WorldWideScience

Sample records for amplification confers glyphosate

  1. Characterization of Halomonas Varabilis Strain HTG7 Conferring Glyphosate Resistance

    Institute of Scientific and Technical Information of China (English)

    Liu Zhu(刘柱); Liang Aimin; Ping Shuzhen; Zhang Wei; Chen Ming; Yang Zhirong; Lin Min

    2004-01-01

    Bcterial strain HTG7 is isolated from extremely glyphosate-polluted soil. It is identified as Halomonas Varabilis. It can tolerate in 500 m mol/L glyphosate concentration. Physiological characterization of strain HTG7 shows that the optimum pH and temperature are 7.0 and 30℃, respectively. It grows well in the NaCl concentrations ranging from 0% to 10%. A plasmid pACYC184 carrying a 3.5 kb DNA fragment, which confers increased glyphosate tolerance, is cloned. The DNA fragment is able to complement with an E.coli auxotrophic aroA mutant.

  2. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  3. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  4. Growth and Reproduction of Glyphosate-Resistant and Susceptible Populations of Kochia scoparia

    OpenAIRE

    Vipan Kumar; Prashant Jha

    2015-01-01

    Evolution of glyphosate-resistant kochia is a threat to no-till wheat-fallow and glyphosate-resistant (GR) cropping systems of the US Great Plains. The EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase) gene amplification confers glyphosate resistance in the tested Kochia scoparia (L.) Schrad populations from Montana. Experiments were conducted in spring to fall 2014 (run 1) and summer 2014 to spring 2015 (run 2) to investigate the growth and reproductive traits of the GR vs. glyphosate-sus...

  5. A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

    KAUST Repository

    Sharkhuu, Altanbadralt

    2014-06-01

    Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

  6. Growth and Reproduction of Glyphosate-Resistant and Susceptible Populations of Kochia scoparia.

    Directory of Open Access Journals (Sweden)

    Vipan Kumar

    Full Text Available Evolution of glyphosate-resistant kochia is a threat to no-till wheat-fallow and glyphosate-resistant (GR cropping systems of the US Great Plains. The EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase gene amplification confers glyphosate resistance in the tested Kochia scoparia (L. Schrad populations from Montana. Experiments were conducted in spring to fall 2014 (run 1 and summer 2014 to spring 2015 (run 2 to investigate the growth and reproductive traits of the GR vs. glyphosate-susceptible (SUS populations of K. scoparia and to determine the relationship of EPSPS gene amplification with the level of glyphosate resistance. GR K. scoparia inbred lines (CHES01 and JOP01 exhibited 2 to 14 relative copies of the EPSPS gene compared with the SUS inbred line with only one copy. In the absence of glyphosate, no differences in growth and reproductive parameters were evident between the tested GR and SUS inbred lines, across an intraspecific competition gradient (1 to 170 plants m-2. GR K. scoparia plants with 2 to 4 copies of the EPSPS gene survived the field-use rate (870 g ha-1 of glyphosate, but failed to survive the 4,350 g ha-1 rate of glyphosate (five-times the field-use rate. In contrast, GR plants with 5 to 14 EPSPS gene copies survived the 4,350 g ha-1 of glyphosate. The results from this research indicate that GR K. scoparia with 5 or more EPSPS gene copies will most likely persist in field populations, irrespective of glyphosate selection pressure.

  7. Growth and Reproduction of Glyphosate-Resistant and Susceptible Populations of Kochia scoparia.

    Science.gov (United States)

    Kumar, Vipan; Jha, Prashant

    2015-01-01

    Evolution of glyphosate-resistant kochia is a threat to no-till wheat-fallow and glyphosate-resistant (GR) cropping systems of the US Great Plains. The EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase) gene amplification confers glyphosate resistance in the tested Kochia scoparia (L.) Schrad populations from Montana. Experiments were conducted in spring to fall 2014 (run 1) and summer 2014 to spring 2015 (run 2) to investigate the growth and reproductive traits of the GR vs. glyphosate-susceptible (SUS) populations of K. scoparia and to determine the relationship of EPSPS gene amplification with the level of glyphosate resistance. GR K. scoparia inbred lines (CHES01 and JOP01) exhibited 2 to 14 relative copies of the EPSPS gene compared with the SUS inbred line with only one copy. In the absence of glyphosate, no differences in growth and reproductive parameters were evident between the tested GR and SUS inbred lines, across an intraspecific competition gradient (1 to 170 plants m-2). GR K. scoparia plants with 2 to 4 copies of the EPSPS gene survived the field-use rate (870 g ha-1) of glyphosate, but failed to survive the 4,350 g ha-1 rate of glyphosate (five-times the field-use rate). In contrast, GR plants with 5 to 14 EPSPS gene copies survived the 4,350 g ha-1 of glyphosate. The results from this research indicate that GR K. scoparia with 5 or more EPSPS gene copies will most likely persist in field populations, irrespective of glyphosate selection pressure. PMID:26580558

  8. Safety evaluation of the double mutant 5-enol pyruvylshikimate-3-phosphate synthase (2mEPSPS) from maize that confers tolerance to glyphosate herbicide in transgenic plants.

    Science.gov (United States)

    Herouet-Guicheney, Corinne; Rouquié, David; Freyssinet, Martine; Currier, Thomas; Martone, Aris; Zhou, Junguo; Bates, Elizabeth E M; Ferullo, Jean-Marc; Hendrickx, Koen; Rouan, Dominique

    2009-07-01

    Glyphosate tolerance can be conferred by decreasing the herbicide's ability to inhibit the enzyme 5-enol pyruvylshikimate-3-phosphate synthase, which is essential for the biosynthesis of aromatic amino acids in all plants, fungi, and bacteria. Glyphosate tolerance is based upon the expression of the double mutant 5-enol pyruvylshikimate-3-phosphate synthase (2mEPSPS) protein. The 2mEPSPS protein, with a lower binding affinity for glyphosate, is highly resistant to the inhibition by glyphosate and thus allows sufficient enzyme activity for the plants to grow in the presence of herbicides that contain glyphosate. Based on both a review of published literature and experimental studies, the potential safety concerns related to the transgenic 2mEPSPS protein were assessed. The safety evaluation supports that the expressed protein is innocuous. The 2mEPSPS enzyme does not possess any of the properties associated with known toxins or allergens, including a lack of amino acid sequence similarity to known toxins and allergens, a rapid degradation in simulated gastric and intestinal fluids, and no adverse effects in mice after intravenous or oral administration (at 10 or 2000 mg/kg body weight, respectively). In conclusion, there is a reasonable certainty of no harm resulting from the inclusion of the 2mEPSPS protein in human food or in animal feed. PMID:19303906

  9. What have the mechanisms of resistance to glyphosate taught us?

    Science.gov (United States)

    The intensive use of glyphosate alone to manage weeds has selected populations that are glyphosate resistant. The three mechanisms of glyphosate resistance that have been elucidated are 1) target site mutations; 2) gene amplification; and 3) altered translocation due to sequestration. What have we...

  10. A Novel Naturally Occurring Class I 5-Enolpyruvylshikimate-3-Phosphate Synthase from Janibacter sp. Confers High Glyphosate Tolerance to Rice

    Science.gov (United States)

    Yi, Shu-yuan; Cui, Ying; Zhao, Yan; Liu, Zi-duo; Lin, Yong-jun; Zhou, Fei

    2016-01-01

    As glyphosate is a broad spectrum herbicide extensively used in agriculture worldwide, identification of new aroA genes with high level of glyphosate tolerance is essential for the development and breeding of transgenic glyphosate-tolerant crops. In this study, an aroA gene was cloned from a Janibacter sp. strain isolated from marine sediment (designated as aroAJ. sp). The purified aroAJ. sp enzyme has a Km value of 30 μM for PEP and 83 μM for S3P, and a significantly higher Ki value for glyphosate (373 μM) than aroAE. coli. AroAJ. sp is characterized as a novel and naturally occurring class I aroA enzyme with glyphosate tolerance. Furthermore, we show that aroAJ. sp can be used as an effective selectable marker in both japonica and indica rice cultivar. Transgenic rice lines were tested by herbicide bioassay and it was confirmed that they could tolerate up to 3360 g/ha glyphosate, a dosage four-fold that of the recommended agricultural application level. To our knowledge, it is the first report of a naturally occurring novel class I aroA gene which can be efficiently utilized to study and develop transgenic glyphosate-tolerant crops, and can facilitate a more economical and simplified weed control system. PMID:26754957

  11. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  12. Glyphosate poisoning.

    Science.gov (United States)

    Bradberry, Sally M; Proudfoot, Alex T; Vale, J Allister

    2004-01-01

    Glyphosate is used extensively as a non-selective herbicide by both professional applicators and consumers and its use is likely to increase further as it is one of the first herbicides against which crops have been genetically modified to increase their tolerance. Commercial glyphosate-based formulations most commonly range from concentrates containing 41% or more glyphosate to 1% glyphosate formulations marketed for domestic use. They generally consist of an aqueous mixture of the isopropylamine (IPA) salt of glyphosate, a surfactant, and various minor components including anti-foaming and colour agents, biocides and inorganic ions to produce pH adjustment. The mechanisms of toxicity of glyphosate formulations are complicated. Not only is glyphosate used as five different salts but commercial formulations of it contain surfactants, which vary in nature and concentration. As a result, human poisoning with this herbicide is not with the active ingredient alone but with complex and variable mixtures. Therefore, It is difficult to separate the toxicity of glyphosate from that of the formulation as a whole or to determine the contribution of surfactants to overall toxicity. Experimental studies suggest that the toxicity of the surfactant, polyoxyethyleneamine (POEA), is greater than the toxicity of glyphosate alone and commercial formulations alone. There is insufficient evidence to conclude that glyphosate preparations containing POEA are more toxic than those containing alternative surfactants. Although surfactants probably contribute to the acute toxicity of glyphosate formulations, the weight of evidence is against surfactants potentiating the toxicity of glyphosate. Accidental ingestion of glyphosate formulations is generally associated with only mild, transient, gastrointestinal features. Most reported cases have followed the deliberate ingestion of the concentrated formulation of Roundup (The use of trade names is for product identification purposes only and

  13. Mechanism Of Resistance Of Evolved Glyphosate-Resistant Palmer Amaranth (Amaranthus Palmeri L.)

    Science.gov (United States)

    Evolved glyphosate resistance in weedy species represents a challenge for the continued success and utility of glyphosate-resistant crops. The first case of evolved glyphosate resistance in Palmer amaranth was a population from the U.S. state of Georgia, which was previously reported to have amplif...

  14. Interspecific hybridization transfers a previously unknown glyphosate resistance mechanism in Amaranthus species

    OpenAIRE

    Gaines, Todd A; Ward, Sarah M.; Bukun, Bekir; Preston, Christopher; Leach, Jan E.; Westra, Philip

    2011-01-01

    A previously unknown glyphosate resistance mechanism, amplification of the 5-enolpyruvyl shikimate-3-phosphate synthase gene, was recently reported in Amaranthus palmeri. This evolved mechanism could introgress to other weedy Amaranthus species through interspecific hybridization, representing an avenue for acquisition of a novel adaptive trait. The objective of this study was to evaluate the potential for this glyphosate resistance trait to transfer via pollen from A. palmeri to five other w...

  15. Selection and physiological response of glyphosate resistant zoysiagrass mutants derived from a radiation breeding technique

    International Nuclear Information System (INIS)

    This study was conducted to select of zoysiagrass mutants resistant to glyphosate and to identify their physiological and molecular characteristics. Experiments were conducted to determine the effects of glyphosate on the physiological responses in zoysiagrass and to select mutants resistant to glyphosate. The results indicated that the optimum concentration for a mutant resistant to glyphosate selection is 0.5∼1.0%. In order to select mutants resistant to glyphosate, M2 plants were sprayed with 0.5% glyphosate after propagation. M2 seeds were collected from the plants that survived after being irradiated with 300Gy gamma ray. Three resistant and susceptible M2 plants were selected for an analysis of their physiological characters. The electrolyte leakage was increased more in the susceptible plants than the resistant plants treated with 0.5% glyphosate. A difference in the malondialdehyde content was not evident between the resistant and susceptible plants. The chlorophyll and carotenoid contents were decreased in the plants treated with 0.5% glyphosate with a greater reduction in the susceptible plants than in the resistant plants. And, the zoysiagrass 5-enolpyruvyl-shikimate-3-phosphate synthase gene was cloned by RT-PCR and RACE (Rapid Amplification of cDNA Ends) approaches. The derived cDNA sequence revealed a high homology with the genes reported in other species. (author)

  16. Physiological responses of glyphosate-resistant and glyphosate-sensitive soybean to aminomethylphosphonic acid a metabolite of glyphosate

    Science.gov (United States)

    Aminomethylphosphonic acid (AMPA) is formed in glyphosate-treated glyphosate-resistant (GR) and glyphosate-sensitive (GS) soybean [Glycine max (L.) Merr.] plants and is known to cause yellowing in soybean. Although, AMPA is less phytotoxic than glyphosate, its mode of action is different from that o...

  17. Characterization of the Amaranthus palmeri Physiological Response to Glyphosate in Susceptible and Resistant Populations.

    Science.gov (United States)

    Fernández-Escalada, Manuel; Gil-Monreal, Miriam; Zabalza, Ana; Royuela, Mercedes

    2016-01-13

    The herbicide glyphosate inhibits the plant enzyme 5-enolpyruvylshikimate3-phosphate synthase (EPSPS) in the aromatic amino acid (AAA) biosynthetic pathway. The physiologies of an Amaranthus palmeri population exhibiting resistance to glyphosate by EPSPS gene amplification (NC-R) and a susceptible population (NC-S) were compared. The EPSPS copy number of NC-R plants was 47.5-fold the copy number of NC-S plants. Although the amounts of EPSPS protein and activity were higher in NC-R plants than in NC-S plants, the AAA concentrations were similar. The increases in total free amino acid and in AAA contents induced by glyphosate were more evident in NC-S plants. In both populations, the EPSPS protein increased after glyphosate exposure, suggesting regulation of gene expression. EPSPS activity seems tightly controlled in vivo. Carbohydrate accumulation and a slight induction of ethanol fermentation were detected in both populations. PMID:26652930

  18. GLYPHOSATE AND GLYPHOSATE-RESISTANT CROP INTERACTIONS WITH RHIZOSPHERE MICROORGANISMS

    Science.gov (United States)

    Glyphosate and glyphosate-resistant crops represent a major advancement in effective weed management that is now widely used in many crop production systems. Studies conducted during 1997-2007 showed that Fusarium root colonization was consistently higher on Roundup Ready (RR) soybean treated with g...

  19. Mode of Action of Glyphosate

    Science.gov (United States)

    Although glyphosate is the most used and studied herbicide in the world, the available information is not enough to fully understand its mode of action. The molecular site of action of glyphosate is the enzyme 5-enolpyruvlyshikimate-3-phosphate synthase (EPSPS). It is the only known compound that ...

  20. Uptake of Glyphosate by an Arthrobacter sp

    OpenAIRE

    Pipke, Rüdiger; Schulz, Arno; Amrhein, Nikolaus

    1987-01-01

    The uptake of glyphosate (N-[phosphonomethyl]glycine) by an Arthrobacter sp. which can utilize this herbicide as its sole source of phosphorus was investigated. Orthophosphate suppressed the expression of the uptake system for glyphosate and also competed with glyphosate for uptake. The Km for glyphosate uptake was 125 μM, and the Ki for orthophosphate was 24 μM. Organophosphonates as well as organophosphates inhibited glyphosate uptake, but only organophosphates and orthophosphate suppressed...

  1. Crop Response to Glyphosate Trimesium Sulphosate

    OpenAIRE

    Danijela PAVLOVIC; VRBNICANIN, Sava; Carl REINHARDT

    2013-01-01

    Glyphosate may cause injury to non-target plants. The first detectable symptom after glyphosate treatment is the growth inhibition, followed by noticeable yellowing (chlorosis) of the treated tissue. Five to ten days after the treatment, the chlorosis turns into necrosis and the plants begin to die. Greenhouse research was conducted in 2007 to investigate the response of glyphosate resistant (GR) soybeans PAN 520 line and non-glyphosate resistant EGRET line of soybeans to glyphosate trimesium...

  2. Glyphosate resistance: state of knowledge

    OpenAIRE

    Sammons, Robert Douglas; Gaines, Todd A

    2014-01-01

    Studies of mechanisms of resistance to glyphosate have increased current understanding of herbicide resistance mechanisms. Thus far, single-codon non-synonymous mutations of EPSPS (5-enolypyruvylshikimate-3-phosphate synthase) have been rare and, relative to other herbicide mode of action target-site mutations, unconventionally weak in magnitude for resistance to glyphosate. However, it is possible that weeds will emerge with non-synonymous mutations of two codons of EPSPS to produce an enzym...

  3. Glyphosate effect on plant rhizobacteria

    OpenAIRE

    Giraldo Duque, Judy Madelén

    2015-01-01

    Abstract: Results obtained from several studies suggest that the pre-seeding application of the widely used herbicide glyphosate can alter the microbial community of the rhizosphere of non-target plants, as well as soil processes mediated by microorganisms. Although this impact should be related to the response of weed plants to glyphosate application, little is known on the changes taking place in the microbial community of weed plant rhizosphere. A field and a greenhouse experiments were co...

  4. Crop Response to Glyphosate Trimesium Sulphosate

    Directory of Open Access Journals (Sweden)

    Danijela PAVLOVIC

    2013-12-01

    Full Text Available Glyphosate may cause injury to non-target plants. The first detectable symptom after glyphosate treatment is the growth inhibition, followed by noticeable yellowing (chlorosis of the treated tissue. Five to ten days after the treatment, the chlorosis turns into necrosis and the plants begin to die. Greenhouse research was conducted in 2007 to investigate the response of glyphosate resistant (GR soybeans PAN 520 line and non-glyphosate resistant EGRET line of soybeans to glyphosate trimesium sulphosate and to evaluate soybeans injury to help in weed resistance detection. The methods used to detect changes were dose response test, HPLC measurement based on glyphosate induced accumulation of shikimate, and morpho-anatomical changes (light and electron microscopy. Damaged chloroplasts are a clear indication of a glyphosate injury. If the injury rating is related to increased shikimate levels, there is greater certainty that differences among biotypes are due to glyphosate tolerance.

  5. THE REMOVAL OF GLYPHOSATE FROM DRINKING WATER

    Science.gov (United States)

    The effectiveness of granulated activated carbon (GAC), packed activated carbon (PAC), conventional treatment, membranes, and oxidation for removing glyphosate from natural waters is evaluated. Results indicate that GAC and PAC are not effective in removing glyphosate, while oxid...

  6. 75 FR 24969 - Glyphosate From China

    Science.gov (United States)

    2010-05-06

    ... From the Federal Register Online via the Government Publishing Office INTERNATIONAL TRADE COMMISSION Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Notice of... gives notice that its antidumping investigation concerning glyphosate from China (investigation No....

  7. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  8. First case of glyphosate resistance in France

    OpenAIRE

    Fernandez, Pablo; Gauvrit, Christian; Barro, Francisco; Menendez, Julio; De Prado, Rafael

    2015-01-01

    International audience AbstractGlyphosate is a broad-spectrum systemic herbicide used to kill weeds, especially annual broadleaf weeds and grasses known to compete with commercial crops grown around the globe. However, weeds evolve and develop resistance to glyphosate. Until recently, no case of glyphosate resistance had been detected in France. Glyphosate resistance was indeed recently recorded in a Lolium rigidum weed population from a vineyard in the South of France. Here, we studied th...

  9. Effects of glyphosate on brachypodium distachyon

    OpenAIRE

    Altıntaş, Ayşegul; Altintas, Aysegul

    2010-01-01

    Glyphosate is a non-selective herbicide used widely as the most popular weed management tool, especially since the commercialization of glyphosate-resistant crops. Due to overuse, several weed species have evolved resistance towards glyphosate and this trend threatens the future of world food production. Brachypodium distachyon has been proposed as a model organism specifically for economically important crops such as wheat and barley. Thus, evaluating the effects of glyphosate on Brachypodiu...

  10. First case of glyphosate resistance in France

    OpenAIRE

    Fernandez, Pablo; Gauvrit, Christian; Barro, Francisco; Menendez, Julio; De Prado, Rafael

    2015-01-01

    Glyphosate is a broad-spectrum systemic herbicide used to kill weeds, especially annual broadleaf weeds and grasses known to compete with commercial crops grown around the globe. However, weeds evolve and develop resistance to glyphosate. Until recently, no case of glyphosate resistance had been detected in France. Glyphosate resistance was indeed recently recorded in a Lolium rigidum weed population from a vineyard in the South of France. Here, we studied the mechanisms of this resistance ca...

  11. An isochromosome confers drug resistance in vivo by amplification of two genes, ERG11 and TAC1.

    Science.gov (United States)

    Selmecki, Anna; Gerami-Nejad, Maryam; Paulson, Carsten; Forche, Anja; Berman, Judith

    2008-05-01

    Acquired azole resistance is a serious clinical problem that is often associated with the appearance of aneuploidy and, in particular, with the formation of an isochromosome [i(5L)] in the fungal opportunist Candida albicans. Here we exploited a series of isolates from an individual patient during the rapid acquisition of fluconazole resistance (Flu(R)). Comparative genome hybridization arrays revealed that the presence of two extra copies of Chr5L, on the isochromosome, conferred increased Flu(R) and that partial truncation of Chr5L reduced Flu(R). In vitro analysis of the strains by telomere-mediated truncations and by gene deletion assessed the contribution of all Chr5L genes and of four specific genes. Importantly, ERG11 (encoding the drug target) and a hyperactive allele of TAC1 (encoding a transcriptional regulator of drug efflux pumps) made independent, additive contributions to Flu(R) in a gene copy number-dependent manner that was not different from the contributions of the entire Chr5L arm. Thus, the major mechanism by which i(5L) formation causes increased azole resistance is by amplifying two genes: ERG11 and TAC1. PMID:18363649

  12. Glyphosate-resistant and conventional canola (Brassica napus L.)responses to glyphosate and Aminomethylphosphonic Acid (AMPA) treatment

    Science.gov (United States)

    Glyphosate-resistant (GR) canola expresses two transgenes: 1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and 2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshiki...

  13. Glyphosate catabolism by Pseudomonas sp

    International Nuclear Information System (INIS)

    The pathway for the degradation of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. PG2982 has been determined using metabolic radiolabeling experiments. Radiorespirometry experiments utilizing [3-14C] glyphosate revealed that approximately 50-59% of the C3 carbon was oxidized to CO2. Fractionation of stationary phase cells labeled with [3-14C]glyphosate revealed that from 45-47% of the assimilated C3 carbon is distributed to proteins and that amino acids methionine and serine are highly labeled. The nucleic acid bases adenine and guanine received 90% of the C3 label that was incorporated into nucleic acids, and the only pyrimidine base labeled was thymine. Pulse labeling of PG2982 cells with [3-14C]glyphosate revealed that [3-14C]sarcosine is an intermediate in glyphosate degradation. Examination of crude extracts prepared from PG2982 cells revealed the presence of an enzyme that oxidizes sarcosine to glycine and formaldehyde. These results indicate that the first step in glyphosate degradation by PG2982 is cleavage of the carbon-phosphorus bond, resulting in the release of sarcosine and a phosphate group. The phosphate group is utilized as a source of phosphorus, and the sarcosine is degraded to glycine and formaldehyde. Phosphonate utilization by Pseudomonas sp. PG2982 was investigated. Each of the ten phosphonates tested were utilized as a sole source of phosphorus by PG2982. Representative compounds tested included alkylphosphonates, 1-amino-substituted alkylphosphonates, amino-terminal phosphonates, and an arylphosphonate. PG2982 cultures degraded phenylphosphonate to benzene and produced methane from methylphosphonate. The data indicate that PG2982 is capable of cleaving the carbon-phosphorus bond of several structurally different phosphonates

  14. GLYPHOSATE REMOVAL FROM DRINKING WATER

    Science.gov (United States)

    Activated-carbon, oxidation, conventional-treatment, filtration, and membrane studies are conducted to determine which process is best suited to remove the herbicide glyphosate from potable water. Both bench-scale and pilot-scale studies are completed. Computer models are used ...

  15. Glyphosate induces neurotoxicity in zebrafish.

    Science.gov (United States)

    Roy, Nicole M; Carneiro, Bruno; Ochs, Jeremy

    2016-03-01

    Glyphosate based herbicides (GBH) like Roundup(®) are used extensively in agriculture as well as in urban and rural settings as a broad spectrum herbicide. Its mechanism of action was thought to be specific only to plants and thus considered safe and non-toxic. However, mounting evidence suggests that GBHs may not be as safe as once thought as initial studies in frogs suggest that GBHs may be teratogenic. Here we utilize the zebrafish vertebrate model system to study early effects of glyphosate exposure using technical grade glyphosate and the Roundup(®) Classic formulation. We find morphological abnormalities including cephalic and eye reductions and a loss of delineated brain ventricles. Concomitant with structural changes in the developing brain, using in situ hybridization analysis, we detect decreases in genes expressed in the eye, fore and midbrain regions of the brain including pax2, pax6, otx2 and ephA4. However, we do not detect changes in hindbrain expression domains of ephA4 nor exclusive hindbrain markers krox-20 and hoxb1a. Additionally, using a Retinoic Acid (RA) mediated reporter transgenic, we detect no alterations in the RA expression domains in the hindbrain and spinal cord, but do detect a loss of expression in the retina. We conclude that glyphosate and the Roundup(®) formulation is developmentally toxic to the forebrain and midbrain but does not affect the hindbrain after 24h exposure. PMID:26773362

  16. Glyphosate effects on photosynthesis, nutrient accumulation, and nodulation in glyphosate-resistant soybean.

    Science.gov (United States)

    Previous studies demonstrated that the photosynthesis of some cultivars of first (GR1) and second generation (GR2) glyphosate-resistant soybean was reduced by glyphosate. The reduction in photosynthesis caused by glyphosate might affect nutrient uptake and lead to lower plant biomass production and ...

  17. Glyphosate-Resistant Goosegrass from Mississippi

    OpenAIRE

    Vijay K. Nandula; Alice A Wright; William T Molin

    2013-01-01

    A suspected glyphosate-resistant goosegrass [Eleusine indica (L.) Gaertn.] population, found in Washington County, Mississippi, was studied to determine the level of resistance and whether the resistance was due to a point mutation, as was previously identified in a Malaysian population. Whole plant dose response assays indicated a two- to four-fold increase in resistance to glyphosate. Leaf disc bioassays based on a glyphosate-dependent increase in shikimate levels indicated a five- to eight...

  18. Glyphosate-Degrading Microorganisms from Industrial Activated Sludge

    OpenAIRE

    Balthazor, Terry M.; Hallas, Laurence E.

    1986-01-01

    A plating medium was developed to isolate N-phosphonomethylglycine (glyphosate)-degrading microorganisms, with glyphosate as the sole phosphorus source. Two industrial biosystems treating glyphosate wastes contained elevated microbial counts on the medium. One purified isolate metabolized glyphosate to aminomethylphosphonic acid, mineralizing this accumulating intermediate during log growth. This microorganism has been identified as a Flavobacterium species.

  19. 76 FR 27268 - Glyphosate; Pesticide Tolerance

    Science.gov (United States)

    2011-05-11

    ... with glyphosate follows. In the Federal Register of April 8, 2011 (76 FR 19701) (FRL-8866- 8), EPA... estimated aggregate risks resulting from use of glyphosate, as discussed in the April 8, 2011 (76 FR 19701...) 305-5805. II. Summary of Petitioned-For Tolerance In the Federal Register of February 4, 2011 (76...

  20. Adjuvants for single droplet application of glyphosate

    DEFF Research Database (Denmark)

    Mathiassen, Solvejg K.; Kudsk, Per; Lund, Ivar

    Retention and biological activity of droplets of glyphosate deposited onto plant leaves using a Drop on Demand inkjet printer application system, was examined on pot-grown Brassica napus, Solanum nigrum, Chenopodium album, Silene noctiflora and Echinocloa crus-galli plants. Retention was measured...... but the biological activity of glyphosate was not improved....

  1. Adjuvants for single droplet application of glyphosate

    DEFF Research Database (Denmark)

    Mathiassen, Solvejg Kopp; Kudsk, Per; Lund, Ivar

    2016-01-01

    Retention and biological activity of droplets of glyphosate deposited onto plant leaves using a Drop on Demand inkjet printer application system, was examined on pot-grown Brassica napus, Solanum nigrum, Chenopodium album, Silene noctiflora and Echinocloa crus-galli plants. Retention was measured...... but the biological activity of glyphosate was not improved....

  2. Glyphosate degradation by immobilized bacteria: laboratory studies showing feasibility for glyphosate removal from waste water.

    Science.gov (United States)

    Heitkamp, M A; Adams, W J; Hallas, L E

    1992-09-01

    To evaluate immobilized bacteria technology for the removal of low levels of glyphosate (N-phosphonomethylglycine) from aqueous industrial effluents, microorganisms with glyphosate-degrading activity obtained from a fill and draw enrichment reactor inoculated with activated sludge were first exposed to glyphosate production wastes containing 500-2000 mg glyphosate/L. The microorganisms were then immobilized by adsorption onto a diatomaceous earth biocarrier contained in upflow Plexiglas columns. The columns were aerated, maintained at pH 7.0-8.0, incubated at 25 degrees C, supplemented with NH4NO3 (50 mg/L), and exposed to glyphosate process wastes pumped upflow through the biocarrier. Glyphosate degradation to aminomethylphosphonic acid was initially > 96% for 21 days of operation at flows yielding hydraulic residence times (HRTs) as short as 42 min. Higher flow rate studies showed > 98% removal of 50 mg glyphosate/L from the waste stream could be achieved at a HRT of 23 min. Glyphosate removal of > 99% at a 37-min HRT was achieved under similar conditions with a column inoculated with a pure culture of Pseudomonas sp. strain LBr, a bacterium known to have high glyphosate-degrading activity. After acid shocking (pH 2.8 for 18 h) of a column of immobilized bacteria, glyphosate-degrading activity was regained within 4 days without reinoculation. Although microbial growth and glyphosate degradation were not maintained under low organic nutrient conditions in the laboratory, the low levels of degradable carbon (45-94 mg/L) in the industrial effluent were sufficient to support prolonged glyphosate-degrading activity. The results demonstrated that immobilized bacteria technology is effective in removing low levels of glyphosate in high-volume liquid waste streams. PMID:1464067

  3. Influence of glyphosate on the copper dissolution in phosphate buffer

    Science.gov (United States)

    Coutinho, C. F. B.; Silva, M. O.; Machado, S. A. S.; Mazo, L. H.

    2007-01-01

    The electrochemical behavior of copper microelectrode in phosphate buffer in the presence of glyphosate was investigated by electrochemical techniques. It was observed that the additions of glyphosate in the phosphate buffer increased the anodic current of copper microelectrode and the electrochemical dissolution was observed. This phenomenon could be associated with the Cu(II) complexation by glyphosate forming a soluble complex. Physical characterization of the surface showed that, in absence of glyphosate, an insoluble layer covered the copper surface; on the other hand, in presence of glyphosate, it was observed a corroded copper surface with the formation of glyphosate complex in solution.

  4. The Mechanism by Which MYCN Amplification Confers an Enhanced Sensitivity to a PCNA-Derived Cell Permeable Peptide in Neuroblastoma Cells

    Directory of Open Access Journals (Sweden)

    Long Gu

    2015-12-01

    Full Text Available Dysregulated expression of MYC family genes is a hallmark of many malignancies. Unfortunately, these proteins are not amenable to blockade by small molecules or protein-based therapeutic agents. Therefore, we must find alternative approaches to target MYC-driven cancers. Amplification of MYCN, a MYC family member, predicts high-risk neuroblastoma (NB disease. We have shown that R9-caPep blocks the interaction of PCNA with its binding partners and selectively kills human NB cells, especially those with MYCN amplification, and we now show the mechanism. We found elevated levels of DNA replication stress in MYCN-amplified NB cells. R9-caPep exacerbated DNA replication stress in MYCN-amplified NB cells and NB cells with an augmented level of MYC by interfering with DNA replication fork extension, leading to Chk1 dependence and susceptibility to Chk1 inhibition. We describe how these effects may be exploited for treating NB.

  5. 75 FR 20862 - Glyphosate From China

    Science.gov (United States)

    2010-04-21

    ..., the Commission established a schedule for the conduct of the subject investigation (75 FR 17768, April... From the Federal Register Online via the Government Publishing Office INTERNATIONAL TRADE COMMISSION Glyphosate From China AGENCY: United States International Trade Commission. ACTION:...

  6. Impact of phosphate on glyphosate uptake and toxicity in willow.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Le Manac'h, Sarah Gingras; Moingt, Matthieu; Smedbol, Elise; Paquet, Serge; Labrecque, Michel; Lucotte, Marc; Juneau, Philippe

    2016-03-01

    Phosphate (PO4(3-)) has been shown to increase glyphosate uptake by willow, a plant species known for its phytoremediation potential. However, it remains unclear if this stimulation of glyphosate uptake can result in an elevated glyphosate toxicity to plants (which could prevent the use of willows in glyphosate-remediation programs). Consequently, we studied the effects of PO4(3-) on glyphosate uptake and toxicity in a fast growing willow cultivar (Salix miyabeana SX64). Plants were grown in hydroponic solution with a combination of glyphosate (0, 0.001, 0.065 and 1 mg l(-1)) and PO4(3-) (0, 200 and 400 mg l(-1)). We demonstrated that PO4(3-) fertilization greatly increased glyphosate uptake by roots and its translocation to leaves, which resulted in increased shikimate concentration in leaves. In addition to its deleterious effects in photosynthesis, glyphosate induced oxidative stress through hydrogen peroxide accumulation. Although it has increased glyphosate accumulation, PO4(3-) fertilization attenuated the herbicide's deleterious effects by increasing the activity of antioxidant systems and alleviating glyphosate-induced oxidative stress. Our results indicate that in addition to the glyphosate uptake, PO4(3-) is involved in glyphosate toxicity in willow by preventing glyphosate induced oxidative stress. PMID:26561751

  7. Water use efficiency and photosynthesis of glyphosate-resistant soybean as affected by glyphosate

    Science.gov (United States)

    Previous studies comparing cultivars of different maturity groups in different soils demonstrated that early maturity group cultivars were more sensitive to glyphosate injury than those of other maturity groups. In this work, we evaluated the effect of increasing rates of glyphosate on water absorpt...

  8. Effect of Glyphosate on Symbiotic N2 Fixation and Nickel Concentration in Glyphosate-Resistant Soybean

    Science.gov (United States)

    The impact of widespread cultivation of glyphosate-resistant (GR) soybean and the use of one herbicide class on biological processes has received considerable attention. Decreased biological nitrogen fixation in GR soybean has been attributed directly to toxicity of glyphosate or its metabolites to ...

  9. SUSCEPTIBILITY TO GLYPHOSATE OF WEED ESCAPES IN GLYPHOSATE-TOLERANT SOYBEAN

    Science.gov (United States)

    Plots of glyphosate-tolerant soybeans at twelve locations in five states were monitored for weed escapes. Seeds were collected from each of these sites in the glyphosate and non-treated weedy check plots. These seeds were planted and grown in a greenhouse and then sprayed one time with 10% of a stan...

  10. Glyphosate-resistant Palmer Amaranth in the U.S.

    Science.gov (United States)

    Since glyphosate-resistant (GR) crops were commercialized, glyphosate has been extensively used to effectively and economically manage weeds. The adoption of GR technology also provided growers with the capabilities needed to rapidly adopt conservation tillage production systems. Selection pressure ...

  11. Manganese uptake and redistribution in soybean as affected by glyphosate

    OpenAIRE

    Ciro Antonio Rosolem; Gabriel José Massoni de Andrade; Izaias Pinheiro Lisboa; Samuel Menegatti Zoca

    2010-01-01

    Detrimental effects of glyphosate on plant mineral nutrition have been reported in the literature, particularly on Mn uptake and redistribution. However, in most of the experiments conducted so far glyphosate-susceptible plants were used. Effects of glyphosate on Mn absorption kinetics, accumulation, and distribution within the plant, as well as soybean response to Mn as affected by glyphosate were studied in three experiments. In the first experiment, in nutrient solution, the effect of glyp...

  12. Glyphosate and its formulations – Toxicity, occupational and environmental exposure

    OpenAIRE

    Marta Kwiatkowska; Paweł Jarosiewicz; Bożena Bukowska

    2013-01-01

    Glyphosate (N-(phosphonomethyl)glycine) is an active ingredient of the most widely used herbicide formulations in protecting agricultural and horticultural crops. Numerous results (mostly published in the years 2010-2013) concerning the action of glyphosate and its formulations in the recent decade were analyzed. Initial reports about alleged biodegradability of glyphosate in the environment turned out to be wrong. It has been shown that glyphosate remains in the soil and can reach people by ...

  13. Economic assessment of alternatives for glyphosate application in arable farming

    OpenAIRE

    Kehlenbeck, Hella; Saltzmann, Jovanka; Schwarz, Jürgen; Zwerger, Peter; Nordmeyer, Henning

    2016-01-01

    Application and sales of herbicides with glyphosate have strongly increased in Germany during the past 10 years. This has raised a number of questions and discussions concerning glyphosate use. Therefore, this paper identifies and evaluates alternatives with an efficacy almost equivalent to glyphosate for different treatmentareas in terms of economic consequences for farms in comparison to glyphosate use by way of example. With the help of exemplary crop rotations uses in arable farming fo...

  14. Molecular basis of glyphosate resistance: Different approaches through protein engineering

    OpenAIRE

    Pollegioni, Loredano; Schonbrunn, Ernst; Siehl, Daniel

    2011-01-01

    Glyphosate (N-phosphonomethyl-glycine) is the most-used herbicide in the world: glyphosate-based formulations exhibit broad-spectrum herbicidal activity with minimal human and environmental toxicity. The extraordinary success of this simple small molecule is mainly due to the high specificity of glyphosate towards the plant enzyme enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway leading to biosynthesis of aromatic amino acids. Starting in 1996, transgenic glyphosate-resistan...

  15. Glyphosate and its formulations – Toxicity, occupational and environmental exposure

    Directory of Open Access Journals (Sweden)

    Marta Kwiatkowska

    2013-10-01

    Full Text Available Glyphosate (N-(phosphonomethylglycine is an active ingredient of the most widely used herbicide formulations in protecting agricultural and horticultural crops. Numerous results (mostly published in the years 2010-2013 concerning the action of glyphosate and its formulations in the recent decade were analyzed. Initial reports about alleged biodegradability of glyphosate in the environment turned out to be wrong. It has been shown that glyphosate remains in the soil and can reach people by spreading along with groundwater. Recent publications have shown that glyphosate is detected at low concentrations in the human blood. Publications cited in this article, which indicate a possible induction of neoplastic changes by glyphosate formulation, have raised great concern and controversy in the scientific world. Presenting adverse effects of glyphosate and its formulations we focused on the role of glyphosate formulations in hormonal disorders by impeding the expression of steroidogenic acute regulatory protein and the inhibition of aromatase activity. The impact of glyphosate on oxygen reactive species formation, changes in redox system and the effect on necrosis and apoptosis in various types of cells was shown. We also revealed that glyphosate as a phosphonate herbicide does not inhibit directly the activity of acetylcholinesterase. Based on numerous studies it was noted that commercial formulations of glyphosate exhibit higher toxicity than that of the active substance itself. The discussed problems clearly show the need to evaluate the toxicity of glyphosate and its formulations and related potential threat to humans. Med Pr 2013;64(5:717–729

  16. Glyphosate reduced seed and leaf concentrations of calcium, manganese, magnesium, and iron in non-glyphosate resistant soybean

    OpenAIRE

    ÇAKMAK, İsmail; Cakmak, Ismail; Yazıcı, M. Atilla; YAZICI, M. Atilla; Tutuş, Yusuf; Tutus, Yusuf; Öztürk, Levent; Ozturk, Levent

    2009-01-01

    Greenhouse experiments were conducted to study the effects of glyphosate drift on plant growth and concentrations of mineral nutrients in leaves and seeds of non-glyphosate resistant soybean plants (Glycine max, L.). Glyphosate was sprayed on plant shoots at increasing rates between 0.06 and 1.2% of the recommended application rate forweed control. In an experiment with 3-week-old plants, increasing application of glyphosate on shoots significantly reduced chlorophyll concentration of the ...

  17. Glyphosate translocation in herbicide tolerant plants Translocação do glyphosate em plantas tolerantes ao herbicida

    OpenAIRE

    L Galon; E.A. Ferreira; I. Aspiazú; G. Concenço; A.F. Silva; Silva, A. A.; Vargas, L.

    2013-01-01

    The objective of this study was to evaluate glyphosate translocation in glyphosate-tolerant weed species (I. nil, T. procumbens and S. latifolia) compared to glyphosate-susceptible species (B. pilosa). The evaluations of 14C-glyphosate absorption and translocation were performed at 6, 12, 36 and 72 hours after treatment (HAT) in I. nil and B. pilosa, and only at 72 HAT in the species T. procumbens and S. latifolia. The plants were collected and fractionated into application leaf, other leaves...

  18. Glyphosate-Resistant and Conventional Canola (Brassica napus L.) Responses to Glyphosate and Aminomethylphosphonic Acid (AMPA) Treatment.

    Science.gov (United States)

    Corrêa, Elza Alves; Dayan, Franck E; Owens, Daniel K; Rimando, Agnes M; Duke, Stephen O

    2016-05-11

    Glyphosate-resistant (GR) canola contains two transgenes that impart resistance to the herbicide glyphosate: (1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and (2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshikimic acid-3-phosphate synthase. The objectives of this research were to determine the phytotoxicity of AMPA to canola, the relative metabolism of glyphosate to AMPA in GR and conventional non-GR (NGR) canola, and AMPA pool sizes in glyphosate-treated GR canola. AMPA applied at 1.0 kg ha(-1) was not phytotoxic to GR or NGR. At this AMPA application rate, NGR canola accumulated a higher concentration of AMPA in its tissues than GR canola. At rates of 1 and 3.33 kg ae ha(-1) of glyphosate, GR canola growth was stimulated. This stimulatory effect is similar to that of much lower doses of glyphosate on NGR canola. Both shikimate and AMPA accumulated in tissues of these glyphosate-treated plants. In a separate experiment in which young GR and NGR canola plants were treated with non-phytotoxic levels of [(14)C]-glyphosate, very little glyphosate was metabolized in NGR plants, whereas most of the glyphosate was metabolized to AMPA in GR plants at 7 days after application. Untreated leaves of GR plants accumulated only metabolites (mostly AMPA) of glyphosate, indicating that GOX activity is very high in the youngest leaves. These data indicate that more glyphosate is transformed to AMPA rapidly in GR canola and that the accumulated AMPA is not toxic to the canola plant. PMID:27092715

  19. Glyphosate resistant and susceptible soybean (Glycine max) and canola (Brassica napus) dose response and metabolism relationships with glyphosate

    Science.gov (United States)

    Experiments were conducted to determine 1) dose response of glyphosate-resistant (GR) and –susceptible (non-GR) soybean [Glycine max (L.) Merr.] and canola (Brassica napus L.) to glyphosate, 2) if differential metabolism of glyphosate to aminomethylphosphonic acid (AMPA) is the underlying mechanism ...

  20. Glyphosate-Resistant Goosegrass from Mississippi

    Directory of Open Access Journals (Sweden)

    Vijay K. Nandula

    2013-05-01

    Full Text Available A suspected glyphosate-resistant goosegrass [Eleusine indica (L. Gaertn.] population, found in Washington County, Mississippi, was studied to determine the level of resistance and whether the resistance was due to a point mutation, as was previously identified in a Malaysian population. Whole plant dose response assays indicated a two- to four-fold increase in resistance to glyphosate. Leaf disc bioassays based on a glyphosate-dependent increase in shikimate levels indicated a five- to eight-fold increase in resistance. Sequence comparisons of messenger RNA for epsps, the gene encoding the enzyme 5-enolpyruvylshikimate-3-phosphate synthase, from resistant and sensitive goosegrass, revealed a cytosine to thymine nucleotide change at position 319 in the resistant accessions. This single nucleotide polymorphism causes a proline to serine amino acid substitution at position 106 in 5-enolpyruvylshikimate-3-phosphate synthase. A real-time polymerase chain reaction assay using DNA probes specific for the nucleotide change at position 319 was developed to detect this polymorphism. Goosegrass from 42 locations were screened, and the results indicated that glyphosate-resistant goosegrass remained localized to where it was discovered. Pendimethalin, s-metolachlor, clethodim, paraquat and fluazifop controlled resistant goosegrass 93% to 100%, indicating that several control options for glyphosate-resistant goosegrass are available.

  1. Phosphate fertilizer impacts on glyphosate sorption by soil.

    Science.gov (United States)

    Munira, Sirajum; Farenhorst, Annemieke; Flaten, Don; Grant, Cynthia

    2016-06-01

    This research examined the impact of field-aged phosphate and cadmium (Cd) concentrations, and fresh phosphate co-applications, on glyphosate sorption by soil. Soil samples were collected in 2013 from research plots that had received, from 2002 to 2009, annual applications of mono ammonium phosphate (MAP) at 20, 40 and 80 kg P ha(-1) and from products containing 0.4, 70 or 210 mg Cd kg(-1) as an impurity. A series of batch equilibrium experiments were carried out to quantify the glyphosate sorption distribution constant, Kd. Extractable Cd concentrations in soil had no significant effect on glyphosate sorption. Glyphosate Kd values significantly decreased with increasing Olsen-P concentrations in soil, regardless of the pH conditions studied. Experiments repeated with a commercially available glyphosate formulation showed statistically similar results as the experiments performed with analytical-grade glyphosate. Co-applications of MAP with glyphosate also reduced the available sorption sites to retain glyphosate, but less so when soils already contain large amounts of phosphate. Glyphosate Kd values in soils ranged from 173 to 939 L kg(-1) under very strong to strongly acidic condition but the Kd was always glyphosate may become mobile by water in soils with high phosphate levels. Otherwise, glyphosate residues in agricultural soils are more likely to be transported off-site by wind and water-eroded sediments than by leaching or runoff. PMID:27035384

  2. The EPSPS Pro106Ser substitution solely accounts for glyphosate resistance in a goosegrass (Eleusine indica) population from Tennessee, United States

    Institute of Scientific and Technical Information of China (English)

    Janel L Huffman; Chance W Riggins; Lawrence E Steckel; Patrick J Tranel

    2016-01-01

    Previous studies have documented the occurrence of glyphosate-resistant (GR) goosegrass (Eleusine indica (L.) Gaertn.) and, in at least some cases, resistance is due to an altered target site. Research was performed to determine if an altered target site was responsible for GR in a Tennessee, United States goosegrass population (TennGR). DNA sequencing revealed a mutation in TennGR plants conferring the Pro106Ser 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) substitution previously identiifed in other GR populations. F2 populations were derived from TennGR plants crossed with plants from a glyphosate-susceptible population (TennGS) and analyzed for their response to glyphosate and genotyped at the EPSPS locus. Plants from the F2 populations segregated 1:2:1 sensitive:intermediate:resistant in response to a selec-tive dose of glyphosate, and these responses co-segregated with the EPSPS genotypes (PP106, PS106, and SS106). To separately investigate the effect of the Pro106Ser substitution on GR, glyphosate dose-response curves and 50% effective dose (ED50) values were compared among the three genotypes and the two parental populations. The SS106 genotype was 3.4-fold resistant relative to the PP106 genotype, identical to the resistance level obtained when comparing the resistant and susceptible parental populations. We conclude that the mutation conferring a Pro106Ser EPSPS mutation is solely responsible for GR in the TennGR goosegrass population.

