erbium-doped fibre laser and amplifier

International Nuclear Information System (INIS)