  3. Effect of glyphosate on reproductive organs in male rat.

    Science.gov (United States)

    Dai, Pengyuan; Hu, Ping; Tang, Juan; Li, Yansen; Li, Chunmei

    2016-06-01

    Glyphosate as an active ingredient of Roundup(®) which is thought to be one of the most popular herbicide was used worldwide. Many studies have focused on reproductive toxicity on glyphosate-based herbicide, but few evidence exists to imply the male reproductive toxicity of glyphosate alone in vivo. In this study SD rats were Lavaged with glyphosate at doses of 5, 50, 500mg/kg to detect the toxicity of glyphosate on rat testis. Glyphosate significantly decreased the average daily feed intake at dose of 50mg/kg, and the weight of seminal vesicle gland, coagulating gland as well as the total sperm count at dose of 500mg/kg. Immunohistochemistry of androgen receptor (AR) has no difference among all groups. As to testosterone, estradiol, progesterone and oxidative stress parameters, the level of them has no differences amidst all doses. Taken together, we conclude that glyphosate alone has low toxicity on male rats reproductive system. PMID:27286640

  4. Cadmium adsorption in montmorillonite as affected by glyphosate

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; LUO Xiao-san; SUN Rui-juan; CHEN Huai-man

    2004-01-01

    Behaviors of soil heavy metals are often affected by coexisting herbicides due to their physical and chemical interaction. Effect of glyphosate, an herbicide containing -PO32- and -COOH groups, on cadmium adsorption in montmorillonite was studied in detail. The results showed that cadmium adsorption quantity in montmorillonite increased with increasing soil solution pH and cadmium concentration as usual, but decreased with glyphosate, which is due to the formation of a low affinity complex of Cd and glyphosate and decreasing solution pH induced by glyphosate addition. When the equilibrium solution pH was below 6.7, glyphosate has little effect on cadmium adsorption, but when the equilibrium solution pH was above 6.7, glyphosate significantly decreased cadmium adsorption quantity in montmorillonite. In addition, the adding order of Cd and glyphosate also influenced Cd adsorption quantity in montmorillonite.

  5. AUXIN-PRODUCING BACTERIA AND UREASE ACTIVITY IN THE RHIZOSPHERE OF GLYPHOSATE-RESISTANT SOYBEAN

    Science.gov (United States)

    Repeated use of glyphosate on glyphosate-resistant crops has raised concerns regarding the potential environmental impacts of this herbicide. Glyphosate may affect microbial production of plant-growth-regulating compounds including hydrogen cyanide, phytohormones including auxins, and other unidenti...

  6. Interação de glyphosate com carfentrazone-ethyl Glyphosate - carfentrazone-ethyl interaction

    OpenAIRE

    R.C. Werlang; Silva, A. A.

    2002-01-01

    Foi conduzido um experimento em condições controladas para determinar a interação do carfentrazone-ethyl em mistura no tanque com o herbicida glyphosate, no controle de seis espécies de plantas daninhas. Glyphosate aplicado isoladamente na dose de 720 g ha-1 foi eficaz no controle de Amaranthus hybridus (100%), Desmodium tortuosum (100%), Bidens pilosa (99%), Eleusine indica (96%), Digitaria horizontalis (100%) e Commelina benghalensis (93%) aos 21 DAA. Carfentrazone-ethyl aplicado isoladamen...

  7. Glyphosate in Runoff Waters and in the Root-Zone: A Review

    OpenAIRE

    Saunders, Lyndsay E.; Reza Pezeshki

    2015-01-01

    Glyphosate is the most commonly-used herbicide in the world. The present review summarizes the discovery, prevalence, chemical and physical properties, mode of action and effects in plants, glyphosate resistance and the environmental fate of glyphosate. Numerous studies are reviewed that demonstrate that glyphosate may run off of fields where it is applied, while other studies provide evidence that plant roots can take up glyphosate. Non-target vegetation may be exposed to glyphosate in the r...

  8. Interação de glyphosate com carfentrazone-ethyl Glyphosate - carfentrazone-ethyl interaction

    Directory of Open Access Journals (Sweden)

    R.C. Werlang

    2002-04-01

    Full Text Available Foi conduzido um experimento em condições controladas para determinar a interação do carfentrazone-ethyl em mistura no tanque com o herbicida glyphosate, no controle de seis espécies de plantas daninhas. Glyphosate aplicado isoladamente na dose de 720 g ha-1 foi eficaz no controle de Amaranthus hybridus (100%, Desmodium tortuosum (100%, Bidens pilosa (99%, Eleusine indica (96%, Digitaria horizontalis (100% e Commelina benghalensis (93% aos 21 DAA. Carfentrazone-ethyl aplicado isoladamente controlou eficazmente C. benghalensis. As misturas de glyphosate nas doses de 252 e 720 g ha-1 com carfentrazone-ethyl nas doses de 15 e 30 g ha¹ demonstraram efeito aditivo no controle de A. hybridus, D. tortuosum e Bidens pilosa, à exceção das misturas de glyphosate na dose de 252 g ha-1 com as doses de 15 e 30 g ha-1 de carfentrazone-ethyl, que proporcionam efeito sinergístico no controle de D. tortuosum. A adição das duas doses de carfentrazone-ethyl antagonizou o efeito de glyphosate na menor dose (252 g ha-1 no controle de E. indica, apresentando, no entanto, efeito aditivo com o glyphosate na maior dose (720 g ha-1. Já para D. horizontalis, as misturas de carfentrazone-ethyl com glyphosate na menor dose (252 g ha-1 apresentaram efeito sinergístico no controle dessa espécie, demonstrando, ainda, efeito aditivo na mistura com glyphosate na dose de 720 g ha-1. A mistura de carfentrazone-ethyl com glyphosate proporcionou efeito aditivo no controle de C. benghalensis, independentemente das combinações de doses avaliadas. Os resultados deste experimento indicam que carfentrazone-ethyl apresenta comportamento diferenciado quanto à interação com glyphosate, dependendo da espécie de planta daninha e da dose dos herbicidas utilizados na mistura em tanque, sendo complementar na mistura em tanque com glyphosate, pois demonstrou efeito antagônico em poucas das combinações estudadas, prevalecendo seu efeito aditivo na mistura com glyphosate, no

  9. Chemical control alternatives for sourgrass (Digitaria insularis resistant to glyphosate

    Directory of Open Access Journals (Sweden)

    Marcel Sereguin Cabral de Melo

    2012-08-01

    Full Text Available Herbicides alternatives for controlling sourgrass (Digitaria insularis weed in infested citrus areas are limited, mainly due to the few options of registered herbicides and by the modalities in that these chemical products are used (directed applications. Thus it is important to evaluate other post-emergence herbicides, to be used in association with glyphosate, for the efficient control of glyphosate-resistant biotype of sourgrass (Digitaria insularis, resistant to glyphosate.  The experiment was conducted in Matão County, Sao Paulo State, in area belonging to Cambuhy Farm, during September to October 2009, in areas presenting biotypes of D. insularis resistant to glyphosate. Application occurred when sourgrass plants were with 3 to 5 tillers stage. Treatments consisted of different herbicides in association with glyphosate. It was conducted control visual assesments at 7, 14, 21, 28 and 35 days after application and collecting and weighting of weed dry mass dossel. Treatments that showed better results were glyphosate in association with clethodim, complemented by paraquat + diuron 7 days after the first application and glyphosate in association with clethodim complemented by  ammonium-glufosinate 7 days after the first application. Further, glyphosate treatments mixture to haloxyfop-methyl, glyphosate + fenoxaprop-p-ethyl + clethodim and glyphosate + tepraloxydim showed excelent performance, even with just one application.

  10. Glyphosate fate in soils when arriving in plant residues.

    Science.gov (United States)

    Mamy, Laure; Barriuso, Enrique; Gabrielle, Benoît

    2016-07-01

    A significant fraction of pesticides sprayed on crops may be returned to soils via plant residues, but its fate has been little documented. The objective of this work was to study the fate of glyphosate associated to plants residues. Oilseed rape was used as model plant using two lines: a glyphosate-tolerant (GT) line and a non-GT one, considered as a crucifer weed. The effects of different fragmentation degrees and placements in soil of plant residues were tested. A control was set up by spraying glyphosate directly on the soil. The mineralization of glyphosate in soil was slower when incorporated into plant residues, and the amounts of extractable and non-extractable glyphosate residues increased. Glyphosate availability for mineralization increased when the size of plant residues decreased, and as the distribution of plant residues in soil was more homogeneous. After 80 days of soil incubation, extractable (14)C-residues mostly involved one metabolite of glyphosate (AMPA) but up to 2.6% of initial (14)C was still extracted from undecayed leaves as glyphosate. Thus, the trapping of herbicides in plant materials provided a protection against degradation, and crops residues returns may increase the persistence of glyphosate in soils. This pattern appeared more pronounced for GT crops, which accumulated more non-degraded glyphosate in their tissues. PMID:27077537

  11. 78 FR 60707 - Glyphosate; Pesticide Tolerances

    Science.gov (United States)

    2013-10-02

    ... with glyphosate follows. In the Federal Register of May 1, 2013 (78 FR 25396) (FRL-9384-3), EPA issued... April 20, 2011 (76 FR 22067) (FRL-8869- 7), EPA issued a document pursuant to FFDCA section 408(d)(3... Register of May 1, 2013 (78 FR 25396), EPA concludes that there is a reasonable certainty that no harm...

  12. 75 FR 17768 - Glyphosate From China

    Science.gov (United States)

    2010-04-07

    ....8 of the Commission's rules, as amended, 67 FR 68036 (November 8, 2002). Even where electronic...(C) of the Commission's Handbook on Electronic Filing Procedures, 67 FR 68168, 68173 (November 8... COMMISSION Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Institution...

  13. RHIZOSPHERE ECOLOGY AND GLYPHOSATE-RESISTANT SOYBEAN

    Science.gov (United States)

    The interaction of glyphosate-resistant (GR) soybean with the ecology of plant-associated microbial populations has been the subject of environmental assessments in response to the public concern regarding the ecological compatibility of transgenic crops. Changes in the dynamics of soil and rhizosph...

  14. Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes

    OpenAIRE

    Baoqing Dun; Xujing Wang; Wei Lu; Ming Chen; Wei Zhang; Shuzhen Ping; Zhixing Wang; Baoming Zhang; Min Lin

    2014-01-01

    The widely used herbicide glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Glyphosate acetyltransferase (GAT) effectively detoxifies glyphosate by N-acetylation. With the aim of identifying a new strategy for development of glyphosate-tolerant crops, the plant expression vector pG2-GAT harboring gat and G2-aroA (encoding EPSPS) has been transformed into tobacco (Nicotiana tabacum) to develop novel plants with higher tolerance to glyphosate. Results from Southern and Wes...

  15. Sensibilidade de estirpes de Bradyrhizobium ao glyphosate

    Directory of Open Access Journals (Sweden)

    Rodrigo Josemar Seminoti Jacques

    2010-02-01

    Full Text Available A aplicação do glyphosate sobre a soja resistente a este herbicida pode causar prejuízos à simbiose com o rizóbio. O objetivo deste trabalho foi avaliar a sensibilidade ao herbicida glyphosate de três estirpes de Bradyrhizobium recomendadas para a produção de inoculantes de sementes de soja no Brasil. Avaliou-se o efeito das concentrações de 0,0; 5,4; 10,8; 21,6 e 43,2 µg L-1 do ingrediente ativo do glyphosate [N-(fosfonometil glicina] no meio YM líquido sobre o crescimento de B. japonicum (estirpe SEMIA 5079 e de B. elkanii (estirpe SEMIA 5019 e estirpe SEMIA 587, por meio de leituras das densidades óticas e geração de curvas de crescimento. As reduções de crescimento na presença da menor concentração do glyphosate foram de 18% para SEMIA 5079, 29% para SEMIA 5019 e de 35% para SEMIA 587, sendo, de modo geral, quanto maior a concentração do herbicida no meio de cultura maior a inibição do crescimen­to. As estirpes apresentaram sensibilidade diferencial somente às concentrações mais baixas do glyphosate; nesse caso, foi possível determinar a seguinte ordem de sensibilidade: SEMIA 587 > SEMIA 5019 > SEMIA 5079. Essa sensibilidade diferencial é dependente da concentração do herbicida, pois na presença de 43,2 µg L-1 todas as estirpes tiveram seu crescimento severamente reduzido, não havendo diferença entre elas.

  16. Differential response of two sourgrass populations to glyphosate

    Directory of Open Access Journals (Sweden)

    São Paulo State University, Jaboticabal, SP, Brazil

    2013-02-01

    Full Text Available The repetitive use of glyphosate may cause increase on the resistance of sourgrass (Digitaria insularis through mechanisms of natural selection. The aim of this study was to verify the response of two populations of sourgrass (one collected from nonagricultural area and the other one from area suspected of glyphosate resistance to increasing doses of glyphosate. The experimental design was completely randomized with four repetitions. For both populations, glyphosate was sprayed at 10 doses (0D, D/16, D/8, D/4, D/2, D, 2D, 4D, 8D, and 16D; so that D is the dose of 1.08 kg e.a. ha-1. The treatments were sprayed when the plants had shown 3-5 tillers. The population collected in the nonagricultural area was slightly more sensible to the herbicide glyphosate than the population originated from an area where the herbicide application is common, not indicating glyphosate resistance.

  17. Identification of glyphosate resistance in Lolium rigidum Gaudin

    OpenAIRE

    Danijela Pavlović; Charlie Reinhardt; Igor Elezović; Sava Vrbničanin

    2011-01-01

    Glyphosate resistance was found in Lolium rigidum Gaudin (Rigid ryegrass, LOLRI) in South Africa. Suspected glyphosate-resistant L. rigidum populations were collected and grown under greenhouse conditions. The plants were sprayed with a range of doses of glyphosate 35 days after planting and shoot dry biomass was determined 17 days after herbicide treatment. Based on the dose-response experiment conducted in the greenhouse, one population of L. rigidum susp...

  18. Comparison of Torpedograss and Pickerelweed Susceptibility to Glyphosate

    OpenAIRE

    Gettys, Lyn A.; Sutton, David L.

    2004-01-01

    Torpedograss (Panicum repens L.) is one of the most invasive exotic plants in aquatic systems. Repeat applications of (N-phosphonomethyl) glycine (glyphosate) herbicides provide limited control of torpedograss; unfortunately, glyphosate often negatively impacts most non-target native species that grow alongside the weed. This experiment studied the effect of glyphosate on pickerelweed (Pontederia cordata L.), a native plant that shares habitats with torpedograss. Actively gr...

  19. Exploring the effects of glyphosate products on weed composition

    OpenAIRE

    Koning, Laurie Anne; Sefzat, David; Gerowitt, Bärbel

    2016-01-01

    Glyphosate is a non-selective, broad-spectrum, systematic herbicide that is the world’s most widely used herbicide since its introduction in the 1970s as a pre-plant, post-directed and post-harvest herbicide application with further technological developments leading to its use within glyphosate resistant crops (GRCs) as of the 1990s. In countries around the world, weed shifts have accompanied weed management systems employing glyphosate products. The farmer actions and weed reactions that ha...

  20. Metabolism of glyphosate in Pseudomonas sp. strain LBr.

    OpenAIRE

    Jacob, G S; Garbow, J.R.; Hallas, L E; Kimack, N M; Kishore, G M; Schaefer, J.

    1988-01-01

    Metabolism of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. strain LBr, a bacterium isolated from a glyphosate process waste stream, was examined by a combination of solid-state 13C nuclear magnetic resonance experiments and analysis of the phosphonate composition of the growth medium. Pseudomonas sp. strain LBr was capable of eliminating 20 mM glyphosate from the growth medium, an amount approximately 20-fold greater than that reported for any other microorganism to date. The bact...

  1. Refractory cardiopulmonary failure after glyphosate surfactant intoxication: a case report

    OpenAIRE

    Chang Chia-Chu; Chang Chirn-Bin

    2009-01-01

    Abstract Background Glyphosate is an herbicide considered to be of low toxicity to humans because its effects are specific to plants. However, fatal reactions to glyphosate have been reported after the ingestion of large amounts. Pulmonary edema, shock, and arrhythmia were the reported causes of mortality. Case presentation We present the case of a 57-year-old woman who was admitted to the emergency department unconsciousness after ingestion of glyphosate surfactant in a suicide attempt. Meta...

  2. Protein kinase GCN2 mediates responses to glyphosate in Arabidopsis

    OpenAIRE

    Faus, I.; ZABALZA OSTOS, ANA Mª; Santiago, J.; González Nebauer, Sergio; Royuela, M.; Serrano, R; J Gadea

    2015-01-01

    Background The increased selection pressure of the herbicide glyphosate has played a role in the evolution of glyphosate-resistance in weedy species, an issue that is becoming a threat to global agriculture. The molecular components involved in the cellular toxicity response to this herbicide at the expression level are still unidentified. Results In this study, we identify the protein kinase GCN2 as a cellular component that fosters the action of glyphosate in the model plant Arabidopsis tha...

  3. Manganese uptake and redistribution in soybean as affected by glyphosate

    Directory of Open Access Journals (Sweden)

    Ciro Antonio Rosolem

    2010-12-01

    Full Text Available Detrimental effects of glyphosate on plant mineral nutrition have been reported in the literature, particularly on Mn uptake and redistribution. However, in most of the experiments conducted so far glyphosate-susceptible plants were used. Effects of glyphosate on Mn absorption kinetics, accumulation, and distribution within the plant, as well as soybean response to Mn as affected by glyphosate were studied in three experiments. In the first experiment, in nutrient solution, the effect of glyphosate on soybean Mn uptake kinetic parameters (Imax, Km and Cmin was determined. In a second experiment, also in nutrient solution, differential Mn accumulation and distribution were studied for a conventional soybean cultivar and its near-isogenic glyphosate-resistant counterpart as affected by glyphosate. In a third experiment, response of glyphosate-resistant soybean cultivars to Mn application was studied in the presence of glyphosate, in pots with Mn-deficient soil. Maximum Mn influx (Imax was higher in the herbicide-resistant (GR cultivar than in its conventional counterpart. Glyphosate applied to nutrient solution at low rates decreased Km and Cmin. A few days after herbicide treatment, RR soybean plants developed yellowish leaves, a symptom which, in the field, could be misinterpreted as Mn deficiency, but herbicide application had no effect on Mn uptake or distribution within the plant. In the soil experiment, soybean Mn uptake was increased by Mn application, with no effect of glyphosate. Under greenhouse conditions, there was no evidence of deleterious effects of glyphosate on Mn absorption, accumulation and distribution in the plant and on soybean cultivars response to Mn application.

  4. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate

    OpenAIRE

    Wang, Cong; Lin, Xin; Li, Ling; Lin, Senjie

    2016-01-01

    Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta). Based on growth responses to different concentrations of glyphosate under contrasting dissolv...

  5. Physiology of Glyphosate-Resistant and Glyphosate-Susceptible Palmer Amaranth (Amaranthus palmeri) Biotypes Collected from North Carolina

    OpenAIRE

    Jared R. Whitaker; James D. Burton; Alan C. York; Jordan, David L.; Aman Chandi

    2013-01-01

    Glyphosate-resistant (GR) biotypes of Palmer amaranth are now commonly found across the southern United States. Experiments were conducted to characterize physiological differences between a GR biotype and a glyphosate-susceptible (GS) biotype from North Carolina. The GR biotype had an 18-fold level of resistance based upon rates necessary to reduce shoot fresh weight 50%. Shikimate accumulated in both biotypes following glyphosate application, but greater concentrations were found in GS plan...

  6. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate

    Science.gov (United States)

    Wang, Cong; Lin, Xin; Li, Ling; Lin, Senjie

    2016-01-01

    Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta). Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP) conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum) could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella) could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana) and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina) regardless of DIP condition. Group V (Amphidinium carterae) exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine phytoplankton

  7. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate.

    Directory of Open Access Journals (Sweden)

    Cong Wang

    Full Text Available Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta. Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina regardless of DIP condition. Group V (Amphidinium carterae exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine

  8. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate.

    Science.gov (United States)

    Wang, Cong; Lin, Xin; Li, Ling; Lin, Senjie

    2016-01-01

    Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta). Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP) conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum) could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella) could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana) and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina) regardless of DIP condition. Group V (Amphidinium carterae) exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine phytoplankton

  9. Draft Genome Sequence of Pseudomonas Strain P818, Isolated from Glyphosate-Polluted Soil

    OpenAIRE

    Cao, Gaoyi; Liu, Yunjun; Liu, Guiming; Wang, Jianhua; Wang, Guoying

    2013-01-01

    Pseudomonas strain P818 was isolated from glyphosate-polluted soil in China. This bacterium presents a capacity for high glyphosate tolerance. We present the draft genome sequence of the strain Pseudomonas P818. The genes involved in the glyphosate tolerance were identified. This genomic information will facilitate the study of glyphosate tolerance mechanisms.

  10. Differentiating glyphosate-resistant and glyphosate-sensitive Italian ryegrass using hyperspectral imagery

    Science.gov (United States)

    Lee, Matthew A.; Huang, Yanbo; Nandula, Vijay K.; Reddy, Krishna N.

    2014-05-01

    Glyphosate based herbicide programs are most preferred in current row crop weed control practices. With the increased use of glyphosate, weeds, including Italian ryegrass (Lolium multiflorum), have developed resistance to glyphosate. The identification of glyphosate resistant weeds in crop fields is critical because they must be controlled before they reduce the crop yield. Conventionally, the method for the identification with whole plant or leaf segment/disc shikimate assays is tedious and labor-intensive. In this research, we investigated the use of high spatial resolution hyperspectral imagery to extract spectral curves derived from the whole plant of Italian ryegrass to determine if the plant is glyphosate resistant (GR) or glyphosate sensitive (GS), which provides a way for rapid, non-contact measurement for differentiation between GR and GS weeds for effective site-specific weed management. The data set consists of 226 greenhouse grown plants (119 GR, 107 GS), which were imaged at three and four weeks after emergence. In image preprocessing, the spectral curves are normalized to remove lighting artifacts caused by height variation in the plants. In image analysis, a subset of hyperspectral bands is chosen using a forward selection algorithm to optimize the area under the receiver operating characteristic (ROC) between GR and GS plants. Then, the dimensionality of selected bands is reduced using linear discriminant analysis (LDA). Finally, the maximum likelihood classification was conducted for plant sample differentiation. The results show that the overall classification accuracy is between 75% and 80% depending on the age of the plants. Further refinement of the described methodology is needed to correlate better with plant age.

  11. Metallic complexes with glyphosate: a review

    International Nuclear Information System (INIS)

    We present studies involving metallic ions and the herbicide glyphosate. The metallic complexes of Cu(II), Zn(II), Mn(II), Ni(II), Cd(II), Pb(II), Cr(III), Fe(III), Co(III), ammonium, sodium, Ag(I), alkaline earth metals and of some lanthanides ions are described. The complexes are discussed in terms of their synthesis, identification, stability and structural properties, based on data from the current literature. (author)

  12. Synthesis of 15N labeled glyphosate

    International Nuclear Information System (INIS)

    Amongst the actually commercialized herbicides the Glyphosate is the most used in Brazil. Its efficiency as well as the others herbicides against undesirable weeds is harmed by its final composts left at the environment. Although studies has being carried out to improve the knowledge about the herbicides behavior at the environment its complexity has led them towards innumerous to new significant research work where the use of radiolabeled composts (radiative tracers) are recommended to evaluate their bio-availability in the soil. However is the use, the manipulation and the storage of radiolabeled composts is requires an extra care under chemical safety point of view. The use of non radiolabeled composts is a world tendency especially for field researches. Under this context the presented work describes a method for the synthesis of 15N labeled glyphosate. The 15N-herbicide was undertaken by phosphometilation with the phosphit dialquil and 15N-glycine. The tests where carried out through a micro scale production plant and of equimolars amounts. At these conditions it's was possible to reach approximately a 20% of yield. At the conclusion of a best operational condition its expected to offer another important toll that shall be used in glyphosate behavior at the environment and undesirably weeds. (author)

  13. Hormesis with glyphosate depends on coffee growth stage

    Science.gov (United States)

    Weed management systems in almost all Brazilian coffee plantations allow herbicide spray to drift on crop plants. In order to evaluate if there is any effect of the most commonly used herbicide in coffee production, glyphosate, on coffee plants, a range of glyphosate doses were applied directly on ...

  14. Soil Depth and Tillage Effects on Glyphosate Degradation

    Science.gov (United States)

    The use of glyphosate-resistant crops facilitated the widespread adoption of no-tillage (NT) cropping systems. The experimental objectives were to determine glyphosate sorption, mineralization, and persistence at two depths [0- to 2- cm (A) and 2- to 10-cm (B)] in a silt loam managed under long ter...

  15. Biological response of soybean and cotton to aerial glyphosate drift

    Science.gov (United States)

    An aerial application drift study was conducted in 2009 to determine biological effects of glyphosate on cotton (Gossypium hirsutum L.) and soybean [Glycine max (L.) Merr.]. Glyphosate at 866 g ae/ha was applied using an Air Tractor 402B agricultural aircraft in an 18.3 m spray swath to crops at the...

  16. Uses of glyphosate in German arable farming – operational aspects

    Directory of Open Access Journals (Sweden)

    Wiese, Armin

    2016-02-01

    Full Text Available Glyphosate is the most frequently used herbicide active ingredient in Germany. Studies regarding its usage in non-GMO arable farming are still rare even though it plays an important role in several agronomic situations. Therefore, we conducted a comprehensive survey, which was carried out among conventional German farms in Winter 2014/2015. Based on the results of this survey we analyzed via cluster analysis how types of farms differ in terms of glyphosate usage. An illustration of seven clusters allows deep insights into arable farm structures. The farm types can be distinguished regarding their tillage system and similar to this differentiation also concerning their intensity of glyphosate application. Furthermore, it becomes obvious that farm clusters with a higher level of glyphosate usage are characterized by a lower number of labourers per hectare, more arable land and/or enhanced cover cropping. Moreover, groups of farmers who rely more on glyphosate are more likely to state that they need glyphosate for herbicide resistance management. Farmers’ assessments of the economic importance of glyphosate usage vary depending on the type of farm. By means of the farm clusters, the most important situations of glyphosate usage can be further analyzed economically and scenarios for impact assessments can be made.

  17. Glyphosate effects on soil rhizosphere-associated bacterial communities.

    Science.gov (United States)

    Newman, Molli M; Hoilett, Nigel; Lorenz, Nicola; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W

    2016-02-01

    Glyphosate is one of the most widely used herbicides in agriculture with predictions that 1.35 million metric tons will be used annually by 2017. With the advent of glyphosate tolerant (GT) cropping more than 10 years ago, there is now concern for non-target effects on soil microbial communities that has potential to negatively affect soil functions, plant health, and crop productivity. Although extensive research has been done on short-term response to glyphosate, relatively little information is available on long-term effects. Therefore, the overall objective was to investigate shifts in the rhizosphere bacterial community following long-term glyphosate application on GT corn and soybean in the greenhouse. In this study, rhizosphere soil was sampled from rhizoboxes following 4 growth periods, and bacterial community composition was compared between glyphosate treated and untreated rhizospheres using next-generation barcoded sequencing. In the presence or absence of glyphosate, corn and soybean rhizospheres were dominated by members of the phyla Proteobacteria, Acidobacteria, and Actinobacteria. Proteobacteria (particularly gammaproteobacteria) increased in relative abundance for both crops following glyphosate exposure, and the relative abundance of Acidobacteria decreased in response to glyphosate exposure. Given that some members of the Acidobacteria are involved in biogeochemical processes, a decrease in their abundance could lead to significant changes in nutrient status of the rhizosphere. Our results also highlight the need for applying culture-independent approaches in studying the effects of pesticides on the soil and rhizosphere microbial community. PMID:26580738

  18. Pitted and Hybrid Morningglory Accessions Have Variable Tolerance to Glyphosate

    Science.gov (United States)

    Greenhouse studies were conducted to investigate the variability in tolerance to glyphosate among 38 accessions of pitted morningglory collected from several southern United States. Glyphosate at 420 g ae/ha was applied postemergence to plants at 4- to 5-leaf stage and control was visually estimated...

  19. Potato (Solanum tuberosum) response to simulated glyphosate drift

    Science.gov (United States)

    Field studies were conducted in 2008 in Ontario, OR and Paterson, WA to determine the effect of simulated glyphosate drift on 'Ranger Russet' potato injury, shikimic acid accumulation, and tuber yield. Glyphosate was applied at 8.5-, 54-, 107-, 215-, and 423 g ae ha-1; which corresponds to 0.01, 0.0...

  20. Effects of Transgenic Glyphosate-Resistant Crops on Water Quality

    Science.gov (United States)

    Glyphosate (N-[phosphonomethyl] glycine) is a highly effective, non-selective herbicide. Herbicide-resistant crop (HRC) has been the most successful trait used in transgenic crops throughout the world. Transgenic glyphosate-resistant crops (GRCs) have been commercialized and grown extensively in the...

  1. Heterodera glycines Population Development on Soybean Treated with Glyphosate

    Science.gov (United States)

    Soybean cyst nematode (Heterodera glycines) is a major yield limiting pest in all major soybean producing countries. In the last decade genetically modified soybean tolerant to glyphosate has become widely planted and postemergence application of glyphosate has increased exponentially. Genetically m...

  2. Study of glyphosate transport through suspended particulate matter

    Science.gov (United States)

    Amiot, Audrey; Landry, David; Jadas-Hécart, Alain; La Jeunesse, Isabelle; Sourice, Stéphane; Ballouche, Aziz

    2014-05-01

    The results have been produced in a project aiming to improve the water quality of the Layon localy supported by stakeholders involved in the implementation of the Water Framework Directive as the SAGE-Layon Aubance. The study site is a small vineyard catchment (2.2 ha) of the Loire Valley. The slopes of the study site are between 8 and 40% resulting in strong erosive episodes during rainy event. The main objective is to understand the transfer of pesticide residues to stream. Preliminary results have shown glyphosate can be found with high concentrations during runoff. However this study was realized only in the dissolved phase. The objective is now to understand the glyphosate transport driven by SPM. The methodology developed has been (i) characterization and production of the erodible water fraction from soils aggregates; (ii) achievement of the adsorption of glyphosate on these erodible materials to compare this results with adsorption on soil sieved to 2 mm, (iii) achievement of the desorption of glyphosate on these erodible materials. Measurements have been performed on soil samples distinguishing weed or grassed soils. Soils are sieved to 2 mm or between 2 and 5 mm (to produce the erodible water fraction). Both fractions are then used to glyphosate sorption and desorption. The erodible fraction was produce with a wet sieving machine (eijkelkampt Method Kemper and Rosenau, 1986), using sieve porosity of 250 microns. The fraction obtained at 250 microns is considered to be the erodible water fraction and is used to study the adsorption and desorption of glyphosate. Kinetics has been first carried out then the isotherm to obtain the value of Kd. A ratio soil/solution of 1/5 was used. Successive desorption's method was chosen with a stirring time of 20 min, centrifugation at 6000 g and the supernatant in each desorption of 20 min is analyzed. This step is repeated 25 times. The main results of the study are: (i) adsorption of glyphosate is rapid and almost

  3. Rhizosphere processes as determinants for glyphosate damage of non-target plants

    OpenAIRE

    Bott, Sebastian

    2010-01-01

    Due to low production costs and high herbicidal efficiency, glyphosate is the most widely used wide-spectrum herbicide. Glyphosate acts as a non-selective, total herbicide by inhibiting the biosynthesis of aromatic amino acids. Apart from glyphosate drift contamination, risks of glyphosate toxicity to crop plants and other non-target organisms are generally considered as marginal, because glyphosate is almost instantaneously inactivated by adsorption to the soil matrix and rapid microbial/che...

  4. Assessing the Value of Glyphosate in the South African Agricultural Sector

    OpenAIRE

    Gouse, Marnus

    2014-01-01

    This study assessed the value of glyphosate in the South African agricultural sector with focus on the 2012/13 agricultural season. Glyphosate is the most used herbicide in South African and in 2012 more than 23 million litres of glyphosate was sold at an estimated value of R641 million. Glyphosate is a highly effective broad spectrum herbicide and the only herbicide on the market with a systemic mode of action. Glyphosate is considered to be, based on numerous scientific studies environmenta...

  5. Fate of glyphosate stored in weed residues and the potential of phytotoxicity for following crops.

    OpenAIRE

    Tesfamariam, Tsehaye; Bott, Sebastian; Roemheld, Volker; Neumann, Guenter

    2009-01-01

    Glyphosate, a broad spectrum, non-selective herbicide, is the world´s most important and widely used herbicide. The globally increasing adoption of no-till or reduced tillage systems is becoming a driving force for enhanced glyphosate use. In such systems, glyphosate is applied pre-sowing for weed control and glyphosate may remain in root and shoot residues. To evaluate potential risks associated with glyphosate residues, a pot experiment was conducted under controlled greenhouse conditions w...

  6. Research on the weed control degree and glyphosate soil biodegradation in apple plantations (Pioneer variety)

    OpenAIRE

    Alexa, Ersilia; Roxana MICU; Monica NEGREA; Renata SUMALAN; Olimpia IORDANESCU

    2010-01-01

    In this study we follow control degree of glyphosate herbicide on weeds in apple plantations (Pioneer variety) of the Research Station Timisoara. It was also followed glyphosate biodegradation capacity in the soil by determining the amount of CO2 released by the action of microorganisms on C14 glyphosate marked isotope. Laboratory analysis of glyphosate residues in soil was made using a Liquid Scintillation TRIATHLER. Glyphosate biodegradation ability in the presence of soil microorganisms is...

  7. Glyphosate tolerance of soybean mutant gained after boarding on satellite

    International Nuclear Information System (INIS)

    Glyphosate-tolerant germplasm and genetic variation characteristics of SP2 and SP3 soybean varieties boarded on Shijian No.8 satellite were analyzed after treated by herbicide glyphosate in the field. Abundant variations of traits were produced, and the resistance within and among cultivars were different in their offspring of space mutagenesis. Plant height and maturity were used as index to screen glyphosate tolerant materials. Space mutation increased of soybean 661 SP3 of Zhongpin, and one glyphosate-resistance variant was screened from Zhongpin 661 SP3. It showed that glyphosate tolerance was different among offspring of different space mutagenesis soybean materials. It is feasible to systemically screen elite traits soybean by applying space mutation breeding. (authors)

  8. Effects of additives on glyphosate activity in purple nutsedge

    International Nuclear Information System (INIS)

    Effects of additives on 14 C-glyphosate penetration into purple nutsedge leaves were examined in the laboratory and efficacy of glyphosate for purple nutsedge control was studied in the greenhouse and field. The addition of (NH4)2 SO4 at 1.0% (v/v) + diesel oil at 1,0% (v/v) + Tendal at 1.0% (v/v) increased 14C-glyphosate penetration into nutsedge leaves more than the addition of either one alone. (NH4)2SO4 at 1.0% + diesel oil at 1.0% + Tendal at 0.12 or 0.25% increased the phytotoxicity of glyphosate at 0.5 and 0.75 kg, a.e./ha on nutsedge plants in the greenhouse but not in the field. Additives did not enhance glyphosate activity by reducing the number of nutsedae tubers. (author)

  9. Refractory cardiopulmonary failure after glyphosate surfactant intoxication: a case report

    Directory of Open Access Journals (Sweden)

    Chang Chia-Chu

    2009-01-01

    Full Text Available Abstract Background Glyphosate is an herbicide considered to be of low toxicity to humans because its effects are specific to plants. However, fatal reactions to glyphosate have been reported after the ingestion of large amounts. Pulmonary edema, shock, and arrhythmia were the reported causes of mortality. Case presentation We present the case of a 57-year-old woman who was admitted to the emergency department unconsciousness after ingestion of glyphosate surfactant in a suicide attempt. Metabolic acidosis, refractory respiratory failure, and shock developed during hospitalization. Despite aggressive supportive care, the patient died in the hospital. Conclusion The toxicokinetics of glyphosate surfactant is complicated. Respiratory failure, metabolic acidosis, tachycardia, elevated creatinine, and hyperkalemia are poor prognostic factors if presented. Physicians should consider using hemodialysis early to improve the outcome of patients with glyphosate surfactant intoxication.

  10. DISPERSION OF GLYPHOSATE IN SOILS UNDERGOING EROSION

    Directory of Open Access Journals (Sweden)

    Gorana Todorovic Rampazzo

    2010-08-01

    Full Text Available Different physical, chemical and biological processes influence the behaviour of organic contaminants in soils. A better understanding of the organic pollutant behaviour in soils would improve the environmental protection. One possible way for better attenuation of the risk of pollution in agriculture can be achieved through ta better-specified pesticide management based on the adaptation of the pesticide type and application rates to the specific environmental characteristics of the area of application. Nowadays, one of the actually most applied herbicide world wide is glyphosate. Glyphosate is highly water soluble and traces have been found in surface and groundwater systems. For a better understanding of the natural influence of erosion processes on glyphosate behaviour and dispersion under heavy rain conditions after application in the field, two erosion simulation experiments were conducted on two different locations in Austria with completely different soil types in September 2008. The results of the experiments showed that under normal practical conditions (e.g. no rainfall is expected immediatly after application, the potential adsorption capacity of the Kirchberg soil (Stagnic Cambisol, with about 16.000 ppm Fe-oxides is confirmed compared to the low adsorption Chernosem soil (about 8.000 ppm pedogenic Fe-oxides.  Considering the enormous difference in the run-off amounts between the two sites Pixendorf and Kirchberg soils it can be concluded how important the soil structural conditions and vegetation type and cover are for the risks of erosion and, as a consequence, pollution of neighbouring waters. In the rainfall experiments under comparable simulation conditions, the amount of run-off was about 10 times higher at Kirchberg, owing to its better infiltration rate, than at the Pixendorf site. Moreover, the total loss of glyphosate (NT+CT through run-off at the Kirchberg site was more than double that at Pixendorf, which confirms the

  11. Effect of Glyphosate-boron Application on Seed Composition and Nitrogen Metabolism in Glyphosate-resistant Soybean

    Science.gov (United States)

    Information is limited on the effect of combined foliar application of glyphosate (Gly) and boron (B) on seed composition and nitrogen metabolism in glyphosate resistant soybean (Glycine max(L.)Merr.). Therefore, the objective of this two-year field study was to evaluate the effects of single foliar...

  12. Changes in rhizosphere bacterial gene expression following glyphosate treatment.

    Science.gov (United States)

    Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W

    2016-05-15

    In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. PMID:26901800

  13. Glyphosate em mistura com herbicidas alternativos para o manejo de plantas daninhas Glyphosate combined with alternative herbicides for vegetation management

    Directory of Open Access Journals (Sweden)

    P.A. Monquero

    2001-12-01

    Full Text Available O uso intensivo de glyphosate como herbicida não-seletivo tem selecionado espécies de plantas daninhas tolerantes. Dessa forma, é importante que sejam estudadas misturas de tanque com herbicidas de mecanismos de ação alternativos e que apresentem efeitos sinergísticos ou aditivos. Por essa razão, foi instalado um experimento inteiramente casualizado, composto por 13 tratamentos e 4 repetições, em casa de vegetação da Universidade de São Paulo - ESALQ/USP, Piracicaba-SP, com as plantas daninhas Richardia brasiliensis, Commelina benghalensis, Amaranthus hybridus, Galinsoga parviflora e Ipomoea grandifolia em misturas de tanque dos herbicidas chlorimuron-ethyl, sulfentrazone, carfentrazone, bentazon ou flumioxazin com glyphosate. As interações foram aditivas para as plantas daninhas I. grandifolia e C. benghalensis, e os herbicidas flumioxazin, sulfentrazone e carfentrazone aplicados isoladamente e em mistura com glyphosate foram os que proporcionaram os melhores níveis de controle. A interação de glyphosate com sulfentrazone foi antagônica em R. brasiliensis; a mistura de glyphosate com os demais herbicidas estudados foi aditiva, sendo os tratamentos com mistura de glyphosate e chlorimuron-ethyl ou flumioxazin os mais eficazes. Em A. hybridus, os tratamentos que apresentaram melhores níveis de controle foram o glyphosate e carfentrazone, aplicados isoladamente, e a mistura de glyphosate com flumioxazin, sulfentrazone, chlorimuron-ethyl e bentazon, sendo estes interações aditivas. No caso de G. parviflora, os tratamentos com flumioxazin e sulfentrazone apresentaram controle total, o mesmo acontecendo com as misturas de glyphosate com carfentrazone, flumioxazin, sulfentrazone, chlorimuron-ethyl ou bentazon.The intensive use of glyphosate as a non-selective herbicide for weed vegetation management has selected some tolerant weed species. Thus, it is important to study the synergistic or antagonic or additive effects of tank

  14. Multiple resistance to glyphosate and pyrithiobac in Palmer amaranth (Amaranthus palmeri) from Mississippi and response to flumiclorac

    Science.gov (United States)

    Greenhouse and laboratory studies were conducted to confirm and quantify glyphosate resistance, to investigate interactions between flumiclorac and glyphosate mixtures on weed control, to determine patterns of absorption and translocation of glyphosate applied alone and in combination with flumiclor...

  15. Potential Accumulative Effect of the Herbicide Glyphosate on Glyphosate-Tolerant Maize Rhizobacterial Communities over a Three-Year Cultivation Period

    OpenAIRE

    Jorge Barriuso; Silvia Marín; Mellado, Rafael P.

    2011-01-01

    BACKGROUND: Glyphosate is a herbicide that is liable to be used in the extensive cultivation of glyphosate-tolerant cultivars. The potential accumulation of the relative effect of glyphosate on the rhizobacterial communities of glyphosate-tolerant maize has been monitored over a period of three years. METHODOLOGY/PRINCIPAL FINDINGS: The composition of rhizobacterial communities is known to vary with soil texture, hence, the analyses have been performed in two agricultural fields with a differ...

  16. Glyphosate in Runoff Waters and in the Root-Zone: A Review

    Directory of Open Access Journals (Sweden)

    Lyndsay E. Saunders

    2015-11-01

    Full Text Available Glyphosate is the most commonly-used herbicide in the world. The present review summarizes the discovery, prevalence, chemical and physical properties, mode of action and effects in plants, glyphosate resistance and the environmental fate of glyphosate. Numerous studies are reviewed that demonstrate that glyphosate may run off of fields where it is applied, while other studies provide evidence that plant roots can take up glyphosate. Non-target vegetation may be exposed to glyphosate in the root-zone, where it has the potential to remove aqueous glyphosate from the system. Further study on the effects of root-zone glyphosate on non-target vegetation is required to develop best management practices for land managers seeking to ameliorate the effects of root-zone glyphosate exposure.

  17. Foliar-applied glyphosate substantially reduced uptake and transport of iron and manganese in sunflower (helianthus annuus L.) plants

    OpenAIRE

    Eker, Selim; Öztürk, Levent; Ozturk, Levent; Yazıcı, Mustafa Atilla; Yazici, Mustafa Atilla; Erenoğlu, Bülent; Erenoglu, Bulent; Romheld, Volker; ÇAKMAK, İsmail; Cakmak, Ismail

    2006-01-01

    Evidence clearly shows that cationic micronutrients in spray solutions reduce the herbicidal effectiveness of glyphosate for weed control due to the formation of metal-glyphosate complexes. The formation of these glyphosate-metal complexes in plant tissue may also impair micronutrient nutrition of nontarget plants when exposed to glyphosate drift or glyphosate residues in soil. In the present study, the effects of simulated glyphosate drift on plant growth and uptake, translocation, and accum...

  18. Glyphosate on digestive enzymes activity in piava (Leporinus obtusidens

    Directory of Open Access Journals (Sweden)

    Joseânia Salbego

    2014-09-01

    Full Text Available The effects of glyphosate, a nonselective herbicide (1.0 or 5.0mg L-1 on digestive enzymes activity (stomach and intestine were evaluated in juveniles of piava (Leporinus obtusidens after 90 days of exposure. The activity of acid protease, trypsin, chymotrypsin and amylase increased with the increase of glyphosate concentration. These results indicate that glyphosate affects digestive enzyme activities in this species, and may be an indicator of poor nutrient availability when fish survive in herbicide-contaminated water.

  19. Adsorption of glyphosate and aminomethylphosphonic acid in soils

    Science.gov (United States)

    Rampazzo, N.; Rampazzo Todorovic, G.; Mentler, A.; Blum, W. E. H.

    2013-03-01

    The results showed that glyphosate is initially adsorbed mostly in the upper 2 cm. It is than transported and adsorbed after few days in deeper soil horizons with concomitant increasing content of its metabolite aminomethylphosphonic acid. Moreover, Fe-oxides seem to be a key parameter for glyphosate and aminomethylphosphonic adsorption in soils. This study confirmed previous studies: the analysis showed lower contents of dithionite-soluble and Fe-oxides for the Chernozem, with consequently lower adsorption of glyphosate and aminomethylphosphonic as compared with the Cambisol and the Stagnosol.

  20. The herbicide Glyphosate affects nitrification in the Elbe estuary, Germany

    Science.gov (United States)

    Sanders, Tina; Lassen, Stephan

    2015-04-01

    The Elbe River is one of the biggest European rivers discharging into the North Sea. It also transports high amounts of nutrients and pollutants like pesticides. Important source regions of both nutrients and pollutants are located within the river catchment, which is dominated by agricultural land-use. From these agricultural soils, pesticides can be carried via the river and estuary into the North Sea. Glyphosate (N-(phosphonomethyl) glycine) is the most commonly used herbicide worldwide and mainly used to regulate unwanted plant growth and for the expedition of crop ripening. In Germany, ~ 6000 tons of glyphosate are applied yearly in agriculture and private use. Glyphosate is degradable by microorganisms and has a half-life in water of 35 to 60 days. This herbicide specifically inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), an enzyme that catalyzes the biosynthesis of essential aromatic amino acids in plants, fungi, and bacteria. Nitrifying bacteria, which play an important role in the internal nitrogen cycling in the Elbe estuary, also possess this enzyme. The aim of our study was to quantify the concentration of glyphosate in water and sediment samples of the Elbe to get an overview about relevant environmental levels and to assess the impact of glyphosate on inhibition of nitrifying activities. To quantify the effect of glyphosate on nitrification activity, natural samples as well as pure cultures of Nitrosomonas europea (strain Nm50) were incubated with different concentrations of glyphosate over a period of some weeks. The nitrifying activity was determined according to changes of the nitrite and nitrate concentration as well as the cell number. Glyphosate was detectable in water and sediment samples in the Elbe estuary with up to 5 ppb mainly in the Port of Hamburg region. In both incubation experiments an inhibiting effect of glyphosate on nitrification could be shown. The incubated natural water sample was affected by a glyphosate

  1. Evolved glyphosate-resistant weeds around the world: lessons to be learnt.

    Science.gov (United States)

    Powles, Stephen B

    2008-04-01

    Glyphosate is the world's most important herbicide, with many uses that deliver effective and sustained control of a wide spectrum of unwanted (weedy) plant species. Until recently there were relatively few reports of weedy plant species evolving resistance to glyphosate. Since 1996, the advent and subsequent high adoption of transgenic glyphosate-resistant crops in the Americas has meant unprecedented and often exclusive use of glyphosate for weed control over very large areas. Consequently, in regions of the USA where transgenic glyphosate-resistant crops dominate, there are now evolved glyphosate-resistant populations of the economically damaging weed species Ambrosia artemissifolia L., Ambrosia trifida L., Amaranthus palmeri S Watson, Amaranthus rudis JD Sauer, Amaranthus tuberculatus (Moq) JD Sauer and various Conyza and Lolium spp. Likewise, in areas of transgenic glyphosate-resistant crops in Argentina and Brazil, there are now evolved glyphosate-resistant populations of Sorghum halepense (L.) Pers and Euphorbia heterophylla L. respectively. As transgenic glyphosate-resistant crops will remain very popular with producers, it is anticipated that glyphosate-resistant biotypes of other prominent weed species will evolve over the next few years. Therefore, evolved glyphosate-resistant weeds are a major risk for the continued success of glyphosate and transgenic glyphosate-resistant crops. However, glyphosate-resistant weeds are not yet a problem in many parts of the world, and lessons can be learnt and actions taken to achieve glyphosate sustainability. A major lesson is that maintenance of diversity in weed management systems is crucial for glyphosate to be sustainable. Glyphosate is essential for present and future world food production, and action to secure its sustainability for future generations is a global imperative. PMID:18273881

  2. Uses of glyphosate in German arable farming – operational aspects

    OpenAIRE

    Wiese, Armin; Schulte, Michael; Theuvsen, Ludwig; Steinmann, Horst-Henning

    2016-01-01

    Glyphosate is the most frequently used herbicide active ingredient in Germany. Studies regarding its usage in non-GMO arable farming are still rare even though it plays an important role in several agronomic situations. Therefore, we conducted a comprehensive survey, which was carried out among conventional German farms in Winter 2014/2015. Based on the results of this survey we analyzed via cluster analysis how types of farms differ in terms of glyphosate usage. An illustration of seven clus...

  3. Glyphosate-resistant hairy fleabane documented in the Central Valley

    OpenAIRE

    Shrestha, Anil; Hanson, Bradley D.; Hembree, Kurt J

    2008-01-01

    In recent years, growers and pest consultants have reported poor control of the weed hairy fleabane in some areas of the Central Valley. Hairy fleabane seeds were collected from Esparto, Fresno and Reedley, Calif., and greenhouse-grown seedlings were treated at several different glyphosate rates and compared with an untreated control. None of the Esparto or Fresno plants survived glyphosate rates greater than 0.78 pounds acid equivalent per acre (lb ae/ac), while some of the plants from Reedl...

  4. MON 79351 – a novel liquid glyphosate herbicide

    OpenAIRE

    Kiepe, Björn; Ophoff, Holger; Voegler, Wolfgang

    2012-01-01

    MON 79351 is a novel liquid glyphosate herbicide which represents the improved product generation within the Roundup® product family. Containing 480 g/l active ingredient, this liquid formulation exceeds our current distributed soluble concentrates in Germany. MON 79351 is formulated as a potassium salt and offers product advantages in contrast to conventional glyphosate products. In product development trials, MON 79351 provides an excellent efficacy against mono- and dicotyledonous annual a...

  5. Root-Zone Glyphosate Exposure Adversely Affects Two Ditch Species

    Directory of Open Access Journals (Sweden)

    Lyndsay E. Saunders

    2013-12-01

    Full Text Available Glyphosate, one of the most applied herbicides globally, has been extensively studied for its effects on non-target organisms. In the field, following precipitation, glyphosate runs off into agricultural ditches where it infiltrates into the soil and thus may encounter the roots of vegetation. These edge-of-field ditches share many characteristics with wetlands, including the ability to reduce loads of anthropogenic chemicals through uptake, transformation, and retention. Different species within the ditches may have a differential sensitivity to exposure of the root zone to glyphosate, contributing to patterns of abundance of ruderal species. The present laboratory experiment investigated whether two species commonly found in agricultural ditches in southcentral United States were affected by root zone glyphosate in a dose-dependent manner, with the objective of identifying a sublethal concentration threshold. The root zone of individuals of Polygonum hydropiperoides and Panicum hemitomon were exposed to four concentrations of glyphosate. Leaf chlorophyll content was measured, and the ratio of aboveground biomass to belowground biomass and survival were quantified. The findings from this study showed that root zone glyphosate exposure negatively affected both species including dose-dependent reductions in chlorophyll content. P. hydropiperdoides showed the greatest negative response, with decreased belowground biomass allocation and total mortality at the highest concentrations tested.

  6. A glyphosate-based pesticide impinges on transcription

    International Nuclear Information System (INIS)

    Widely spread chemicals used for human benefits may exert adverse effects on health or the environment, the identification of which are a major challenge. The early development of the sea urchin constitutes an appropriate model for the identification of undesirable cellular and molecular targets of pollutants. The widespread glyphosate-based pesticide affected sea urchin development by impeding the hatching process at millimolar range concentration of glyphosate. Glyphosate, the active herbicide ingredient of Roundup, by itself delayed hatching as judged from the comparable effect of different commercial glyphosate-based pesticides and from the effect of pure glyphosate addition to a threshold concentration of Roundup. The surfactant polyoxyethylene amine (POEA), the major component of commercial Roundup, was found to be highly toxic to the embryos when tested alone and therefore could contribute to the inhibition of hatching. Hatching, a landmark of early development, is a transcription-dependent process. Correlatively, the herbicide inhibited the global transcription, which follows fertilization at the 16-cell stage. Transcription inhibition was dose-dependent in the millimolar glyphosate range concentration. A 1257-bp fragment of the hatching enzyme transcript from Sphaerechinus granularis was cloned and sequenced; its transcription was delayed by 2 h in the pesticide-treated embryos. Because transcription is a fundamental basic biological process, the pesticide may be of health concern by inhalation near herbicide spraying at a concentration 25 times the adverse transcription concentration in the sprayed microdroplets

  7. Studies on a new group of biodegradable surfactants for glyphosate.

    Science.gov (United States)

    Haefs, Roland; Schmitz-Eiberger, Michaela; Mainx, Hans-G; Mittelstaedt, Werner; Noga, Georg

    2002-08-01

    The effectiveness of a homologous series of biodegradable rapeseed oil derivatives (triglyceride ethoxylates; Agnique RSO series containing an average of 5, 10, 30 and 60 units of ethylene oxide (EO) as adjuvants for foliage-applied, water-soluble, systemic active ingredients was evaluated employing glyphosate as an example. Previous experiments had revealed that the surfactants used are not phytotoxic at concentrations ranging from 1 to 10 g litre-1. The experiments were performed using Phaseolus vulgaris L and nine selected weed species, grown in a growth chamber at 25/20 (+/- 2) degrees C day/night temperature and 40/70 (+/- 10)% relative humidity. The surfactants were evaluated for enhancement of spray retention, and foliar penetration biological efficacy of glyphosate. Glyphosate was applied at a concentration of 43 mM. The surfactants were added at concentrations of 1 g litre-1. The commercial glyphosate 360 g AE litre-1 SL Roundup Ultra and unformulated glyphosate served as references. The surfactants used improved spray retention, foliar penetration and biological efficacy. Some of the formulations were comparable to the performance of Roundup Ultra in the aspects evaluated; some were even more effective in enhancing spray liquid retention and promoting glyphosate phytotoxicity in several plant species. In these studies Agnique RSO 60 generally was most effective. PMID:12192908

  8. Root-zone glyphosate exposure adversely affects two ditch species.

    Science.gov (United States)

    Saunders, Lyndsay E; Koontz, Melissa B; Pezeshki, Reza

    2013-01-01

    Glyphosate, one of the most applied herbicides globally, has been extensively studied for its effects on non-target organisms. In the field, following precipitation, glyphosate runs off into agricultural ditches where it infiltrates into the soil and thus may encounter the roots of vegetation. These edge-of-field ditches share many characteristics with wetlands, including the ability to reduce loads of anthropogenic chemicals through uptake, transformation, and retention. Different species within the ditches may have a differential sensitivity to exposure of the root zone to glyphosate, contributing to patterns of abundance of ruderal species. The present laboratory experiment investigated whether two species commonly found in agricultural ditches in southcentral United States were affected by root zone glyphosate in a dose-dependent manner, with the objective of identifying a sublethal concentration threshold. The root zone of individuals of Polygonum hydropiperoides and Panicum hemitomon were exposed to four concentrations of glyphosate. Leaf chlorophyll content was measured, and the ratio of aboveground biomass to belowground biomass and survival were quantified. The findings from this study showed that root zone glyphosate exposure negatively affected both species including dose-dependent reductions in chlorophyll content. P. hydropiperdoides showed the greatest negative response, with decreased belowground biomass allocation and total mortality at the highest concentrations tested. PMID:24833234

  9. WEED CONTROL AND COTTON (GOSSYPIUM HIRSUTUM) INJURY WITH COMBINATIONS OF GLYPHOSATE AND TRIFLOXYSULFURON

    Science.gov (United States)

    Greenhouse and field studies were conducted to evaluate potential interactions between glyphosate and trifloxysulfuron on barnyardgrass, browntop millet, hemp sesbania, pitted morningglory, prickly sida, sicklepod, and velvetleaf control as well as cotton injury. Glyphosate was tested at 560 and 112...

  10. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops.

    OpenAIRE

    Mamy, Laure; Gabrielle, Benoit; Barriuso Benito, Enrique,

    2010-01-01

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts...

  11. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

    Energy Technology Data Exchange (ETDEWEB)

    Mamy, Laure, E-mail: laure.mamy@versailles.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Gabrielle, Benoit, E-mail: benoit.gabrielle@agroparistech.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Barriuso, Enrique, E-mail: barriuso@grignon.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France)

    2010-10-15

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

  12. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

    International Nuclear Information System (INIS)

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

  13. Differential Effects of Glyphosate and Roundup on Human Placental Cells and Aromatase

    OpenAIRE

    Richard, Sophie; Moslemi, Safa; Sipahutar, Herbert; Benachour, Nora; Seralini, Gilles-Eric

    2005-01-01

    Roundup is a glyphosate-based herbicide used worldwide, including on most genetically modified plants that have been designed to tolerate it. Its residues may thus enter the food chain, and glyphosate is found as a contaminant in rivers. Some agricultural workers using glyphosate have pregnancy problems, but its mechanism of action in mammals is questioned. Here we show that glyphosate is toxic to human placental JEG3 cells within 18 hr with concentrations lower than those found with agricult...

  14. Influencing factors on regional differences in glyphosate use in North German arable farming

    OpenAIRE

    Andert, Sabine; Bürger, Jana; Gerowitt, Bärbel

    2016-01-01

    Glyphosate is the worldwide mostly used herbicide substance. Glyphosate use in arable cropping is under strong discussion in scientific and public communities. In the present study, we investigated the use of glyphosate from 15 farms in four districts in North German arable farming from 2005 until 2014. Objective of our research is to reveal influencing factors on glyphosate use intensity. The farm structures differ between two West districts (Diepholz, Uelzen) and two East districts (Fläm...

  15. The effect of glyphosate on the frequency of micronuclei in bovine lymphocytes in vitro

    OpenAIRE

    Piešova Elena

    2005-01-01

    Glyphosate is a widely used broad-spectrum herbicide that has expanded its applications on plant varieties that are genetically modified to tolerate glyphosate treatment. The aim of this study was to determine the frequency of micronuclei (MNi) in bovine peripheral lymphocytes after exposure to glyphosate in vitro. The cytokinesis block micronucleus assay (CBMN) for estimation of genotoxic activity was used. The obtained results indicate that glyphosate weakly induced micronuclei in bovine pe...

  16. The Economics of Glyphosate Resistance Management in Corn and Soybean Production

    OpenAIRE

    Livingston, Michael; Fernandez-Cornejo, Jorge; Unger, Jesse; Osteen, Craig; Schimmelpfennig, David; Park, Tim; Lambert, Dayton

    2015-01-01

    Glyphosate, known by many trade names, including Roundup, is a highly effective herbicide. Widespread glyphosate use for corn and soybean has led to glyphosate resistance, which is now documented in 14 weed species affecting U.S. cropland, and recent surveys suggest that acreage with glyphosate-resistant (GR) weeds is expanding. Data from USDA’s Agricultural Resource Management Survey (ARMS), along with the Benchmark Study (conducted independently by plant scientists), are used to address sev...

  17. Degradation of the Phosphonate Herbicide Glyphosate by Arthrobacter atrocyaneus ATCC 13752

    OpenAIRE

    Pipke, Rüdiger; Amrhein, Nikolaus

    1988-01-01

    Of nine authentic Arthrobacter strains tested, only A. atrocyaneus ATCC 13752 was capable of using the herbicide glyphosate [N-(phosphonomethyl)glycine] as its sole source of phosphorus. Contrary to the previously isolated Arthrobacter sp. strain GLP-1, which degrades glyphosate via sarcosine, A. atrocyaneus metabolized glyphosate to aminomethylphosphonic acid. The carbon of aminomethylphosphonic acid was entirely converted to CO2. This is the first report on glyphosate degradation by a bacte...

  18. Biodegradation of glyphosate herbicide by Salinicoccus spp isolated from Qom Hoze-soltan lake, Iran

    OpenAIRE

    Yaser Sharifi; Ahmad Ali Pourbabaei; Ali Javadi; Mohammad Hossein Abdolmohammadi; Mehri Saffari; Abbas Morovvati

    2015-01-01

    Background: Glyphosate (N-phosphonomethyl Glycine) is an organophosphorus pesticide with dangerous effects on the environment. In this study, the biodegradation of glyphosate herbicide by halophilic bacteria isolated from Qom Hoze-Soltan Lake has been investigated. Methods: After sampling and bacterial isolation, native halophilic strains grown in the presence of glyphosate at a wavelength of 660 nm and also the disappearance of the glyphosate in the plates at a wavelength of 220 nm were d...

  19. Impact of seven years of glyphosate resistant corn and glyphosate applications under conventional and reduced tillage on bulk and rhizosphere soil exoenzyme activities and corn root endophytic microbial community structure

    Science.gov (United States)

    Background: Conservation tillage practices across the country have been implementing genetically engineered glyphosate resistant corn crops along with applications of the herbicide glyphosate. We tested the hypothesis that seven years of glyphosate applications to both glyphosate resistant and non-r...

  20. Seed Germination Differences Between Glyphosate-Resistant and -Susceptible Italian Ryegrass Populations

    Science.gov (United States)

    Italian ryegrass tolerant to glyphosate is becoming a major weed problem in glyphosate-resistant crops. The effects of temperature, light, pH, salt and osmotic stress, shikimic acid, and planting depth on germination of glyphosate-tolerant (T) and susceptible (S) Italian ryegrass populations were st...

  1. Glyphosate-Resistant Palmer Amaranth (Amaranthus palmeri) Spreads in the Southern United States (U.S.)

    Science.gov (United States)

    Glyphosate (N-phosphonomethyl glycine) is an exceptionally broad-spectrum herbicide that was first registered for use in 1974. Glyphosate is used mainly in conjunction with transgenic, glyphosate-resistant soybean, canola (Brassica napus), cotton (Gossypium hirsutum), and corn (Zea mays) cultivars, ...

  2. Varying tolerance to glyphosate in a population of Palmer amaranth with low epsps copy number

    Science.gov (United States)

    A Palmer amaranth population (seeds collected in the year 2000; Washington Co., MS) suspected to be susceptible to glyphosate was examined as a population and as individual plants and found to exhibit varying tolerance or resistance to glyphosate. Whole plant spraying of glyphosate (0.84 kg ha-1) t...

  3. Assessing crop injury caused by aerially applied glyphosate drift using spray sampling

    Science.gov (United States)

    Crop injury caused by off-target drift of aerially applied glyphosate is of great concern to farmers and aerial applicators. An experiment was conducted in 2009 to determine the extent of injury due to near-field glyphosate drift from aerial application to glyphosate-sensitive cotton, corn and soybe...

  4. Effects of phosphate on the adsorption of glyphosate on three different types of Chinese soils

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; SUN Rui-juan

    2005-01-01

    Glyphosate (GPS) is a non-selective, post-mergence herbicide that is widely used throughout the world. Due to the similar molecular structures of glyphosate and phosphate, adsorption of glyphosate on soil is easily affected by coexisting phosphate, especially when phosphate is applied at a significant rate in farmland. This paper studied the effects of phosphate on the adsorption of glyphosate on three different types of Chinese soils including two variable charge soils and one permanent charge soil. The results indicated that Freundlich equations used to simulate glyphosate adsorption isotherms gave high correlation coefficients(0.990-0.998) with K values of 2751, 2451 and 166 for the zhuanhong soil(ZH soil, Laterite), red soil(RS, Udic Ferrisol) and Wushan paddy soil(WS soil, Anthrosol),respectively. The more the soil iron and aluminum oxides and clay contained, the more glyphosate adsorbed. The presence of phosphate significantly decreased the adsorption of glyphosate to the soils by competing with glyphosate for adsorption sites of soils. Meanwhile, the effects of phosphate on adsorption of glyphosate on the two variable charge soils were more significant than that on the permanent charge soil. When phosphate and glyphosate were added in the soils in different orders, the adsorption quantities of glyphosate on the soils were different, which followed GPS-soil>GPS-P-soil = GPS-soil-P > P-soil-GPS, meaning a complex interaction occurred among glyphosate,phosphate and the soils.

  5. Leaching of Glyphosate and Aminomethylphosphonic Acid from an Agricultural Field over a Twelve-Year Period

    DEFF Research Database (Denmark)

    Norgaard, Trine; Moldrup, Per; Ferré, Ty P A;

    2014-01-01

    The globally-used herbicide glyphosate (N-(phosphonomethyl)glycine) and its most frequently detected metabolite, aminomethylphosphonic acid (AMPA), were studied in a unique 12-year field-scale monitoring program. The leaching of glyphosate, AMPA, and soil particles were studied in a shallow...... intensity and the timing of rain events after glyphosate application....

  6. Effects of Glyphosate Application on Seed Iron and Root Ferric (III) Reductase in Soybean Cultivars

    Science.gov (United States)

    Previous research demonstrated that nitrate assimilation and nitrogen fixation were significantly reduced by glyphosate (Gly) drift in glyphosate-susceptible (GS) soybean, but soybean had the ability to recover from the physiological stress caused by glyphosate drift. The objective of this study was...

  7. Glyphosate accumulation, translocation, and biological effects in Coffea arabica after single and multiple exposures

    DEFF Research Database (Denmark)

    Schrübbers, Lars Christoph; Valverde, Bernal E.; Strobel, Bjarne W.;

    2016-01-01

    In perennial crops like coffee, glyphosate drift exposure can occur multiple times during its commercial life span. Due to limited glyphosate degradation in higher plants, a potential accumulation of glyphosate could lead to increased biological effects with increased exposure frequency. In this...... study, we investigated glyphosate translocation over time, and its concentration and biological effects after single and multiple simulated spray-drift exposures. Additionally, shikimic acid/glyphosate ratios were used as biomarkers for glyphosate binding to its target enzyme.Four weeks after the...... exposure, glyphosate was continuously translocated. Shikimic acid levels were lin-ear correlated with glyphosate levels. After two months, however, glyphosate appeared to have reduced activity. In the greenhouse, multiple applications resulted in higher internal glyphosate concentrations.The time of...

  8. Resposta de cultivares de algodoeiro a subdoses de glyphosate Response of cotton cultivars to reduced rates of glyphosate

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2005-12-01

    Full Text Available Avaliou-se a resposta de nove cultivares de algodoeiro, de importância econômica no Estado do Mato Grosso, quanto à intoxicação causada por subdoses de glyphosate. Os cultivares de algodoeiro utilizados foram Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal, BRS Facual, Antares e Coodetec 407. As plantas foram cultivadas em tubetes preenchidos com substrato de solo e mantidas em casa telada, tendo recebido a aplicação do glyphosate aos 20 dias após a emergência, época em que apresentavam quatro folhas verdadeiras. As subdoses de glyphosate, simulando deriva, foram de 270 e 540 g ha-1. Também foi utilizada testemunha, sem aplicação do herbicida, para efeito de comparação. Foram realizadas avaliações semanais até 42 dias após a aplicação dos tratamentos (DAA, período em que também foi tomada a altura das plantas. Os sintomas visuais de intoxicação iniciaram-se aos 3 DAA, caracterizados pelo amarelecimento das pontas das folhas mais novas, seguido de murchamento do ápice das plantas. Na dose de 270 g ha-1 esses sintomas foram de baixa intensidade, mas a 540 g ha-1 causaram, na maioria dos casos, toxidez "preocupante" a "muito alta". Os cultivares BRS Facual e FM 986 mostraram-se os mais suscetíveis. A altura das plantas foi mais afetada quando se aplicou a menor dose de glyphosate. Houve recuperação de todos os cultivares tratados com 270 g ha-1 de glyphosate até os 42 DAA. Quando tratados com 540 g ha-1 de glyphosate, os cultivares Fabrika, Coodetec 407, BRS-Facual e ITA-90 foram mais sensíveis, apresentando redução de altura entre 84 e 90% aos 42 DAA. Os cultivares menos sensíveis na dose de 270 g ha-1 de glyphosate não foram os mesmos para a dose de 540 g ha-1.The response of nine cotton cultivars economically important in the state of Mato Grosso was evaluated in relation to the toxicity caused by reduced rates of glyphosate. The cotton cultivars used were Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal

  9. Rezistence turanky kanadské vůči účinné látce glyphosate

    OpenAIRE

    Jeřábková, Julie

    2013-01-01

    My thesis is called ,,Glyphosate resistance in Conyza canadensis‘‘ and deals with issues of evolved herbicide-resistant weeds, specifically glyphosate-resistant Conyza canadensis. The objective of this thesis was to assess the susceptibility of Conyza canadensis to glyphosate experimentally. The thesis starts with an overview of the discovery of glyphosate, development, applications, its properties and the development of transgenic glyphosate-resistant crops. The next chapters take a closer l...

  10. Skin decontamination of glyphosate from human skin in vitro.

    Science.gov (United States)

    Zhai, H; Chan, H P; Hui, X; Maibach, H I

    2008-06-01

    This study compared three model decontaminant solutions (tap water, isotonic saline, and hypertonic saline) for their ability to remove a model herbicide (glyphosate) from an in vitro human skin model. Human cadaver skin was dosed (approximately 375microg) of [14C]-glyphosate on 3cm2 per skin. After each exposure time (1, 3, and 30min post-dosing, respectively), the surface skin was washed three times (4ml per time) with each solution. After washing, the skin was stripped twice with tape discs. Lastly, the wash solutions, strippings, receptor fluid, and remainder of skin were liquid scintillation analyzer counted to determine the amount of glyphosate. There were no statistical differences among these groups at any time points. The total mass balance recovery at three time exposure points was between 94.8% and 102.4%. The wash off rates (glyphosate in wash solutions) at three different exposure times is 79-101.2%. Thus the three tested decontaminants possess similar effectiveness in removing glyphosate from skin. This in vitro model is not only economic and rapid, but also provides quantitative data that may aid screening for optimal decontaminants. PMID:18407393

  11. DIFFERENTIAL RESPONSE OF CLONES OF EUCALYPT TO GLYPHOSATE1

    Directory of Open Access Journals (Sweden)

    Leonardo Bianco de Carvalho

    2015-02-01

    Full Text Available Weed control is commonly performed by the inter-row mechanical weeding associated to intrarow glyphosate directed spraying, causing a risk for drift or accidental herbicide application, that can affect the crop of interest. The objective was to evaluate the response of clones C219, GG100, I144, and I224 of eucalypt (Eucalyptus grandis x E. urophylla to glyphosate doses of 0, 18, 36, 72, 180, 360, and 720 g of acid equivalent per hectare. The clones showed different growth patterns with regard to height, leaf number, stem dry weight, relative growth rate, net assimilation rate, and relative leaf growth rate. The clones I144 and GG100 were more susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 113.4 and 119.6 g acid equivalent per hectare, respectively. The clones C219 and I224 were less susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 237.5 and 313.5 g acid equivalent per hectare, respectively. Eucalyptus clones respond differently to glyphosate exposure, so that among I224, C219, GG100, and I144, the susceptibility to the herbicide is increasing.

  12. Water use efficiency by coffee arabica after glyphosate application

    Directory of Open Access Journals (Sweden)

    Felipe Paolinelli de Carvalho

    2014-07-01

    Full Text Available Many coffee growers apply glyphosate in directed applications, but some phytotoxicity has been noted. It is believed some herbicides can exert a direct or indirect negative effect on photosynthesis by reducing the metabolic rate in a way that can affect the water use efficiency. The objective of this study was to investigate the variables related to water use among coffee cultivars subjected to the application of glyphosate and the effects of each dose. The experiment was conducted in a greenhouse using three varieties of coffee (Coffea arabica, Acaiá (MG-6851, Catucaí Amarelo (2SL and Topázio (MG-1190, and three doses of glyphosate (0.0, 115.2 and 460.8 g acid equivalent ha-1, in a factorial 3 x 3 design. At 15 days after application, a reduction in stomatal conductance was observed, and smaller transpiration rate and water use efficiency were found in the fourth leaf at 15 days after application. There was a decrease in the transpiration rate at 45 DAA, with the Acaiá cultivar showing reductions with 115.2 g ha-1. There was transitory reduction in water use efficiency with glyphosate application, but can affect the growth and production. The Acaiá cultivar showed the highest tolerance to glyphosate because the water use efficiency after herbicide application.

  13. A Preliminary Study of Soybean Genotype Responses to Glyphosate

    Directory of Open Access Journals (Sweden)

    Plamen Marinov-Serafimov

    2009-01-01

    Full Text Available The effect of four application rates of glyphosate (Roundup, 360 g a.i./l – 180; 360; 720 and 1440 g a.i./ha on the survival, dynamics of growth, and accumulation of fresh biomass in g per plant was studied on eight newly-developed Bulgarian lines, varieties and candidate varieties of soybean bred by different methods under greenhouse conditions. The objective of this study was to determine and compare the sensitivities of different soybean genotypes to glyphosate. The studied soybean genotypes showed different levelsof glyphosate sensitivity due to their genetic differences. Glyphosate rates of 180, 360, 720 and 1440 g a.i./ha, applied at the stage of three trifoliate leaves (V4 of soybean had effect on the survival of the studied genotypes and can be presented conditionally in the following order: H (40.6% < G (40.7% < D (51.3% < C (52.6% < F (58.9% < E (60.5% < B (62.0% < A (65.3%. The depression coefficients (B of the studied characteristics dependedmainly on soybean genotypes and the applied herbicide rates. The tested glyphosate rates showed a high (GI 26.5-51.6% to relatively low degree of toxicity (GI 16.0-18.7% in the studied soybean genotypes.

  14. Herbicide-resistant weed management: focus on glyphosate.

    Science.gov (United States)

    Beckie, Hugh J

    2011-09-01

    This review focuses on proactive and reactive management of glyphosate-resistant (GR) weeds. Glyphosate resistance in weeds has evolved under recurrent glyphosate usage, with little or no diversity in weed management practices. The main herbicide strategy for proactively or reactively managing GR weeds is to supplement glyphosate with herbicides of alternative modes of action and with soil-residual activity. These herbicides can be applied in sequences or mixtures. Proactive or reactive GR weed management can be aided by crop cultivars with alternative single or stacked herbicide-resistance traits, which will become increasingly available to growers in the future. Many growers with GR weeds continue to use glyphosate because of its economical broad-spectrum weed control. Government farm policies, pesticide regulatory policies and industry actions should encourage growers to adopt a more proactive approach to GR weed management by providing the best information and training on management practices, information on the benefits of proactive management and voluntary incentives, as appropriate. Results from recent surveys in the United States indicate that such a change in grower attitudes may be occurring because of enhanced awareness of the benefits of proactive management and the relative cost of the reactive management of GR weeds. PMID:21548004

  15. Eficácia de glyphosate em plantas de cobertura Efficacy of glyphosate in cover crops

    Directory of Open Access Journals (Sweden)

    P.C. Timossi

    2006-09-01

    Full Text Available Objetivou-se comparar a eficácia de três dosagens do herbicida glyphosate para a dessecação de Brachiaria decumbens, B. brizantha cv. Marandu e vegetação espontânea, visando a adoção do sistema plantio direto. Utilizou-se delineamento experimental de blocos ao acaso, num esquema fatorial 3 x 3, com quatro repetições. Testaram-se três tipos de cobertura vegetal e três dosagens de glyphosate (1,44, 2,16 e 2,88 kg ha-1. Aos 7, 14, 21 e 28 dias após a aplicação (DAA, foram feitas avaliações visuais da porcentagem de controle das coberturas vegetais e, aos 45 DAA, avaliações visuais da porcentagem de reinfestação da área. Conclui-se que, para as espécies que compunham a vegetação espontânea, o uso de 1,44 kg ha-1 proporcionou bom controle, sem no entanto evitar rebrotes de Digitaria insularis. Para as braquiárias, a mesma taxa de controle foi observada a partir de 2,16 kg ha-1. A camada de palha das braquiárias sobre o solo não foi capaz de suprimir a emergência de Cyperus rotundus, Alternanthera tenella, Raphanus raphanistrum, Bidens pilosa e Euphorbia heterophylla.This work aimed to compare rates of glyphosate to desiccate Brachiaria decumbens, B. brizantha cv. Marandu and spontaneous plants (weeds, aiming to adopt the no-tillage system. A randomized block experimental design in a factorial scheme was used (3x3, with four replications. The factors consisted of three species of cover crops and three rates of glyphosate (1.44, 2.16 and 2.88 kg ha-1. At 7, 14, 21 and 28 days after application of the herbicide, visual evaluations of the percentage of cover crop control were carried out and at 45 days of the reinfestation percentage of the area. It was concluded that the spontaneous plants presented a good control at 1.44 kg ha-1, without, however, preventing Digitaria insularis sprouts. The same control rate starting at 2.16 kg ha-1 was observed for the Brachiaria species. The straw layer of these cover crops on the soil

  16. Comparison of Nitrogen Fertilizers, Induce and Zinc Addition on Glyphosate Efficacy on Three Different Weed Species.

    Directory of Open Access Journals (Sweden)

    Hussein F. Abouziena

    2014-05-01

    Full Text Available Herbicides are often tank-mixed with fertilizers to save time, labour, energy, and equipment costs. However addition of some additives with glyphosate may result in reducing glyphosate efficacy. Therefore we evaluated the potential of three nitrogen sources (ammonium sulphate (AMS at 2 or 4% w/v, ammonium nitrate (AN at 1 or 2% w/v, urea at 1 or 2 % w/v, nonionic adjuvant (Induce at 0.05% v/v and Zn at 250 g Zn/ha (1321 ppm to enhance glyphosate efficacy on pig weed (Amaranthus retroflexus L., crowfoot grass (Dactyloctenium egyptium L. and yellow nutsedge (Cyperus esculentus L. under greenhouse conditions. The results indicated that there were variations in susceptibility of the three weeds to glyphosate+adjuvant treatments. Addition of AN at 2% reduced the efficacy of glyphosate on crowfoot grass. There was an antagonistic effect between glyphosate herbicide and Zn; the phytotoxic effect of glyphosate on the three weeds was less than 50 %. Zinc tank-mixed with glyphosate resulted in a greater number of tubers and shoots per plant than the untreatedol. Addition of AN or urea at 2% reduced glyphosate efficacy by about 2.3 and 9 %, respectively, relative to their addition at 1%. Tankmixes of urea (1%, AN (1%, AMS (2% and Induce adjuvant (0.05% generally enhanced the efficacy of glyphosate (0.85 kg/ha, whereas the addition of Zn, as zinc sulphate, to glyphosate sprays adversely affected herbicide efficacy.

  17. Comparative toxicity of two glyphosate-based formulations to Eisenia andrei under laboratory conditions.

    Science.gov (United States)

    Piola, Lucas; Fuchs, Julio; Oneto, María Luisa; Basack, Silvana; Kesten, Eva; Casabé, Norma

    2013-04-01

    Glyphosate-based products are the leading post-emergent agricultural herbicides in the world, particularly in association with glyphosate tolerant crops. However, studies on the effects of glyphosate-based formulations on terrestrial receptors are scarce. This study was conducted to evaluate the comparative toxicity of two glyphosate-based products: Roundup FG (monoammonium salt, 72% acid equivalent, glyphosate-A) and Mon 8750 (monoammonium salt, 85.4% acid equivalent, glyphosate-B), towards the earthworm Eisenia andrei. Median lethal concentration (LC50) showed that glyphosate-A was 4.5-fold more toxic than glyphosate-B. Sublethal concentrations caused a concentration-dependent weight loss, consistent with the reported effect of glyphosate as uncoupler of oxidative phosphorylation. Glyphosate-A showed deleterious effects on DNA and lysosomal damage at concentrations close to the applied environmental concentrations (14.4 μg ae cm(-2)). With glyphosate-B toxic effects were observed at higher doses, close to its LC50, suggesting that the higher toxicity of formulate A could be attributed to the effects of some of the so-called "inert ingredients", either due to a direct intrinsic toxicity, or to an enhancement in the bioavailability and/or bioaccumulation of the active ingredient. Our results highlight the importance of ecotoxicological assessment not only of the active ingredients, but also of the different formulations usually employed in agricultural practices. PMID:23332878

  18. Glyphosate in the rhizosphere-role of waiting times and different glyphosate binding forms in soils for phytotoxicity to non-target plants

    OpenAIRE

    Tesfamariam, Tsehaye; Bott, S.; ÇAKMAK, İsmail; Cakmak, Ismail; Roemheld, V.; Neumann, G.

    2009-01-01

    Glyphosate is the most widely used non-selective, systemic herbicide. It is easily translocated from shoot to roots and released into the rhizosphere, where it is immobilized at the soil matrix or microbially degraded. However, contradictory results are reported in the literature concerning the bio-availability of glyphosate residues in soils and the potential risks for intoxication of non-target organisms. This study addresses the question whether plant residues of glyphosate-treated weeds (...

  19. Amplification for the Adolescent.

    Science.gov (United States)

    Wilber, Laura Ann

    1978-01-01

    Explored are various means of amplification for aurally handicapped adolescents, including behind-the-ear hearing aids, "custom ear" (or in-the-ear) hearing aids, as well as aural rehabilitation. (BD)

  20. Photodegradation of glyphosate in the ferrioxalate system

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yong [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China); Wu Feng [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China)], E-mail: fengwu@whu.edu.cn; Lin Yixin; Deng Nansheng [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China); Bazhin, Nikolai; Glebov, Evgeni [Institute of Chemical Kinetics and Combustion, 3 Institutskaya St., Novosibirsk 630090 (Russian Federation)

    2007-09-05

    The photoinduced degradation of glyphosate (GLP) in the ferrioxalate system was investigated under irradiation with a 250 W metal halide lamp ({lambda} {>=} 365 nm). The efficiency of orthophosphates release, representing the photodegradation efficiency of GLP, increased with decreasing the initial concentrations of GLP and Fe(III)/oxalate ratios. At acidic pH value in the range of 3.5-5.0, higher efficiency of orthophosphates release up to 60.6% was achieved, while the efficiency dropped to 42.1% at pH 6.0. The photochemical process mainly involved the predominant species of iron(III), namely Fe(C{sub 2}O{sub 4}){sub 2}{sup -} and Fe(C{sub 2}O{sub 4}){sub 3}{sup 3-}, which lead to the formation of hydroxyl radicals in the presence of dissolved oxygen under UV-vis irradiation. Also, the complexation of GLP with Fe(III) obviously increased the light absorption of GLP and facilitated its degradation by direct photolysis. The ninhydrin test for primary amines showed that the GLP was attacked by hydroxyl radicals with C-N cleavage to yield aminomethylphosphonic acid (AMPA) and C-P cleavage to yield sarcosine. The photodegradation may be enhanced by the decomposition of reactive radicals produced through ligand-to-metal charge transfer (LMCT) of ferric-GLP complexes.

  1. Photodegradation of glyphosate in the ferrioxalate system

    International Nuclear Information System (INIS)

    The photoinduced degradation of glyphosate (GLP) in the ferrioxalate system was investigated under irradiation with a 250 W metal halide lamp (λ ≥ 365 nm). The efficiency of orthophosphates release, representing the photodegradation efficiency of GLP, increased with decreasing the initial concentrations of GLP and Fe(III)/oxalate ratios. At acidic pH value in the range of 3.5-5.0, higher efficiency of orthophosphates release up to 60.6% was achieved, while the efficiency dropped to 42.1% at pH 6.0. The photochemical process mainly involved the predominant species of iron(III), namely Fe(C2O4)2- and Fe(C2O4)33-, which lead to the formation of hydroxyl radicals in the presence of dissolved oxygen under UV-vis irradiation. Also, the complexation of GLP with Fe(III) obviously increased the light absorption of GLP and facilitated its degradation by direct photolysis. The ninhydrin test for primary amines showed that the GLP was attacked by hydroxyl radicals with C-N cleavage to yield aminomethylphosphonic acid (AMPA) and C-P cleavage to yield sarcosine. The photodegradation may be enhanced by the decomposition of reactive radicals produced through ligand-to-metal charge transfer (LMCT) of ferric-GLP complexes

  2. Early amplification options.

    Science.gov (United States)

    Gabbard, Sandra Abbott; Schryer, Jennifer

    2003-01-01

    Children with permanent hearing loss have been remediated with hearing amplification devices for decades. The influx of young infants identified with hearing loss through successful newborn hearing screening programs has established a need for amplification resources for infants within the first six months of life. For the approximately two of every 1000 infants born who are identified with bilateral hearing loss [Mehl and Thomson, 1998, Pediatrics 101, p. e4], the use of amplification is commonly the first step in treating the sequella of their loss. The use of hearing aids, combined with early intervention, has been shown to significantly improve the speech and language skills of young children with hearing loss [Yoshinaga-Itano, 2000, Seminars in Hearing 21, p. 309]. Speech and language delays have contributed to compromised academic performance of school aged children with hearing loss [Johnson et al., 1997, Educational Audiology Handbook, Singular Publishing, San Diego]. Most hard-of-hearing and deaf children use hearing aids and other assistive listening devices every day throughout their lifetime and the life expectancy of a hearing aid is only five to eight years. The current challenge for pediatric audiologists is selecting and evaluating the available amplification to provide the best options for children and their families. Amplification technology has seen an explosion in growth the past few years and the options continue to expand rapidly. This article examines currently available amplification technology and reviews the selection criteria that may be used for infants and young children. Issues such as style, type, amplification features, signal processing strategies, and verification and validation tools are also discussed. PMID:14648816

  3. The effect of two glyphosate formulations on a small, diurnal lizard (Oligosoma polychroma).

    Science.gov (United States)

    Carpenter, Joanna K; Monks, Joanne M; Nelson, Nicola

    2016-04-01

    Formulations of glyphosate-based herbicides continue to dominate the global herbicide market, while there continue to be concerns regarding the impact of this herbicide on non-target organisms. Research also indicates that the additives within certain glyphosate formulations, such as surfactants, are actually more toxic than the glyphosate active ingredient alone. Concerns arise in particular when glyphosate formulations are proposed for vegetation control in areas inhabited by rare or threatened species. Although the effect of glyphosate on birds and mammals is well studied, reptiles remain neglected in ecotoxicological studies. We investigated whether dermal exposure to two different commercial glyphosate formulations affected performance measures in the New Zealand common skink (Oligosoma polychroma). Fifty-eight skinks were each placed in a box of straw to simulate field conditions and sprayed once with Agpro Glyphosate 360, Yates Roundup Weedkiller (both at the label-specified concentrations of 144 mg glyphosate per 1 L water), or water (control). Agpro Glyphosate 360 contained ethoxylated tallow amine at a concentration of <200 g/L, while the surfactant within Yates Roundup Weedkiller was unknown. Following treatment skinks were kept in captivity and sampled for selected temperature and mass over a four-week period. Neither glyphosate formulation had a significant impact on mass. However, skinks treated with Yates Roundup Weedkiller selected significantly higher temperatures across 3 weeks following exposure. This heat-seeking behaviour could be a fever response to increase metabolism and thereby counteract physiological stress. PMID:26841966

  4. Quantum Feedback Amplification

    Science.gov (United States)

    Yamamoto, Naoki

    2016-04-01

    Quantum amplification is essential for various quantum technologies such as communication and weak-signal detection. However, its practical use is still limited due to inevitable device fragility that brings about distortion in the output signal or state. This paper presents a general theory that solves this critical issue. The key idea is simple and easy to implement: just a passive feedback of the amplifier's auxiliary mode, which is usually thrown away. In fact, this scheme makes the controlled amplifier significantly robust, and furthermore it realizes the minimum-noise amplification even under realistic imperfections. Hence, the presented theory enables the quantum amplification to be implemented at a practical level. Also, a nondegenerate parametric amplifier subjected to a special detuning is proposed to show that, additionally, it has a broadband nature.

  5. Weed species shifts in glyphosate-resistant crops.

    Science.gov (United States)

    Owen, Micheal D K

    2008-04-01

    The adoption of glyphosate-based crop production systems has been one of the most important revolutions in the history of agriculture. Changes in weed communities owing to species that do not respond to current glyphosate-based management tactics are rapidly increasing. Clearly, glyphosate-resistant crops (GRCs) do not influence weeds any more than non-transgenic crops. For most crops, the trait itself is essentially benign in the environment. Rather, the weed control tactics imposed by growers create the ecological selection pressure that ultimately changes the weed communities. This is seen in the adoption of conservation tillage and weed management programs that focus on one herbicide mode of action and have hastened several important weed population shifts. Tillage (disturbance) is one of the primary factors that affect changes in weed communities. The intense selection pressure from herbicide use will result in the evolution of herbicide-resistant weed biotypes or shifts in the relative prominence of one weed species in the weed community. Changes in weed communities are inevitable and an intrinsic consequence of growing crops over time. The glyphosate-based weed management tactics used in GRCs impose the selection pressure that supports weed population shifts. Examples of weed population shifts in GRCs include common waterhemp [Amaranthus tuberculatus (Moq ex DC) JD Sauer], horseweed (Conyza canadensis L), giant ragweed (Ambrosia trifida L) and other relatively new weed problems. Growers have handled these weed population shifts with varying success depending on the crop. PMID:18232055

  6. Interactions between glyphosate, Fusarium infection of waterhemp, and soil microorganisms

    Science.gov (United States)

    Greenhouse and laboratory experiments were conducted on waterhemp (Amaranthus rudis Sauer) and soil collected from 144 soybean fields in Missouri that contained late-season waterhemp escapes. The objectives of these experiments were to: 1) determine the frequency and distribution of glyphosate res...

  7. Weed Community and Glyphosate Management in Soybean Crops

    Science.gov (United States)

    A concern to some conservationists is the loss of biodiversity of weedy plant species in the face of wide-spread adoption by farmers of transgenic crops that are resistant to broad-spectrum herbicides such as glyphosate. We studied weed biodiversity in both Argentina and the USA, the two countries w...

  8. A novel 5-enolpyruvoylshikimate-3-phosphate (EPSP) synthase transgene for glyphosate resistance stimulates growth and fecundity in weedy rice (Oryza sativa) without herbicide.

    Science.gov (United States)

    Wang, Wei; Xia, Hui; Yang, Xiao; Xu, Ting; Si, Hong Jiang; Cai, Xing Xing; Wang, Feng; Su, Jun; Snow, Allison A; Lu, Bao-Rong

    2014-04-01

    Understanding evolutionary interactions among crops and weeds can facilitate effective weed management. For example, gene flow from crops to their wild or weedy relatives can lead to rapid evolution in recipient populations. In rice (Oryza sativa), transgenic herbicide resistance is expected to spread to conspecific weedy rice (Oryza sativa f. spontanea) via hybridization. Here, we studied fitness effects of transgenic over-expression of a native 5-enolpyruvoylshikimate-3-phosphate synthase (epsps) gene developed to confer glyphosate resistance in rice. Controlling for genetic background, we examined physiological traits and field performance of crop-weed hybrid lineages that segregated for the presence or absence of this novel epsps transgene. Surprisingly, we found that transgenic F2 crop-weed hybrids produced 48-125% more seeds per plant than nontransgenic controls in monoculture- and mixed-planting designs without glyphosate application. Transgenic plants also had greater EPSPS protein levels, tryptophan concentrations, photosynthetic rates, and per cent seed germination compared with nontransgenic controls. Our findings suggest that over-expression of a native rice epsps gene can lead to fitness advantages, even without exposure to glyphosate. We hypothesize that over-expressed epsps may be useful to breeders and, if deployed, could result in fitness benefits in weedy relatives following transgene introgression. PMID:23905647

  9. Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes

    Institute of Scientific and Technical Information of China (English)

    Baoqing; Dun; Xujing; Wang; Wei; Lu; Ming; Chen; Wei; Zhang; Shuzhen; Ping; Zhixing; Wang; Baoming; Zhang; Min; Lin

    2014-01-01

    The widely used herbicide glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase(EPSPS).Glyphosate acetyltransferase(GAT)effectively detoxifies glyphosate by N-acetylation.With the aim of identifying a new strategy for development of glyphosate-tolerant crops,the plant expression vector pG2-GAT harboring gat and G2-aroA(encoding EPSPS)has been transformed into tobacco(Nicotiana tabacum)to develop novel plants with higher tolerance to glyphosate.Results from Southern and Western blotting analyses indicated that the target genes were integrated into tobacco chromosomes and expressed effectively at the protein level.Glyphosate tolerance was compared among transgenic tobacco plants containing gat,G2-aroA,or both genes.Plants containing both gat and G2-aroA genes were the most glyphosate-tolerant.This study has shown that a combination of different strategies may result in higher tolerance in transgenic crops,providing a new approach for development of glyphosate-tolerant crops.

  10. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    Directory of Open Access Journals (Sweden)

    Prata Fábio

    2003-01-01

    Full Text Available The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with KH2PO4 at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha-1 of P2O5, which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L-1, with a 14C radioactivity of 0.233 kBq mL-1. Four steps of the desorption procedure with CaCl2 0.01 mol L-1 and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L-1. Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm-3. Moreover, a small amount of applied glyphosate was extracted (<10%, and the extraction increased with increasing soil phosphorus content.

  11. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    International Nuclear Information System (INIS)

    The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with Kh2PO4 at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha-1 of P2O5, which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L-1), with a 14C radioactivity of 0.233 kBq mL-1. Four steps of the desorption procedures withCaCl2 0.01 mol L-1 and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L-1). Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm-3. Moreover, a small amount of applied glyphosate was extracted (<10%), and the extraction increased with increasing soil phosphorus content. (author)

  12. Growth stage influences level of resistance in glyphosate-resistant horseweed

    OpenAIRE

    Shrestha, Anil; Hembree, Kurt J; Va, Neil

    2007-01-01

    While glyphosate-resistant horseweed has not previously been reported in California, we suspected that it might exist, especially in noncrop areas. We collected horseweed seeds from two locations in the San Joaquin Valley and treated greenhouse-grown plants at different stages with different amounts of glyphosate. This study showed that a glyphosate-resistant biotype of horseweed exists in the noncrop areas of Dinuba, in Tulare County, and that the level of resistance may be influenced by the...

  13. Losses of glyphosate and AMPA via drainflow in a typical Belgian residential area

    Science.gov (United States)

    Tang, Ting; Boënne, Wesley; van Griensven, Ann; Seuntjens, Piet; Bronders, Jan; Desmet, Nele

    2014-05-01

    Urban hard surfaces are considered as important facilitators for pesticide transport into urban streams. To obtain concurrent high-resolution data for a detailed investigation on the losses of pesticide runoff from hard surfaces, a monitoring campaign was performed in a typical Belgian residential area (9.5 ha) between 7 May and 7 August, 2013. The campaign yielded a concurrent dataset of rainfall (1-mm rainfall interval), discharge (1-min interval), glyphosate application by the residents and the occurrences of glyphosate and its major degradation product - aminomethylphosphonic acid (AMPA) in the separated storm drainage outflow during 12 rainfall events. In addition, detailed information was obtained on the spatial characteristics of the study area. The resulting dataset allows us to investigate the relevance of catchment hydrology, urban surface properties and pesticide application to the transport and losses of glyphosate in a residential environment. During the campaign, glyphosate was only applied by local residents, mainly on their private driveways. As a result of their continuous use, both glyphosate and AMPA were detected in all analysed outflow samples, with maximum concentrations of 6.1 μg/L and 5.8 μg/L, respectively. Overall, the storm drainage system collected 0.43% of the applied amount of glyphosate. However, this loss rate varied considerably among rainfall events, ranging from 0.04% to 23.36%. According to statistical analysis of the 12 rainfall events, the loss rate was significantly correlated with three factors: the application amount prior to a rainfall event (p glyphosate application and the start of the rainfall event (negatively, p glyphosate. Furthermore, three types of glyphosate runoff were classified by a clustering analysis based on these factors: events dominated by runoff availability (runoff-limited), dominated by glyphosate availability (pesticide-limited) and controlled by both runoff and glyphosate availability. To sum up

  14. Review of GMO safety assessment studies: glyphosate residues in Roundup Ready crops is an ignored issue

    OpenAIRE

    Cuhra, Marek

    2015-01-01

    Published version, also available at http://dx.doi.org/10.1186/s12302-015-0052-7 Background Genetically modified glyphosate-tolerant cultivar varieties have been a commercial success widely known as Roundup Ready plants. As new glyphosate-tolerant varieties are introduced to satisfy agriculture demand, it is relevant to review the scientific evidence that documents the quality and safety of such biotechnology. Assessments of genetically modified glyphosate-tolerant plants are partly ba...

  15. Degradation Dynamics of Glyphosate in Different Types of Citrus Orchard Soils in China

    OpenAIRE

    Changpeng Zhang; Xiuqing Hu; Jinyan Luo; Zhiyi Wu; Li Wang; Bin Li,; Yanli Wang; Guochang Sun

    2015-01-01

    Glyphosate formulations that are used as a broad-spectrum systemic herbicide have been widely applied in agriculture, causing increasing concerns about residues in soils. In this study, the degradation dynamics of glyphosate in different types of citrus orchard soils in China were evaluated under field conditions. Glyphosate soluble powder and aqueous solution were applied at 3000 and 5040 g active ingredient/hm2, respectively, in citrus orchard soils, and periodically drawn soil samples were...

  16. Degradation of the Herbicide Glyphosate by Members of the Family Rhizobiaceae

    OpenAIRE

    Liu, C.-M.; McLean, P A; Sookdeo, C. C.; Cannon, F C

    1991-01-01

    Several strains of the family Rhizobiaceae were tested for their ability to degrade the phosphonate herbicide glyphosate (isopropylamine salt of N-phosphonomethylglycine). All organisms tested (seven Rhizobium meliloti strains, Rhizobium leguminosarum, Rhizobium galega, Rhizobium trifolii, Agrobacterium rhizogenes, and Agrobacterium tumefaciens) were able to grow on glyphosate as the sole source of phosphorus in the presence of the aromatic amino acids, although growth on glyphosate was not a...

  17. Uses of glyphosate in German arable farming – aspects of weed management and arable practice

    OpenAIRE

    Wiese, Armin; Schulte, Michael; Theuvsen, Ludwig

    2016-01-01

    Data on glyphosate use, personal attitudes and farm characteristics were collected in a Germany-wide inventory from 2026 farms. About 1700 farms could be analyzed in detail. Categories of glyphosate users were split into: non-users, low proportion users and high proportion users. The latter apply glyphosate on > 20% of their arable land are characterized by a high amount of non-inversion tillage, low labor effort and aboveaverage farm size. Perennial weeds play a less important role for glyph...

  18. BEHAVIOR OF THE NON-SELECTIVE HERBICIDE GLYPHOSATE IN AGRICULTURAL SOIL

    OpenAIRE

    Abdul Jabbar Al-Rajab; Othman M. Hakami

    2014-01-01

    Glyphosate [N-phosphonomethyl]glycine is a systematic, non-selective, organophosphorus herbicide used worldwide in agriculture and industrial zones. Following its application, residues of glyphosate can threaten soil or aquatic organisms in adjacent water. In this study, we followed the degradation, stabilization, remobilization and leaching of 14C-glyphosate in three agricultural soils in laboratory incubations and in lysimeters under field condition...

  19. Annual Glyphosate Treatments Alter Growth of Unaffected Bentgrass (Agrostis) Weeds and Plant Community Composition

    OpenAIRE

    Ahrens, Collin W.; Carol A Auer

    2012-01-01

    Herbicide resistance is becoming more common in weed ecotypes and crop species including turfgrasses, but current gaps in knowledge limit predictive ecological risk assessments and risk management plans. This project examined the effect of annual glyphosate applications on the vegetative growth and reproductive potential of two weedy bentgrasses, creeping bentgrass (CB) and redtop (RT), where the glyphosate resistance (GR) trait was mimicked by covering the bentgrass plants during glyphosate ...

  20. On soliton amplification

    Science.gov (United States)

    Leibovich, S.; Randall, J. D.

    1979-01-01

    The paper considers a modified Korteweg-de Vries equation that permits wave amplification or damping. A 'terminal similarity' solution is identified for large times in amplified systems. Numerical results are given which confirm that the terminal similarity solution is a valid local approximation for mu t sufficiently large and positive, even though the approximation is not uniformly valid in space.

  1. Neutralization of the antimicrobial effect of glyphosate by humic acid in vitro.

    Science.gov (United States)

    Shehata, Awad A; Kühnert, Manfred; Haufe, Svent; Krüger, Monika

    2014-06-01

    In the present study, the neutralization ability of the antimicrobial effect of glyphosate by different humic acids was investigated. The minimal inhibitory concentrations of glyphosate for different bacteria such as Bacillus badius, Bifidobacterium adolescentis, Escherichia coli, E. coli 1917 strain Nissle, Enterococcus faecalis, Enterococcus faecium, Salmonella enteritidis and Salmonella typhimurium were determined in the presence or absence of different concentrations of humic acid (0.25, 0.5 and 1.0 mg mL(-1)). Our findings indicated that humic acids inhibited the antimicrobial effect of glyphosate on different bacteria. This information can help overcome the negative impact of glyphosate residues in feed and water. PMID:24268342

  2. Differential effects of glyphosate and aminomethylphosphonic acid (AMPA) on photosynthesis and chlorophyll metabolism in willow plants.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Le Manac'h, Sarah Gingras; Maccario, Sophie; Labrecque, Michel; Lucotte, Marc; Juneau, Philippe

    2016-06-01

    We used a willow species (Salix miyabeana cultivar SX64) to examine the differential secondary-effects of glyphosate and aminomethylphosphonic acid (AMPA), the principal glyphosate by-product, on chlorophyll metabolism and photosynthesis. Willow plants were treated with different concentrations of glyphosate (equivalent to 0, 1.4, 2.1 and 2.8kgha(-1)) and AMPA (equivalent to 0, 0.28, 1.4 and 2.8kgha(-1)) and evaluations of pigment contents, chlorophyll fluorescence, and oxidative stress markers (hydrogen peroxide content and antioxidant enzyme activities) in leaves were performed after 12h of exposure. We observed that AMPA and glyphosate trigger different mechanisms leading to decreases in chlorophyll content and photosynthesis rates in willow plants. Both chemicals induced ROS accumulation in willow leaves although only glyphosate-induced oxidative damage through lipid peroxidation. By disturbing chlorophyll biosynthesis, AMPA induced decreases in chlorophyll contents, with consequent effects on photosynthesis. With glyphosate, ROS increases were higher than the ROS-sensitive threshold, provoking chlorophyll degradation (as seen by pheophytin accumulation) and invariable decreases in photosynthesis. Peroxide accumulation in both AMPA and glyphosate-treated plants was due to the inhibition of antioxidant enzyme activities. The different effects of glyphosate on chlorophyll contents and photosynthesis as described in the literature may be due to various glyphosate:AMPA ratios in those plants. PMID:27155486

  3. Glyphosate inhibition of ferric reductase activity in iron deficient sunflower roots

    OpenAIRE

    Öztürk, Levent; Ozturk, Levent; Yazıcı, Mustafa Atilla; Yazici, Mustafa Atilla; Eker, Selim; Gökmen, Özay Özgür; Gokmen, Ozay Ozgur; Römheld, Volker; Romheld, Volker; ÇAKMAK, İsmail; Cakmak, Ismail

    2007-01-01

    Iron (Fe) deficiency is increasingly being observed in cropping systems with frequent glyphosate applications. A likely reason for this is that glyphosate interferes with root uptake of Fe by inhibiting ferric reductase in roots required for Fe acquisition by dicot and nongrass species. This study investigated the role of drift rates of glyphosate (0.32, 0.95 or 1.89 mM glyphosate corresponding to 1, 3 and 6% of the recommended herbicidal dose, respectively) on ferric reductase activity of...

  4. Cloning and sequencing of the genes involved in glyphosate utilization by Pseudomonas pseudomallei.

    OpenAIRE

    Peñaloza-Vazquez, A; Mena, G L; Herrera-Estrella, L.; Bailey, A M

    1995-01-01

    Thirty-four strains of Pseudomonas pseudomallei isolated from soil were selected for their ability to degrade the phosphonate herbicide glyphosate. All strains tested were able to grow on glyphosate as the only phosphorus source without the addition of aromatic amino acids. One of these strains, P. pseudomallei 22, showed 50% glyphosate degradation in 40 h in glyphosate medium. From a genomic library of this strain constructed in pUC19, we have isolated a plasmid carrying a 3.0-kb DNA fragmen...

  5. Import of a precursor protein into chloroplasts is inhibited by the herbicide glyphosate

    OpenAIRE

    della-Cioppa, Guy; Kishore, Ganesh M.

    1988-01-01

    Import of the precursor to 5-enolpyruvylshikimate-3-phosphate synthase (pEPSPS) into chloroplasts is inhibited by the herbicide glyphosate. Inhibition of import is maximal at glyphosate concentrations of ≥10 μm and occurs only when pEPSPS is present as a ternary complex of enzyme–shikimate-3-phosphate–glyphosate. Glyphosate alone had no effect on the import of pEPSPS since it is not known to interact with the enzyme in the absence of shikimate-3-phosphate. Experiments with wild-type and glyph...

  6. Inheritance of Evolved Glyphosate Resistance in a North Carolina Palmer Amaranth (Amaranthus palmeri) Biotype

    OpenAIRE

    Aman Chandi; Susana R. Milla-Lewis; Darci Giacomini; Philip Westra; Christopher Preston; Jordan, David L.; Alan C. York; James D. Burton; Jared R. Whitaker

    2012-01-01

    Inheritance of glyphosate resistance in a Palmer amaranth biotype from North Carolina was studied. Glyphosate rates for 50% survival of glyphosate-resistant (GR) and glyphosate-susceptible (GS) biotypes were 1288 and 58 g ha−1, respectively. These values for F1 progenies obtained from reciprocal crosses (GR×GS and GS×GR were 794 and 501 g ha−1, respectively. Dose response of F1 progenies indicated that resistance was not fully dominant over susceptibility. Lack of significant differences betw...

  7. The Research Progress of Glyphosate Resistance%草甘膦抗性研究进展

    Institute of Scientific and Technical Information of China (English)

    武骁

    2014-01-01

    草甘膦抗性研究集中在2个方面:抗草甘膦作物的研究、杂草对草甘膦抗性的研究。结合草甘膦的开发与发展,论述了这2种抗性的发展及相关研究。%Glyphosate resistance study concentrated on two aspects: glyphosate-tolerant crop, resistance weeds to glyphosate. Combined with the development and evolution of glyphosate, the development and related research of these resistances discusses in this paper.

  8. The Fate and Transport of Glyphosate and AMPA into Surface Waters of Agricultural Watersheds

    Science.gov (United States)

    Coupe, R.; Kalkhoff, S.; Capel, P.; Gregoire, C.

    2010-12-01

    Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used widely throughout the world in the production of many crops, but is particularly heavily used on crops which are genetically modified to be glyphosate tolerant: predominately soybeans, corn, potatoes, and cotton. Glyphosate is used extensively in almost all agricultural areas of the United States, and annual application has increased from less than 10,000 Mg in 1992 to more than 80,000 Mg in 2007. The greatest areal use is in the Midwest where glyphosate is applied on genetically modified corn and soybeans. Although use is increasing, the characterization of glyphosate transport on the watershed scale is lacking. Glyphosate, and its degradate AMPA [aminomethylphosphoric acid], was frequently detected in the surface waters of four agricultural watersheds. The load as a percent of use of glyphosate ranged from 0.009 to 0.86 percent and can be related to three factors: source strength, hydrology, and flowpath. Glyphosate use within a watershed results in some occurrence in surface water at the part per billion level; however watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff, and a flowpath that does not include transport through the soil.

  9. Aplicação foliar de manganês em soja transgênica tolerante ao glyphosate Foliar application of manganese in transgenic soybean tolerant to glyphosate

    Directory of Open Access Journals (Sweden)

    Claudir José Basso

    2011-10-01

    Full Text Available O amarelecimento da soja Roundup Ready após aplicação do glyphosate pode estar associado à deficiência momentânea de manganês. Por isso, com a hipótese de que soja tolerante ao glyphosate necessitaria de uma adição suplementar de manganês, o objetivo deste trabalho foi avaliar diferentes manejos na aplicação foliar de manganês sobre alguns parâmetros da soja. Foram desenvolvidos dois experimentos, um no município de Taquaruçú do Sul e outro em Boa Vista das Missões, RS, no ano agrícola 2009/2010. Foram testados os seguintes tratamentos: 1 sem aplicação de glyphosate, com controle manual das plantas daninhas e sem aplicação foliar de manganês (testemunha; 2 sem aplicação de glyphosate, com controle manual das plantas daninhas e uma aplicação foliar de manganês sete dias após esse controle manual das plantas daninhas; 3 com aplicação de glyphosate e sem aplicação foliar de manganês; 4 aplicação de glyphosate em mistura com manganês; 5 aplicação de glyphosate mais uma aplicação foliar de manganês sete dias após aplicação do glyphosate; 6 aplicação de glyphosate mais aplicação foliar de manganês parcelada em duas épocas, aos 7 e 14 dias após aplicação do glyphosate; 7 aplicação de glyphosate e uma aplicação foliar de manganês aos 14 dias após aplicação de glyphosate. A aplicação de glyphosate foi realizada no estádio V5 da soja, na dose de 720g L-1 e.a, enquanto a dose de Mn utilizada foi 2,0L ha-1 de uma formulação contendo 14% (m/v de manganês solúvel. Não houve diferença significativa entre os tratamentos para as variáveis estatura de plantas e altura de inserção da primeira vagem. A aplicação de glyphosate não afetou a absorção e o teor foliar de manganês e nitrogênio na cultura da soja. Mesmo com aumento no teor foliar de manganês com a suplementação de manganês, não houve incremento na produtividade da soja. Isso mostra que em solos com teores de Mn acima

  10. The intensity of non-target site mechanisms influences the level of resistance of sourgrass to glyphosate

    OpenAIRE

    Flávia Regina da Costa; Leonardo Bianco Carvalho; Pedro Luis da Costa Aguiar Alves; Rafael De Prado

    2014-01-01

    Non-target site mechanisms are involved in the resistance of sourgrass (Digitaria insularis) to glyphosate. Studies on the 14C-glyphosate absorption and translocation as well as the detection of glyphosate and its metabolites in sourgrass plants were carried out under controlled conditions to investigate if the differential response of resistant sourgrass biotypes (R1 and R2) is derived from the intensity of non-target site mechanisms involved in the resistance to glyphosate. Different patter...

  11. Adsorção de glifosato sobre solos e minerais Adsorption of glyphosate on soils and minerals

    OpenAIRE

    Luís R. M. Toni; Henrique de Santana; Dimas A. M. Zaia

    2006-01-01

    Glyphosate, an enzyme inhibitor herbicide, has been widely used around the world in agriculture. Dr. John Franz from Monsanto Corporation (USA) discovered glyphosate in 1970. It has been showed that glyphosate is strongly adsorbed by inorganic soil components especially aluminium and iron oxides, and the phosphate group is involved in this interaction. The inactivation of glyphosate in soils can last for days or even months depending on soil characteristics. The addition of phosphate from fer...

  12. Resistência de Conyza canadensis e C. bonariensis ao herbicida glyphosate Glyphosate-resistance in Conyza canadensis and C. bonariensis

    Directory of Open Access Journals (Sweden)

    M.S. Moreira

    2007-03-01

    Full Text Available O objetivo deste trabalho foi avaliar, por meio de curvas de dose-resposta, a ocorrência de biótipos resistentes ao herbicida glyphosate em populações de Conyza canadensis e C. bonariensis, bem como propor tratamentos alternativos para esses biótipos. Os experimentos foram realizados em casa de vegetação, utilizando-se três populações de cada espécie: duas com suspeita de resistência ao herbicida glyphosate, coletadas em pomares de laranja localizados em duas regiões diferentes do Estado de São Paulo; e uma suscetível, coletada em área sem histórico de aplicação do herbicida. O delineamento experimental adotado foi o de blocos ao acaso, com quatro repetições. Para cada espécie, os tratamentos foram resultado da combinação fatorial entre as três populações e os tratamentos herbicidas (oito doses de glyphosate ou cinco tratamentos alternativos. As doses de glyphosate foram (g e.a. ha¹: 90, 180, 360, 720, 1.440, 2.880, 5.760 e testemunha sem aplicação. Como alternativas de controle, foram testados os seguintes tratamentos (g ha-1: glyphosate + 2,4-D (1.440 + 1.005, glyphosate + metsulfuron (1.440 + 2,4, glyphosate + metsulfuron (1.440 + 3,6, glyphosate + metribuzin (1.440 + 480 e testemunha sem aplicação. A partir dos resultados, comprovou-se a existência de populações de ambas as espécies com biótipos resistentes ao herbicida glyphosate, com diferentes níveis de resistência. Todos os tratamentos herbicidas alternativos controlaram de forma eficiente as três populações de cada espécie.The objective of this research was to evaluate, through dose-response curves, the occurrence of glyphosate-resistant biotypes in populations of Conyza canadensis and C. bonariensis; as well as to propose alternative treatments to these biotypes. The experiments were conducted in a greenhouse, using three populations of each species: two with suspicion of resistance to the herbicide glyphosate, and collected in orange orchards

  13. Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean; Efeito de formulacoes na absorcao e translocacao do glyphosate em soja transgenica

    Energy Technology Data Exchange (ETDEWEB)

    Santos, J.B. [UNIVALE, Governador Valadares, MG (Brazil). FAAG. Agronomia]. E-mail: jbarbosa@univale.br; Ferreira, E.A.; Silva, A.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Fitotecnia]. E-mail: evanderalves@yahoo.com.br; aasilva@ufv.br; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral]. E-mail: jalves@ufv.br; Fialho, C.M.T. [Universidade Federal de Vicosa (UFV), MG (Brazil). Agronomia]. E-mail: cintiamtfialho@yahoo.com.br

    2007-07-01

    This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

  14. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Glyphosate Oxidoreductase GOX or... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.524 Glyphosate... Glyphosate Oxidoreductase GOX or GOXv247 enzyme in all plants are exempt from the requirement of a...

  15. Functional genomics analysis of horseweed (Conyza canadensis) with special reference to the evolution of non-target-site glyphosate resistance

    Science.gov (United States)

    The evolution of glyphosate resistance in weedy species places an environmentally benign herbicide in peril. The first report of a dicot plant with evolved glyphosate resistance was horseweed, which occurred in 2001. Since then, several species have evolved glyphosate resistance and genomic informat...

  16. Research on the weed control degree and glyphosate soil biodegradation in apple plantations (Pioneer variety

    Directory of Open Access Journals (Sweden)

    Ersilia ALEXA

    2010-05-01

    Full Text Available In this study we follow control degree of glyphosate herbicide on weeds in apple plantations (Pioneer variety of the Research Station Timisoara. It was also followed glyphosate biodegradation capacity in the soil by determining the amount of CO2 released by the action of microorganisms on C14 glyphosate marked isotope. Laboratory analysis of glyphosate residues in soil was made using a Liquid Scintillation TRIATHLER. Glyphosate biodegradation ability in the presence of soil microorganisms is high, so glyphosate residues remaining in soil, in terms of its use in weed combating, are minimal. Study of glyphosate biodegradation capacity in the experimental field indicates that the CO2 fraction accumulated after 50 days is 28.02% for samples exposed in the experimental field. Weather conditions, especially temperature variations between day and night, influences the activity of soilmicroorganisms and affect biodegraded glyphosate percentage.Chemical method of weed control consisted in: herbicide used was Roundup 3 l/ha (glyphosate isopropyl amine salt 360 g/l and are based on chemical application on weeds, on the rows of trees, on their uptake and translocation in their organs having as principal scope the total destruction of weeds. The experimental results obtained reveal a weed combat degree of 82.98% , in the case of chemical variant, compared with control variant. The species combated mainly due to glyphosate herbicide, which is no longer found in the final mapping are: Capsella bursa-pastoris, Chenopodium album, Echinochloa crus-galli, Plantago major, Polygonum aviculare. Total combated weeds /m2 with glyphosate is 126.67.

  17. Development of Novel Glyphosate-Tolerant Japonica Rice Lines: A Step Toward Commercial Release.

    Science.gov (United States)

    Cui, Ying; Huang, Shuqing; Liu, Ziduo; Yi, Shuyuan; Zhou, Fei; Chen, Hao; Lin, Yongjun

    2016-01-01

    Glyphosate is the most widely used herbicide for its low cost and high efficiency. However, it is rarely applied directly in rice field due to its toxicity to rice. Therefore, glyphosate-tolerant rice can greatly decrease the cost of rice production and provide a more effective weed management strategy. Although, several approaches to develop transgenic rice with glyphosate tolerance have been reported, the agronomic performances of these plants have not been well evaluated, and the feasibility of commercial production has not been confirmed yet. Here, a novel glyphosate-tolerant gene cloned from the bacterium Isoptericola variabilis was identified, codon optimized (designated as I. variabilis-EPSPS (*)), and transferred into Zhonghua11, a widely used japonica rice cultivar. After systematic analysis of the transgene integration via PCR, Southern blot and flanking sequence isolation, three transgenic lines with only one intact I. variabilis-EPSPS (*) expression cassette integrated into intergenic regions were identified. Seed test results showed that the glyphosate tolerance of the transgenic rice was about 240 times that of wild type on plant medium. The glyphosate tolerance of transgenic rice lines was further evaluated based on comprehensive agronomic performances in the field with T3 and T5generations in a 2-year assay, which showed that they were rarely affected by glyphosate even when the dosage was 8400 g ha(-1). To our knowledge, this is the first demonstration of the development of glyphosate-tolerant rice lines based on a comprehensive analysis of agronomic performances in the field. Taken together, the results suggest that the selected glyphosate-tolerant rice lines are highly tolerant to glyphosate and have the possibility of commercial release. I. variabilis-EPSPS (*) also can be a promising candidate gene in other species for developing glyphosate-tolerant crops. PMID:27625652

  18. Consequences of phosphate application on glyphosate uptake by roots: Impacts for environmental management practices.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Maccario, Sophie; Lucotte, Marc; Labrecque, Michel; Juneau, Philippe

    2015-12-15

    Phosphate (PO4(3-)) fertilization is a common practice in agricultural fields also targets for glyphosate application. Due to their chemical similarities, PO4(3-) and glyphosate compete for soil adsorbing sites, with PO4(3-) fertilization increasing glyphosate bioavailability in the soil solution. After PO4(3-) fertilization, its concentration will be elevated in the soil solution and both PO4(3-) and glyphosate will be readily available for runoff into aquatic ecosystems. In this context, man-made riparian buffer strips (RBS) at the interface of agricultural lands and waterways can be used as a green technology to mitigate water contamination. The plants used in RBS form a barrier to agricultural wastes that can limit runoff, and the ability of these plants to take up these compounds through their roots plays an important role in RBS efficacy. However, the implications of PO4(3-) for glyphosate uptake by roots are not yet clearly demonstrated. Here, we addressed this problem by hydroponically cultivating willow plants in nutrient solutions amended with glyphosate and different concentrations of PO4(3-), assuring full availability of both chemicals to the roots. Using a phosphate carrier inhibitor (phosphonophormic acid-PFA), we found that part of the glyphosate uptake is mediated by PO4(3-) transporters. We observed, however, that PO4(3-) increased glyphosate uptake by roots, an effect that was related to increased root cell membrane stability. Our results indicate that PO4(3-) has an important role in glyphosate physiological effects. Under agricultural conditions, PO4(3-) fertilization can amplify glyphosate efficiency by increasing its uptake by the roots of undesired plants. On the other hand, since simultaneous phosphate and glyphosate runoffs are common, non-target species found near agricultural fields can be affected. PMID:26282745

  19. Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance.

    Science.gov (United States)

    Samsel, Anthony; Seneff, Stephanie

    2013-12-01

    Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup(®), is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of "ripening" sugar cane with glyphosate may explain the recent

  20. Selection and characterization of glyphosate tolerance in birdsfoot trefoil (Lotus corniculatus)

    International Nuclear Information System (INIS)

    If birdsfoot trefoil (Lotus corniculatus L.) was tolerant to glyphosate [N-(phosphonomethyl)glycine], Canada thistle [Cirsium arvense (L.) Scop.] and other dicot weeds could be selectively controlled in certified seed production fields. Glyphosate tolerance in birdsfoot trefoil was identified in plants from the cultivar Leo, plants regenerated from tolerant callus, and selfed progeny of plants regenerated from callus. Plants from the three sources were evaluated in field studies for tolerance to glyphosate at rates up to 1.6 kg ae/ha. Plants of Leo selected for tolerance exhibited a twofold range in the rate required to reduce shoot weight 50% (I50s from 0.6 to 1.2 kg/ha glyphosate). Plants regenerated from tolerant callus had tolerance up to 66% greater than plants regenerated from unselected callus. Transgressive segregation for glyphosate tolerance was observed in the selfed progeny of two regenerated plants that both had I50s of 0.7 kg/ha glyphosate. The selfed progeny ranged from highly tolerant (I50 of 1.5 kg/ha) to susceptible (I50 of 0.5 kg/ha). Spray retention, 14C-glyphosate absorption and translocation did not account for the differential tolerance of nine plants that were evaluated from the three sources. The specific activity of 5-enolpyruvylshikimate 3-phosphate (EPSP) synthase ranged from 1.3 to 3.5 nmol/min sm-bullet mg among the nine plants and was positively correlated with glyphosate tolerance. Leo birdsfoot trefoil was found to have significant variation in glyphosate tolerance which made it possible to initiate a recurrent selection program to select for glyphosate tolerance in birdsfoot trefoil. Two cycles of selection for glyphosate tolerance were practiced in three birdsfoot trefoil populations, Leo, Norcen, and MU-81

  1. Glyphosate resistance in tall waterhemp (Amaranthus tuberculatus) from Mississippi is due to both altered target-site and nontarget-site mechanisms

    Science.gov (United States)

    A tall waterhemp population in a glyphosate-resistant soybean field, Washington County, Missisippi, was suspected to be resistant to glyphosate. Glyphosate dose response experiments resulted in GR50 (glyphosate dose required to cause a 50% reduction in growth of treated plants) values of 1.28 and 0....

  2. XinanⅠ介导的草甘膦高抗转基因水稻的研究%Research on Transgenic Glyphosate-tolerant Rice with High-level Resistance by Mediating the Gene of XinanⅠ

    Institute of Scientific and Technical Information of China (English)

    吴涛; 张晓丽; 童天乐; 何军光; 徐京; 楼亿圆; 陆建明

    2012-01-01

    通过农杆菌介导的转化方法,将携带草甘膦抗性基因xinanⅠ的农杆菌分别侵染粳稻品种豫农粳与方欣4号愈伤组织,通过2轮2 mmol/L草甘膦筛选获得抗性愈伤组织,再经过诱导和分化得到了转基因水稻幼苗.对转基因幼苗进行xinanⅠ基因特异性PCR分析和草甘膦抗性筛选,结果表明,豫农粳与方欣4号抗性愈伤组织分化的幼苗的PCR阳性率分别是75.1%和72.0%,草甘膦抗性筛选阳性率分别为52.7%和49.4%.进一步对转基因植株进行抗性分析表明,草甘膦抗性基因xinanⅠ在水稻中可以高效表达,并赋予水稻高水平草甘膦抗性,T0代转基因植株经1.6%草甘膦溶液处理后仍然可以正常生长发育.%The calli of two japonica rice varieties named Yunongjing and Fangxin 4 were infected with Agrobacterium tumefaciens carrying glyphosate-resistant gene xinanl. The resistant calli were obtained after two rounds of screening challenged with 2 mmol/L glyphosate, and the transgenic rice seedlings were further regenerated from resistant calli through inducing and differentiating. The xinanl specific PCR analysis and glyphosate resistance screening were performed to confirm the transgenic plants. The results showed that 75.1% seedlings from Yunongjing and 72.0% seedlings from Fangxin 4 were transgenic plantlets, and 52.7% seedlings from Yunongjing and 49.4% seedlings from Fangxin 4 survived from the glyphosate resistance screening. Further resistance analysis indicated that the glyphosate-tolerant gene xinanl was efficiently expressed, and conferred high-level resistance to glyphosate on the transgenic rice. The T0 generation of transgenic plants developed normally even after 1.6% glyphosate solution treatment.

  3. Glyphosate translocation in hairy fleabane (Conyza bonariensis) biotypes Translocação do glyphosate em biótipos de buva (Conyza bonariensis)

    OpenAIRE

    E.A. Ferreira; L Galon; I. Aspiazú; A.A. Silva; G. Concenço; A.F. Silva; Oliveira, J. A.; L. Vargas

    2008-01-01

    The objective of this work was to evaluate the translocation of glyphosate in C. bonariensis plants resistant and susceptible to that herbicide. The 14C-glyphosate was mixed with commercial gyhphosate (800 g ha-1) and applied on the center of the adaxial face of a third node leaf, using a micro syringe, and adding 10 µL of a solution with specific activity of 1,400 Bq, 45 days after plant emergence. The concentration of the glyphosate translocated in the plant was evaluated at time intervals ...

  4. Glyphosate-resistant hairy fleabane competition in RR® soybean

    OpenAIRE

    Diecson Ruy Orsolin da Silva; Leandro Vargas; Dirceu Agostinetto; Franciele Mariani

    2014-01-01

    Weed competition in the soybean causes changes in morphological and physiological characteristics that reduce the competitive ability of the crop. The objective of this study was to determine the control periods and coexistence of glyphosate-resistant hairy fleabane and its interference in morphological and photosynthetic variables and RR soybean yield. A field experiment was conducted during the 2011/2012 growing season, the treatments consisted of weed interference and weed free periods of ...

  5. Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos

    OpenAIRE

    Akcha, Farida; Spagnol, Charlene; Rouxel, Julien

    2012-01-01

    We investigated the effects of genotoxicant exposure in gametes and embryos to find a possible link between genotoxicity and reproduction/developmental impairment, and explore the impact of chemical genotoxicity on population dynamics. Our study focused on the genotoxic effects of two herbicides on oyster gametes and embryos: glyphosate (both as an active substance and in the Roundup formulation) and diuron. France is Europe's leading consumer of agrochemical substances and as such, contamina...

  6. Ecotoxicological assessment of soil microbial community tolerance to glyphosate.

    Science.gov (United States)

    Allegrini, Marco; Zabaloy, María Celina; Gómez, Elena del V

    2015-11-15

    Glyphosate is the most used herbicide worldwide. While contrasting results have been observed related with its impact on soil microbial communities, more studies are necessary to elucidate the potential effects of the herbicide. Differences in tolerance detected by Pollution Induced Community Tolerance (PICT) approach could reflect these effects. The objective of the present study was to assess the tolerance to glyphosate (the active ingredient and a commercial formulation) of contrasting soils with (H) and without (NH) history of exposure. The hypothesis of a higher tolerance in H soils due to a sustained selection pressure on community structure was tested through the PICT approach. Results indicated that tolerance to glyphosate is not consistent with previous history of exposure to the herbicide either for the active ingredient or for a commercial formulation. Soils of H and NH sites were also characterized in order to determine to what extent they differ in their functional diversity and structure of microbial communities. Denaturant Gradient Gel Electrophoresis (DGGE) and Quantitative Real Time PCR (Q-PCR) indicated high similarity of Eubacteria profiles as well as no significant differences in abundance, respectively, between H and NH sites. Community level physiological profiling (CLPP) indicated some differences in respiration of specific sources but functional diversity was very similar as reflected by catabolic evenness (E). These results support PICT assay, which ideally requires soils with differences in their exposure to the contaminant but minor differences in other characteristics. This is, to our knowledge, the first report of PICT approach with glyphosate examining tolerance at soil microbial community level. PMID:26150308

  7. Glyphosate-resistant hairy fleabane competition in RR® soybean

    Directory of Open Access Journals (Sweden)

    Diecson Ruy Orsolin da Silva

    2014-12-01

    Full Text Available Weed competition in the soybean causes changes in morphological and physiological characteristics that reduce the competitive ability of the crop. The objective of this study was to determine the control periods and coexistence of glyphosate-resistant hairy fleabane and its interference in morphological and photosynthetic variables and RR soybean yield. A field experiment was conducted during the 2011/2012 growing season, the treatments consisted of weed interference and weed free periods of the glyphosate-resistant hairy fleabane with soybean (BRS Estância RR. The periods were 0, 7, 14, 21, 28, 35, 42 and 154 days after the soybean emergence. The results sugested no differences between the control periods for the variables evaluated. The increase interference period of the weed reduced growth, development and the photosynthetic variables in the soybean. There are positive correlations between morphological and photosynthetic variables of soybean during the weed interference. The period before the glyphosate-resistant hairy fleabane interference in the soybean crop is 24 days for plants established before the crop sowing.

  8. Nodulation and mycorrhization of transgenic soybean after glyphosate application

    Directory of Open Access Journals (Sweden)

    Aloisio Freitas Chagas Junior

    2013-12-01

    Full Text Available The sensitivity of nitrogen-fixing bacteria like Bradyrhizobium spp with in relation to glyphosate can be influenced by the concentration of the herbicide. This study aims to evaluate the effects of two formulations of glyphosate, in two application periods, on nodulation and mycorrhization in a soybean of variety RR P98Y11, using greenhouse, in pots with capacity of 4 L with savanna soils. Six treatments were utilized using Roundup Ultra and Roundup Original with one and two applications, witness without herbicide and witness only with mineral nitrogen, in a completely randomized design. Four evaluations were done, every 15 days, to determine the plant height, shoot and root dry weight, number of nodules, nodule dry weigh and mycorrhizae. It was observed an increase on the number of nodules, with the use of Roundup Ultra until 15 days after the first application. After this period, the witness only with inoculants showed a larger number of nodules. Roundup Ultra had positive influences on the dry weight of nodules, regardless the number of applications. There was no influence of glyphosate formulation considering the mycorrhizal colonization.

  9. Annual glyphosate treatments alter growth of unaffected bentgrass (Agrostis weeds and plant community composition.

    Directory of Open Access Journals (Sweden)

    Collin W Ahrens

    Full Text Available Herbicide resistance is becoming more common in weed ecotypes and crop species including turfgrasses, but current gaps in knowledge limit predictive ecological risk assessments and risk management plans. This project examined the effect of annual glyphosate applications on the vegetative growth and reproductive potential of two weedy bentgrasses, creeping bentgrass (CB and redtop (RT, where the glyphosate resistance (GR trait was mimicked by covering the bentgrass plants during glyphosate application. Five field plots were studied in habitats commonly inhabited by weedy bentgrasses including an agricultural hayfield, natural meadow, and wasteland. Results showed that annual glyphosate treatment improved bentgrass survivorship, vegetative growth, and reproductive potential compared with bentgrass in unsprayed subplots. In the second year of growth, RT plants had an 86-fold increase in flower number in glyphosate-treated subplots versus controls, while CB plants had a 20-fold increase. At the end of the three year study, plant community composition had changed in glyphosate-treated subplots in hayfield and meadow plots compared to controls. Soils in subplots receiving glyphosate had higher nitrate concentrations than controls. This is the first study to mimic the GR trait in bentgrass plants with the goal of quantifying bentgrass response to glyphosate selection pressure and understanding the impacts on surrounding plant communities.

  10. Bioassay and characterization of several palmer amaranth biotypes with varying tolerances to glyphosate

    Science.gov (United States)

    The wide distribution of Palmer amaranth in the southern U.S. became a serious weed control problem prior to the extensive use of glyphosate-resistant crops. Currently glyphosate-resistant populations of Palmer amaranth occur in many areas of this geographic region creating an even more serious thr...

  11. Effects of glyphosate application timing and rate on sicklepod (Senna obtusifolia) fecundity

    Science.gov (United States)

    Greenhouse experiments were conducted to examine the effect of glyphosate on reproductive development in sicklepod. Glyphosate was applied postemergence over the top at 112 and 280 g ai/ha to sicklepod at 4-leaf stage (L), 8-L, 4-L followed by 8-L, and 12-L. A nontreated control was included. Immedi...

  12. Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

    Science.gov (United States)

    This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

  13. Response of Pennsylvania native plant species to dicamba and/or glyphosate

    Science.gov (United States)

    Weeds may become resistant to intensive and extensive use of specific herbicides associated with the growth of herbicide tolerant crops, e.g., the use of glyphosate for weed control with glyphosate tolerant soybeans. To counter this resistance, crops modified to contain genes for...

  14. Decay characteristics and erosion-related transport of glyphosate in Chinese loess soil under field conditions

    NARCIS (Netherlands)

    Yang, X.; Wang, Fei; Martins Bento, Celia; Meng, L.; Dam, van R.C.J.; Mol, J.G.J.; Liu, Guobin; Ritsema, C.J.; Geissen, V.

    2015-01-01

    The decay characteristics and erosion-related transport of glyphosate and aminomethylphosphonic acid (AMPA) were monitored for 35 d at different slope gradients and rates of application in plots with loess soil on the Loess Plateau, China. The initial glyphosate decayed rapidly (half-life of 3.5 d)

  15. Short-term transport of glyphosate with erosion in Chinese loess soil - a flume experiment

    NARCIS (Netherlands)

    Yang, X.; Wang, Fei; Martins Bento, Celia; Xue, Sha; Gai, L.; Dam, van R.C.J.; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2015-01-01

    Repeated applications of glyphosate may contaminate the soil and water and threaten their quality both within the environmental system and beyond it through water erosion related processes and leaching. In this study, we focused on the transport of glyphosate and its metabolite aminomethylphosphonic

  16. Inheritance of Evolved Glyphosate Resistance in a North Carolina Palmer Amaranth (Amaranthus palmeri Biotype

    Directory of Open Access Journals (Sweden)

    Aman Chandi

    2012-01-01

    Full Text Available Inheritance of glyphosate resistance in a Palmer amaranth biotype from North Carolina was studied. Glyphosate rates for 50% survival of glyphosate-resistant (GR and glyphosate-susceptible (GS biotypes were 1288 and 58 g ha−1, respectively. These values for F1 progenies obtained from reciprocal crosses (GR×GS and GS×GR were 794 and 501 g ha−1, respectively. Dose response of F1 progenies indicated that resistance was not fully dominant over susceptibility. Lack of significant differences between dose responses for reciprocal F1 families suggested that genetic control of glyphosate resistance was governed by nuclear genome. Analysis of F1 backcross (BC1F1 families showed that 10 and 8 BC1F1 families out of 15 fitted monogenic inheritance at 2000 and 3000 g ha−1 glyphosate, respectively. These results indicate that inheritance of glyphosate resistance in this biotype is incompletely dominant, nuclear inherited, and might not be consistent with a single gene mechanism of inheritance. Relative 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS copy number varied from 22 to 63 across 10 individuals from resistant biotype. This suggested that variable EPSPS copy number in the parents might be influential in determining if inheritance of glyphosate resistance is monogenic or polygenic in this biotype.

  17. Seasonal timing of glyphosate ripener application affects sugarcane’s response in Louisiana

    Science.gov (United States)

    Glyphosate is applied as a ripener to ratoon sugarcane in Louisiana to increase theoretically recoverable sugar (TRS) in harvested sugarcane. While glyphosate is applied as a ripener throughout the harvest season, recommendations for these applications have been based primarily on the response of s...

  18. Cotton (Gossypium hirsutum) Response to Glyphosate Applied in Irrigated and Non-irrigated Conditions

    Science.gov (United States)

    Field experiments were conducted in Alabama during 1999 and 2000 to test the hypothesis that any glyphosate-induced yield suppression in glyphosate-tolerant cotton would be less with irrigation compared to without irrigation. This objective was best served by measuring for possible yield-compensati...

  19. Glyphosate-resistant hairy fleabane (Conyza bonariensis) Documented in the Central Valley

    Science.gov (United States)

    In recent years poor control of hairy fleabane (Conyza bonariensis) with glyphosate has been reported by growers and pest consultants in some areas of the Central Valley. Since glyphosate-resistance in a related species horseweed (Conyza canadensis) was recently documented in similar locations, we ...

  20. Goss’s wilt incidence in sweet corn is independent of transgenic traits and glyphosate

    Science.gov (United States)

    Recently claims have been made that the use of glyphosate and transgenic crop traits increases the risk of plant diseases. Transgenic traits used widely for years in dent corn are now available in commercial sweet corn cultivars, specifically, the combination of glyphosate resistance (GR) and Lepid...

  1. Biodegradation of glyphosate herbicide by Salinicoccus spp isolated from Qom Hoze-soltan lake, Iran

    Directory of Open Access Journals (Sweden)

    Yaser Sharifi

    2015-01-01

    Full Text Available Background: Glyphosate (N-phosphonomethyl Glycine is an organophosphorus pesticide with dangerous effects on the environment. In this study, the biodegradation of glyphosate herbicide by halophilic bacteria isolated from Qom Hoze-Soltan Lake has been investigated. Methods: After sampling and bacterial isolation, native halophilic strains grown in the presence of glyphosate at a wavelength of 660 nm and also the disappearance of the glyphosate in the plates at a wavelength of 220 nm were determined and the dominant bacteria were isolated. Biochemical, molecular (according to the 16S rRNA sequence, antibiotic, and the Minimum Inhibitory Concentration (MIC test was performed for the dominant bacteria. Analysis of the remaining glyphosate herbicide was performed by HPLC analysis after derivation with FMOC-Cl. Results: According to the results of the biochemical, antibiotic and molecular 16S rRNA tests, the native halophilic isolates with the ability to biodegrade glyphosate were gram positive cocci very similar to Salinicoccusspp. The results of HPLC showed that Salinicoccusspp is able to biodegrade glyphosate herbicide. Conclusion: The native bacteria in Qom Hoze-soltanlake, Iran can be used for biodegradation of glyphosate herbicide.

  2. Correlation of leaf damage with uptake and translocation of glyphosate in velvetleaf (Abutilon theophrasti)

    International Nuclear Information System (INIS)

    Uptake and translocation of glyphosate in three commercial formulations were examined in velvetleaf, a dicotyledonous weed that is commonly treated with glyphosate. The formulations included Roundup(R) (MON35085), Roundup Ultra, and Touchdown(R) as sold in Canada. A minimal amount of 14C-glyphosate was spiked into a lethal rate of each formulation, and the short-term (3 to 72 h) uptake into the treated leaf and subsequent translocation into the plant were measured. Time-course studies showed very rapid uptake and translocation of glyphosate in the Ultra formulation. In comparison, the uptake and translocation of glyphosate in Touchdown was much slower but continued throughout the 72-h period. Glyphosate in the Roundup formulation showed intermediate uptake and translocation. Tissue necrosis at the application sites of Ultra and Roundup was visible within 24 h after treatment. Examinations using stereo and fluorescence microscopy revealed extensive cell death and tissue disruption. Tissue necrosis from Ultra and Roundup was also observed in blank formulations containing no glyphosate and therefore was likely caused by the surfactants. In contrast, the application sites of Touchdown produced little to no leaf damage. Our results demonstrated a direct correlation between tissue necrosis and rapid rates of glyphosate uptake and translocation. (author)

  3. Determination of glyphosate and its metabolite in emergency room in Korea.

    Science.gov (United States)

    Han, Joseph; Moon, Hantae; Hong, Youngki; Yang, Songhee; Jeong, Won-Joon; Lee, Kwang-Sik; Chung, Heesun

    2016-08-01

    The number of glyphosate intoxication cases has been increased after the regulation of paraquat. Unfortunately, there are no reports on the potential concentration of glyphosate for those acute intoxicated patients admitted to emergency rooms and the correlation between the concentration of glyphosate and clinical symptoms in Korea up to our knowledge. As a nonselective herbicide, analysis of glyphosate requires derivatization because of its amphoteric and strongly polar nature. In order to develop a method to determine the concentration of glyphosate and its metabolite, aminomethylphosphonic acid (AMPA) in blood samples without derivatization, liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) was utilized with a hydrophilic interaction chromatography (HILIC) column. The validation of this method showed that the limits of detection (LODs) and limits of quantitation (LOQs) for glyphosate and AMPA were 50 and 100ng/mL, respectively. In addition, matrix effect, recovery rate, and accuracy and precision in intra and inter-day were evaluated during the validation study of this method. Blood samples acquired from five glyphosate intoxicated patients were analyzed to investigate the correlation between the concentration of glyphosate and clinical symptoms. These patients were previously admitted to the emergency room at a University Hospital in Korea after glyphosate was self-administered in suicide attempts or by accident. As results of blood sample study, the concentration of glyphosate and AMPA were found in the range of 1.0-171.1 and 0.2-2.6μg/mL, respectively. The concentration ratio of glyphosate to AMPA was 55-71. According to the clinical reports for those patients, they were in the age between 47 and 82 years old and administered about 50-400mL. The blood samples were collected within 2-5h after administration of glyphosate. Among the intoxicated patients, the most common clinical symptom was metabolic acidosis, identified in four patients

  4. Investigating the mechanisms of glyphosate resistance in goosegrass (Eleusine indica) population from South China

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun; FENG Li; HE Ting-ting; YANG Cai-hong; CHEN Guo-qi; TIAN Xing-shan

    2015-01-01

    Glyphosate has been used worldwide for nearly 40 years, and 30 types of resistant weeds have been reported. Glyphosate is mass-produced and widely used in China, but few studies and reports on glyphosate-resistant weeds and resistance mechanisms exist. Previous studies found a goosegrass species with high glyphosate resistance from orchards in South China and its glyphosate resistant mechanism was described in this study. The cDNA of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, EC 2.5.1.19), the target enzyme of glyphosate, was cloned from the glyphosate-resistant and-suscep-tible goosegrass, respectively, and referred as EPSPS-R and EPSPS-S. The Pro106 residue was known to be involved in the glyphosate resistance in most goosegrass populations. However, sequence analysis did not ifnd the mutation at the Pro106 residue in the R biotype EPSPS amino acid sequence. The residue 133 and 382 was mutated in the R biotype EPSPS amino acid sequence instead, but it did not affect the EPSPS-S and EPSPS-R genes sensitivities to glyphosate. RT-PCR and Western blot analyses suggested that EPSPS mRNA and protein are mainly present in the shoot tissues both in the R and S goosegrass biotypes. The EPSPS-R rapidly responds to the glyphosate in R-biotype goosegrass and the induced expression was detected at 12 h post glyphosate treatment. The mRNA and protein expression of EPSPS-R increased constantly as the increasing concentration of glyphosate. However, the expression of the EPSPS-S was not induced signiifcantly by glyphosate in the S goosegrass biotype. Quantiifcation of real-time PCR results showed that the copy number of the EPSPS in R-biotype goosegrass was 4.7 times higher than that in the S goosegrass biotype. Al the results implied that EPSPS gene ampliifcation might mainly caused the glyphosate resistance of a goosegrass population col ected from orchards in South China.

  5. WEED CONTROL IN GENETICALLY MODIFIED GLYPHOSATE-TOLERANT SOYBEAN MANEJO DE PLANTAS DANINHAS EM SOJA GENETICAMENTE MODIFICADA TOLERANTE AO GLYPHOSATE

    OpenAIRE

    Júlio Cezar Durigan; Núbia Maria Correia; Melina Espanhol

    2011-01-01

    The transgenic production systems, as well as conventional systems, require, in addition to chemical control, the adoption of other weed management strategies. This study was developed to evaluate the weed chemical control in glyphosate tolerant soybean, associated to cover crops cultivated in the autumn/winter. The experiment was carried out under field conditions at the FCAV/Unesp, Jaboticabal, São Paulo State, Brazil. A randomized split-plot block design was used, with four replications. S...

  6. Adsorção de glifosato sobre solos e minerais Adsorption of glyphosate on soils and minerals

    Directory of Open Access Journals (Sweden)

    Luís R. M. Toni

    2006-07-01

    Full Text Available Glyphosate, an enzyme inhibitor herbicide, has been widely used around the world in agriculture. Dr. John Franz from Monsanto Corporation (USA discovered glyphosate in 1970. It has been showed that glyphosate is strongly adsorbed by inorganic soil components especially aluminium and iron oxides, and the phosphate group is involved in this interaction. The inactivation of glyphosate in soils can last for days or even months depending on soil characteristics. The addition of phosphate from fertilizers can displace glyphosate from the soils and this could be the cause of decreased productivity of some crops.

  7. Fate and transport of glyphosate and aminomethylphosphonic acid in surface waters of agricultural basins

    Science.gov (United States)

    Gregoire, Caroline; Capel, Paul D.; Coupe, Richard H.; Kalkhoff, Stephen J.

    2011-01-01

    BACKGROUND: Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used widely throughout the world in the production of many crops and is heavily used on soybeans, corn and cotton. Glyphosate is used in almost all agricultural areas of the United States, and the agricultural use of glyphosate has increased from less than 10 000 Mg in 1992 to more than 80 000 Mg in 2007. The greatest intensity of glyphosate use is in the midwestern United States, where applications are predominantly to genetically modified corn and soybeans. In spite of the increase in usage across the United States, the characterization of the transport of glyphosate and its degradate aminomethylphosphonic acid (AMPA) on a watershed scale is lacking.

  8. Analysis of glyphosate residues in cereals using liquid chromatography-mass spectrometry (LC-MS/MS)

    DEFF Research Database (Denmark)

    Granby, Kit; Johannesen, S.; Gabrielsen, Martin Vahl

    2003-01-01

    A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean-up) in...... monitored m/z 168--> 150 (glyphosate) and 170-->152 (internal standard 2- 13 (CN)-N-15-glyphosate) for quantification. The mean recovery was 85% ( n =32) at spiking levels from 0.03 to 0.33 mg kg(-1) . From 1998 to 2001, from the analysis of about 50 samples per annum, a reduction in the glyphosate residues...... was observed owing to a Danish trade decision not to use grain with glyphosate residues for milling or bread production....

  9. Monitoring glyphosate and AMPA concentrations in wells and drains using the sorbicell passive sampler

    DEFF Research Database (Denmark)

    Vendelboe, Anders Lindblad; de Jonge, Hubert; Møldrup, Per;

    2012-01-01

    Glyphosate is one of the world’s most extensively used weed control agents. Glyphosate, and its metabolite aminomethylphosphonic acid (AMPA), are suspected to be hazardous to human health and the aquatic environment. In Denmark, the extensive use has resulted in an increasing number of occurrences...... SorbiCell, will decrease the workload and number of samples freeing up funds for larger monitoring programs. When installed in a well the SorbiCell will continuously sample the water giving either a flux-weighed or time-weighted average measurement of the glyphosate/AMPA concentration throughout the...... sampling period. It may therefore be possible to measure lower concentrations as the glyphosate/AMPA sorbed in the SorbiCell is an accumulated measurement. Also, glyphosate/AMPA associated with sudden flush events will be detected by the SorbiCells, while such events may pass between two consecutive grab...

  10. Temporal Patterns of Glyphosate Leaching at a Loamy Agricultural Field in Denmark

    DEFF Research Database (Denmark)

    Nørgaard, Trine; Møldrup, Per; Olsen, Preben;

    2013-01-01

    Glyphosate is a herbicide used worldwide for weed control in agriculture. Glyphosate is believed to pose a low risk for groundwater reservoirs due to its strong sorption to soil minerals and fast degradation. However, during the last ten years several studies have shown detections of glyphosate in...... drainage water and groundwater at concentrations exceeding the EU drinking water quality criterion of 0.1 µg L-1. This study presents a unique 12-year time series of monitoring results for glyphosate (applied five times during the period) and its degradation product (AMPA) at a cultivated, highly......-structured loamy field (Estrup) located in southern Denmark. The Estrup field is part of the Danish Pesticide Leaching Assessment Program (PLAP), which monitors and evaluates pesticide leaching from five differently textured agricultural fields in Denmark. The study investigates the effect of successive glyphosate...

  11. Is the growth stimulation by low doses of glyphosate sustained over time?

    Energy Technology Data Exchange (ETDEWEB)

    Cedergreen, Nina [Department of Agricultural Sciences, Faculty of Life Science, University of Copenhagen, Hojbakkegard Alle 13, 2630 Tastrup (Denmark)], E-mail: ncf@life.ku.dk

    2008-12-15

    The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha{sup -1}, corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses <60 g a.e. ha{sup -1}. This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time.

  12. Influence of glyphosate in planktonic and biofilm growth of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Ilana Schneider Lima

    2014-09-01

    Full Text Available This study evaluated the impact of different concentrations of glyphosate (Rondup® on planktonic and biofilm growth of P. aeruginosa. Aerobic and anaerobic cultures of P. aeruginosa ATCC®15442 inoculated in MHB + glyphosate (0.845 ppm, 1.690 ppm, 8.45 ppm, 16.90 ppm, 84.50 ppm, 169 ppm, 845 ppm, and 1690 ppm and cultured in normoxia and anoxia, following their OD560nm every hour for 24 h. Biofilms of adapted cells were formed in the presence of glyphosate (0.845 to 1690 ppm in normoxia and anoxia for 36 h. Glyphosate at concentrations higher than 84.5 ppm reduces the cell density of planktonic aerobic cultures (p 0.05, and more pronounced over 169 ppm. Anaerobic biofilms have their growth more readily favored (p < 0.05, regardless of concentration. In a concentration-dependent manner, glyphosate interferes with the growth ability of P. aeruginosa ATCC®15442.

  13. Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study.

    Science.gov (United States)

    Cassigneul, A; Benoit, P; Bergheaud, V; Dumeny, V; Etiévant, V; Goubard, Y; Maylin, A; Justes, E; Alletto, L

    2016-03-01

    The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of (14)C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. (14)C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH4OH-soluble and non-extractable fractions was determined at 5 dates during a 20°C/84-d period. The presence of CC extends (14)C-glyphosate degradation half-life from 7 to 28days depending on the CC. (14)C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. PMID:26760277

  14. Is the growth stimulation by low doses of glyphosate sustained over time?

    International Nuclear Information System (INIS)

    The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha-1, corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses -1. This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time

  15. Glyphosate impacts on polyphenolic composition in grapevine (Vitis vinifera L.) berries and wine.

    Science.gov (United States)

    Donnini, Silvia; Tessarin, Paola; Ribera-Fonseca, Alejandra; Di Foggia, Michele; Parpinello, Giuseppina Paola; Rombolà, Adamo Domenico

    2016-12-15

    Glyphosate is the most widespread herbicide for weed management, being extensively used in viticulture. In this study we tested, under field conditions, the effects of glyphosate applications on the quality of berry and wine, from cv. Ancellotta (Vitis vinifera L.), with particular regard to anthocyanin concentration and composition. Ripening and growth were monitored by analyzing berry technological parameters and weight. Additionally, microvinifications were performed, in order to analyze the concentration of anthocyanins, other flavonoids and phenolic acids in wine. Our findings indicated that, at harvest, both pH and anthocyanin concentration were significantly lower and titratable acidity higher in berries collected from vines of plots under glyphosate-treatment compared with those of non-treated parcels. Data suggest that treatment with glyphosate did not change the concentration of anthocyanins, other flavonoids and phenolic acids in the wine. Our results indicate that treatment with glyphosate may affect fruit metabolism and nutritional value in non-target plants. PMID:27451151

  16. Effects of glyphosate and endosulfan on soil microorganisms in soybean crop Efeitos do endosulfan e glyphosate sobre microrganismos do solo na cultura da soja

    Directory of Open Access Journals (Sweden)

    J.L. Pereira

    2008-01-01

    Full Text Available Transgenic soybean, resistant to glyphosate, is the most dominant transgenic crop grown commercially in the world. Research works on herbicide and insecticide mixtures and their effects on microorganisms are rarely reported. This work aimed to study the impact of glyphosate, endosulfan and their mixtures on the microbial soil activity in soybean crop. The experiment was carried out in a complete randomized block design with four treatments and five replications. The treatments were glyphosate 480 SL [540 g of active ingredient (a.i. ha-1], endosulfan 350 EC (525 g a.i. ha-1, the glyphosate 480 SL [540 g of active ingredient (a.i. ha-1] mixed with endosulfan 350 EC (525 g a.i. ha-1 and the control. Microbial activity was evaluated five days after treatment application. Glyphosate application was not an impacting factor for soil CO2 production. Endosulfan application (alone or mixed with glyphosate suppressed CO2 production by microorganisms in the soil. Microbial biomass and microbial quotient were lower in the treatments using endosulfan alone and in those using endosulfan mixed with glyphosate than in the treatments using glyphosate alone and control.A soja resistente ao glyphosate é a cultura transgênica mais cultivada em todo o mundo. Pesquisas envolvendo o impacto de mistura de herbicidas e inseticidas e seus efeitos sobre microrganismos do solo são raramente reportadas. Este trabalho teve por objetivo avaliar o impacto do herbicida (glyphosate, do inseticida (endosulfan e da mistura de ambos sobre a atividade microbiana do solo na cultura da soja. O delineamento experimental foi em blocos casualizados, com quatro tratamentos e cinco repetições. Os tratamentos foram o herbicida glyphosate 480 SL [540 g de ingrediente ativo (i.a. ha-1], endosulfan 350 EC (525 g i.a. ha-1, a mistura de glyphosate 480 SL (540 g de i.a. ha-1 com endosulfan 350 EC (525 g i.a. ha-1 e a testemunha onde se aplicou água. A atividade microbiana foi avaliada aos

  17. Physiological, morphological and biochemical studies of glyphosate tolerance in Mexican Cologania (Cologania broussonetii (Balb.) DC.).

    Science.gov (United States)

    Alcántara de la Cruz, Ricardo; Barro, Francisco; Domínguez-Valenzuela, José Alfredo; De Prado, Rafael

    2016-01-01

    In recent years, glyphosate-tolerant legumes have been used as cover crops for weed management in tropical areas of Mexico. Mexican cologania (Cologania broussonetii (Balb.) DC.) is an innate glyphosate-tolerant legume with a potential as a cover crop in temperate areas of the country. In this work, glyphosate tolerance was characterized in two Mexican cologania (a treated (T) and an untreated (UT)) populations as being representatives of the species, compared in turn to a glyphosate-susceptible hairy fleabane (S) (Conyza bonariensis (L.) Cronq.) population. Experiments revealed that T and UT Mexican cologania populations had a higher tolerance index (TI), and a lower shikimic acid accumulation and foliar retention than the hairy fleabane S population. Absorption and translocation, leaf morphology and metabolism studies were only carried out in the Mexican cologania T population and the hairy fleabane S population. The latter absorbed 37% more (14)C-glyphosate compared to the Mexican cologania T at 96 h after treatment (HAT). Mexican cologania T translocated less herbicide from the treated leaf to the remainder of the plant than hairy fleabane S. The Mexican cologania T presented a greater epicuticular wax coverage percentage than the hairy fleabane S. This morphological characteristic contributed to the low glyphosate absorption observed in the Mexican cologania. In addition, the Mexican cologania T metabolized glyphosate mainly into AMPA, formaldehyde and sarcosine. These results indicate that the high glyphosate tolerance observed in Mexican cologania is mainly due to the poor penetration and translocation of glyphosate into the active site, and the high glyphosate degradation into non-toxic substances. PMID:26646239

  18. Non-target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis

    Science.gov (United States)

    Fernández-Moreno, Pablo T.; Alcantara-de la Cruz, Ricardo; Cruz-Hipólito, Hugo E.; Rojano-Delgado, Antonia M.; Travlos, Ilias; De Prado, Rafael

    2016-01-01

    Sterile wild oat (Avena sterilis L.) is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage) before the beginning of summer period (due to the possibility of intense drought stress). In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha−1 for exposed (E) and un-exposed (UE) glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of 14C- glyphosate absorption was the same in the two accessions (E and UE), while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA) and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica, and Lolium rigidum.

  19. Non-target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis.

    Science.gov (United States)

    Fernández-Moreno, Pablo T; Alcantara-de la Cruz, Ricardo; Cruz-Hipólito, Hugo E; Rojano-Delgado, Antonia M; Travlos, Ilias; De Prado, Rafael

    2016-01-01

    Sterile wild oat (Avena sterilis L.) is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage) before the beginning of summer period (due to the possibility of intense drought stress). In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha(-1) for exposed (E) and un-exposed (UE) glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of (14)C- glyphosate absorption was the same in the two accessions (E and UE), while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA) and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica, and Lolium rigidum. PMID:27570531

  20. Evidence of high-elevation amplification versus Arctic amplification

    Science.gov (United States)

    Wang, Qixiang; Fan, Xiaohui; Wang, Mengben

    2016-01-01

    Elevation-dependent warming in high-elevation regions and Arctic amplification are of tremendous interest to many scientists who are engaged in studies in climate change. Here, using annual mean temperatures from 2781 global stations for the 1961-2010 period, we find that the warming for the world’s high-elevation stations (>500 m above sea level) is clearly stronger than their low-elevation counterparts; and the high-elevation amplification consists of not only an altitudinal amplification but also a latitudinal amplification. The warming for the high-elevation stations is linearly proportional to the temperature lapse rates along altitudinal and latitudinal gradients, as a result of the functional shape of Stefan-Boltzmann law in both vertical and latitudinal directions. In contrast, neither altitudinal amplification nor latitudinal amplification is found within the Arctic region despite its greater warming than lower latitudes. Further analysis shows that the Arctic amplification is an integrated part of the latitudinal amplification trend for the low-elevation stations (≤500 m above sea level) across the entire low- to high-latitude Northern Hemisphere, also a result of the mathematical shape of Stefan-Boltzmann law but only in latitudinal direction.

  1. Occurrence and fate of the herbicide glyphosate and its degradate aminomethylphosphonic acid in the atmosphere

    Science.gov (United States)

    Chang, Feng-Chih; Simcik, M.F.; Capel, P.D.

    2011-01-01

    This is the first report on the ambient levels of glyphosate, the most widely used herbicide in the United States, and its major degradation product, aminomethylphosphonic acid (AMPA), in air and rain. Concurrent, weekly integrated air particle and rain samples were collected during two growing seasons in agricultural areas in Mississippi and Iowa. Rain was also collected in Indiana in a preliminary phase of the study. The frequency of glyphosate detection ranged from 60 to 100% in both air and rain. The concentrations of glyphosate ranged from 3 and from glyphosate in air were similar or greater to those of the other high-use herbicides observed in the Mississippi River basin, whereas its concentration in rain was greater than the other herbicides. It is not known what percentage of the applied glyphosate is introduced into the air, but it was estimated that up to 0.7% of application is removed from the air in rainfall. Glyphosate is efficiently removed from the air; it is estimated that an average of 97% of the glyphosate in the air is removed by a weekly rainfall ≥30 mm.

  2. Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean

    International Nuclear Information System (INIS)

    This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

  3. Thermodynamic Study on the Protonation Reactions of Glyphosate in Aqueous Solution: Potentiometry, Calorimetry and NMR spectroscopy.

    Science.gov (United States)

    Liu, Bijun; Dong, Lan; Yu, Qianhong; Li, Xingliang; Wu, Fengchang; Tan, Zhaoyi; Luo, Shunzhong

    2016-03-10

    Glyphosate [N-(phosphonomethyl)glycine] has been described as the ideal herbicide because of its unique properties. There is some conflicting information concerning the structures and conformations involved in the protonation process of glyphosate. Protonation may influence the chemical and physical properties of glyphosate, modifying its structure and the chemical processes in which it is involved. To better understand the species in solution associated with changes in pH, thermodynamic study (potentiometry, calorimetry and NMR spectroscopy) about the protonation pathway of glyphosate is performed. Experimental results confirmed that the order of successive protonation sites of totally deprotonated glyphosate is phosphonate oxygen, amino nitrogen, and finally carboxylate oxygen. This trend is in agreement with the most recent theoretical work in the literature on the subject ( J. Phys. Chem. A 2015, , 119 , 5241 - 5249 ). The result is important because it confirms that the protonated site of glyphosate in pH range 7-8, is not on the amino but on the phosphonate group instead. This corrected information can improve the understanding of the glyphosate chemical and biochemical action. PMID:26862689

  4. Efficient audio power amplification - challenges

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, Michael A.E.

    2005-07-01

    For more than a decade efficient audio power amplification has evolved and today switch-mode audio power amplification in various forms are the state-of-the-art. The technical steps that lead to this evolution are described and in addition many of the challenges still to be faced and where extensive research and development are needed is covered. (au)

  5. Gene amplification during myogenic differentiation

    Science.gov (United States)

    Fischer, Ulrike; Ludwig, Nicole; Raslan, Abdulrahman; Meier, Carola; Meese, Eckart

    2016-01-01

    Gene amplifications are mostly an attribute of tumor cells and drug resistant cells. Recently, we provided evidence for gene amplifications during differentiation of human and mouse neural progenitor cells. Here, we report gene amplifications in differentiating mouse myoblasts (C2C12 cells) covering a period of 7 days including pre-fusion, fusion and post-fusion stages. After differentiation induction we found an increase in copy numbers of CDK4 gene at day 3, of NUP133 at days 4 and 7, and of MYO18B at day 4. The amplification process was accompanied by gamma-H2AX foci that are indicative of double stand breaks. Amplifications during the differentiating process were also found in primary human myoblasts with the gene CDK4 and NUP133 amplified both in human and mouse myoblasts. Amplifications of NUP133 and CDK4 were also identified in vivo on mouse transversal cryosections at stage E11.5. In the course of myoblast differentiation, we found amplifications in cytoplasm indicative of removal of amplified sequences from the nucleus. The data provide further evidence that amplification is a fundamental mechanism contributing to the differentiation process in mammalians. PMID:26760505

  6. Efficient Audio Power Amplification - Challenges

    DEFF Research Database (Denmark)

    Andersen, Michael Andreas E.

    2005-01-01

    For more than a decade efficient audio power amplification has evolved and today switch-mode audio power amplification in various forms are the state-of-the-art. The technical steps that lead to this evolution are described and in addition many of the challenges still to be faced and where...

  7. Effect of foliar treatments on distribution of 14C-glyphosate in Convolvulus arvensis L

    International Nuclear Information System (INIS)

    Field bindweed is a perennial weed which produces shoots from buds on its roots. Herbicides, such as glyphosate [N-(phosphonomethyl)glycine] used for control of field bindweed usually do not kill all shoot buds on the roots, thus field bindweed often reinfests areas within 3 to 6 weeks of treatment. This dissertation deals with the development of a technique to change glyphosate distribution in field bindweed roots and could result in less shoot regrowth after glyphosate application. In field studies eight plant growth regulators were applied in September, 3 days before 2.24 kg/ha of 2.4-D[(2,4-dichlorophenoxy) acetic acid] or 1.68 kg/ha of glyphosate. Eight months later, regrowth of shoots was least where glyphosate was applied at 0.028 kg/ha as a pretreatment, followed by a standard rate of 1.68 kg/ha. In subsequent greenhouse studies, typical patterns of shoot growth and 14C-glyphosate distribution in isolated root sections taken from 15-week-old intact plants were determined. In subsequent growth chamber studies, plants were decapitated to observe the effect of shoot apical dominance on 14C-glyphosate translocation. After 14C-glyphosate was applied, intact plants had about twice as much 14C in distal root sections as in proximal or middle root sections. Decapitated plants had more 14C in proximal and middle root sections than in distal sections, and about twice as much 14C was translocated to roots of decapitated plants than intact plants. Eight concentrations of 2,4,-D or glyphosate from 1 to 5000 ppm were applied in logarithmic series to 6-week old plants

  8. Adsorption of glyphosate on variable-charge, volcanic ash-derived soils.

    Science.gov (United States)

    Cáceres-Jensen, L; Gan, J; Báez, M; Fuentes, R; Escudey, M

    2009-01-01

    Glyphosate (N-phosphonometylglycine) is widely used due to its broad spectrum of activity and nonselective mode of action. In Chile it is the most used herbicide, but its adsorption behavior in the abundant and widespread variable charge soils is not well understood. In this study, three volcanic ash-derived soils were selected, including Andisols (Nueva Braunau and Diguillin) and Ultisols (Collipulli), to evaluate the adsorption kinetics, equilibrium isotherms, and the effect of pH in glyphosate adsorption. The influence of glyphosate on soil phosphorus retention was also studied. Glyphosate was rapidly and strongly adsorbed on the selected soils, and adsorption isotherms were well described by the Freundlich relationship with strong nonlinearity (n(fads) Andisol soils without the addition of glyphosate had similar mean K(ads) values for Nueva Braunau (5.68) and Diguillin (7.38). Collipulli had a mean K(ads) value of 31.58. During the successive desorption steps, glyphosate at the highest level increased K(ads) values for phosphate in the Andisol soils but had little effect in the Ultisol soil. This different behavior was probably due to the irreversible occupation of some adsorption sites by glyphosate in the Ultisol soil attributed to the dominant Kaolinite mineral. Results from this study suggest that in the two types of volcanic soils, different mechanisms are involved in glyphosate and phosphate adsorption and that long-term use of glyphosate may impose different effects on the retention and availability of phosphorus. Volcanic ash-derived soils have a particular environmental behavior in relation to the retention of organic contaminants, representing an environmental substrate that may become highly polluted over time due to intensive agronomic uses. PMID:19465720

  9. Identification of geneticaly modified soybean seeds resistant to glyphosate

    Directory of Open Access Journals (Sweden)

    Tillmann Maria Ângela André

    2004-01-01

    Full Text Available Advances in genetic engineering permit the modification of plants to be tolerant to certain herbicides that are usually not selective. For practical and commercial purposes, it is important to be able to detect the presence or absence of these traits in genotypes. The objective of this research was to develop a procedure for identifying genetically modified soybean (Glycine max L. Merr. with resistance to the herbicide glyphosate. Two studies were conducted based on germination test. In the first study, soybean seeds were pre-imbibed in paper towel with the herbicide solutions, then transferred to moist paper towel for the germination test. In the second study, seeds were placed directly in herbicide solutions in plastic cups and tested for germination using the paper towel method. Eight soybean genotypes were compared: four Roundup Ready, that contained the gene resistant to the herbicide (G99-G725, Prichard RR, G99-G6682, and H7242 RR and four non-transgenic parental cultivars (Boggs, Haskell, Benning, and Prichard. In the first study, the seeds were imbibed for 16 hours at 25°C in herbicide concentrations between 0.0 and 1.5% of the glyphosate active ingredient. In the second, seeds were subjected to concentrations between 0.0 and 0.48%, for one hour, at 30°C. The evaluation parameters were: germination, hypocotyl length, root length and total length of the seedlings. Both methods are efficient in identifying glyphosate-resistant soybean genotypes. It is possible to identify the genetically modified soybean genotypes after three days, by imbibing the seed in 0.12% herbicide solution, and after six days if the substrate is pre-imbibed in a 0.6% herbicide solution. The resistance trait was identified in all cultivars, independent of the initial physiological quality of the seed.

  10. Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos.

    Science.gov (United States)

    Akcha, F; Spagnol, C; Rouxel, J

    2012-01-15

    We investigated the effects of genotoxicant exposure in gametes and embryos to find a possible link between genotoxicity and reproduction/developmental impairment, and explore the impact of chemical genotoxicity on population dynamics. Our study focused on the genotoxic effects of two herbicides on oyster gametes and embryos: glyphosate (both as an active substance and in the Roundup formulation) and diuron. France is Europe's leading consumer of agrochemical substances and as such, contamination of France's coastal waters by pesticides is a major concern. Glyphosate and diuron are among the most frequently detected herbicides in oyster production areas; as oyster is a specie with external reproduction, its gametes and embryos are in direct contact with the surrounding waters and are hence particularly exposed to these potentially dangerous substances. In the course of this study, differences in genotoxic and embryotoxic responses were observed in the various experiments, possibly due to differences in pollutant sensitivity between the tested genitor lots. Glyphosate and Roundup had no effect on oyster development at the concentrations tested, whereas diuron significantly affected embryo-larval development from the lowest tested concentration of 0.05 μg L⁻¹, i.e. an environmentally realistic concentration. Diuron may therefore have a significant impact on oyster recruitment rates in the natural environment. Our spermiotoxicity study revealed none of the tested herbicides to be cytotoxic for oyster spermatozoa. However, the alkaline comet assay showed diuron to have a significant genotoxic effect on oyster spermatozoa at concentrations of 0.05 μg L⁻¹ upwards. Conversely, no effects due to diuron exposure were observed on sperm mitochondrial function or acrosomal membrane integrity. Although our initial results showed no negative effect on sperm function, the possible impact on fertilization rate and the consequences of the transmission of damaged DNA for

  11. The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

    Energy Technology Data Exchange (ETDEWEB)

    Albers, Christian N., E-mail: calbers@ruc.d [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark); Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Banta, Gary T. [Dept. of Environmental, Social and Spatial Change, Roskilde University, DK-4000 Roskilde (Denmark); Hansen, Poul Erik [Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Jacobsen, Ole S. [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark)

    2009-10-15

    Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, approx40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only approx10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

  12. The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

    International Nuclear Information System (INIS)

    Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, ∼40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only ∼10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

  13. Multiple Resistance of Horseweed to Glyphosate and Paraquat and Its Control with Paraquat and Metribuzin Combinations

    OpenAIRE

    Daniel H. Poston; Shaw, David R.; Thomas W. Eubank; Vijay K. Nandula

    2012-01-01

    Greenhouse and field studies were conducted in 2007 and 2008 to investigate possible multiple-resistance of horseweed to paraquat and glyphosate, and to evaluate the effect of the addition of metribuzin to paraquat on control of paraquat-resistant horseweed. Results indicated that the GR50 (herbicide dose required to cause a 50% reduction in plant growth) value for the susceptible population S102 was 0.066 kg ae/ha glyphosate, and for the resistant population MDOT was 0.78 kg/ha glyphosate. T...

  14. Comparison of Nitrogen Fertilizers, Induce and Zinc Addition on Glyphosate Efficacy on Three Different Weed Species.

    OpenAIRE

    Hussein F. Abouziena; Ibraheem M. El-Metwally; H.M. El-Saeid; Megh Singh

    2014-01-01

    Herbicides are often tank-mixed with fertilizers to save time, labour, energy, and equipment costs. However addition of some additives with glyphosate may result in reducing glyphosate efficacy. Therefore we evaluated the potential of three nitrogen sources (ammonium sulphate (AMS) at 2 or 4% w/v, ammonium nitrate (AN) at 1 or 2% w/v, urea at 1 or 2 % w/v), nonionic adjuvant (Induce at 0.05% v/v) and Zn at 250 g Zn/ha (1321 ppm) to enhance glyphosate efficacy on pig weed (Amaranthus retroflex...

  15. Removal of glyphosate from aqueous environment by adsorption using water industrial residual

    OpenAIRE

    Hu, Y. S.; Zhao, Y.Q.; Sorohan, B.

    2011-01-01

    This study investigated the glyphosate adsorption by water treatment residual (termed as alum sludge) in dewatered form (DAS) and liquid form (LAS). Batch adsorption tests were carried out with DAS at different pH, particle size and DAS mass. Standard jar tests were conducted with LAS at two different concentrations (3 g/l and 5 g/l) for glyphosate adsorption. Thereafter, the glyphosate-enriched LAS (after adsorption tests) was subjected to sludge conditioning procedure with polymer LT25 as c...

  16. Placental passage of benzoic acid, caffeine, and glyphosate in an ex vivo human perfusion system

    DEFF Research Database (Denmark)

    Mose, Tina; Kjaerstad, Mia Birkhoej; Mathiesen, Line;

    2008-01-01

    given group of compounds. Benzoic acid, caffeine, and glyphosate were chosen as model compounds because they are small molecules with large differences in physiochemical properties. Caffeine crossed the placenta by passive diffusion. The initial transfer rate of benzoic acid was more limited in the...... first part of the perfusion compared to caffeine, but reached the same steady-state level by the end of perfusion. The transfer of glyphosate was restricted throughout perfusion, with a lower permeation rate, and only around 15% glyphosate in maternal circulation crossed to the fetal circulation during...

  17. Soil Properties Control Glyphosate Sorption in Soils Amended with Birch Wood Biochar

    DEFF Research Database (Denmark)

    Kahawaththa Gamage, Inoka Damayanthi Kumari; Møldrup, Per; Paradelo Pérez, Marcos;

    2016-01-01

    agrochemicals such as pesticides. In a fieldbased study at two experimental sites in Denmark (sandy loam soils at Risoe and Kalundborg), we investigated the influence of birch wood biochar with respect to application rate, aging (7–19 months), and physico- chemical soil properties on the sorption coefficient...... with pH and EC. In conclusion, the results show that biochar, despite initially being a poor sorbent for glyphosate, can increase glyphosate sorption in soil. However, the effect of biochar on glyphosate sorption is depends on prevailing soil physicochemical properties....

  18. Differential susceptibility to glyphosate among the Conyza weed species in Spain.

    Science.gov (United States)

    González-Torralva, Fidel; Cruz-Hipolito, Hugo; Bastida, Fernando; Mülleder, Norbert; Smeda, Reid J; De Prado, Rafael

    2010-04-14

    Greenhouse and laboratory experiments were conducted to investigate differences in glyphosate susceptibility among three species of the genus Conyza introduced as weeds in Spain: tall fleabane (Conyza sumatrensis), hairy fleabane (Conyza bonariensis), and horseweed (Conyza canadensis). Plant material was obtained from seeds collected in weed populations growing in olive groves and citrus orchards in southern Spain, with no previous history of glyphosate application. Dose-response curves displayed ED(50) values of 2.9, 15.7, and 34.9 g ai ha(-1), respectively, for C. sumatrensis, C. bonariensis, and C. canadensis plants at the rosette stage (6-8 leaves). Significant differences were found among the three species in the glyphosate retention on leaves as well as the leaf contact angle. The species order according to glyphosate retention was C. sumatrensis > C. bonariensis > C. canadensis, while the mean contact angles of glyphosate droplets were 59.2, 65.5, and 72.9 degrees , respectively. There were no significant differences among species in the absorption of [(14)C]glyphosate (ranged from 37.4% for C. canadensis to 52.4% for C. sumatrensis), but the order among species was the same as glyphosate retention. The amount of radioactivity translocated from treated leaves was lower in C. canadensis as compared to the other two species (C. sumatrensis > C. bonariensis > C. canadensis). Combined, all of the studied parameters identified differential susceptibility to glyphosate among the Conyza species. Each species accumulated shikimate in leaf tissues following application of glyphosate at 200 g ai ha(-1). However, C. canadensis exhibited lower shikimate levels than the other two species at 168 h after herbicide application. For hairy fleabane, a greenhouse study explored its susceptibility to glyphosate at three developmental stages: rosette, bolting (stem height, 10-15 cm), and flowering. The ED(50) was lower at the rosette stage (15.7 g ai ha(-1)) as compared to

  19. Glyphosate Accumulation and Detrimental Effects on Coffea Arabica

    DEFF Research Database (Denmark)

    Schrübbers, Lars Christoph

    method and the MS/MS system provided a limit of quantification (LOQ) below 0.1 mg/kg; the commonly used maximum residue limit (MRL) for glyphosate in plant derived food products. Glyphosate was found in all samples analyzed from different coffee fields, regardless of management practices. AMPA was not......Coffee is one of the most popular beverages worldwide and a highly traded commodity. In order to maintain a high yield of the perennial crop, weed competition for resources needs to be reduced. For this purpose herbicides are commonly applied, with glyphosate being one of the most prominent...

  20. Evidence of high-elevation amplification versus Arctic amplification

    OpenAIRE

    Qixiang Wang; Xiaohui Fan; Mengben Wang

    2016-01-01

    Elevation-dependent warming in high-elevation regions and Arctic amplification are of tremendous interest to many scientists who are engaged in studies in climate change. Here, using annual mean temperatures from 2781 global stations for the 1961–2010 period, we find that the warming for the world’s high-elevation stations (>500 m above sea level) is clearly stronger than their low-elevation counterparts; and the high-elevation amplification consists of not only an altitudinal amplification b...

  1. Glyphosate em mistura com herbicidas alternativos para o manejo de plantas daninhas Glyphosate combined with alternative herbicides for vegetation management

    OpenAIRE

    P.A. Monquero; P.J. Christoffoleti; C.T.D. Santos

    2001-01-01

    O uso intensivo de glyphosate como herbicida não-seletivo tem selecionado espécies de plantas daninhas tolerantes. Dessa forma, é importante que sejam estudadas misturas de tanque com herbicidas de mecanismos de ação alternativos e que apresentem efeitos sinergísticos ou aditivos. Por essa razão, foi instalado um experimento inteiramente casualizado, composto por 13 tratamentos e 4 repetições, em casa de vegetação da Universidade de São Paulo - ESALQ/USP, Piracicaba-SP, com as plantas daninha...

  2. Glyphosate behavior at soil and mineral-water interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Pessagno, Romina C. [INQUIMAE and Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria Pabellon II, (C1428EHA) Buenos Aires (Argentina)], E-mail: rpessagno@qi.fcen.uba.ar; Torres Sanchez, Rosa M. [CETMIC, CC 49, (B1896ZCA) M.B. Gonnet, Buenos Aires Province (Argentina)], E-mail: rosats@cetmic.unlp.edu.ar; Santos Afonso, Maria dos [INQUIMAE and Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria Pabellon II, (C1428EHA) Buenos Aires (Argentina)], E-mail: dosantos@qi.fcen.uba.ar

    2008-05-15

    Adsorption isotherms and surface coverage of glyphosate, N-phosphonomethylglycine (PMG), in aqueous suspensions of three Argentine soils with different mineralogical composition were measured as a function of PMG concentration and pH. Zeta potential curves for PMG/soils system were also determined. Montmorillonite and soil sample surface charges were negative and increased as the amount of adsorbed PMG increased, showing that the surface complexes are more negative than those formed during the surface protonation. PMG adsorption on soils were described using Langmuir isotherms and the affinity constants, and the maximum surface coverage was estimated at pH 4 and 7 using a two-term Langmuir isotherm, the mineralogical composition percentages, and maximum surface coverage and Langmuir constants for pure minerals. The influence of organic matter (OM) and iron content of soils on the PMG adsorption was evaluated. The surface coverage of PMG decreased when the OM and iron content decreased for minerals and soils. - Adsorption isotherms, surface coverage and zeta potential curves of glyphosate in aqueous suspensions of montmorillonite and three Argentine soils were measured as a function of PMG concentration and pH.

  3. Glyphosate behavior at soil and mineral-water interfaces

    International Nuclear Information System (INIS)

    Adsorption isotherms and surface coverage of glyphosate, N-phosphonomethylglycine (PMG), in aqueous suspensions of three Argentine soils with different mineralogical composition were measured as a function of PMG concentration and pH. Zeta potential curves for PMG/soils system were also determined. Montmorillonite and soil sample surface charges were negative and increased as the amount of adsorbed PMG increased, showing that the surface complexes are more negative than those formed during the surface protonation. PMG adsorption on soils were described using Langmuir isotherms and the affinity constants, and the maximum surface coverage was estimated at pH 4 and 7 using a two-term Langmuir isotherm, the mineralogical composition percentages, and maximum surface coverage and Langmuir constants for pure minerals. The influence of organic matter (OM) and iron content of soils on the PMG adsorption was evaluated. The surface coverage of PMG decreased when the OM and iron content decreased for minerals and soils. - Adsorption isotherms, surface coverage and zeta potential curves of glyphosate in aqueous suspensions of montmorillonite and three Argentine soils were measured as a function of PMG concentration and pH

  4. Influence of soil tillage and erosion on the dispersion of glyphosate and aminomethylphosphonic acid in agricultural soils

    Science.gov (United States)

    Todorovic, Gorana Rampazzo; Rampazzo, Nicola; Mentler, Axel; Blum, Winfried E. H.; Eder, Alexander; Strauss, Peter

    2014-03-01

    Erosion processes can strongly influence the dissipation of glyphosate and aminomethylphosphonic acid applied with Roundup Max® in agricultural soils; in addition, the soil structure state shortly before erosive precipitations fall can be a key parameter for the distribution of glyphosate and its metabolite. Field rain simulation experiments showed that severe erosion processes immediately after application of Roundup Max® can lead to serious unexpected glyphosate loss even in soils with a high presumed adsorption like the Cambisols, if their structure is unfavourable. In one of the no-tillage-plot of the Cambisol, up to 47% of the applied glyphosate amount was dissipated with surface run-off. Moreover, at the Chernozem site with high erosion risk and lower adsorption potential, glyphosate could be found in collected percolation water transported far outside the 2x2 m experimental plots. Traces of glyphosate were found also outside the treated agricultural fields.

  5. Conference summaries

    International Nuclear Information System (INIS)

    This volume contains conference summaries for the 31. annual conference of the Canadian Nuclear Association and the 12. annual conference of the Canadian Nuclear Society. Topics of discussion include: reactor physics; thermalhydraulics; industrial irradiation; computer applications; fuel channel analysis; small reactors; severe accidents; fuel behaviour under accident conditions; reactor components, safety related computer software; nuclear fuel management; fuel behaviour and performance; reactor safety; reactor engineering; nuclear waste management; and, uranium mining and processing

  6. How-To-Do-It: Glyphosate: Herbicidal Effects, Mode of Action and Degradation in Soil.

    Science.gov (United States)

    Kafarski, Pawel; And Others

    1988-01-01

    Describes the usefulness of glyphosate for a demonstration of its herbicidal properties. Includes a list of the materials, preparation of solutions, procedures, data collection and analysis for three activities involving this chemical. (CW)

  7. Glyphosate herbicide affects belowground interactions between earthworms and symbiotic mycorrhizal fungi in a model ecosystem

    Science.gov (United States)

    Zaller, Johann G.; Heigl, Florian; Ruess, Liliane; Grabmaier, Andrea

    2014-07-01

    Herbicides containing glyphosate are widely used in agriculture and private gardens, however, surprisingly little is known on potential side effects on non-target soil organisms. In a greenhouse experiment with white clover we investigated, to what extent a globally-used glyphosate herbicide affects interactions between essential soil organisms such as earthworms and arbuscular mycorrhizal fungi (AMF). We found that herbicides significantly decreased root mycorrhization, soil AMF spore biomass, vesicles and propagules. Herbicide application and earthworms increased soil hyphal biomass and tended to reduce soil water infiltration after a simulated heavy rainfall. Herbicide application in interaction with AMF led to slightly heavier but less active earthworms. Leaching of glyphosate after a simulated rainfall was substantial and altered by earthworms and AMF. These sizeable changes provide impetus for more general attention to side-effects of glyphosate-based herbicides on key soil organisms and their associated ecosystem services.

  8. Severe adverse effects related to dermal exposure to a glyphosate-surfactant herbicide

    DEFF Research Database (Denmark)

    Mariager, T P; Madsen, P V; Ebbehøj, N E;

    2013-01-01

    This is a case of severe chemical burns following prolonged accidental exposure to a glyphosate-surfactant herbicide. The patient developed local swelling, bullae and exuding wounds. Neurological impairment followed affecting finger flexion and sensation with reduced nerve conduction. Imaging...

  9. An intercomparison study of the determination of glyphosate, chlormequat and mepiquat residues in wheat

    DEFF Research Database (Denmark)

    Andersen, Jens Hinge; Bille, Rikke; Granby, Kit

    2007-01-01

    An intercomparison study of the determinations of glyphosate, chlormequat and mepiquat residues in cereals was performed. Four samples comprising one blank, two incurred and one spiked sample were sent to six participating laboratories. For glyphosate, two laboratories reported considerably lower...... results than the other four. One of the two laboratories with low results also reported low recoveries. The results of a sample spiked with 0.80 mg kg(-1) glyphosate and an incurred sample, ranged from 0.23-0.87 mg kg(-1) and 0.11-0.25 mg kg(-1) respectively. The strong correlation between the two samples...... (r(2) = 0.95) indicates a systematic between-laboratory variation. Several different principles were used for the analysis of glyphosate using different clean-up techniques and GC/MS, HPLC-fluorescence or LC/MS for detection. The results of the chlormequat residues showed more consistency. All but...

  10. Influence of palm oil on the efficacy of glyphosate in the control of Cyperus rotondus L

    International Nuclear Information System (INIS)

    The influence of the addition of palm oil to the formulation on the efficacy of glyphosate for the control of Cyperus rotundus was evaluated in the laboratory, glass-house and field. Triton X-100 failed to maintain a stable emulsion of palm oil in the formulation 10 minutes after mixing. In glass-house experiments adding mineral oil and palm oil to the glyphosate spray mixture did not increase the herbicidal efficacy. In general, glyphosate was more effective when sprayed at the volume application rate of 100 L/ha than at 400 L/ha. In contrast to the glass-house studies, in the field trial the addition of palm oil increased the efficacy of glyphosate. (author)

  11. The effect of glyphosate on import into a sink leaf of sugar beet

    International Nuclear Information System (INIS)

    The basis for glyphosate inducted limitation of carbon import into developing leaves was studied in sugar beet. To separate the effects of the herbicide on export from those on import, glyphosate was supplied to a developing leaf from two exporting source leaves which fed the sink leaf. Carbon import into the sink leaf was determined by supplying 14CO2 to a third source leaf which also supplies carbon to the monitored sink leaf. Import into the sink leaf decreased within 2 to 3 h after glyphosate application, even though photosynthesis and export in the source leaf supplying 14C were unaffected. Reduced import into the sink leaf was accompanied by increased import by the tap root. Elongation of the sink leaf was only slightly decreased following arrival of glyphosate. Photosynthesis by the sink leaf was not inhibited. The results to data support the view that import is slowed by the inhibition of synthesis of structural or storage compounds in the developing leaves

  12. Nostradamus conference

    CERN Document Server

    Rössler, Otto; Snášel, Václav; Abraham, Ajith; Corchado, Emilio; Nostradamus: Modern Methods of Prediction, Modeling and Analysis of Nonlinear Systems

    2013-01-01

    This proceeding book of Nostradamus conference (http://nostradamus-conference.org) contains accepted papers presented at this event in 2012. Nostradamus conference was held in the one of the biggest and historic city of Ostrava (the Czech Republic, http://www.ostrava.cz/en), in September 2012. Conference topics are focused on classical as well as modern methods for prediction of dynamical systems with applications in science, engineering and economy. Topics are (but not limited to): prediction by classical and novel methods, predictive control, deterministic chaos and its control, complex systems, modelling and prediction of its dynamics and much more.

  13. Glyphosate and AMPA in U.S. streams, groundwater, precipitation and soils

    Science.gov (United States)

    Battaglin, William A.; Meyer, Michael T.; Kuivila, Kathryn M.; Dietze, Julie E.

    2014-01-01

    Herbicides containing glyphosate are used in more than 130 countries on more than 100 crops. In the United States (U.S.), agricultural use of glyphosate [N-(phosphonomethyl)glycine] has increased from less than 10,000 metric tons per year (active ingredient) in 1993 to more than 70,000 metric tons per year in 2006. In 2006, glyphosate accounted for about 20 percent of all herbicide use (by weight of active ingredient). Glyphosate formulations such as Roundup® are used in homes and in agriculture. Part of the reason for the popularity of glyphosate is the perception that it is an “environmentally benign” herbicide that has low toxicity and little mobility or persistence in the environment. The U.S. Geological Survey developed an analytical method using liquid chromatography/tandem mass spectrometry that can detect small amounts of glyphosate and its primary degradation product aminomethylphosphonic acid (AMPA) in water and sediment. Results from more than 2,000 samples collected from locations distributed across the U.S. indicate that glyphosate is more mobile and occurs more widely in the environment than was previously thought. Glyphosate and AMPA were detected (reporting limits between 0.1 and 0.02 micrograms per liter) in samples collected from surface water, groundwater, rainfall, soil water, and soil, at concentrations from less than 0.1 to more than 100 micrograms per liter. Glyphosate was detected more frequently in rain (86%), ditches and drains (71%), and soil (63%); and less frequently in groundwater (3%) and large rivers (18%). AMPA was detected more frequently in rain (86%), soil (82%), and large rivers (78%); and less frequently in groundwater (8%) and wetlands or vernal pools (37%). Most observed concentrations of glyphosate were well below levels of concern for humans or wildlife, and none exceeded the U.S. Environmental Protection Agency’s Maximum Contaminant Level of 700 micrograms per liter. However, the ecosystem effects of chronic low

  14. Clone- and age-dependent toxicity of a glyphosate commercial formulation and its active ingredient in Daphnia magna.

    OpenAIRE

    Cuhra, Marek; Traavik, Terje; Bøhn, Thomas

    2013-01-01

    Low levels of glyphosate based herbicide induced significant negative effects on the aquatic invertebrate Daphnia magna. Glyphosate herbicides such as brands of Roundup, are known to be toxic to daphnids. However, published findings on acute toxicity show significant discrepancies and variation across several orders of magnitude. To test the acute effects of both glyphosate and a commercial formulation of Roundup (hereafter Roundup), we conducted a series of exposure experiments with differen...

  15. (Bio)degradation of glyphosate in water-sediment microcosms - A stable isotope co-labeling approach.

    Science.gov (United States)

    Wang, Shizong; Seiwert, Bettina; Kästner, Matthias; Miltner, Anja; Schäffer, Andreas; Reemtsma, Thorsten; Yang, Qi; Nowak, Karolina M

    2016-08-01

    Glyphosate and its metabolite aminomethylphosphonic acid (AMPA) are frequently detected in water and sediments. Up to date, there are no comprehensive studies on the fate of glyphosate in water-sediment microcosms according to OECD 308 guideline. Stable isotope co-labeled (13)C3(15)N-glyphosate was used to determine the turnover mass balance, formation of metabolites, and formation of residues over a period of 80 days. In the water-sediment system, 56% of the initial (13)C3-glyphosate equivalents was ultimately mineralized, whereas the mineralization in the water system (without sediment) was low, reaching only 2% of (13)C-glyphosate equivalents. This finding demonstrates the key role of sediments in its degradation. Glyphosate was detected below detection limit in the water compartment on day 40, but could still be detected in the sediments, ultimately reaching 5% of (13)C3(15)N-glyphosate equivalents. A rapid increase in (13)C(15)N-AMPA was noted after 10 days, and these transformation products ultimately constituted 26% of the (13)C3-glyphosate equivalents and 79% of the (15)N-glyphosate equivalents. In total, 10% of the (13)C label and 12% of the (15)N label were incorporated into amino acids, indicating no risk bearing biogenic residue formation from (13)C3(15)N-glyphosate. Initially, glyphosate was biodegraded via the sarcosine pathway related to microbial growth, as shown by co-labeled (13)C(15)N-glycine and biogenic residue formation. Later, degradation via AMPA dominated under starvation conditions, as shown by the contents of (13)C-glycine. The presented data provide the first evidence of the speciation of the non-extractable residues as well as the utilization of glyphosate as a carbon and nitrogen source in the water-sediment system. This study also highlights the contribution of both the sarcosine and the AMPA degradation pathways under these conditions. PMID:27140906

  16. Effect of surfactants on the penetration of 14C-glyphosate in Cyperus rotundus in Pakistani agroclimatic conditions

    International Nuclear Information System (INIS)

    The penetration of 14C-glyphosate was studied in Cyperus rotundus with three nonionic surfactants. Among the three surfactants Synperonic A20 was more effective than A2 and A7 in enhancing penetration of glyphosate 24 hours after treatment both in dry and wet seasons. The addition of diesel oil to Synperonic A20 further increased penetration of glyphosate in both seasons. (author)

  17. Next generation Chirped Pulse Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Nees, J.; Biswal, S.; Mourou, G. [Univ. Michigan, Center for Ultrafast Optical Science, Ann Arbor, MI (United States); Nishimura, Akihiko; Takuma, Hiroshi

    1998-03-01

    The limiting factors of Chirped Pulse Amplification (CPA) are discussed and experimental results of CPA in Yb:glass regenerative amplifier are given. Scaling of Yb:glass to the petawatt level is briefly discussed. (author)

  18. Agricultural impacts of glyphosate-resistant soybean cultivation in South America.

    Science.gov (United States)

    Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B

    2011-06-01

    In the 2009/2010 growing season, Brazil was the second largest world soybean producer, followed by Argentina. Glyphosate-resistant soybeans (GRS) are being cultivated in most of the soybean area in South America. Overall, the GRS system is beneficial to the environment when compared to conventional soybean. GRS resulted in a significant shift toward no-tillage practices in Brazil and Argentina, but weed resistance may reduce this trend. Probably the highest agricultural risk in adopting GRS in Brazil and South America is related to weed resistance due to use of glyphosate. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. Five weed species, in order of importance, Conyza bonariensis (L.) Cronquist, Conyza canadensis (L.) Cronquist, Lolium multiflorum Lam., Digitaria insularis (L.) Mez ex Ekman, and Euphorbia heterophylla L., have evolved resistance to glyphosate in GRS in Brazil. Conyza spp. are the most difficult to control. A glyphosate-resistant biotype of Sorghum halepense L. has evolved in GRS in Argentina and one of D. insularis in Paraguay. The following actions are proposed to minimize weed resistance problem: (a) rotation of GRS with conventional soybeans in order to rotate herbicide modes of action; (b) avoidance of lower than recommended glyphosate rates; (c) keeping soil covered with a crop or legume at intercrop intervals; (d) keeping machinery free of weed seeds; and (d) use of a preplant nonselective herbicide plus residuals to eliminate early weed interference with the crop and to minimize escapes from later applications of glyphosate due to natural resistance of older weeds and/or incomplete glyphosate coverage. PMID:20839871

  19. Isolation and characterization of a glyphosate-degrading rhizosphere strain, Enterobacter cloacae K7.

    Science.gov (United States)

    Kryuchkova, Yelena V; Burygin, Gennady L; Gogoleva, Natalia E; Gogolev, Yuri V; Chernyshova, Marina P; Makarov, Oleg E; Fedorov, Evgenii E; Turkovskaya, Olga V

    2014-01-20

    Plant-growth-promoting rhizobacteria exert beneficial effects on plants through their capacity for nitrogen fixation, phytohormone production, phosphate solubilization, and improvement of the water and mineral status of plants. We suggested that these bacteria may also have the potential to express degradative activity toward glyphosate, a commonly used organophosphorus herbicide. In this study, 10 strains resistant to a 10 mM concentration of glyphosate were isolated from the rhizoplane of various plants. Five of these strains--Alcaligenes sp. K1, Comamonas sp. K4, Azomonas sp. K5, Pseudomonas sp. K3, and Enterobacter cloacae K7--possessed a number of associative traits, including fixation of atmospheric nitrogen, solubilization of phosphates, and synthesis of the phytohormone indole-3-acetic acid. One strain, E. cloacae K7, could utilize glyphosate as a source of P. Gas-liquid chromatography showed that E. cloacae growth correlated with a decline in herbicide content in the culture medium (40% of the initial 5mM content), with no glyphosate accumulating inside the cells. Thin-layer chromatography analysis of the intermediate metabolites of glyphosate degradation found that E. cloacae K7 had a C-P lyase activity and degraded glyphosate to give sarcosine, which was then oxidized to glycine. In addition, strain K7 colonized the roots of common sunflower (Helianthus annuus L.) and sugar sorghum (Sorghum saccharatum Pers.), promoting the growth and development of sunflower seedlings. Our findings extend current knowledge of glyphosate-degrading rhizosphere bacteria and may be useful for developing a biotechnology for the cleanup and restoration of glyphosate-polluted soils. PMID:23545355

  20. COMPARISON OF GLYPHOSATE PERSISTENCE IN CLAY SOIL ON NO-TILLED AND AUTUMN PLOUGHED PLOTS

    OpenAIRE

    Petruneva, Ekaterina

    2015-01-01

    The present work was based on the analysis of glyphosate concentrations in six soil layers after continuous multiple applications of herbicide products and various sampling times during the study period of 2010−2012, and aimed to contribute to a better recognition of the glyphosate persistence in clay soil. Two tillage methods (conventional tillage and no-till) were carried out in two replicates on the experimental field located in Jokioinen, South-Western Finland. This experiment was impo...

  1. Isolation of a Pseudomonas sp. Which Utilizes the Phosphonate Herbicide Glyphosate

    OpenAIRE

    Moore, J. Kent; Braymer, Hugh D.; Larson, Alworth D.

    1983-01-01

    A strain of bacteria has been isolated which rapidly and efficiently utilizes the herbicide glyphosate (N-phosphonomethylglycine) as its sole phosphorus source in a synthetic medium. The strain (PG2982) was isolated by subculturing Pseudomonas aeruginosa ATCC 9027 in a synthetic broth medium containing glyphosate as the sole phosphorus source. Strain PG2982 differs from the culture of P. aeruginosa in that it is nonflagellated, does not produce pyocyanin, and has an absolute requirement for t...

  2. Foliar levels of macro and micronutrients in glyphosate-tolerant corn submitted to herbicides

    Directory of Open Access Journals (Sweden)

    Núbia Maria Correia

    2013-12-01

    Full Text Available A serial of factors related to development of glyphosate-tolerant corn should be approached and best studied. This work was developed to evaluate foliar levels of N, P, K, Ca, Mg, S, B, Cu, Fe, Mn and Zn, besides the grain yield of glyphosate-tolerant corn (DKB390 RR hybrid. An experiment was carried out under field conditions, during the crop year of 2010/2011. A randomized complete block design with four repetitions was used to distribute the treatments in the field. Twelve herbicide treatments were studied: glyphosate (720, 1200 and sequential application of 960 plus 720 g ha-1 of the acid glyphosate equivalent, atrazine (2500 g ha-1, nicosulfuron (60 g ha-1, mesotrione (192 g ha-1, tembotrione (100,8 g ha-1, atrazine plus glyphosate (1000 + 960 g ha-1, atrazine plus nicosulfuron (1000 + 20 g ha-1, atrazine plus mesotrione (1000 + 144 g ha-1 and atrazine plus tembotrione (1000 + 75,6 g ha-1 and one control treatment without herbicide. The glyphosate and mesotrione alone did not cause no visible injury to corn. The other herbicides caused intoxication symptoms classified as light (<5%. The treatments studied did not affect foliar levels of N, P, K, Ca, Mg, S, B, Mn and Zn in the corn plants. But, the plants treated with atrazine plus nicosulfuron had more leaf Fe content, and the plants sprayed with glyphosate (in the three doses and atrazine, more accumulation of Cu in the leaf. The Grain yield of corn was reduced with application single of glyphosate (1200 g ha-1, nicosulfuron, tembotrione and with the mixture atrazine plus nicosulfuron.

  3. A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

    Directory of Open Access Journals (Sweden)

    Ri-He Peng

    Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

  4. Investigation of LC50, NOEC and LOEC of Glyphosate, Deltamethrin and Pretilachlor in Guppies (Poecilia Reticulata

    Directory of Open Access Journals (Sweden)

    Ali Sadeghi

    2014-09-01

    Full Text Available Background: The presence of pesticides is very prevalent in surface waters of Iran. These toxic substances may accumulate in the food chain and cause serious ecological and health problems. The aim of this study was to determine the acute toxicity of glyphosate, deltamethrin and pretilachlor as potential dangerous organic pesticides to assess lethal effects of these chemicals agents to the Guppy (Poecilia reticulata. Methods: Fish samples were exposed to different concentrations of glyphosate (41% (0, 2, 5, 10, 15 and 25 ppm, deltamethrin (2.5% (0, 0.01, 0.02, 0.04, 0.10 and 0.30 ppm and pretilachlor (50% (0, 2, 4, 8, 16 and 32 ppm for 96 h and cumulative mortality of the guppies was calculated with 24 h intervals. Results: LC50-96h was 12.01±1.00, 0.08±0.47 and 8.24±0.42 for glyphosate, deltamethrin and pretilachlor respectively. The very low LC50 obtained for glyphosate (12.01±1.00 ppm, deltamethrin (0.08±0.47 ppm and pretilachlor (8.24±0.42 ppm indicate that glyphosate, deltamethrin and pretilachlor are highly toxic to guppies. Conclusion: Our results demonstrated that deltamethrin and glyphosate had the lowest and highest rate of mortality on the guppy respectively.

  5. Degradation of 14C-glyphosate in apple plantations in agrotechniques conditions of Western Romania

    International Nuclear Information System (INIS)

    This study has proposed the identification of glyphosate degradation capacity in trees plantation in the scientific didactic resort of Banat's University of Agricultural Sciences and Veterinary Medicine Timisoara, Romania compared with experiments realized on the same soil in laboratory conditions. Laboratory analysis of glyphosate residues in soil were made using TRIATHLER Scintillator liquid. Radioactivity brought by the C-14 glyphosate standard to phosphonomethyl) group was 37kBq for each soil. Evolution of glyphosate mineralization in soil was highlighted by capturing 14CO2 evolved following the action of soil microorganisms on herbicide, in 0.2 M NaOH solution at various time intervals. Results indicate that the percentage of CO2 accumulated after glyphosate biodegradation under the action of microorganisms is higher in the laboratory experiment compared with the results from experimental field. C02 fraction accumulated after 50 days, is 73.42% in the laboratory experiment versus 28.02% for samples exposed in the experimental field. Key words: glyphosate, apple plantation, microorganisms, degradation

  6. Equilibrium and kinetic mechanisms of woody biochar on aqueous glyphosate removal.

    Science.gov (United States)

    Mayakaduwa, S S; Kumarathilaka, Prasanna; Herath, Indika; Ahmad, Mahtab; Al-Wabel, Mohammed; Ok, Yong Sik; Usman, Adel; Abduljabbar, Adel; Vithanage, Meththika

    2016-02-01

    We investigated the removal of aqueous glyphosate using woody (dendro) biochar obtained as a waste by product from bioenergy industry. Equilibrium isotherms and kinetics data were obtained by adsorption experiments. Glyphosate adsorption was strongly pH dependent occurring maximum in the pH range of 5-6. The protonated amino moiety of the glyphosate molecule at this pH may interact with π electron rich biochar surface via π-π electron donor-acceptor interactions. Isotherm data were best fitted to the Freundlich and Temkin models indicating multilayer sorption of glyphosate. The maximum adsorption capacity of dendro biochar for glyphosate was determined by the isotherm modeling to be as 44 mg/g. Adsorption seemed to be quite fast, reaching the equilibrium forces through sharing or exchanging electrons between the adsorbent and sorbate. The FTIR spectral analysis indicated the involvement of functional groups such as phenolic, amine, carboxylic and phosphate in adsorption. Hence, a heterogeneous chemisorption process between adsorbate molecules and functional groups on biochar surface can be suggested as the mechanisms involved in glyphosate removal. PMID:26340852

  7. Review of potential environmental impacts of transgenic glyphosate-resistant soybean in Brazil.

    Science.gov (United States)

    Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B; Spadotto, Claudio A

    2007-01-01

    Transgenic glyphosate-resistant soybeans (GRS) have been commercialized and grown extensively in the Western Hemisphere, including Brazil. Worldwide, several studies have shown that previous and potential effects of glyphosate on contamination of soil, water, and air are minimal, compared to those caused by the herbicides that they replace when GRS are adopted. In the USA and Argentina, the advent of glyphosate-resistant soybeans resulted in a significant shift to reduced- and no-tillage practices, thereby significantly reducing environmental degradation by agriculture. Similar shifts in tillage practiced with GRS might be expected in Brazil. Transgenes encoding glyphosate resistance in soybeans are highly unlikely to be a risk to wild plant species in Brazil. Soybean is almost completely self-pollinated and is a non-native species in Brazil, without wild relatives, making introgression of transgenes from GRS virtually impossible. Probably the highest agricultural risk in adopting GRS in Brazil is related to weed resistance. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. These include Chamaesyce hirta (erva-de-Santa-Luzia), Commelina benghalensis (trapoeraba), Spermacoce latifolia (erva-quente), Richardia brasiliensis (poaia-branca), and Ipomoea spp. (corda-de-viola). Four weed species, Conyza bonariensis, Conyza Canadensis (buva), Lolium multiflorum (azevem), and Euphorbia heterophylla (amendoim bravo), have evolved resistance to glyphosate in GRS in Brazil and have great potential to become problems. PMID:17562462

  8. Clastogenic Effects of Glyphosate in Bone Marrow Cells of Swiss Albino Mice

    International Nuclear Information System (INIS)

    Glyphosate (N-(phosphonomethyl) glycine, C3H8NO5P), a herbicide, used to control unwanted annual and perennial plants all over the world. Nevertheless, occupational and environmental exposure to pesticides can pose a threat to nontarget species including human beings. Therefore, in the present study, genotoxic effects of the herbicide glyphosate were analyzed by measuring chromosomal aberrations (CAs) and micronuclei (MN) in bone marrow cells of Swiss albino mice. A single dose of glyphosate was given intraperitoneally (i.p) to the animals at a concentration of 25 and 50 mg/kg b.wt. Animals of positive control group were injected i.p. benzo(a)pyrene (100 mg/kg b.wt., once only), whereas, animals of control (vehicle) group were injected i.p. dimethyl sulfoxide (0.2 mL). Animals from all the groups were sacrificed at sampling times of 24, 48, and 72 hours and their bone marrow was analyzed for cytogenetic and chromosomal damage. Glyphosate treatment significantly increases CAs and MN induction at both treatments and time compared with the vehicle control (P<.05). The cytotoxic effects of glyphosate were also evident, as observed by significant decrease in mitotic index (MI). The present results indicate that glyphosate is clastogenic and cytotoxic to mouse bone marrow.

  9. Adsorption-desorption, mobility and degradation of 14C-Glyphosate in two soil series

    International Nuclear Information System (INIS)

    The adsorption desorption and degradation of glyphosate (Roundup) have been studied using 14C glyphosate in two soils, namely Serdang Series and Sungai Buloh Series. The percentage of adsorption was not significantly different (p14C- glyphosate was detected in 0-10 cm zone of the two soils studied. However, in Sungai Buloh Series, a significant amount of 14C-glyphosate was detected in the 10-20 cm zone. A small amount of 14C radioactivity was also detected in the leachate of the two soils. The percentage of degradation in the Sungai Buloh and Serdang Series soils was higher at 10 μg/ml and 50 μg/ml, concentration, respectively. At 50 μg/ml concentration the Sungai Buloh Series soil showed higher glyphosate residue (83%) as compared to Serdang Series (48%). In contrast, the glyphosate residue was found to be higher in the Serdang Series (73916) as compared to the Sungai Buloh Series (30%) at 10 μg/ml concentration. (Author)

  10. A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Gaoyi Cao

    Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

  11. A Novel 5-Enolpyruvylshikimate-3-Phosphate Synthase Shows High Glyphosate Tolerance in Escherichia coli and Tobacco Plants

    OpenAIRE

    Gaoyi Cao; Yunjun Liu; Shengxue Zhang; Xuewen Yang; Rongrong Chen; Yuwen Zhang; Wei Lu; Yan Liu; Jianhua Wang; Min Lin; Guoying Wang

    2012-01-01

    A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA gen...

  12. Micromorfologia foliar na análise da fitotoxidez por glyphosate em Eucalyptus grandis Leaf micromorphology in the analysis of glyphosate toxicity in Eucalyptus grandis

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2009-01-01

    Full Text Available Foram avaliados os efeitos da deriva de formulações comerciais de glyphosate sobre a superfície foliar e o crescimento de clones de eucalipto. Mudas de seis clones foram submetidas a 129,6 g ha-1 de glyphosate das formulações comerciais Scout®, Roundup NA®, Roundup transorb® e Zapp QI®. Entre os clones não foram identificadas diferenças quanto à tolerância ao glyphosate. Plantas expostas à deriva simulada de Roundup transorb® e Zapp QI® apresentaram, respectivamente, a maior e menor porcentagem de intoxicação. Observou-se menor massa seca em plantas expostas ao glyphosate, independentemente da formulação, e menor altura naquelas expostas ao Scout® e ao Roundup transorb®. As características quantitativas da superfície foliar não foram afetadas pelo glyphosate. As alterações micromorfológicas ocorreram na ausência de danos visíveis e foram observadas em ambas as faces da epiderme, em todos os clones avaliados. Danos como erosão e aspecto amorfo das ceras epicuticulares e infestação por hifas fúngicas ocorreram, independentemente da formulação utilizada. A avaliação anatômica da superfície foliar foi relevante para descrição e interpretação dos danos causados pelo glyphosate. Os dados de crescimento e de intoxicação indicam o Zapp QI® como a formulação de menor risco para a cultura do eucalipto quanto aos efeitos indesejáveis da deriva.The effects of commercial glyphosate drift on the leaf surface and growth of eucalypt clones were evaluated. Seedlings of six clones were submitted to 129.6 g ha-1 sub-rate of commercial glyphosate formulations Scout®, Roundup NA®, Roundup transorb® and Zapp QI®. No differences in tolerance to glyphosate were observed among the clones. Plants exposed to simulated drift of Roundup transorb® and Zapp QI® presented the highest and lowest intoxication percentages, respectively. Plants exposed to glyphosate reduced dry biomass, regardless of the formulation, and also

  13. 草甘膦废水回收草甘膦的方法研究%Recovery of Glyphosate from Glyphosate Wastewater

    Institute of Scientific and Technical Information of China (English)

    李致宝; 韦少平; 柯敏; 张丽娟; 许朝芳

    2016-01-01

    对草甘膦废水进行浓缩,然后加入生石灰等搅拌反应60min,过滤,滤饼加1∶1盐酸调节至pH=2.0,冷藏结晶。溶液过滤、水洗、烘干,得到草甘膦粉。草甘膦回收率达86%以上。%After concentration, the glyphosate wastewater reacted with quicklime for 60min. Hydrochloric acid was added into filter cake to make pH=2.0. The filtrate was crystallized by refrigerated overnight. After filtered, washing and drying, glyphosate powder was got. The glyphosate recovery was more than 85%.

  14. Translocação do glyphosate em biótipos de azevém (Lolium multiflorum) Glyphosate translocation in Italian ryegrass biotypes (Lolium multiflorum)

    OpenAIRE

    E.A. Ferreira; J.B. Santos; Silva, A. A.; de Oliveira, J. A.; Vargas, L.

    2006-01-01

    Foram avaliadas neste trabalho a absorção foliar e a translocação do glyphosate por biótipos de azevém (Lolium multiflorum) sensíveis e resistentes a esse herbicida. Para isso, aplicou-se 14C-glyphosate utilizando-se uma microsseringa de precisão, adicionando-se 10 µL da calda sobre a face adaxial da primeira folha com lígula totalmente visível, quando as plantas de azevém se apresentavam com três perfilhos. A quantidade de glyphosate absorvido e translocado foi avaliada em intervalos de temp...

  15. Conference summaries

    International Nuclear Information System (INIS)

    This volume contains conference summaries of the international conference on radioactive waste management of the Canadian Nuclear Society. Topics of discussion include: storage and disposal; hydrogeology and geochemistry; transportation; buffers and backfill; public attitudes; tailings; site investigations and geomechanics; concrete; economics; licensing; matrix materials and container design; durability of fuel; biosphere modelling; radioactive waste processing; and, future options

  16. Sources and Input Pathways of Glyphosate and its Degradation Product AMPA

    Science.gov (United States)

    Bischofberger, S.; Hanke, I.; Wittmer, I.; Singer, H.; Stamm, C.

    2009-04-01

    Despite being the pesticide used in the largest quantities worldwide, the environmental relevance of glyphosate has been considered low for many years. Reasons for this assessment were the observations that glyphosate degrades quickly into its degradation product AMPA and that it sorbs strongly to soil particles. Hence, little losses to water bodies had been expected. Research during the last few years however contradicts this expectation. Although glyphosate is a dominant pesticide used in agriculture, recent studies on other pesticides revealed that urban sources may play a significant role for water quality. Therefore this study compares glyphosate input into streams from agricultural and urban sources. For that purpose, a catchment of an area of 25 km2 was selected. It has by about 12'000 inhabitants and about 15 % of the area is used as arable land. Four sampling sites were selected in the river system in order to reflect different urban and agricultural sources. Additionally, we sampled a combined sewer overflow, a rain sewer and the outflow of a waste water treatment plant. At each site discharge was measured continuously from March to November 2007. During 16 rain events samples were taken by automatic devices at a high temporal resolution. To analyze the concentration of glyphosate and its degradation product AMPA, the samples were derivatized with FMOC-Cl at low pH conditions and then filtrated. The solid phase extraction was conducted with Strata-X sorbent cartridge. Glyphosate and AMPA were detected with API 4000 after the chromatography with X bridge column C18. To assure the data quality, interne standards of Glyphosate and AMPA were added to every sample. The limit of detection and quantification for glyphosate and AMPA are bellow 1ng/l. We analyzed two rain events at a high resolution for all stations and several events at the outlet of the catchment. We measured high glyphosate concentration in urban and agriculture dominated catchments with up to

  17. Seletividade de glyphosate isolado ou em misturas para soja RR em aplicações sequenciais Selectivity of glyphosate alone or in mixtures for RR soybean in sequential applications

    Directory of Open Access Journals (Sweden)

    D.G Alonso

    2013-03-01

    Full Text Available O uso de misturas de herbicidas latifolicidas com o glyphosate tem sido uma alternativa para o controle de plantas daninhas resistentes ao glyphosate ou de difícil controle nos cultivos de soja RR. Este trabalho teve o objetivo de avaliar a seletividade de aplicações sequenciais de glyphosate, isolado ou em mistura com latifolicidas, para a soja RR. As aplicações dos tratamentos foram feitas em plantas de soja cultivar CD214 RR nos estádios de desenvolvimento V1 a V2 e V3 a V4. Os herbicidas e as respectivas doses (g i.a. ha-1 utilizadas foram: glyphosate (g e.a. ha-1 isolado (720/480, 720/720, 960/960 e 1.200/1.200 e as misturas de glyphosate + cloransulam-methyl (720 + 15,12/480 + 15,12, glyphosate + fomesafen (720 + 62,5/480 + 62,5, glyphosate + lactofen (720 + 36/480 + 36, glyphosate + chlorimuron-ethyl (720 + 6,25/480 + 6,25, glyphosate + flumiclorac-pentyl (720 + 15/480 + 15, glyphosate + bentazon (720 + 240/480 + 240 e glyphosate + imazethapyr (720 + 40/480 + 40. O delineamento adotado foi o de blocos casualizados, em esquema de parcelas subdivididas, com quatro repetições. As variáveis avaliadas foram: fitointoxicação, altura de plantas, estande, fechamento do dossel, número de vagens por planta, massa de cem grãos e produtividade. Todos os tratamentos promoveram efeitos visuais de fitointoxicação na cultura da soja; todavia, em nenhuma das situações estudadas houve prejuízo no rendimento de grãos.The use of latifolicide mixed with glyphosate has been an alternative to control weeds resistant to glyphosate or difficult to control in RR soybean crops. The aim of this work was to evaluate the selectivity of sequential applications of glyphosate isolated or in mixture with latifolicide herbicides for RR soybean. Treatment applications were carried out on the soybean cultivar plants CD 214 RR at the developmental stages V1 up to V2 and V3 up to V4. The herbicides and respective rates (g a.i. ha-1 evaluated were: glyphosate

  18. Teores de nutrientes em cultivares de café arábica submetidos à deriva de glyphosate Nutrient content in arabica coffee cultivars subjected to glyphosate drift

    Directory of Open Access Journals (Sweden)

    A.C França

    2010-12-01

    Full Text Available Avaliaram-se, neste trabalho, os efeitos do glyphosate sobre os teores foliares de nutrientes em três cultivares de café (Coffea arabica. Utilizou-se o esquema fatorial (3 x 5 em delineamento de blocos casualizados, com quatro repetições, sendo os tratamentos compostos por três cultivares de café: Catucaí Amarelo (2 SL, Oeiras (MG-6851 e Topázio (MG-1190; e cinco doses de glyphosate (0; 57,6; 115,2; 230,4; e 460,8 g ha-1. Aos 45 e 120 DAA, coletaram-se folhas (terceiro par de ramos plagiotrópicos, contidos na parte mediana das plantas. Os sintomas de intoxicação foram caracterizados por clorose e estreitamento do limbo foliar para os três cultivares de café. Houve redução nos teores foliares de N, P, K, Cu e Zn aos 45 DAA e de N, K, Mn e Zn aos 120 DAA nas plantas de café tratadas com glyphosate, independentemente do cultivar utilizado. O cultivar Topázio apresentou as maiores reduções nos teores foliares de Fe e Mn, aos 45 DAA, e de P e Fe, aos 120 DAA.The effects of glyphosate on the foliar levels of nutrients in three coffee cultivars (Coffea arabica were evaluated in this work. A factorial (3 x 5 was used in a randomized block design with four replications, with treatments consisting of three coffee varieties: Catucaí Amarelo (2 SL, Oeiras (MG-6851 and Topázio (MG-1190 and five glyphosate doses (0, 57.6, 115.2, 230.4 and 460.8 g ha-1. At 45 and 120 DAA, leaves (third pair from plagiotrophic branches were collected from the medium part of the plants. Glyphosate intoxication symptoms were characterized by chlorosis and leaf narrowing for the three coffee varieties. There was a reduction in foliar levels of N, P, K, Cu and Zn at 45 DAA, and N, K, Mn and Zn at 120 DAA, in coffee plants treated with glyphosate, regardless of the cultivar used. Cultivar Topázio showed the greatest reductions in the foliar levels of Fe and Mn, at 45 DAA and P and Fe, at 120 DAA, when treated with glyphosate.

  19. The intensity of non-target site mechanisms influences the level of resistance of sourgrass to glyphosate

    Directory of Open Access Journals (Sweden)

    Flávia Regina da Costa

    2014-02-01

    Full Text Available Non-target site mechanisms are involved in the resistance of sourgrass (Digitaria insularis to glyphosate. Studies on the 14C-glyphosate absorption and translocation as well as the detection of glyphosate and its metabolites in sourgrass plants were carried out under controlled conditions to investigate if the differential response of resistant sourgrass biotypes (R1 and R2 is derived from the intensity of non-target site mechanisms involved in the resistance to glyphosate. Different pattern of absorption was observed between S (susceptible and R2 from 12 up to 48 hours after treatment with glyphosate (HAT, and between S and R1 just at 12 HAT. The initial difference in glyphosate absorption among the biotypes did not maintained at 96 HAT and afterwards. Smaller amount of herbicide left the treated leaf into the rest of shoot and roots in R2 (25% than in S (58% and R1 (52%. In addition, slight difference in glyphosate translocation was observed between S and R1. We found high percentage (81% of glyphosate in the S biotype up to 168 HAT, while just 44% and 2% of glyphosate was recovered from R1 and R2 plant tissues. In addition, high percentage of glyphosate metabolites was found in R2 (98% and R1 (56% biotypes, while a very low percentage (11% was found in the S biotype. As previous studies indicated resistant factors of 3.5 and 5.6 for R1 and R2, respectively, we conclude that the differential response of sourgrass biotypes is derived from the intensity of the non-target site mechanisms involved in the resistance to glyphosate.

  20. The fate of glyphosate in water hyacinth and its physiological and biochemical influences on growth of algae

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Baolong.

    1989-01-01

    Absorption, translocation, distribution, exudation, and guttation of {sup 14}C-glyphosate in water hyacinth (Eichhornia crassipes) were studied. Glyphosphate entered the plant by foliage and solution treatment. Plants were harvested and separated into the following parts: treated leaf blade, treated leaf petiole, young leaf blade, young leaf petiole, old leak blade, old leaf petiole, and root. Each part was extracted with methanol. Treated leaves, which exist only in foliage treatment, were washed with water and chloroform to remove the glyphosate residues. All {sup 14}C counting was made by liquid scintillation spectrometry. Autoradiography was used to locate {sup 14}C-glyphosate after foliage treatment. Results indicated that glyphosate can be absorbed from the leaf surface and translocated rapidly through phloem tissues into the whole plant body. The roots of water hyacinth absorbed glyphosate without vertical transport. Guttation of glyphosate occurred in treated leaf tips. Exudation of glyphosate from roots of water hyacinth occurred within 8 hr after foliage treatment. Chlorella vulgaris, Chlamydomonas reihardii, Anabaena cylindrica, and Chroococcus turgidus were used to explore the physiological and biochemical effects of glyphosate on algae. Spectrophotometric assays were performed for algal growth, chlorophyll, carotenoids, phycobiliprotein, carbohydrate, and protein. TLC procedures and an image analyzer were used to detect the metabolites of glyphosate inside algal cells. The common visible symptom of glyphosate toxicity in all algal cells were bleaching effect and reduction of contents of carbohydrate, protein, and pigments. The results highly suggested that glyphosate injured the algal cells by destruction of photosynthetic pigments and resulted in lowering the contents of carbohydrate and protein in algal cells.

  1. The fate of glyphosate in water hyacinth and its physiological and biochemical influences on growth of algae

    International Nuclear Information System (INIS)

    Absorption, translocation, distribution, exudation, and guttation of 14C-glyphosate in water hyacinth (Eichhornia crassipes) were studied. Glyphosphate entered the plant by foliage and solution treatment. Plants were harvested and separated into the following parts: treated leaf blade, treated leaf petiole, young leaf blade, young leaf petiole, old leak blade, old leaf petiole, and root. Each part was extracted with methanol. Treated leaves, which exist only in foliage treatment, were washed with water and chloroform to remove the glyphosate residues. All 14C counting was made by liquid scintillation spectrometry. Autoradiography was used to locate 14C-glyphosate after foliage treatment. Results indicated that glyphosate can be absorbed from the leaf surface and translocated rapidly through phloem tissues into the whole plant body. The roots of water hyacinth absorbed glyphosate without vertical transport. Guttation of glyphosate occurred in treated leaf tips. Exudation of glyphosate from roots of water hyacinth occurred within 8 hr after foliage treatment. Chlorella vulgaris, Chlamydomonas reihardii, Anabaena cylindrica, and Chroococcus turgidus were used to explore the physiological and biochemical effects of glyphosate on algae. Spectrophotometric assays were performed for algal growth, chlorophyll, carotenoids, phycobiliprotein, carbohydrate, and protein. TLC procedures and an image analyzer were used to detect the metabolites of glyphosate inside algal cells. The common visible symptom of glyphosate toxicity in all algal cells were bleaching effect and reduction of contents of carbohydrate, protein, and pigments. The results highly suggested that glyphosate injured the algal cells by destruction of photosynthetic pigments and resulted in lowering the contents of carbohydrate and protein in algal cells

  2. Conference summaries

    International Nuclear Information System (INIS)

    This volume contains conference summaries of the 28. annual conference of the Canadian Nuclear Association, and the 9. annual conference of the Canadian Nuclear Society. Topics of discussion include: power reactors; fuel cycles; nuclear power and public understanding; future trends; applications of nuclear technology; CANDU reactors; operational enhancements; design of small reactors; accident behaviour in fuel channels; fuel storage and waste management; reactor commissioning/decommissioning; nuclear safety experiments and modelling; the next generation reactors; advances in nuclear engineering education in Canada; safety of small reactors; current position and improvements of fuel channels; current issues in nuclear safety; and radiation applications - medical and industrial

  3. Impact of glyphosate on the development, fertility and demography of Chrysoperla externa (Neuroptera: Chrysopidae): ecological approach.

    Science.gov (United States)

    Schneider, M I; Sanchez, N; Pineda, S; Chi, H; Ronco, A

    2009-09-01

    Few ecotoxicological studies have used life table analysis to evaluate the toxicity of pesticides on beneficial organisms. This study is the first report of the effect of the herbicide glyphosate on a predator insect, Chrysoperla externa, using a demographic approach. This predator is associated to soybean pests and has a potential role as a biological control agent in the Neotropical Region. The objective of this work was to evaluate the side-effects of glyphosate on the development, fertility and demography of C. externa, treated orally by ingestion of glyphosate-dipped eggs of Sitotroga cerealella in laboratory conditions. The data were analyzed using the age-stage, two-sex life table. Development from third larval instar to pupae and adult longevity were shorter in glyphosate-treatment than in the control. Adult pre-reproductive period was longer in glyphosate-treatment than in the control. Fecundity and fertility were deeply reduced, as well, being fertility greater affected. A high important reduction was registered in all population parameters. Most eggs from glyphosate-treated cohort looked abnormal, smaller than control, dehydrated and became black 2d after oviposition. In addition, adults developed tumours in the abdomen region at 20d after emergence, being the effect more drastic in females than males. It is beyond the scope of our study to speculate on the effects of this herbicide on C. externa field populations. However, it seems likely that populations under continuous use of glyphosate would be exposed at greater detrimental effects in the long term. PMID:19577273

  4. Feedback Amplification of Neutrophil Function.

    Science.gov (United States)

    Németh, Tamás; Mócsai, Attila

    2016-06-01

    As the first line of innate immune defense, neutrophils need to mount a rapid and robust antimicrobial response. Recent studies implicate various positive feedback amplification processes in achieving that goal. Feedback amplification ensures effective migration of neutrophils in shallow chemotactic gradients, multiple waves of neutrophil recruitment to the site of inflammation, and the augmentation of various effector functions of the cells. We review here such positive feedback loops including intracellular and autocrine processes, paracrine effects mediated by lipid (LTB4), chemokine, and cytokine mediators, and bidirectional interactions with the complement system and with other immune and non-immune cells. These amplification mechanisms are not only involved in antimicrobial immunity but also contribute to neutrophil-mediated tissue damage under pathological conditions. PMID:27157638

  5. WEED CONTROL IN GENETICALLY MODIFIED GLYPHOSATE-TOLERANT SOYBEAN MANEJO DE PLANTAS DANINHAS EM SOJA GENETICAMENTE MODIFICADA TOLERANTE AO GLYPHOSATE

    Directory of Open Access Journals (Sweden)

    Júlio Cezar Durigan

    2011-04-01

    Full Text Available The transgenic production systems, as well as conventional systems, require, in addition to chemical control, the adoption of other weed management strategies. This study was developed to evaluate the weed chemical control in glyphosate tolerant soybean, associated to cover crops cultivated in the autumn/winter. The experiment was carried out under field conditions at the FCAV/Unesp, Jaboticabal, São Paulo State, Brazil. A randomized split-plot block design was used, with four replications. St. Lucia Grass (Brachiaria brizantha ‘Marandu’, forage millet (Pennisetum americanum ‘BN2’, and a treatment with spontaneous growth vegetation were evaluated for plots, and, for subplots, the herbicides glyphosate, chlorimuron - ethyl plus lactofen, and fluazifop-p-butyl, in a sequential spraying, and two controls without any application. Grass cover contributed to the chemical control, suppressing weeds, and the single application of 720 g a.e. ha-1 of glyphosate, independently of the cover crop cultivated in the autumn/winter, was sufficient for adequately controlling Acanthospermum hispidum, Alternanthera tenella, Amaranthus sp., Bidens pilosa, Xanthium strumarium, Cenchrus echinatus, Digitaria sp., and Eleusine indica, with results similar to the treatment (chlorimuron-ethyl + lactofen + fluazifop-p-buthyl. When compared to the weeded control, the herbicides did not affect plants height, dry matter of the aerial parts, mass of 100 grains, and grain yield. Soybean plants grown over St. Lucia Grass and forage millet presented a higher height, however, no other feature was influenced by the cover crop.

    KEY-WORDS: Brachiaria brizantha; Pennisetum americanum; no-tillage; Roundup Ready; spontaneous vegetation.

    Os sistemas de produção transgênicos, assim como os

  6. Glyphosate and dicamba herbicide tank mixture effects on native plant and non-genetically engineered soybean seedlings

    Science.gov (United States)

    Weed species are becoming resistant to intensive and extensive use of specific herbicides associated with the production of herbicide resistant crops, e.g., the use of glyphosate for weed management with glyphosate resistant soybeans. To counter this resistance, crops engineered ...

  7. An estimation of pollen flight time and dispersal distance for glyphosate-resistant Palmer amaranth (Amaranthus palmeri)

    Science.gov (United States)

    Palmer amaranth is a common and competitive weed of cotton in the southeastern United States. The recent discovery of glyphosate-resistant biotypes is of particular concern as 98% of the cotton acreage is devoted to the production of glyphosate-tolerant varieties. Herbicide resistance can be acquire...

  8. Detection of the onset of glyphosate-induced soybean plant injury through chlorophyll fluorescence signal extraction and measurement

    Science.gov (United States)

    In this study, Chlorophyll Fluorescence (ChlF) was used to detect the onset of soybean plant injury from glyphosate, the most widely used herbicide. Thirty-six pots of non-glyphosate-resistant soybean (cultivar FM955LL) were randomly divided into three groups and treated with different doses of glyp...

  9. Response of direct-seeded dry bulb onion to simulated glyphosate drift with variable rates and application timings

    Science.gov (United States)

    Field studies were conducted in 2011 at the Malheur Experiment Station, Ontario, OR and Prosser, WA to evaluate the effect of simulated glyphosate drift on direct-seeded dry bulb onion. Glyphosate was applied at 8.6, 25.8, 86, 290, 434, and 860 g ae ha-1 when onion plants were at the flag-, 2-, 4-, ...

  10. Bioaccumulation of glyphosate and its formulation Roundup Ultra in Lumbriculus variegatus and its effects on biotransformation and antioxidant enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Contardo-Jara, Valeska [Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Department of Inland Fisheries, Biochemical Regulation, Mueggelseedamm 301, 12587 Berlin (Germany)], E-mail: contardo@igb-berlin.de; Klingelmann, Eva [Technische Universitaet Berlin/Berlin Institute of Technology, Department of Ecology, Chair of Soil Protection, Salzufer 12, 10587 Berlin (Germany)], E-mail: eva.klingelmann@TU-Berlin.de; Wiegand, Claudia [Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Department of Inland Fisheries, Biochemical Regulation, Mueggelseedamm 301, 12587 Berlin (Germany); Humboldt University Berlin, Faculty of Biology, Unter den Linden 6, 10099 Berlin (Germany)], E-mail: cwiegand@igb-berlin.de

    2009-01-15

    The bioaccumulation potential of glyphosate and the formulation Roundup Ultra, as well as possible effects on biotransformation and antioxidant enzymes in Lumbriculus variegatus were compared by four days exposure to concentrations between 0.05 and 5 mg L{sup -1} pure glyphosate and its formulation. Bioaccumulation was determined using {sup 14}C labeled glyphosate. The bioaccumulation factor (BCF) varied between 1.4 and 5.9 for the different concentrations, and was higher than estimated from log P{sub ow}. Glyphosate and its surfactant POEA caused elevation of biotransformation enzyme soluble glutathione S-transferase at non-toxic concentrations. Membrane bound glutathione S-transferase activity was significantly elevated in Roundup Ultra exposed worms, compared to treatment with equal glyphosate concentrations, but did not significantly differ from the control. Antioxidant enzyme superoxide dismutase was significantly increased by glyphosate but in particular by Roundup Ultra exposure indicating oxidative stress. The results show that the formulation Roundup Ultra is of more ecotoxicological relevance than the glyphosate itself. - Roundup Ultra is of more ecotoxicological relevance than the active ingredient, glyphosate, to Lumbriculus variegatus regarding accumulation potential and enzymatic responses.

  11. Bioaccumulation of glyphosate and its formulation Roundup Ultra in Lumbriculus variegatus and its effects on biotransformation and antioxidant enzymes

    International Nuclear Information System (INIS)

    The bioaccumulation potential of glyphosate and the formulation Roundup Ultra, as well as possible effects on biotransformation and antioxidant enzymes in Lumbriculus variegatus were compared by four days exposure to concentrations between 0.05 and 5 mg L-1 pure glyphosate and its formulation. Bioaccumulation was determined using 14C labeled glyphosate. The bioaccumulation factor (BCF) varied between 1.4 and 5.9 for the different concentrations, and was higher than estimated from log Pow. Glyphosate and its surfactant POEA caused elevation of biotransformation enzyme soluble glutathione S-transferase at non-toxic concentrations. Membrane bound glutathione S-transferase activity was significantly elevated in Roundup Ultra exposed worms, compared to treatment with equal glyphosate concentrations, but did not significantly differ from the control. Antioxidant enzyme superoxide dismutase was significantly increased by glyphosate but in particular by Roundup Ultra exposure indicating oxidative stress. The results show that the formulation Roundup Ultra is of more ecotoxicological relevance than the glyphosate itself. - Roundup Ultra is of more ecotoxicological relevance than the active ingredient, glyphosate, to Lumbriculus variegatus regarding accumulation potential and enzymatic responses

  12. Sources of aminomethylphosphonic acid (AMPA) in urban and rural catchments in Ontario, Canada: Glyphosate or phosphonates in wastewater?

    International Nuclear Information System (INIS)

    Correlation analysis suggests that occurrences of AMPA in streams of southern Ontario are linked mainly to glyphosate in both urban and rural settings, rather than to wastewater sources, as some previous studies have suggested. For this analysis the artificial sweetener acesulfame was analyzed as a wastewater indicator in surface water samples collected from urban and rural settings in southern Ontario, Canada. This interpretation is supported by the concurrence of seasonal fluctuations of glyphosate and AMPA concentrations. Herbicide applications in larger urban centres and along major transportation corridors appear to be important sources of glyphosate and AMPA in surface water, in addition to uses of this herbicide in rural and mixed use areas. Fluctuations in concentrations of acesulfame and glyphosate residues were found to be related to hydrologic events. - Highlights: • Widespread occurrence of glyphosate and AMPA in surface waters of southern Ontario. • Linked to applications of glyphosate in urban and rural settings. • Supported by lack of correlation between AMPA and the wastewater tracer acesulfame. • Contrasts with view that AMPA found in the environment is derived from wastewater. • AMPA more persistent than glyphosate and both fluctuated with hydrological cycles. - The occurrence of AMPA in streams in southern Ontario is linked mainly to glyphosate rather than wastewater sources

  13. Weed Management and Crop Response with Glyphosate, S-metolachlor, Trifloxysulfuron, Prometryn, and MSMA in Glyphosate-Resistant Cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    Field studies were conducted in five states at six locations from 2002 through 2003 to evaluate weed control and cotton response to EPOST, POST, and LAYBY systems utilizing glyphosate-TM (trimethylsulfonium salt), s-metolachlor, trifloxysulfuron, prometryn, and MSMA. Early-season cotton injury and ...

  14. Effect of vineyard row orientation on growth and phenology of glyphosate-resistant and glyphosate-susceptible horseweed (Conyza canadensis L. Cronq.)

    Science.gov (United States)

    Horseweeds (Conyza canadensis L. Cronq.) have become increasingly common and difficult to control in San Joaquin Valley (SJV) vineyards, due in part, to the evolution of a glyphosate resistant (GR) biotype. The development of weed suppressive vineyard designs in which the trellis design, spacing, an...

  15. Impacto do glyphosate associado com endossulfan e tebuconazole sobre microrganismos endossimbiontes da soja Impact of glyphosate associated with endosulphan and tebuconazole on the endosymbiotic microorganisms of the soybean

    Directory of Open Access Journals (Sweden)

    M.R. Reis

    2010-01-01

    Full Text Available Objetivou-se neste trabalho avaliar o efeito do glyphosate, em aplicação sequencial, e da sua interação com endossulfan + tebuconazole na colonização micorrízica, na nodulação e nos teores de fósforo e nitrogênio foliar em plantas de soja. O experimento foi conduzido a campo em Argissolo Vermelho-Amarelo câmbico, no ano agrícola de 2007/08. Foram avaliados dez tratamentos em em esquema de parcelas subdivididas, no delineamento de blocos casualizados, com quatro repetições. Nas parcelas, avaliou-se o efeito da aplicação ou não da mistura de inseticida (endossulfan + fungicida (tebuconazole e, nas subparcelas, o efeito dos métodos de controle de plantas daninhas (testemunha não capinada, testemunha capinada, aplicação única de glyphosate, aplicação sequencial de glyphosate e aplicação única de fomesafen + fluazifop-p-butil. A matéria seca de nódulos (MSN e da parte aérea (MSPA, o número de nódulos (NN, a colonização micorrízica e os teores de N e P foliar foram avaliados quando as plantas de soja atingiram o estádio R2. O glyphosate e fomesafen + fluazifop-p-butil não reduziram a MSN de plantas de soja, exceto na presença de endossulfan + tebuconazole. O glyphosate em aplicação sequencial, na ausência de endossulfan + tebuconazole, reduziu o NN das plantas de soja em relação às plantas tratadas com inseticida + fungicida. A mistura fomesafen + fluazifop-p-butil e o glyphosate em aplicação sequencial afetaram negativamente os teores de N foliar em relação à testemunha capinada na ausência de endossulfan + tebuconazole, enquanto que na presença dessa mistura não se observou efeito. O glyphosate não afetou a colonização micorrízica em soja tratada ou não com a mistura endossulfan + tebuconazole. Já a mistura de fomesafen + fluazifop-p-butil estimulou a colonização micorrízica na ausência da mistura endossulfan + tebuconazole. O glyphosate, em aplicação sequencial, não afetou a coloniza

  16. Glyphosate distribution in loess soils as a result of dynamic sediment transport processes during a simulated rainstorm

    Science.gov (United States)

    Commelin, Meindert; Martins Bento, Celia; Baartman, Jantiene; Geissen, Violette

    2016-04-01

    Glyphosate is one of the most widely used herbicides in the world. The wide and extensive use of glyphosate makes it important to be certain about the safety of glyphosate to off-target environments and organisms. This research aims to create more detailed insight into the distribution processes of glyphosate, and the effect that dynamic sediment transport processes have on this distribution, during water erosion in agricultural fields. Glyphosate distribution characteristics are investigated for two different soil surfaces: a smooth surface, and a surface with seeding lines on the contour. The capacity to transport glyphosate for different sediment groups was investigated. These groups were water-eroded sediment and sedimentation areas found on the plot surface. The contribution of particle bonded and dissolved transport to total overland transportation of glyphosate was analysed with a mass balance study. The experiment was conducted in the Wageningen UR rainfall simulator. Plots of 0.5m2 were used, with a 5% slope, and a total of six experimental simulations were done. A rainfall event with an intensity of 30mm/h was simulated, applied in four showers of 15 minutes each with 30 minutes pause in between. Glyphosate (16mg/kg) was applied on the top 20cm of each plot, and in the downstream part, soil samples were taken. Glyphosate analysis was done using HPLC-MS/MS (High Performance Liquid Chromatography tandem Mass Spectrometry). Besides that, photo analysis with eCognition was used to derive the soil surface per sediment group. The results show that particle bonded transport of glyphosate contributes significantly (for at least 25%) to glyphosate transport during a rainstorm event. Particle size and organic matter have a large influence on the mobility of glyphosate and on the transported quantity to off-target areas. Moreover, seeding lines on the soil surface decreased total overland transport, both of sediment and glyphosate. Taking this into account, plots

  17. Studies on transfer, bioaccumulation and disappearance of glyphosate in the aquatic ecosystem by utilizing 14C tracer technique

    International Nuclear Information System (INIS)

    Studies on transfer, bioaccumulation and disappearance of glyphosate in the aquatic environment were conducted with methods of model tests and outdoor trials in the aquatic ecosystem. The result showed that glyphosate transferred rapidly into sediment and hormwort (Ceratopyllum demersum L.) after applied; and then, it was taken up faster and accumulated more by topmouth gudgeon (Psudorasobora parva) 5-10 days after application. The partitioning coefficient (sediment-water) and bioconcentration factors of glyphosate were 8.59, 27.96 and 45.79, respectively, in day 20. The concentration of glyphosate residue in the aquatic ecosystem followed the order of topmouth gudgeon > hormwort > sediment > water. And it was also indicated that glyphosate transferred and disappeared extremely fast in both pond and river after application

  18. Treatment of Glyphosate-producing Wastewater%草甘膦废水处理

    Institute of Scientific and Technical Information of China (English)

    柯敏; 李致宝; 许朝芳; 张丽娟; 黄科润; 韦少平

    2016-01-01

    草甘膦生产母液含大量甲醛和CODCr,难处理排放。本文主要讨论了纳滤浓缩回收母液中大部分的草甘膦,然后以生石灰处理纳滤透过液、浓缩液的草甘膦母液处理方法。采用(纳滤回收草甘膦+生石灰)处理废液的工艺可以得到较好的处理效果和草甘膦回收率。%Bstract: The glyphosate mother liquid contained the large amounts of formaldehyde and CODCr,so it was difficult to disintegrate and drain off. The nanofiltration process was applied to recycled most of glyphosate from the glyphosate mother liquid. Then the nanofiltration concentrated solution reacted with calcium oxide. By this (nanofiltration recycling glyphosate + calcium oxide) treatment process, the wastewater treatment effect and the recovery rate of glyphosate got ideal result.

  19. Effects of the herbicide glyphosate on the uptake of 239Pu and 241Am to vegetation

    International Nuclear Information System (INIS)

    Glyphosate (n-phosphonomethyl glycine) is a broad spectrum herbicide widely used in lowland agriculture, forestry and improved upland pastures. Although its metal chelating properties are well established, its interaction with radionuclides remains unknown. A pot experiment was conducted to determine the effect of soil applications of glyphosate on the uptake of 239Pu and 241Am to peas and carrots grown in loam, peat and sand soils. Soil-to-plant transfer factors were calculated for treated and untreated soils at harvest. The most marked effect was an increase in 241Am uptake to crops grown in loam soil. Supplementary laboratory batch experiments were conducted by shaking radiolabelled soil and its associated soil solution with glyphosate. The activity concentration of 241Am increased ten fold in the liquid phase of loam soils treated with glyphosate. It is postulated that this 241Am desorption could have been mediated by the formation of a stable Am-glyphosate complex which was subsequently more available for crop uptake than Am alone. (author)

  20. Genome position and gene amplification

    Czech Academy of Sciences Publication Activity Database

    Jirsová, Pavla; Snijders, A.M.; Kwek, S.; Roydasgupta, R.; Fridlyand, J.; Tokuyasu, T.; Pinkel, D.; Albertson, D. G.

    2007-01-01

    Roč. 8, č. 6 (2007), r120. ISSN 1474-760X Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : gene amplification * array comparative genomic hybridization * oncogene Subject RIV: BO - Biophysics Impact factor: 6.589, year: 2007

  1. The role of L-type amino acid transporters in the uptake of glyphosate across mammalian epithelial tissues.

    Science.gov (United States)

    Xu, Jiaqiang; Li, Gao; Wang, Zhuoyi; Si, Luqin; He, Sijie; Cai, Jialing; Huang, Jiangeng; Donovan, Maureen D

    2016-02-01

    Glyphosate is one of the most commonly used herbicides worldwide due to its broad spectrum of activity and reported low toxicity to humans. Glyphosate has an amino acid-like structure that is highly polar and shows low bioavailability following oral ingestion and low systemic toxicity following intravenous exposures. Spray applications of glyphosate in agricultural or residential settings can result in topical or inhalation exposures to the herbicide. Limited systemic exposure to glyphosate occurs following skin contact, and pulmonary exposure has also been reported to be low. The results of nasal inhalation exposures, however, have not been evaluated. To investigate the mechanisms of glyphosate absorption across epithelial tissues, the permeation of glyphosate across Caco-2 cells, a gastrointestinal epithelium model, was compared with permeation across nasal respiratory and olfactory tissues excised from cows. Saturable glyphosate uptake was seen in all three tissues, indicating the activity of epithelial transporters. The uptake was shown to be ATP and Na(+) independent, and glyphosate permeability could be significantly reduced by the inclusion of competitive amino acids or specific LAT1/LAT2 transporter inhibitors. The pattern of inhibition of glyphosate permeability across Caco-2 and nasal mucosal tissues suggests that LAT1/2 play major roles in the transport of this amino-acid-like herbicide. Enhanced uptake into the epithelial cells at barrier mucosae, including the respiratory and gastrointestinal tracts, may result in more significant local and systemic effects than predicted from glyphosate's passive permeability, and enhanced uptake by the olfactory mucosa may result in further CNS disposition, potentially increasing the risk for brain-related toxicities. PMID:26701683

  2. Creation of glyphosate-resistant Brassica napus L. plants expressing DesC desaturase of cyanobacterium Synechococcus vulcanus

    Directory of Open Access Journals (Sweden)

    Goldenkova-Pavlova I. V.

    2012-12-01

    Full Text Available Aim. Creation of glyphosate-resistant canola plants expressing bifunctional hybrid desC::licBM3 gene. In the hybrid gene the sequence of DesC desaturase of cyanobacterium S. vulcanus without plastid targeting was fused with the sequence of thermostable lichenase reporter LicBM3 gene. Methods. Agrobacterium tumefaciens-mediated transformation, PCR, quantitative and qualitative determination of lichenase activity, genetic analysis. Results. Transgenic canola plants, carring the enolpyruvat shikimat phosphate syntase gene (epsps, conferring on plants resistance to phosphonomethyl glycine herbicides (Roundup, as well as the desC::licBM3 gene, were selected. The presence of transgenes was confimed by multiplex PCR. The epsps gene expression in canola was shown at the transcription level, during in vitro growth and after greenhouse herbicide treatment. Activity of the licBM3 gene product as a part of hybrid protein allowed quantitative and qualitative estimation of the desaturase gene expression. Inheritance of heterologous genes and their expression in the first generation were investigated. Conclusions. Transgenic canola plants were obtained, the presence of trangenes in plant genome was proved and expression of the target genes was detected.

  3. Mendel conference

    CERN Document Server

    2015-01-01

    This book is a collection of selected accepted papers of Mendel conference that has been held in Brno, Czech Republic in June 2015. The book contents three chapters which represent recent advances in soft computing including intelligent image processing and bio-inspired robotics.: Chapter 1: Evolutionary Computing, and Swarm intelligence, Chapter 2: Neural Networks, Self-organization, and Machine Learning, and Chapter3: Intelligent Image Processing, and Bio-inspired Robotics. The Mendel conference was established in 1995, and it carries the name of the scientist and Augustinian priest Gregor J. Mendel who discovered the famous Laws of Heredity. In 2015 we are commemorating 150 years since Mendel's lectures, which he presented in Brno on February and March 1865. The main aim of the conference was to create a periodical possibility for students, academics and researchers to exchange their ideas and novel research methods.  .

  4. Double regenerative amplification of picosecond pulses

    Science.gov (United States)

    Bai, Zhen-ao; Chen, Li-yuan; Bai, Zhen-xu; Chen, Meng; Li, Gang

    2012-04-01

    An double Nd:YAG regenerative amplification picosecond pulse laser is demonstrated under the semiconductor saturable absorption mirror(SESAM) mode-locking technology and regenerative amplification technology, using BBO crystal as PC electro-optic crystal. The laser obtained is 20.71ps pulse width at 10 KHz repetition rate, and the energy power is up to 4W which is much larger than the system without pre-amplification. This result will lay a foundation for the following amplification.

  5. Conference Notification

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Roskill Information Services and Metal Events Ltd areorganizing the 2nd International Rare Earths Conference,which will be held at the Conrad Hotel in Hong Kong onFebruary 28 to March 2 2006.The program is structured tocover all the main aspects of the rare earths industry,including development of Chinese rare earth industry; trendsin rare earths demand; potential constraints on supply;research on potential capacity of rare earths supply chain.Global rare earths consumers will attend the conference.Registra...

  6. Leipzig Conference

    International Nuclear Information System (INIS)

    Showcase for a memorable year of progress in particle physics, the 22nd International Conference on High Energy Physics was held in Leipzig, German Democratic Republic, from 19-25 July. After a busy three days of parallel sessions (four streams), well over a thousand participants gathered in Leipzig's Kongresshalle for the plenary talks. As at the Brighton Conference last year, these began with presentations from the big UA1 and UA2 experiments at CERN's SPS proton-antiproton Collider, still the focus of world attention despite having taken no new data since last year

  7. Ultrasonic Extraction and TLC Determination of Glyphosate in the Spiked Red Soils

    Directory of Open Access Journals (Sweden)

    Sandra Babić

    2005-09-01

    Full Text Available Pesticides that get into soil bind mostly to its solid phase by physical or chemical processes. In the valley of the Neretva River the use of herbicides, especially of glyphosate is widespread and sometimes uncontrolled. In this work ultrasonic solvent extraction (USE followed by thin-layer chromatography (TLC was applied for determining glyphosate presence in soil. The experiments were conducted with two characterised soil types. The impact of soil composition on extraction efficiency is discussed. Chemical analysis showed that soil 1 contained much more iron and aluminium oxides than soil 2, which was richer in humic substances. Low glyphosate efficiency (ca 44 % in both soils could be attributed either to its binding to iron and aluminium oxides (soil 1, or to chemisorption on humic macromolecules (soil 2.

  8. Can Simple Soil Parameters Explain Field-Scale Variations in Glyphosate-, Bromoxyniloctanoate-, Diflufenican-, and Bentazone Mineralization?

    DEFF Research Database (Denmark)

    Norgaard, Trine; De Jonge, L. W.; Møldrup, Per;

    2015-01-01

    major process for the complete degradation of pesticides without generation of metabolites. The aim of our study was to determine field-scale variation in the potential for mineralization of the herbicides glyphosate, bromoxyniloctanoate, diflufenican, and bentazone and to investigate whether this......-radiorespirometric method. Initial mineralization rates were determined using first-order kinetics for glyphosate and bromoxyniloctanoate and zero-order kinetics for diflufenican and bentazone. The mineralization rates of the four pesticides varied between the different pesticides and the different soil samples, but we...... could not establish correlations between the pesticide mineralization rates and the measured soil parameters. Only the glyphosate mineralization rates showed slightly increasing mineralization potentials towards the northern area of the field, with increasing clay and decreasing OC contents. The...

  9. Comprehensive human genome amplification using multiple displacement amplification

    OpenAIRE

    Dean, Frank B.; Hosono, Seiyu; Fang, Linhua; Wu, Xiaohong; Faruqi, A. Fawad; Bray-Ward, Patricia; Zhenyu SUN; Zong, Qiuling; Du, Yuefen; Du, Jing; Driscoll, Mark; Song, Wanmin; Kingsmore, Stephen F.; Egholm, Michael; Lasken, Roger S.

    2002-01-01

    Fundamental to most genetic analysis is availability of genomic DNA of adequate quality and quantity. Because DNA yield from human samples is frequently limiting, much effort has been invested in developing methods for whole genome amplification (WGA) by random or degenerate oligonucleotide-primed PCR. However, existing WGA methods like degenerate oligonucleotide-primed PCR suffer from incomplete coverage and inadequate average DNA size. We describe a method, termed multi...

  10. Deriva simulada de formulações comerciais de glyphosate sobre maracujazeiro amarelo Drift simulation of glyphosate commercial formulations on yellow passion fruit growth

    Directory of Open Access Journals (Sweden)

    A. Wagner Júnior

    2008-01-01

    Full Text Available Objetivou-se com este trabalho avaliar os efeitos da deriva de formulações comerciais de glyphosate no desenvolvimento de plantas jovens de maracujazeiro amarelo. O trabalho foi realizado em casa de vegetação do Departamento de Fitotecnia da Universidade Federal de Viçosa, durante o período de março a abril de 2007. Foi utilizado o delineamento experimental de blocos casualizados, em esquema fatorial 3 x 4 + 1, em que três foram as formulações de glyphosate e cinco foram as doses utilizadas acrescidas de testemunha sem herbicida. O trabalho foi conduzido com cinco repetições, sendo cada planta considerada como parcela experimental. As formulações comerciais aplicadas foram Roundup Transorb®, Roundup Original® e Zapp QI®, utilizando-se as seguintes doses (g e.a ha-1: 43,2; 86,4; 172,8; e 345,6 g ha-1. Aos 28 dias após a aplicação (DAA, avaliaram-se os comprimentos da parte aérea, da raiz e total (cm; o diâmetro do caule (mm; o número de folhas e de ramificações primárias; a massa seca da parte aérea e da raiz das plantas (g; e a área foliar por planta (cm². Aos 7, 14 e 28 DAA, avaliou-se, visualmente, a porcentagem de intoxicação das plantas. O glyphosate em deriva simulada, independentemente das formulações utilizadas, ocasionou injúrias no maracujazeiro amarelo, acarretando redução no crescimento e desenvolvimento das plantas. As formulações Roundup Transorb® e Roundup Original® foram mais prejudiciais às plantas que o Zapp Qi®. O maracujazeiro amarelo mostrou-se suscetível à deriva, devendo o glyphosate ser usado com cuidado, de maneira a atingir somente as plantas daninhas a serem controladas.The aim of this work was to evaluate the effects of drift simulation of commercial formulations of glyphosate on the growth of young plants of yellow passion fruit. The work was carried out at the Plant Science Department of the Universidade Federal de Viçosa (MG, Brazil, from March to April 2007. The

  11. Characterization of glyphosate-resistant goosegrass (Eleusine indica) populations in China

    Institute of Scientific and Technical Information of China (English)

    CHEN Jing-chao; HUANG Hong-juan; WEI Shou-hui; ZHANG Chao-xian; HUANG Zhao-feng

    2015-01-01

    Goosegrass is a worst grass weed in orchards and turf. The increased use of glyphosate for goosegrass control has led to the occurrence of many resistant populations. Although glyphosate has been used to control weeds for the past 30 years in China, few reports are available on glyphosate-resistant (GR) googegrass. In this study, we determined the GR level of 14 goosegrass populations from Chengdu and Guangzhou, China. Glyphosate only control ed 3.1 and 25.0%of the populations SL5 and SL1, respectively, at the dose of 1 680 g acid equivalent (ae) ha–1 at 14 days after treatment (DAT). In contrast, the susceptible population (XD1) was completely (100%) control ed. The resistant index (RI) of SL5 and SL1 were 5.1 and 4.5, and the RI for SL2, SL3 and ZC1 were 4.2, 3.2 and 2.6, respectively. The RI for other populations was range from 1.8 to 2.5. Under the dose of glyphosate at 1 640 g ae ha–1 at 10 DAT, shikimate accumulation in susceptible population XD1 was 17.6 and 16.4 times higher than SL5 and SL1, respectively. And the chlorophyl content in the plant leaf of populations SL1, SL2 and SL5 were decreased slightly ranging from 22.6 to 28.0. These results conifrmed that the SL1, SL2, SL3, ZC1 and SL5 populations had evolved moderate resistance to glyphosate. This is the ifrst report for the GR goosegrass populations conifrmed in Chengdu, China.

  12. Glyphosate input modifies microbial community structure in clear and turbid freshwater systems.

    Science.gov (United States)

    Pizarro, H; Vera, M S; Vinocur, A; Pérez, G; Ferraro, M; Menéndez Helman, R J; Dos Santos Afonso, M

    2016-03-01

    Since it was commercially introduced in 1974, glyphosate has been one of the most commonly used herbicides in agriculture worldwide, and there is growing concern about its adverse effects on the environment. Assuming that glyphosate may increase the organic turbidity of water bodies, we evaluated the effect of a single application of 2.4 ± 0.1 mg l(-1) of glyphosate (technical grade) on freshwater bacterioplankton and phytoplankton (pico, micro, and nanophytoplankton) and on the physical and chemical properties of the water. We used outdoor experimental mesocosms under clear and oligotrophic (phytoplanktonic chlorophyll a = 2.04 μg l(-1); turbidity = 2.0 NTU) and organic turbid and eutrophic (phytoplanktonic chlorophyll a = 50.3 μg l(-1); turbidity = 16.0 NTU) scenarios. Samplings were conducted at the beginning of the experiment and at 1, 8, 19, and 33 days after glyphosate addition. For both typologies, the herbicide affected the abiotic water properties (with a marked increase in total phosphorus), but it did not affect the structure of micro and nanophytoplankton. In clear waters, glyphosate treatment induced a trend toward higher bacteria and picoeukaryotes abundances, while there was a 2 to 2.5-fold increase in picocyanobacteria number. In turbid waters, without picoeukaryotes at the beginning of the experiment, glyphosate decreased bacteria abundance but increased the number of picocyanobacteria, suggesting a direct favorable effect. Moreover, our results show that the impact of the herbicide was observed in microorganisms from both oligo and eutrophic conditions, indicating that the impact would be independent of the trophic status of the water body. PMID:26552793

  13. Disposition and metabolism of glyphosate in the Sprague Dawley rat following oral administration

    International Nuclear Information System (INIS)

    Five groups of male SD rats were administered 14C-labelled glyphosate, (N-[(phosphonomethyl)glycine]) by gavage at a dose level of 10 mg/kg. Animals were killed 2, 6.3, 28, 96 and 168 hours after dosing and the amount of glyphosate-derived material in various organs and excreta were determined. In addition, the metabolic profile in tissues containing > 1% of the administered dose was evaluated. Approximately 93% of the body burden 2 hours after administration was associated with the GI contents and small intestinal tissue. The total body burden 7 days after administration was ∼1% of the dose. Only the kidneys, small intestine, colon, bone, GI contents, residual carcass contained > 1% of the dose 6 hours after administration and the metabolic profiles of these tissues indicated that ∼100% of the body burden was present as unmetabolized parent material. Glyphosate was rapidly eliminated from these tissues with halflives ranging from 20 to 90 hours. A minor metabolite comprising < 0.1% of the dose was detected in the GI contents and colon tissue of 3 animals. Less than 40% of the administered dose was absorbed from the gut and glyphosate was rapidly eliminated from the body with urine and feces being equally important routes of elimination. The whole body halflife was approximately 52 hours. The results from this study indicate that no toxic metabolites of glyphosate were produced, as there was little evidence of metabolism, and essentially 100% of the body burden was parent glyphosate with no significant persistence of accumulated material

  14. Differential susceptibility and resistance to glyphosate in annual ryegrass and wavy-leaved fleabane

    OpenAIRE

    Flávia Regina da Costa; Humberto Henrique Ansolin; Leonardo Bianco Carvalho

    2014-01-01

    Annual ryegrass (Lolium multiflorum) and wavy-leaved fleabane (Conyza bonariensis) were tested, aiming to investigate the dose-response of biotypes of both species to glyphosate. Glyphosate herbicide at doses varying from 0 up to 1.440 g e.a. ha-1 was sprayed onto annual ryegrass plants showed four leaves and wavy-leaved fleabane showed three pair of leaves. The fresh weight of shoot was obtained at 21 days after herbicide application. The response of biotypes of L. multiflorum and C. bonarie...

  15. Coca and poppy eradication in Colombia: environmental and human health assessment of aerially applied glyphosate.

    Science.gov (United States)

    Solomon, Keith R; Anadón, Arturo; Carrasquilla, Gabriel; Cerdeira, Antonio L; Marshall, Jon; Sanin, Luz-Helena

    2007-01-01

    The production of coca and poppy as well as the processing and production of cocaine and heroin involve significant environmental impacts. Both coca and poppy are grown intensively in a process that involves the clearing of land in remote areas, the planting of the crop, and protection against pests such as weeds, insects, and pathogens. The aerial spray program to control coca and poppy production in Colombia with the herbicide glyphosate is conducted with modern state-of-the-art aircraft and spray equipment. As a result of the use of best available spray and navigation technology, the likelihood of accidental off-target spraying is small and is estimated to be less than 1% of the total area sprayed. Estimated exposures in humans resulting from direct overspray, contact with treated foliage after reentry to fields, inhalation, diet, and drinking water were small and infrequent. Analyses of surface waters in five watersheds showed that, on most occasions, glyphosate was not present at measurable concentrations; only two samples had residues just above the method detection limit of 25 microg/L. Concentrations of glyphosate in air were predicted to be very small because of negligible volatility. Glyphosate in soils that are directly sprayed will be tightly bound and biologically unavailable and have no residual activity. Concentrations of glyphosate plus Cosmo-Flux will be relatively large in shallow surface waters that are directly oversprayed (maximum instantaneous concentration of 1,229microgAE/L in water 30cm deep); however, no information was available on the number of fields in close proximity to surface waters, and thus it was not possible to estimate the likelihood of such contamination. The formulation used in Colombia, a mixture of glyphosate and Cosmo-Flux, has low toxicity to mammals by all routes of exposure, although some temporary eye irritation may occur. Published epidemiological studies have not suggested a strong or consistent linkage between

  16. Lethal and Sublethal Effects of Glyphosate (Roundup® Active) to Embryos of Colombian Anurans

    OpenAIRE

    Teófila María Triana Velásquez; Claudia Montes Rojas; Manuel Hernando Bernal Bautista

    2013-01-01

    Glyphosate is an herbicide widely used in agriculture, which may affect non-target species. The aim of this study was to determine the lethal (Median lethal concentration - LC50) and sublethal effects (changes on body size and development) of glyphosate (Roundup® Active) to embryos of four anuran species, exposed during 96 hours under laboratory and microcosm tests. Under laboratory conditions, Engystomops pustulosus was the most tolerant species (LC50 = 3033,18 μg a.e./L) and Rhinella marina...

  17. Controle de plantas daninhas na cultura de soja resistente ao glyphosate

    Directory of Open Access Journals (Sweden)

    Núbia Maria Correia

    2010-01-01

    Full Text Available O objetivo da pesquisa foi avaliar o controle de plantas daninhas em área cultivada com soja resistente ao herbicida glyphosate, sem a utilização de práticas complementares de manejo de plantas daninhas. Foram desenvolvidos experimentos, em condições de campo, nos anos agrícolas 2005/2006 e 2006/2007 em Jaboticabal (SP. Foram avaliadas duas cultivares de soja resistentes ao glyphosate (CD 214 RR e M-SOY 8008 RR, oito tratamentos de herbicidas (glyphosate, em aplicação única, nas doses de 0,48; 0,72; 0,96 e 1,20 kg ha-1 de equivalente ácido, associadas ou não a aplicação sequencial na dose de 0,48 kg ha-1, além de duas testemunhas, uma capinada e outra mantida infestada. As cultivares de soja influenciaram na infestação das espécies de plantas daninhas na área. Sem a aplicação de glyphosate, houve o predomínio de X. strumarium na área, desfavorecendo a ocorrência de outras espécies. Quando utilizado glyphosate, independentemente da dose, a infestação contabilizada aos 35 e 40 dias após a primeira aplicação, no primeiro e segundo ano, respectivamente, foi baixa. O controle de plantas daninhas na cultura da soja transgênica é diretamente influenciado pela dose de glyphosate, havendo controle satisfatório com a aplicação única de 0,96 kg ha-1 ou a sequencial de 0,48 + 0,48 kg ha-1 de glyphosate. Em situação de menor infestação (2006/2007, a aplicação única de 0,48 kg ha-1 de glyphosate é suficiente para o controle das plantas daninhas. As cultivares de soja transgênica CD 214 RR e M-SOY 8008 RR influenciam diferencialmente a dinâmica das espécies de plantas daninhas, sendo o controle químico mais efetivo na situação de cultivo de M-SOY 8008 RR, em que houve menor diversidade e desenvolvimento das plantas daninhas.

  18. Consensus conferences

    DEFF Research Database (Denmark)

    Nielsen, Annika Porsborg; Lassen, Jesper

    , the differing perceptions are each in their own way rooted in an argument for democratic legitimacy. We therefore argue that national interpretations of consensus conferences, and of their ability to functions as a tool for public participation, depend to a great extent on the dominant ideals of...... democratic legitimacy embedded in national political cultures....

  19. Conference Hopes

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Annual conference outlines tasks for 2010 to solidify China’s economic recovery through rational investment and increasing consumptionc hina will adhere to a consistent and stable economic strategy, putting in place a proactive fiscal policy and an accommodative monetary policy for the 2010 fiscal year-the macro-economic course mapped out during China’s Central

  20. Conference summaries

    International Nuclear Information System (INIS)

    The papers presented at this conference cover the fields of thermalhydraulics, nuclear plant design and operation, licensing, decontamination, restoration and dismantling of nuclear power facilities, services to the nuclear industry, new applications of nuclear technology, reactor physics and fuel cycles, accelerator-breeders, fusion research and lasers

  1. Occurrence of glyphosate in water bodies derived from intensive agriculture in a tropical region of southern Mexico.

    Science.gov (United States)

    Ruiz-Toledo, Jovani; Castro, Ricardo; Rivero-Pérez, Norma; Bello-Mendoza, Ricardo; Sánchez, Daniel

    2014-09-01

    Glyphosate is an agrochemical widely used to control weeds. However, glyphosate spreads to water bodies by spray-drift, run-off and leaching, potentially causing detrimental effects on non-target biota. There is no information on the occurrence of this herbicide in water bodies near crop fields in Mexico, although it is the most commonly used pesticide in this country. To fill this gap, we quantified glyphosate in water bodies from twenty-three locations, including natural protected areas and agricultural areas in southern Mexico, during the dry and the rainy seasons. We expected (1) higher concentrations during the dry season due to reduced dilution by precipitation and, (2) absence of glyphosate in the protected areas. In agreement with our expectation, concentration of glyphosate was higher during the dry season (up to 36.7 μg/L). Nonetheless, glyphosate was detected in all samples-including natural protected areas. These results emphasize the need for an evaluation of the impact of glyphosate on native species as well as regulate its use. PMID:25011503

  2. Influence of glyphosate and its formulation (Roundup[reg]) on the toxicity and bioavailability of metals to Ceriodaphnia dubia

    International Nuclear Information System (INIS)

    This study examined the toxicological interaction between glyphosate (or its formulation, Roundup[reg]) and several heavy metals to a freshwater cladoceran, Ceriodaphnia dubia. We demonstrated that all binary combinations of Roundup[reg] and metals (Cd, Cu, Cr, Ni, Pb, Se and Zn) exhibited 'less than additive' mixture toxicity, with 48-h LC50 toxic unit>1. Addition of glyphosate alone could significantly reduce the acute toxicity of Ag, Cd, Cr, Cu, Ni, Pb and Zn (but not Hg and Se). The ratio between glyphosate and metal ions was important in determining the mitigation of metal toxicity by glyphosate. A bioaccumulation study showed that in the presence of glyphosate the uptake of some metals (e.g. Ag) was halted but that of others (e.g. Hg) was increased significantly. Therefore, our study strongly suggests that glyphosate and its commercial formulations can control the toxicity as well as the bioavailability of heavy metals in aquatic ecosystems where both groups of chemicals can co-occur. - Glyphosate can control the toxicity and bioavailability of many heavy metals in the aquatic environment

  3. Seletividade de glyphosate isolado ou em misturas para soja RR em aplicações sequenciais Selectivity of glyphosate alone or in mixtures for RR soybean in sequential applications

    OpenAIRE

    D.G Alonso; J. Constantin; R.S. Oliveira Jr.; Santos, G.; H.A Dan; A.M Oliveira Neto

    2013-01-01

    O uso de misturas de herbicidas latifolicidas com o glyphosate tem sido uma alternativa para o controle de plantas daninhas resistentes ao glyphosate ou de difícil controle nos cultivos de soja RR. Este trabalho teve o objetivo de avaliar a seletividade de aplicações sequenciais de glyphosate, isolado ou em mistura com latifolicidas, para a soja RR. As aplicações dos tratamentos foram feitas em plantas de soja cultivar CD214 RR nos estádios de desenvolvimento V1 a V2 e V3 a V4. Os herbicidas ...

  4. Glyphosate translocation in hairy fleabane (Conyza bonariensis biotypes Translocação do glyphosate em biótipos de buva (Conyza bonariensis

    Directory of Open Access Journals (Sweden)

    E.A. Ferreira

    2008-01-01

    Full Text Available The objective of this work was to evaluate the translocation of glyphosate in C. bonariensis plants resistant and susceptible to that herbicide. The 14C-glyphosate was mixed with commercial gyhphosate (800 g ha-1 and applied on the center of the adaxial face of a third node leaf, using a micro syringe, and adding 10 µL of a solution with specific activity of 1,400 Bq, 45 days after plant emergence. The concentration of the glyphosate translocated in the plant was evaluated at time intervals of 6, 12, 36 and 72 hours after being applied on the application leaf, stem, roots and leaves. Ten hours after treatment application, the distribution of the product in the application leaf, divided into base, center and apex, was also evaluated by measuring the radiation emitted by 14C-glyphosate in a liquid scintillation spectrometer. Greater glyphosate retention was observed in the resistant biotype leaf, approximately 90% of the total absorbed up to 72 hours. In the susceptible biotype, this value was close to 70% in the same period. Susceptible biotype leaves, stem and roots showed greater concentration of glyphosate, indicating greater translocation efficiency in this biotype. In the resistant biotype, the herbicide accumulated in greater quantity at the apex and center of the application leaf, while in the susceptible biotype greater accumulation was observed at the base and center leaf. Thus, it can be stated that the resistance mechanism is related to the differential translocation of this herbicide in the biotypes.Objetivou-se com este trabalho avaliar a translocação do glyphosate em plantas de C. bonariensis resistentes e suscetíveis a esse herbicida. Para isso aplicou-se o 14C-glyphosate em mistura com glyphosate comercial (800 g ha-1 sobre o centro da face adaxial da folha do terceiro nó, utilizando-se uma microsseringa, adicionando-se 10 µL da calda com atividade específica de 1.400 Bq, aos 45 dias após a emergência da buva. A concentra

  5. Depth distribution of glyphosate and AMPA under diferent tillage system and soils in long-term experiments

    Science.gov (United States)

    Aparicio, Virginia; Costa, Jose Luis; De Geronimo, Eduardo

    2016-04-01

    Glyphosate (N-(phosphonomethyl glycine) is a post-emergence, non-selective, foliar herbicide. Around 200 million liters of this herbicide are applied every year in Argentina, where the main agricultural practice is no-till (NT), accounting for 78 % of the cultivated land. In this work, we studied the depth distribution of glyphosate in long-term experiments (more than 15 years) at different locations under NT and conventional tillage (CT). Samples from 0-2, 2-5, 5-10, 10-15, and 15-20 cm depth with four replication and two treatments NT CT at three locations: Balcarce (BA) a loam soil, Bordenave (BO) a sandy loam soil y Marcos Juarez a silty loam soil (MJ). The glyphosate concentration in the first 2 cm of soil was, on the average, 70% greater than in the next 2-5 cm. The mass of glyphosate in CT was higher at 2 to 10 cm depth. The depth concentration of AMPA follows the same trend than glyphosate, although its average concentration at 0-2 cm depth is 28 times higher than the glyphosate concentration at 2-5 cm (glyphosate = 147 ppb and AMPA = 4100 ppb). Beside the AMPA concentration at 0-2 cm depth is greater in NT than in CT, the mass of AMPA is higher in CT only for the Balcarce location. To our knowledge, this study is the first dealing with the depth distribution of glyphosate concentration in soils under different soil managements. In the present study, it was demonstrated that glyphosate and AMPA are present in soils under agricultural activity with maximum concentration in the first two cm of soil and the AMPA concentration at this depth is greater in NT than in CT.

  6. Factors affecting the fate and transport of glyphosate and AMPA into surface waters of agricultural watersheds in the United States and Europe

    Science.gov (United States)

    Coupe, R.; Kalkhoff, S.; Capel, P.; Gregoire, C.

    2012-04-01

    Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used extensively in almost all agricultural and urban areas of the United States and Europe. Although, glyphosate is used widely throughout the world in the production of many crops, it is predominately used in the United States on soybeans, corn, potatoes, and cotton that have been genetically modified to be tolerant to glyphosate. From 1992 to 2007, the agricultural use of glyphosate has increased from less than 10,000 Mg to more than 80,000 Mg, respectively. The greatest areal use is in the midwestern United States where glyphosate is applied on transgenic corn and soybeans. Because of the difficulty and expense in analyzing for glyphosate and AMPA (aminomethylphosphonic acid, a primary glyphosate degradate) in water, there have been only small scale studies on the fate and transport of glyphosate. The characterization of the transport of glyphosate and AMPA on a watershed scale is lacking. Glyphosate and AMPA were frequently detected in the surface waters of 4 agricultural watersheds in studies conducted by the U.S. Geological Survey in the United States and at the Laboratory of Hydrology and Geochemistry of Strasbourg. Two of these basins were located in the midwestern United States where the major crops are corn and soybean, the third is located the lower Mississippi River Basin where the major crops are soybean, corn, rice, and cotton, and the fourth was located near Strasbourg, France where the use of glyphosate was on a vineyard. The load as a percent of use ranged from 0.009 to 0.86 percent and could be related to 3 factors: source strength, hydrology, and flowpath. Glyphosate use in a watershed results in some occurrence in surface water at the part per billion level; however, those watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff, and a flowpath that does not include transport through the soil.

  7. Fenologia da trapoeraba como indicador para tolerância ao herbicida glyphosate Phenology of bengal dayflower as indicator of glyphosate tolerance

    Directory of Open Access Journals (Sweden)

    A.C.R Dias

    2013-03-01

    Full Text Available Rotineiramente, tem sido desconsiderada a contribuição do estádio de desenvolvimento das espécies de plantas daninhas nas análises de tolerância ou resistência a herbicidas, o que pode resultar em divergências entre a pesquisa teórica e a aplicação prática dos dados. Nesse sentido, este trabalho foi desenvolvido com o objetivo de avaliar a resposta biológica da trapoeraba (Commelina benghalensis, comparativamente ao capim-marmelada (Brachiaria plantaginea, a aplicações de doses do herbicida glyphosate, em seis estádios fenológicos. Dois experimentos foram desenvolvidos em casa de vegetação, submetendo-se plantas de trapoeraba e capim-marmelada ao esquema fatorial de tratamentos 9 x 6, em que nove foram as doses de glyphosate e seis foram os estádios fenológicos das plantas daninhas, variáveis entre a emissão da primeira folha definitiva e o início do florescimento. Por meio do emprego de curvas de dose-resposta e de regressões polinomiais, concluiu-se que o estádio de desenvolvimento da trapoeraba contribui significativamente para o grau de tolerância da espécie ao herbicida glyphosate, de modo que, comparativamente ao capim-marmelada, plantas de trapoeraba tornam-se quatro vezes mais tolerantes ao glyphosate a cada dez unidades de desenvolvimento fenológico na escala BBCH. Essas considerações possuem importante aplicabilidade prática, justificando medidas de controle químico em estádios iniciais do crescimento da trapoeraba.The importance of the phenological development of weeds has been frequently ignored when analyzing plant-herbicide tolerance or resistance, what may result on divergences between theoretical research and practical data application. Thus, this work was carried out to evaluate the biological response of Bengal dayflower (Commelina benghalensis, comparatively to alexandergrass (Brachiaria plantaginea, to the application of different rates of glyphosate, at six phenological stages. Two

  8. Resposta de varjão (Parkia multijuga a subdoses de glyphosate Response of varjão (Parkia multijuga seedlings to reduced glyphosate rates

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2006-09-01

    Full Text Available O consumo de madeira no Brasil e no mundo apresenta demanda crescente. Em confronto com a pressão ambientalista de manutenção das florestas nativas, há necessidade de se estabelecerem áreas de reflorestamento para suprir o aumento da demanda de madeira, com a utilização de formas de manejo e tratos culturais que permitam o pleno crescimento das essências florestais. Um dos principais problemas do manejo de reflorestamento é a interferência das plantas daninhas após o plantio das mudas no campo, sendo o uso de herbicidas a principal forma de manejo. Este trabalho teve o objetivo de avaliar a eficiência de doses crescentes de glyphosate em mudas de varjão em condições de ambiente protegido. Foram avaliadas as doses de 0, 90, 180, 360 e 720 g ha-1 de glyphosate em plantas com quatro meses de idade, observando a intoxicação das plantas, altura, diâmetro do caule e número de folhas. O varjão, nas condições do experimento, apresentou tolerância e recuperação ao glyphosate até a dose de 360 g ha-1. Doses superiores a esta retardaram o crescimento da planta. O prejuízo causado pela deriva de glyphosate nessas plantas foi diretamente proporcional ao aumento da dose. Os sintomas evoluíram para queda de folhas, comprometendo o crescimento das plantas.Wood consumption has significantly increased in Brazil and worldwide.The environmental pressure to preserve native forest led to the need to establish reforestation areas to meet the increasing wood demand by applying cultural practices and management allowing a total growth of forest trees. One of the main problems in reforestation management is weed competition after seedling planting, with herbicide use being the main form of management. The objective of this work was to evaluate the phytotoxic effect of increasing rates of glyphosate on Varjão seedlings, under greenhouse conditions. Concentrations of 90, 180, 360 and 720 g ha-1 of glyphosate were evaluated in four

  9. SIGEF Conference

    CERN Document Server

    Terceño-Gómez, Antonio; Ferrer-Comalat, Joan; Merigó-Lindahl, José; Linares-Mustarós, Salvador

    2015-01-01

    This book is a collection of selected papers presented at the SIGEF conference, held at the Faculty of Economics and Business of the University of Girona (Spain), 06-08 July, 2015. This edition of the conference has been presented with the slogan “Scientific methods for the treatment of uncertainty in social sciences”. There are different ways for dealing with uncertainty in management. The book focuses on soft computing theories and their role in assessing uncertainty in a complex world. It gives a comprehensive overview of quantitative management topics and discusses some of the most recent developments in all the areas of business and management in soft computing including Decision Making, Expert Systems and Forgotten Effects Theory, Forecasting Models, Fuzzy Logic and Fuzzy Sets, Modelling and Simulation Techniques, Neural Networks and Genetic Algorithms and Optimization and Control. The book might be of great interest for anyone working in the area of management and business economics and might be es...

  10. Conference summaries

    International Nuclear Information System (INIS)

    This volume contains summaries of 28 papers presented at the 27. conference of the Canadian Nuclear Association. These papers discuss the general situation of the Canadian nuclear industry and the CANDU reactor; dialogue with the public; the International Atomic Energy Agency; and economic goals and operating lessons. It also contains summaries of 70 papers presented at the 8. conference of the Canadian Nuclear Society, which discuss plant life extension; safety and the environment; reactor physics; thermalhydraulics; risk assessment; the CANDU spacer location and repositioning project; CANDU operations; safety research after Chernobyl; fuel channels; and nuclear technology developments. The individual papers are also available in INIS-mf--13673 (CNA), and INIS-mf--12909 (CNS). (L.L.)

  11. Conference information

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    @@ Thermag Ⅳ- The 4th International Conference on Magnetic Refrigeration at Room Temperature of IIR Refrigeration technology is widely used today. However, traditional vapor compression/expansion refrigeration technology has some disadvantages, such as low conversion efficiency of vapor compressor, and emission of the ozonosphere depletion gas and greenhouse effect gas, etc. Magnetic refrigeration is a new cooling technology with huge potential application prospect, characterized by high efficiency, energy saving and environmental friendly.

  12. Eficiência de glyphosate no controle de Commelina benghalensis e Commelina diffusa Efficiency of glyphosate in the control of Commelina benghalensis and Commelina diffusa

    Directory of Open Access Journals (Sweden)

    I.C. Santos

    2001-04-01

    Full Text Available A planta daninha trapoeraba (Commelina spp. possui grande capacidade de sobreviver em ambientes diversificados, o que dificulta o seu controle. Em cafezais da Zona da Mata de Minas Gerais, onde o herbicida glyphosate é aplicado repetidamente, as espécies Commelina benghalensis e C. diffusa têm apresentado tolerância a este herbicida. Para confirmar esse fato e verificar o efeito de doses crescentes de glyphosate (720, 1.440, 2.160, 2.880 e 3.600 g i.a. ha-1 no controle dessas duas espécies de plantas daninhas, instalou-se um experimento no delineamento experimental de blocos casualizados, com seis repetições. As doses do herbicida foram aplicadas no período de florescimento de plantas de trapoeraba cultivadas em caixas de polietileno com dimensões de 10 cm de altura, 27,5 cm de largura e 39,5 cm de comprimento, em ambiente desprotegido. A eficácia dos tratamentos foi avaliada por meio da porcentagem de controle em relação à testemunha e da biomassa seca da parte aérea que sobreviveu aos tratamentos. C. benghalensis foi eficientemente controlada pelo glyphosate, mas C. diffusa apresentou tolerância. Para C. benghalensis o controle foi acima de 94% a partir da menor dose, 25 dias após tratamento (DAT e de 100% em todas as doses aos 63 DAT. Para C. diffusa, em geral, quanto maior a dose de glyphosate, menor a biomassa seca da parte aérea. Entretanto, mesmo nas três maiores doses, nas quais se observou, aos 46 DAT, até 98,3% de controle, constatou-se regeneração de plantas aos 88 DAT. Nas condições do experimento, o glyphosate proporcionou excelente controle de C. benghalensis a partir de 720 g i.a. ha-1, 25 DAT. Contudo, excelente controle de C. diffusa por mais de 60 dias só foi obtido a partir de 2.880 g i.a. ha-1 de glyphosate.The weed dayflower, Commelina spp., can survive in a great diversity of environments, what makes its control difficult. In coffee plantations of the Zona da Mata, Minas Gerais - Brazil, glyphosate

  13. Assessment of soybean injury from glyphosate using airborne multispectral remote sensing

    Science.gov (United States)

    BACKGROUND: Glyphosate drift onto off-target sensitive crops can reduce growth and yield, and is of great concern to growers and pesticide applicators. Detection of herbicide injury using biological responses is tedious, so more convenient and rapid detection methods are needed. The objective of thi...

  14. Determination of differences in crop injury from aerial application of glyphosate using vegetation indices and geostatistics

    Science.gov (United States)

    Injury to crops caused by off-target drift of glyphosate can seriously reduce growth and yield, and is of great concern to farmers and aerial applicators. Determining an indirect method for assessing the levels and extent of crop injury could support management decisions. The objectives of this stud...

  15. STUDY OF CHRONIC TOXICITY OF THE GLYPHOSATE HERBICIDE IN SEEDS OF CORN,

    Directory of Open Access Journals (Sweden)

    Ana Cláudia Rebessi

    2011-07-01

    Full Text Available Glyphosate is an agrochemical from the group of phosphonates, which is widely used as a herbicide. Although it kills almost any plant, it can be used to eliminate weeds during the growth of crops that are resistant to glyphosate. This research aimed to evaluate the toxicological effects of the herbicide in a study using as test organism seeds of maize (Zea mays, okra (Abelmoschus esculentus (L. Moench and arugula (Eruca sativa. The toxicological testing was to use a paper towel dampened with a sample of glyphosate and twenty seeds evenly distributed in containers with lids, left in a dry and airy place, and watered once a day for 5 days. It was possible to check the toxic effect of glyphosate for corn seeds at concentrations above 90 mg.L-1, for okra seeds at concentrations above 75 mg L-1 and arugula seeds in concentrations above 2 mg L - 1. Thus it was concluded that the seeds studied showed a high sensitivity with the possibility to be applied in toxicity testing, representing a simple and low cost.

  16. EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

    Science.gov (United States)

    Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

    2016-01-01

    Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance. PMID:27525929

  17. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    Directory of Open Access Journals (Sweden)

    Cristiane Fortes Gris

    2013-04-01

    Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.

  18. An Efficient Synthesis of Tertiaryaminomethylphosphonates, A Versatile Precursor for Synthesis of Glyphosate and α-Aminomethylphosphonates

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Reaction of simple dialkyl phosphites with symmetrical 1,3,5-trisubstituted hexahydro- triazines (HHTs) in the presence of benzyl chloride, afforded tertiaryaminomethylphosphonates in excellent yields. Glyphosate, α-aminomethylphosphonates and their derivatives can therefore be synthesized by this procedure conveniently.

  19. Introduction. Glyphosate Interactions with Physiology, Nutrition, and Diseases of Plants: Threat to Sustainability

    Science.gov (United States)

    One of the most significant inputs necessary for successful conventional crop production is synthetic chemical herbicides to control a wide variety of weed infestations. Glyphosate, the active ingredient in the herbicide, “Roundup”, became very popular after introduction in the 1970’s for non-select...

  20. Bioherbicidal effects of Myrothecium verrucaria on Glyphosate-resistant and -susceptible Palmer amaranth biotypes

    Science.gov (United States)

    Bioherbicidal effects of the fungus Myrothecium verrucaria (MV) on glyphosate-resistant and -susceptible Palmer amaranth were examined on whole plants and in leaf bioassays of young and mature plants. Leaf bioassays using mycelia from the fermentation product of MV indicated that excised leaves of ...

  1. Ground-based spectral reflectance measurements for efficacy evaluation of aerially applied glyphosate treatments

    Science.gov (United States)

    Aerial application of herbicides is a common tool in agricultural field management. The objective of this study was to evaluate the efficacy of glyphosate herbicide applied aerially with both conventional and emerging aerial nozzle technologies. A Texas A&M University Plantation weed field was set u...

  2. Analysis of glyphosate and aminomethylphosphonic acid in water, plant materials and soil.

    Science.gov (United States)

    Koskinen, William C; Marek, LeEtta J; Hall, Kathleen E

    2016-03-01

    There is a need for simple, fast, efficient and sensitive methods of analysis for glyphosate and its degradate aminomethylphosphonic acid (AMPA) in diverse matrices such as water, plant materials and soil to facilitate environmental research needed to address the continuing concerns related to increasing glyphosate use. A variety of water-based solutions have been used to extract the chemicals from different matrices. Many methods require extensive sample preparation, including derivatization and clean-up, prior to analysis by a variety of detection techniques. This review summarizes methods used during the past 15 years for analysis of glyphosate and AMPA in water, plant materials and soil. The simplest methods use aqueous extraction of glyphosate and AMPA from plant materials and soil, no derivatization, solid-phase extraction (SPE) columns for clean-up, guard columns for separation and confirmation of the analytes by mass spectrometry and quantitation using isotope-labeled internal standards. They have levels of detection (LODs) below the regulatory limits in North America. These methods are discussed in more detail in the review. © 2015 Society of Chemical Industry. PMID:26454260

  3. Field application of glyphosate induces molecular changes affecting vegetative growth processes in leafy spurge

    Science.gov (United States)

    Recommended rates of glyphosate for non-cultivated areas destroy the aboveground shoots of the perennial plant leafy spurge. However, such applications cause little or no damage to underground adventitious buds (UABs), and thus the plant readily regenerates vegetatively. High concentrations of glyph...

  4. Effects of Glyphosate Ripener Timing and Rate on Cane and Sugar Yields

    Science.gov (United States)

    The Louisiana sugarcane industry is dependent on the use of glyphosate ripener applications to increase sucrose levels. Initially these applications began in late-August and were limited to the second-ratoon crop harvested at the start of the growing season. Currently, applications have been exten...

  5. Response of Pennsylvania native plant species, corn and soybean to tank mixes of dicamba and glyphosate

    Science.gov (United States)

    Crops such as soybean are being genetically modified to be tolerant to multiple herbicides, such as dicamba and glyphosate, in order to allow treatment with several herbicides to control the development of herbicide resistance in weeds. However, with increased use of multiple-he...

  6. Effects of increasing use of trifluralin and glyphosate on the microbial activity of a lea soil

    International Nuclear Information System (INIS)

    This work considers the importance of the glyphosate and trifluralin, which are the most used herbicides by the brazilian plantations, applying approximately fifteen and nine millions of liters by crop, respectively, for the evaluation of the increasing use of these herbicides effects on the microbial activity of a lea soil which are used for beans cultivation

  7. Ab initio computational studies on molecular conformation of N-methyl-glyphosate

    Science.gov (United States)

    Kaliannan, P.; Naseer Ali, M. Mohamed; Venuvanalingam, P.

    Conformational analysis of N-methyl-glyphosate has been carried out using an ab initio molecular orbital (MO) method at the HF/3-21G* levels of theory and the results are compared with the results of a previously studied compound, namely glyphosate. The potential energy surface of the molecule obtained by varying the central torsion angles (Φ, Ψ) was investigated in detail. Fourteen conformers with 5 kcal mol-1 energy cut-off have been selected from the potential energy surface for geometry optimization to locate the true minimum on the conformational space. The minimum has been found to be at (-62°, 110°) for the central torsion angles. This conformation is stabilized by hydrogen bond interactions (O-H···O and C-H···O) and the interactions due to protons nearer to each other. This cationic field leads to the formation of a hydrophobic patch in this structure, as well as in the structures closer to the global minimum. This patch may destabilize the favourable interaction of N-methyl-glyphosate with the surrounding amino acid residues in the binding cavity as they form the cationic field throughout the glyphosate binding region.

  8. Manejo de Conyza bonariensis resistente ao glyphosate: coberturas de inverno e herbicidas em pré-semeadura da soja Management of glyphosate resistant Conyza bonariensis: winter cover crops and herbicides in soybean pre-seeding

    Directory of Open Access Journals (Sweden)

    F.P. Lamego

    2013-06-01

    Full Text Available Conyza bonariensis tornou-se a principal planta daninha da cultura da soja no Sul do Brasil, em decorrência da evolução para resistência ao herbicida glyphosate. O objetivo deste trabalho foi avaliar o efeito de diferentes coberturas de inverno e da associação de manejo de dessecação pré-semeadura da soja, visando ao controle de C. bonariensis resistente ao glyphosate. Um experimento foi conduzido em campo, na safra 2010/2011. Os tratamentos foram conduzidos em esquema de parcelas subdivididas, em que as coberturas de inverno foram alocadas nas parcelas principais: aveia-preta, nabo, ervilhaca, azevém, trigo e pousio. Nas subparcelas, foram alocados os tratamentos de manejo de dessecação pré-semeadura da soja: glyphosate (720 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha‑1 e roçada. O nabo foi a espécie de cobertura que produziu o maior volume de massa seca durante o inverno, enquanto a ervilhaca foi a que apresentou maior efeito supressor sobre a germinação e o desenvolvimento inicial de C. bonariensis. Associações de glyphosate com 2,4-D ou chlorimuron-ethyl, seguidas da aplicação sequencial de paraquat + diuron, causaram maior redução na infestação de C. bonariensis.Conyza bonariensis became the main weed in soybean crop in Southern Brazil, as a consequence of the evolution of resistance to the herbicide glyphosate. The objective of this work was to evaluate the effect of different winter cover crops and the association of burn-down herbicides on the control of glyphosate-resistant C. bonariensis. A field experiment was conducted in the 2010/2011 season. The treatments were arranged in a split-plot scheme, with the winter

  9. Suscetibilidade de duas Gramas-boiadeiras a diferentes formulações de glyphosate

    Directory of Open Access Journals (Sweden)

    Ananda Scherner

    2014-03-01

    Full Text Available A utilização do herbicida glyphosate para o controle químico das espécies de gramas-boiadeiras nas lavouras orizícolas não tem se mostrado eficiente. Nesse contexto, a investigação do controle dessas espécies com o glyphosate torna-se de fundamental importância, uma vez que não estão disponíveis no mercado herbicidas seletivos para o controle dessas em pós-emergência na cultura do arroz irrigado. Em vista do exposto, o objetivo do presente estudo foi avaliar a suscetibilidade das gramas-boiadeiras a diferentes formulações de glyphosate. Foram conduzidos dois experimentos em casa de vegetação em esquema fatorial. No primeiro experimento, o fator A constituiu-se de duas formulações de glyphosate (sal potássico e isopropilamina e o fator B de nove doses dos herbicidas (zero; 175; 350; 700; 1400; 2800; 5600; 11200; 22400g e.a. ha-1. No segundo experimento, o fator A constituiu-se de duas espécies de gramas-boiadeiras (Leersia hexandra e Luziola peruviana, o fator B de três formulações do glyphosate (sal amônio, potássico e isopropilamina e o fator C de nove doses dos herbicidas (zero; 87,5; 175; 350; 700; 1400; 2800; 5600; 11200g e.a. ha-1. Com base nos resultados obtidos, foi possível observar que as espécies apresentaram diferença de suscetibilidade ao herbicida glyphosate. Além disso, Leersia hexandra foi mais sensível em comparação a Luziola peruviana. As formulações de glyphosate influenciaram na suscetibilidade das espécies ao controle, sendo que, Roundup Transorb R® e Roundup Ultra® proporcionam melhor controle das espécies de gramas-boiadeiras.

  10. Heralded amplification of photonic qubits.

    Science.gov (United States)

    Bruno, Natalia; Pini, Vittorio; Martin, Anthony; Verma, Varun B; Nam, Sae Woo; Mirin, Richard; Lita, Adriana; Marsili, Francesco; Korzh, Boris; Bussières, Félix; Sangouard, Nicolas; Zbinden, Hugo; Gisin, Nicolas; Thew, Rob

    2016-01-11

    We demonstrate postselection free heralded qubit amplification for Time-Bin qubits and single photon states in an all-fibre, telecom-wavelength, scheme that highlights the simplicity, stability and potential for fully integrated photonic solutions. Exploiting high-efficiency superconducting detectors, the gain, fidelity and the performance of the amplifier are studied as a function of loss. We also demonstrate the first heralded single photon amplifier with independent sources. This provides a significant advance towards demonstrating device-independent quantum key distribution as well as fundamental tests of quantum mechanics over extended distances. PMID:26832244

  11. Resonant primordial gravitational waves amplification

    Directory of Open Access Journals (Sweden)

    Chunshan Lin

    2016-01-01

    Full Text Available We propose a mechanism to evade the Lyth bound in models of inflation. We minimally extend the conventional single-field inflation model in general relativity (GR to a theory with non-vanishing graviton mass in the very early universe. The modification primarily affects the tensor perturbation, while the scalar and vector perturbations are the same as the ones in GR with a single scalar field at least at the level of linear perturbation theory. During the reheating stage, the graviton mass oscillates coherently and leads to resonant amplification of the primordial tensor perturbation. After reheating the graviton mass vanishes and we recover GR.

  12. Telomerase Repeated Amplification Protocol (TRAP)

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W.

    2016-01-01

    Telomeres are found at the end of eukaryotic linear chromosomes, and proteins that bind to telomeres protect DNA from being recognized as double-strand breaks thus preventing end-to-end fusions (Griffith et al., 1999). However, due to the end replication problem and other factors such as oxidative damage, the limited life span of cultured cells (Hayflick limit) results in progressive shortening of these protective structures (Hayflick and Moorhead, 1961; Olovnikov, 1973). The ribonucleoprotein enzyme complex telomerase-consisting of a protein catalytic component hTERT and a functional RNA component hTR or hTERC- counteracts telomere shortening by adding telomeric repeats to the end of chromosomes in ~90% of primary human tumors and in some transiently proliferating stem-like cells (Shay and Wright, 1996; Shay and Wright, 2001). This results in continuous proliferation of cells which is a hallmark of cancer. Therefore, telomere biology has a central role in aging, cancer progression/metastasis as well as targeted cancer therapies. There are commonly used methods in telomere biology such as Telomere Restriction Fragment (TRF) (Mender and Shay, 2015b), Telomere Repeat Amplification Protocol (TRAP) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this detailed protocol we describe Telomere Repeat Amplification Protocol (TRAP). The TRAP assay is a popular method to determine telomerase activity in mammalian cells and tissue samples (Kim et al., 1994). The TRAP assay includes three steps: extension, amplification, and detection of telomerase products. In the extension step, telomeric repeats are added to the telomerase substrate (which is actually a non telomeric oligonucleotide, TS) by telomerase. In the amplification step, the extension products are amplified by the polymerase chain reaction (PCR) using specific primers (TS upstream primer and ACX downstream primer) and in the detection step, the presence or absence of telomerase is

  13. Desempenho da soja roundup ready sob aplicação de glyphosate em diferentes estádios Performance of roundup ready soybean under glyphosate application at different stages

    Directory of Open Access Journals (Sweden)

    L.P Albrecht

    2011-09-01

    Full Text Available Em razão de estudos e especulações envolvendo a questão da soja RR sob aplicação de glyphosate, são necessárias investigações que permitam esclarecer melhor essa situação. O presente trabalho teve por objetivo avaliar o desempenho agronômico e os teores de óleo e proteínas sob aplicação do herbicida glyphosate na cultura da soja transgênica. Para isso, foi desenvolvido um ensaio em delineamento em blocos casualizados, com quatro repetições, em que os tratamentos avaliados consistiram da pulverização foliar contendo glyphosate, em doses crescentes, aplicadas nos estádios V6 e R 2 . As variáveis avaliadas foram: altura média das plantas, número de vagens por planta, massa de mil grãos e produtividade, assim como os teores de óleo e proteínas. Verificou-se que o glyphosate, especialmente quando usado em R 2, pode comprometer o desempenho agronômico e os teores de proteínas.Previous studies and speculation involving the behavior of Roundup Ready soybean under glyphosate application requires further investigations to clarify this issue. This study aimed to evaluate the agronomic performance and oil and protein contents of transgenic soybean culture under glyphosate application. Thus, an assay was carried out in a completely randomized block design, with four replications. Treatments consisted of foliar sprays in increasing doses of glyphosate applied at stages V6 and R2. The variables evaluated were: plant height, number of pods per plant, thousand grain weight and yield, as well as oil and protein contents. It was verified that glyphosate, especially when used in R2, can compromise both the agronomic performance and protein contents.

  14. Dynamics and Control of DNA Sequence Amplification

    CERN Document Server

    Marimuthu, Karthikeyan

    2014-01-01

    DNA amplification is the process of replication of a specified DNA sequence \\emph{in vitro} through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction (PCR) as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal tempe...

  15. Glyphosate and AMPA contents in sediments produced by wind erosion of agricultural soils in Argentina

    Science.gov (United States)

    Aparicio, Virginia; Aimar, Silvia; De Gerónimo, Eduardo; Buschiazzo, Daniel; Mendez, Mariano; Costa, José Luis

    2014-05-01

    Wind erosion of soils is an important event in arid and semiarid regions of Argentina. The magnitude of wind erosion occurring under different management practices is relatively well known in this region but less information is available on the quality of the eroded material. Considering that the intensification of agriculture may increase the concentrations of substances in the eroded material, producing potential negative effects on the environment, we analyzed the amount of glyphosate and AMPA in sediments produced by wind erosion of agricultural soils of Argentina. Wind eroded materials were collected by means of BSNE samplers in two loess sites of the semiarid region of Argentina: Chaco and La Pampa. Samples were collected from 1 ha square fields at 13.5, 50 and 150 cm height. Results showed that at higher heights the concentrations of glyphosate and AMPA were mostly higher. The glyphosate concentration was more variable and higher in Chaco (0.66 to 313 µg kg-1) than in La Pampa (4.17 to 114 µg kg-1). These results may be due to the higher use of herbicides in Chaco, where the predominant crops are soybeans and corn, produced under no-tillage. Under these conditions the use of glyphosate for weeds control is a common practice. Conversely, AMPA concentrations were higher in La Pampa (13.1 to 101.3 µg kg-1) than in Chaco (1.3 to 83 µg kg-1). These preliminary results show high concentrations of glyphosate and AMPA in wind eroded materials of agricultural soils of Argentina. More research is needed to confirm these high concentrations in other conditions in order to detect the temporal and spatial distribution patterns of the herbicide.

  16. Concentrations of Glyphosate, Its Degradation Product, Aminomethylphosphonic Acid, and Glufosinate in Ground- and Surface-Water, Rainfall, and Soil Samples Collected in the United States, 2001-06

    Science.gov (United States)

    Scribner, Elisabeth A.; Battaglin, William A.; Gilliom, Robert J.; Meyer, Michael T.

    2007-01-01

    The U.S. Geological Survey conducted a number of studies from 2001 through 2006 to investigate and document the occurrence, fate, and transport of glyphosate, its degradation product, aminomethylphosphonic acid (AMPA), and glufosinate in 2,135 ground- and surface-water samples, 14 rainfall samples, and 193 soil samples. Analytical methods were developed to detect and measure glyphosate, AMPA, and glufosinate in water, rainfall, and soil. Results show that AMPA was detected more frequently and occurred at similar or higher concentrations than the parent compound, glyphosate, whereas glufosinate was seldom found in the environment. Glyphosate and AMPA were detected more frequently in surface water than in ground water. Trace levels of glyphosate and AMPA may persist in the soil from year to year. The methods and data described in this report are useful to researchers and regulators interested in the occurrence, fate, and transport of glyphosate and AMPA in the environment.

  17. 草甘膦原粉母液处理的探讨%Discussion on Treatment of Glyphosate Mother Liquor

    Institute of Scientific and Technical Information of China (English)

    陈元群; 卢孙荣; 林庆才

    2013-01-01

      用过氧化氢氧化还原双甘膦制备草甘膦后,提取草甘膦原粉,对剩余草甘膦母液的处理条件进行摸索,进而提高草甘膦的生产收率,增加草甘膦母液的利用途径。%Glyphosate was prepared from N-(phosphonomethyl)iminodiacetic acid (PMIDA) by hydrogen peroxide oxidation and reduction reaction. The treatment conditions of glyphosate mother liquor were investigated in order to increase the production yield of glyphosate and expand the application of glyphosate mother liquor.

  18. Morpho-physiological characterization of glyphosate-resistant and -susceptible horseweed (Conyza canadensis) biotypes of US Midsouth

    Science.gov (United States)

    Growth chamber and greenhouse experiments were conducted to compare selected biological and physiological parameters of glyphosate-resistant (GR) and -susceptible (GS) horseweed biotypes from Mississippi with a broader goal of fitness characterization in these biotypes. Vegetative growth parameters ...

  19. Genotoxic effects of the herbicide Roundup Transorb and its active ingredient glyphosate on the fish Prochilodus lineatus.

    Science.gov (United States)

    Moreno, Natália Cestari; Sofia, Silvia Helena; Martinez, Claudia B R

    2014-01-01

    Roundup Transorb (RT) is a glyphosate-based herbicide and despite its wide use around the world there are few studies comparing the effects of the active ingredient with the formulated product. In this context the purpose of this study was to compare the genotoxicity of the active ingredient glyphosate with the formulated product RT in order to clarify whether the active ingredient and the surfactant of the RT formula may exert toxic effects on the DNA molecule in juveniles of fish Prochilodus lineatus. Erythrocytes and gill cells of fish exposed to glyphosate and to RT showed DNA damage scores significantly higher than control animals. These results revealed that both glyphosate itself and RT were genotoxic to gill cells and erythrocytes of P. lineatus, suggesting that their use should be carefully monitored considering their potential impact on tropical aquatic biota. PMID:24448465

  20. Modelling and Managing SSD Write-amplification

    OpenAIRE

    Dayan, Niv; Bouganim, Luc; Bonnet, Philippe

    2015-01-01

    How stable is the performance of your flash-based Solid State Drives (SSDs)? This question is central for database designers and administrators, cloud service providers, and SSD constructors. The answer depends on write-amplification, i.e., garbage collection overhead. More specifically, the answer depends on how write-amplification evolves in time. How then can one model and manage write-amplification, especially when application workloads change? This is the focus of this paper. Managing wr...

  1. Conference Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-09-01

    Computational fluid dynamics (CFD) is rapidly becoming a useful tool for simulating a variety of fluid flows. The 6. annual meeting of the Society in Quebec City discussed a wide variety of topics, organized into 15 sessions. Session titles included aerodynamics, shocks and detonations, geophysical and environmental flows, unsteady flows, multiphase flows, turbulence, natural convection, industrial applications, numerical techniques and simulations, heat and mass transfer, and moving boundary /interface problems. The use of CFD for mathematical modeling was demonstrated at this conference which included addresses by four guest speakers, 85 presentations, and 10 exhibits. refs., tabs., figs.

  2. Conference summaries

    International Nuclear Information System (INIS)

    The 113 papers presented at this conference covered the areas of 1) fuel design, development and production; 2) nuclear plant safety; 3) nuclear instrumentation; 4) public and regulatory matters; 5) developments and opportunities in fusion; 6) fuel behaviour under normal operating conditions; 7) nuclear plant design and operations; 8) materials science and technology; 9) nuclear power issues; 10) fusion technology; 11) fuel behaviour under accident conditions; 12) large scale fuel channel replacement programs; 13) thermalhydraulics experimental studies; 14) reactor physics and analysis; 15) applications of accelerators; 16) fission product release and severe fuel damage under accident conditions; 17) thermalhydraulics modeling and assessments; 18) waste management and the environment; and 20) new reactor concepts

  3. USE OF GLYPHOSATE AS GROWTH REGULATOR IN UPLAND RICE GLYPHOSATE COMO REGULADOR DE CRESCIMENTO EM ARROZ DE TERRAS ALTAS

    Directory of Open Access Journals (Sweden)

    Daiene Camila Dias Chaves Corsini

    2011-10-01

    Full Text Available

    The lodging of some rice cultivars at harvest time can lead to significant losses in yield, and the inappropriate water and nitrogen management, under high-tech conditions, can aggravate the problem. The use of vegetal regulators is an alternative to reduce lodging, however, information on this topic are rare. The study aimed to evaluate the application of glyphosate sub doses (26 g ha-1, 52 g ha-1, 78 g ha-1, 104 g ha-1, 130 g ha-1, 156 g ha-1, and 182 g ha-1 on agronomical traits, development, and yield of upland rice crops irrigated by aspersion, during the floral differentiation period. The experiment was carried out in Selvíria, Mato Grosso do Sul State, Brazil, through the agricultural years of 2008/2009 and 2009/2010. The increase of glyphosate sub doses, at the floral differentiation period of the Primavera cultivar, reduced the plants height, panicle size, and, consequently, yield. Sub doses higher than or equal to 78 g ha-1 eliminated the plants lodging process.

    O acamamento de algumas cultivares de arroz, no momento da colheita, acarreta perdas significativas na produtividade e, além disto, manejos de água e nitrogênio inadequados, em condições de alta tecnologia

  4. Dynamics and control of DNA sequence amplification

    International Nuclear Information System (INIS)

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions

  5. Dynamics and control of DNA sequence amplification

    Energy Technology Data Exchange (ETDEWEB)

    Marimuthu, Karthikeyan [Department of Chemical Engineering and Center for Advanced Process Decision-Making, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu [Department of Chemical Engineering and Center for Advanced Process Decision-Making, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054 (United States)

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  6. Misturas em tanque com glyphosate para o controle de trapoeraba, erva-de-touro e capim-carrapicho em soja RR®

    Directory of Open Access Journals (Sweden)

    Cleber Daniel de Goes Maciel

    2011-02-01

    Full Text Available O uso de misturas de glyphosate, em tanque, para manejo de espécies de plantas daninhas de difícil controle tem sido prática comum entre os agricultores brasileiros. Desta forma, este trabalho teve como objetivo avaliar a eficácia e seletividade de misturas, em tanque, de herbicidas com glyphosate para o controle de trapoeraba (Commelina benghalensis L., erva-de-touro (Tridax procumbens L. e capim-carrapicho (Cenchrus echinatus L. na cultura da soja RR®. O experimento foi conduzido em Maracaí, São Paulo, no período de novembro de 2006 a março de 2007, utilizando-se o cultivar CD-214RR® e delineamento experimental de blocos ao acaso, com 21 tratamentos e quatro repetições. Os tratamentos foram constituídos da aplicação de: glyphosate (180; 360; 540 e 720 g ha-1; glyphosate em sequencial (180/360; 360/360 e 540/360 g ha-1; glyphosate + chlorimuron-ethyl 360+10; 540+10; 360+5/ 360+5 g ha-1; glyphosate + lactofen (360+120; 540+120; 360+60/ 360+60 g ha-1; glyphosate + cloransulam-methyl (360+30; 540+30; 360+16,9/ 360+12,9 g ha-1; glyphosate + carfentrazone (360+4 g ha-1; glyphosate + imazethapyr (360+50 g ha-1; glyphosate + imazethapyr (177,8+30 g ha-1 e testemunhas capinada e sem capina. Apesar da similaridade de produtividade de grãos entre os tratamentos com glyphosate isolado e sequencial, nas doses 540, 720 e 540/ 360 g ha-1, as misturas em tanque com chlorimuron-ethyl, cloransulam-methyl, lactofen e imazethapyr favoreceram o controle de espécies de plantas daninhas tolerantes ao glyphosate como C. benghalensis e T. procumbens.

  7. Risk Perception and Social Amplification

    International Nuclear Information System (INIS)

    This paper seeks to consider social amplification as it applies to risk perception. Perceptions of the magnitude of a risk are conditioned by issues such as the degree of uncertainty in probability and consequences, the nature of the consequences and the relative weightings placed on probability and consequences. Risk perceptions are also influenced by factors such as confidence in the operator of an industrial process, trust in the regulator and the perceived fairness of regulatory decision-making. Different people may hold different views about these issues and there may also be difficulties in communication. The paper identifies and discusses self-reinforcing mechanisms, which will be labelled 'lock-in' here. They appear to apply in many situations where social amplification is observed. Historically, the term 'lock-in' has been applied mainly in the technological context but, in this paper, four types of lock-in are identified, namely scientific/technological, economic, social and institutional lock-in. One type of lock-in tends to lead to the next and all are buttressed by people's general acceptance of the familiar, fear of the unknown and resistance to change. The regulator seeks to make decisions which achieve the common good rather than supporting or perpetuating any set of vested interests. In this regard the locked-in positions of stakeholders, whether organisations, interest groups, or individual members of the public, are obstacles and challenges. Existing methods of consultation are unsatisfactory in terms of achieving a proper and productive level of dialogue with stakeholders

  8. Variabilidade genética e sensibilidade de acessos de Pistia stratiotes ao herbicida glyphosate Genetic variability and sensitivity of Pistia stratiotes accesses to glyphosate

    Directory of Open Access Journals (Sweden)

    E.A.S. Cícero

    2007-09-01

    Full Text Available A alface-d'água (Pistia stratiotes é uma das principais entre as macrófitas aquáticas que causam problemas em corpos hídricos no Brasil e são consideradas como plantas daninhas. O presente trabalho foi realizado com os objetivos de conhecer melhor a variabilidade genética dessa macrófita e relacionar essa variabilidade com a resposta à aplicação do herbicida glyphosate. Para isso, foram coletados indivíduos em 12 corpos hídricos em diferentes cidades do território nacional (Americana, Cambaratiba, Curitiba, Itapura, Jaboticabal, Lagoa Santa, Piraí, Rio Grande, Rubinéia, Salto Grande, Santa Gertrudes e Três Lagoas. Os acessos foram caracterizados pelo uso de marcadores RAPD (DNA Polimórfico Amplificado ao Acaso, que permitiram, com o auxílio de iniciadores aleatórios, a caracterização dos locos polimórficos identificados por uma matriz de ausência e presença de bandas. Utilizando essa matriz, a análise de agrupamento permitiu nítida classificação dos acessos em três grupos com diferenças genéticas entre eles. Um ensaio de controle químico, com plantas mantidas em vasos plásticos (5 L e pulverizadas com o herbicida glyphosate nas concentrações de 0,0, 0,6, 1,2, 1,8 e 2,4 kg ha-1, identificou, utilizando avaliações aos 7, 14 e 21 dias após aplicação, que as duas maiores doses promoveram melhor efeito herbicida. Foi verificado também que os acessos de Curitiba e Cambaratiba apresentaram menor suscetibilidade ao herbicida glyphosate. Não houve correspondência entre a estrutura de grupos dos acessos pela análise multivariada de agrupamento com a técnica RAPD e a suscetibilidade da alface-d'água ao glyphosate.Water lettuce (Pistia stratiotes is one the most important macrophytes, classified as weed and causing serious problems in watercourses in Brazil. The aim of this research was to evaluate the genetic variability of water lettuce and its relationship with this plant's susceptibility to glyphosate

  9. The carbon isotope composition of herbicides in groundwater : the example of Glyphosate and its degradation by product AMPA

    OpenAIRE

    Widory, David; Kujawinski, Dorothea; Baran, Nicole; Amalric, Laurence; Jochmann, Maik; Schmidt, Torsten

    2011-01-01

    1. Introduction Glyphosate is the principal active substance of a weed-killer used worldwide. Its use and migration towards groundwater is of real concern. Both glyphosate and the aminomethyl phosphonic acid (AMPA), one of its degradation product, are among the 10-most observed pesticides or metabolites in France (SOeS, 2009), usually leading to the classification of the corresponding groundwater as having a bad quality status (in regard to the Water Framework Directive). Moreover, the glypho...

  10. Exsudação radicular de glyphosate por Brachiaria decumbens e seus efeitos em plantas de eucalipto Radicular exudation of glyphosate by Brachiaria decumbens and its effects on eucalypt plant

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2008-06-01

    Full Text Available Plantas de eucalipto com sintomas de intoxicação por glyphosate são comuns em áreas em que esse herbicida é usado. Uma das possíveis formas de contato com glyphosate é por meio da exsudação radicular do produto, por plantas daninhas tratadas, e subseqüente absorção pelas plantas de eucalipto. Objetivou-se com este trabalho avaliar a exsudação de glyphosate por Brachiaria decumbens e seus efeitos sobre plantas de eucalipto, por meio da aplicação de 14C-glyphosate misturado à calda de pulverização do produto comercial. Mudas de dois clones de eucalipto (UFV05 e UFV06 foram cultivadas em consórcio com Brachiaria decumbens (capim-braquiária, em vasos contendo dois tipos de solo: um arenoso e outro argiloso. Aos 35 dias após o transplantio das mudas, foram aplicados na braquiária 50 µL da mistura de 14C-glyphosate com a formulação comercial de glyphosate Scout®, utilizando-se uma microsseringa de precisão. Aos 2, 8, 16 e 24 dias após aplicação, as plantas de eucalipto foram coletadas e fracionadas em ápice primário, ápices secundários, folhas e raízes, sendo processadas de acordo com metodologia usual para determinação da radioatividade. Não foram observados sintomas de intoxicação por glyphosate nas plantas de eucalipto, em nenhuma das avaliações realizadas. Entretanto, o 14C-glyphosate foi encontrado em todas as plantas de eucalipto avaliadas, independentemente do solo, do clone e da época de avaliação, em maior concentração em plantas cultivadas no solo arenoso. Os resultados evidenciam a exsudação radicular do glyphosate e/ou de seus metabólitos pela braquiária e subseqüente absorção, via raízes, pelas plantas de eucalipto, em concentrações inferiores às necessárias para causar intoxicação na cultura.Eucalypt plants commonly present symptoms of intoxication in areas where glyphosate is used. One possible way of contamination is through radicular exudation of glyphosate by the treated

  11. EGC Conferences

    CERN Document Server

    Ritschard, Gilbert; Pinaud, Bruno; Venturini, Gilles; Zighed, Djamel; Advances in Knowledge Discovery and Management

    This book is a collection of representative and novel works done in Data Mining, Knowledge Discovery, Clustering and Classification that were originally presented in French at the EGC'2012 Conference held in Bordeaux, France, on January 2012. This conference was the 12th edition of this event, which takes place each year and which is now successful and well-known in the French-speaking community. This community was structured in 2003 by the foundation of the French-speaking EGC society (EGC in French stands for ``Extraction et Gestion des Connaissances'' and means ``Knowledge Discovery and Management'', or KDM). This book is intended to be read by all researchers interested in these fields, including PhD or MSc students, and researchers from public or private laboratories. It concerns both theoretical and practical aspects of KDM. The book is structured in two parts called ``Knowledge Discovery and Data Mining'' and ``Classification and Feature Extraction or Selection''. The first part (6 chapters) deals with...

  12. Munich conference

    International Nuclear Information System (INIS)

    'The Standard Model has survived impact for another year', declared Don Perkins of Oxford, summarizing the 24th International Conference on High Energy Physics held in Munich from 4-10 August. 'But is this a triumph or a frustration for physics?' he added. The twin pillars of the Standard Model, the electroweak unification of electromagnetism and the weak nuclear force, and the field theory (quantum chromodynamics) of the quark-gluon interactions responsible for the strong nuclear force, have not trembled since the electroweak unification went to the textbooks in 1983, but from time to time small cracks have appeared which might have gone on to shake the theory severely, if not undermine it. Major conference summarizers have got used to singing the praises of the Standard Model, but this year at Munich even detailed examination failed to reveal any serious cracks, while looking deeper into physics even some anomalous results hinting at gaps in understanding have either gone away or have diminished credibility

  13. NATO Conference

    CERN Document Server

    Lynn, W

    1975-01-01

    The contents of this volume involve selection, emendation and up-dating of papers presented at the NATO Conference "Mathe­ matical Analysis of Decision problems in Ecology" in Istanbul, Turkey, July 9-13, 1973. It was sponsored by the System Sciences Division of NATO directed by Dr. B. Bayraktar with local arrange­ ments administered by Dr. Ilhami Karayalcin, professor of the Department of Industrial Engineering at the Technical University of Istanbul. It was organized by A. Charnes, University professor across the University of Texas System, and Walter R.Lynn, Di­ rector of the School of Civil and Environmental Engineering at Cornell Unjversity. The objective of the conference was to bring together a group of leading researchers from the major sciences involved in eco­ logical problems and to present the current state of progress in research of a mathematical nature which might assist in the solu­ tion of these problems. Although their presentations are not herein recorded, the key­ note address of Dr....

  14. Use of chlorophyll lfuorescence and P700 absorbance to rapidly detect glyphosate resistance in goosegrass (Eleusine indica)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Tai-jie; FENG Li; TIAN Xing-shan; YANG Cai-hong; GAO Jia-dong

    2015-01-01

    The rapid detection of glyphosate resistance in goosegrass (Eleusine indica) wil enhance our ability to respond to new resistant populations of this major weed. Chlorophyl lfuorescence (Fluo) and P700 (reaction center chlorophyl of pho-tosystem I) absorbance were analyzed in one biotype of goosegrass that is resistant to glyphosate and in another that remains sensitive to the herbicide. Both biotypes were treated with a foliar spray of glyphosate. Differences in photosys-tem II maximum quantum yield (Fv/Fm), effective photochemical quantum yield (Y(II)), and non-photochemical quenching (NPQ) between the biotypes increased over time. Values for Fv/Fm and Y(II) differed between the two biotypes 24 h after treatment (HAT). Differentiated activities and energy dissipation processes of photosystem II (PSII) and energy dissipation processes of photosystem I (PSI) were manifested in the two biotypes 24 HAT with 20 mmol L–1 glyphosate. Differentiated energy dissipation processes of PSI were stil apparent 24 HAT with 200 mmol L–1 glyphosate. These results indicate that the Fluo parameters related to PSII activity and energy dissipation and the P700 parameters related to energy dissipation are suitable indicators that enable rapid detection of glyphosate resistance in goosegrass.

  15. The use of environmental metabolomics to determine glyphosate level of exposure in rapeseed (Brassica napus L.) seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, Iben Lykke; Tomasi, Giorgio; Sorensen, Hilmer; Boll, Esther S.; Hansen, Hans Christian Bruun [Department of Basic Sciences and Environment, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C (Denmark); Christensen, Jan H., E-mail: jch@life.ku.dk [Department of Basic Sciences and Environment, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C (Denmark)

    2011-10-15

    Metabolic profiling in plants can be used to differentiate between treatments and to search for biomarkers for exposure. A methodology for processing Ultra-High-Performance Liquid Chromatography-Diode-Array-Detection data is devised. This methodology includes a scheme for selecting informative wavelengths, baseline removal, retention time alignment, selection of relevant retention times, and principal component analysis (PCA). Plant crude extracts from rapeseed seedling exposed to sublethal concentrations of glyphosate are used as a study case. Through this approach, plants exposed to concentrations down to 5 {mu}M could be distinguished from the controls. The compounds responsible for this differentiation were partially identified and were different from those specific for high exposure samples, which suggests that two different responses to glyphosate are elicited in rapeseed depending on the level of exposure. The PCA loadings indicate that a combination of other metabolites could be more sensitive than the response of shikimate to detect glyphosate exposure. - Highlights: > A method for processing UHPLC-DAD data for plant metabolic profiling is devised. > The metabolic profiling approach is more sensitive to glyphosate exposure than shikimate. > Plants exposed to concentrations down to 5 {mu}M can be distinguished from the controls. > Two different responses to glyphosate may be elicited in rapeseed depending on the level of exposure. - A novel untargeted environmental metabololomic approach is used to detect low-level glyphosate exposure of rapeseed seedlings.

  16. The use of environmental metabolomics to determine glyphosate level of exposure in rapeseed (Brassica napus L.) seedlings

    International Nuclear Information System (INIS)

    Metabolic profiling in plants can be used to differentiate between treatments and to search for biomarkers for exposure. A methodology for processing Ultra-High-Performance Liquid Chromatography-Diode-Array-Detection data is devised. This methodology includes a scheme for selecting informative wavelengths, baseline removal, retention time alignment, selection of relevant retention times, and principal component analysis (PCA). Plant crude extracts from rapeseed seedling exposed to sublethal concentrations of glyphosate are used as a study case. Through this approach, plants exposed to concentrations down to 5 μM could be distinguished from the controls. The compounds responsible for this differentiation were partially identified and were different from those specific for high exposure samples, which suggests that two different responses to glyphosate are elicited in rapeseed depending on the level of exposure. The PCA loadings indicate that a combination of other metabolites could be more sensitive than the response of shikimate to detect glyphosate exposure. - Highlights: → A method for processing UHPLC-DAD data for plant metabolic profiling is devised. → The metabolic profiling approach is more sensitive to glyphosate exposure than shikimate. → Plants exposed to concentrations down to 5 μM can be distinguished from the controls. → Two different responses to glyphosate may be elicited in rapeseed depending on the level of exposure. - A novel untargeted environmental metabololomic approach is used to detect low-level glyphosate exposure of rapeseed seedlings.

  17. EFFECTS OF GLYPHOSATE AMMONIUM SALT ON THE BIOAVAILABLE PHOSPHORUS CONTENT AND THE ACTIVITY OF SELECTED PHOSPHATASES IN LOAMY SAND

    Directory of Open Access Journals (Sweden)

    Maciej Płatkowski

    2015-07-01

    Full Text Available The aim of this study was to determine the effects of glyphosatę ammonium salt on the activity of some enzymes involved in the metabolism of phosphorus in the soil: acid phosphomonoeaterase (EC 3.1.3.2, alkaline phosphomonoeaterase (EC 3.1.3.1, phosphotrieaterase (EC 3.1.5.1, inorganic pyrophosphatase (EC 3.1.6.1, and a phosphorus content in a form available to plants. The experiment was carried out on loamy sand samples with organic carbon content 8.7 g kg-1. Into soil samples the aqueous solutions of Avans Premium 360 SC (360 g glyphosate ammonium salt in 1 dm3 were added. The amount of introduced glyphosate ammonium salt was 0 (control, 1, 10, 50 and 100 mg·kg-1, on days 0 (1 hour after glyphosate application, 7, 14, 28 and 56 measured parameters were determined spectrophotometrically. The obtained results showed that the application of glyphosate ammonium salt resulted in changes of available phosphorus content and the activity of enzymes involved in the metabolism of this element in loamy sand. The effects glyphosate ammonium salt dosage and effect of day of experiment were ambiguous. Among the determined parameters the most sensitive to the presence of the glyphosate ammonium was alkaline phosphomonoesterase.

  18. Glyphosate sub-lethal toxicity to non-target organisms occurring in Jatropha curcas plantations in Brazil.

    Science.gov (United States)

    de Saraiva, Althiéris Souza; Sarmento, Renato Almeida; Pedro-Neto, Marçal; Teodoro, Adenir Vieira; Erasmo, Eduardo Andrea Lemus; Belchior, Diana Cléssia Vieira; de Azevedo, Emiliano Brandão

    2016-10-01

    Weed management in physic nut plantations has generally been performed by spraying the herbicide glyphosate. However, the effects of glyphosate on non-target organisms present in the crop system are unknown. Here, we evaluated the toxicity of glyphosate (Roundup Transorb(®)) against the pest species Polyphagotarsonemus latus (Acari: Tarsonemidae) and Tetranychus bastosi (Acari: Tetranychidae) which can be exposed by drift. These mites are considered pests of the physic nut; however, they can also feed and reside on weeds associated with the crop, serving as food sources for predatory mites. When subjected to residue (by ingestion of sap of treated plants), and direct contact to glyphosate, P. latus reproduction was affected but T. bastosi was affected only by the residual effect. Although the herbicide caused a reduction in the number of eggs laid by the females of both pest mites, it is suggested that sublethal effects of glyphosate stimulates oviposition of P. latus and T. bastosi: both species displayed higher reproductive rates when exposed to 0.36 kg ha(-1) of the herbicide. We conclude that glyphosate negatively affects the arthropod herbivores studied and we discuss possible implications on their biological control in Jatropha curcas plantations. PMID:27502112

  19. Approaches towards molecular amplification for sensing.

    Science.gov (United States)

    Goggins, Sean; Frost, Christopher G

    2016-06-01

    Diagnostic assays that rely on molecular interactions have come a long way; from initial reversible detection systems towards irreversible reaction indicator-based methods. More recently, the emergence of innovative molecular amplification methodologies has revolutionised sensing, allowing diagnostic assays to achieve ultra-low limits of detection. There have been a significant number of molecular amplification approaches developed over recent years to accommodate the wide variety of analytes that require sensitive detection. To celebrate this achievement, this comprehensive critical review has been compiled to give a broad overview of the many different approaches used to attain amplification in sensing with an aim to inspire the next generation of diagnostic assays looking to achieve the ultimate detection limit. This review has been created with the focus on how each conceptually unique molecular amplification methodology achieves amplification, not just its sensitivity, while highlighting any key processes. Excluded are any references that were not found to contain an obvious molecular amplifier or amplification component, or that did not use an appropriate signal readout that could be incorporated into a sensing application. Additionally, methodologies where amplification is achieved through advances in instrumentation are also excluded. Depending upon the type of approach employed, amplification strategies are divided into four categories: target, label, signal or receptor amplification. More recent, more complex protocols combine a number of approaches and are therefore categorised by which amplification component described within was considered as the biggest advancement. The advantages and disadvantages of each methodology are discussed along with any limits of detection, if stated in the original article. Any subsequent use of the methodology within sensing or any other application is also mentioned to draw attention to its practicality. The importance of

  20. Concerns over use of glyphosate-based herbicides and risks associated with exposures: a consensus statement.

    Science.gov (United States)

    Myers, John Peterson; Antoniou, Michael N; Blumberg, Bruce; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vandenberg, Laura N; Vom Saal, Frederick S; Welshons, Wade V; Benbrook, Charles M

    2016-01-01

    The broad-spectrum herbicide glyphosate (common trade name "Roundup") was first sold to farmers in 1974. Since the late 1970s, the volume of glyphosate-based herbicides (GBHs) applied has increased approximately 100-fold. Further increases in the volume applied are likely due to more and higher rates of application in response to the widespread emergence of glyphosate-resistant weeds and new, pre-harvest, dessicant use patterns. GBHs were developed to replace or reduce reliance on herbicides causing well-documented problems associated with drift and crop damage, slipping efficacy, and human health risks. Initial industry toxicity testing suggested that GBHs posed relatively low risks to non-target species, including mammals, leading regulatory authorities worldwide to set high acceptable exposure limits. To accommodate changes in GBH use patterns associated with genetically engineered, herbicide-tolerant crops, regulators have dramatically increased tolerance levels in maize, oilseed (soybeans and canola), and alfalfa crops and related livestock feeds. Animal and epidemiology studies published in the last decade, however, point to the need for a fresh look at glyphosate toxicity. Furthermore, the World Health Organization's International Agency for Research on Cancer recently concluded that glyphosate is "probably carcinogenic to humans." In response to changing GBH use patterns and advances in scientific understanding of their potential hazards, we have produced a Statement of Concern drawing on emerging science relevant to the safety of GBHs. Our Statement of Concern considers current published literature describing GBH uses, mechanisms of action, toxicity in laboratory animals, and epidemiological studies. It also examines the derivation of current human safety standards. We conclude that: (1) GBHs are the most heavily applied herbicide in the world and usage continues to rise; (2) Worldwide, GBHs often contaminate drinking water sources, precipitation, and air

  1. 草甘膦毒性研究进展%Research advance in ecotoxicity of glyphosate

    Institute of Scientific and Technical Information of China (English)

    周垂帆; 李莹; 张晓勇; 俞元春

    2013-01-01

    随着现代农业的飞速发展,农药的应用越来越广泛。而目前草甘膦是使用最广泛、用量最大的除草剂种类之一,其在环境中的大量残留给环境带来了巨大潜在风险。介绍了草甘膦对靶标生物(植物)的制毒机理和非靶标生物(如:水生生物、两栖类动物、土壤生物和哺乳动物)的生态毒性,总结了草甘膦在群落、个体、细胞和分子水平上的生态毒性。综合国内外最新的研究表明:草甘膦制剂具有低毒性,且毒性要远远高于草甘膦酸的毒性,农药草甘膦制剂对非光合生物产生毒性的原因主要是由于表面活性剂的存在。而大多研究都表明,不同的草甘膦制剂及其组成成分毒性强弱为表面活性剂>草甘膦制剂>草甘膦酸>草甘膦异丙胺盐,而草甘膦酸产生的毒性原因主要和其产生的酸性物质有关,并认为在当前的使用品种和剂量的状况下,草甘膦对人类的危害风险是很低的。最后,分析了草甘膦在土壤中与无机重金属共存的的生态毒性研究现状,认为由于草甘膦分子结构中含有磷酸基、羧基、氨基等配位基团,能够与土壤或水体中金属离子发生络合反应,使得重金属在一定程度上能够降低草甘膦的除草效率,草甘膦一定程度上也能够降低重金属对生物的毒性和有效性,此外对今后的研究重点进行了展望。%It has been widely recognized that pesticides represent a potential threat in aquatic and soil ecosystems. Glyphosate is a kind of antibiotics which has been extensively used in most countries. Its residues in environment bring to a potential hazard. However, the knowledge on the toxicity of pesticides to organism is still limited. The present work attempts to provide a summary of the utility and the environmental health problems of glyphosate applications. It comes in a number of chemical forms but most of the formulated

  2. Tsunami Amplification due to Focusing

    Science.gov (United States)

    Moore, C. W.; Kanoglu, U.; Titov, V. V.; Aydin, B.; Spillane, M. C.; Synolakis, C. E.

    2012-12-01

    Tsunami runup measurements over the periphery of the Pacific Ocean after the devastating Great Japan tsunami of 11 March 2011 showed considerable variation in far-field and near-field impact. This variation of tsunami impact have been attributed to either directivity of the source or by local topographic effects. Directivity arguments alone, however, cannot explain the complexity of the radiated patterns in oceans with trenches and seamounts. Berry (2007, Proc. R. Soc. Lond. A 463, 3055-3071) discovered how such underwater features may concentrate tsunamis into cusped caustics and thus cause large local amplifications at specific focal points. Here, we examine focusing and local amplification, not by considering the effects of underwater diffractive lenses, but by considering the details of the dipole nature of the initial profile, and propose that certain regions of coastline are more at-risk, not simply because of directivity but because typical tsunami deformations create focal regions where abnormal tsunami wave height can be registered (Marchuk and Titov, 1989, Proc. IUGG/IOC International Tsunami Symposium, Novosibirsk, USSR). In this work, we present a new general analytical solution of the linear shallow-water wave equation for the propagation of a finite-crest-length source over a constant depth without any restriction on the initial profile. Unlike the analytical solution of Carrier and Yeh (2005, Comp. Mod. Eng. & Sci. 10(2), 113-121) which was restricted to initial conditions with Gaussian profiles and involved approximation, our solution is not only exact, but also general and allows the use of realistic initial waveform such as N-waves as defined by Tadepalli and Synolakis (1994, Proc. R. Soc. Lond. A 445, 99-112). We then verify our analytical solution for several typical wave profiles, both with the NOAA tsunami forecast model MOST (Titov and Synolakis, 1998, J. Waterw. Port Coast. Ocean Eng. 124(4), 157-171) which is validated and verified through

  3. Glyphosate e nitrgênio no controle de Brachiaria decumbens Stapf em capineiras estabelecidas Glyphosate and nitrogen in the control of Brachiaria decumbens Stapf in established elephant grass stocking piles

    Directory of Open Access Journals (Sweden)

    Joadil Gonçalves de Abreu

    2006-10-01

    Full Text Available O objetivo do experimento foi avaliar a eficiência de utilização do herbicida glyphosate associado com adubação nitrogenada no controle de Brachiaria decumbens Stapf em capineiras estabelecidas. O delineamento experimental foi em blocos casualizados, com dezessete tratamentos e três repetições. Os tratamentos foram arranjados em esquema fatorial 4 x 4 + 1, sendo quatro doses de glyphosate (0, 720, 1440 e 2160 g/ha/aplicação, quatro doses de nitrogênio (0, 75, 150 e 225 kg/ha/ano e um tratamento adicional (testemunha com capina. As aplicações do nitrogênio e glyphosate, nas respectivas doses, foram realizadas imediatamente após o corte do capim-elefante. A associação entre o herbicida glyphosate (2160 g/ha/aplicação e nitrogênio (225 kg/ha/ano foi eficiente no controle de capim-braquiária em capineiras estabelecidas. A aplicação do herbicida glyphosate (2160 g/ha/aplicação reduziu o tamanho do banco de sementes de capim-braquiária no solo em 64%.The objective of this experiment was to evaluate the efficiency of the use of the herbicide glyphosate associated with nitrogen fertilization in the control of Brachiaria decumbens Stapf in elephant grass stocking piles. The experimental design used was a randomized blocks with 17 treatments and three replications. The treatments were arranged in 4x4+1 factorial scheme, namely four doses of glyphosate (0, 720, 1440 e 2160 g/ha/application, four doses of nitrogen (0, 75, 150 e 225 kg/ha/ano and one additional treatment (control with a hoeing. The application of the nitrogen and glyphosate, in the respective doses were performed immediately after the cutting of elephant grass. The association between glyphosate (2160 g/ha/application and nitrogen (225 kg/ha/ano was efficient in the control brachiaria grass in established elephant grass stocking piles. The application of the glyphosate (2160 g/ha/application reduced the size of the bank of brachiaria grass seeds in the soil in 64%.

  4. Tolerância do Tifton 85 (Cynodon spp. e da Brachiaria brizantha ao glyphosate Tifton 85 (Cynodon spp. and Brachiaria brizantha tolerance to glyphosate

    Directory of Open Access Journals (Sweden)

    M.V. Santos

    2008-06-01

    Full Text Available Objetivou-se avaliar a tolerância de Tifton 85 e Brachiaria brizantha ao glyphosate e verificar o controle de B. brizantha em área de pastagem de Tifton 85 já estabelecida. O delineamento experimental foi em blocos casualizados, com quatro repetições, em que se testaram as doses: 0, 720, 1.440, 2.160 e 2.880 g ha-1 de glyphosate. Cada parcela possuía dimensões de 3,5 m de comprimento por 3,0 m de largura, totalizando 10,5 m², com área útil de 7,5 m ². A eficiência do herbicida no controle de B. brizantha e o nível de intoxicação nas plantas de Tifton 85 foram avaliados 15, 30 e 60 dias após aplicação (DAA, mediante escala de 0 a 100, em que 0 é ausência de controle e/ou intoxicação e 100, controle total ou morte das plantas. Para avaliação da produção e do potencial de rebrota das forrageiras, as plantas de ambas as espécies foram colhidas aos 300 DAA e secas em estufa. Observou-se controle acima de 90% das plantas de B. brizantha a partir das doses de 1.473,75 e 1.721,25 g ha-1 de glyphosate, aos 30 e 60 DAA, respectivamente. As porcentagens de intoxicação das plantas de Tifton 85, referente a estas doses de controle de B. brizantha, foram, respectivamente, de 24,90 e 4,13% aos 30 e 60 DAA. Além disso, aos 60 DAA, para a maior dose avaliada (2.880 g ha-1 de glyphosate foi observada intoxicação das plantas de Tifton 85 de apenas 18,22%. Aos 300 DAA, observou-se ausência de produção de massa seca de B. brizantha a partir da dose de 2.160 g ha-1 do herbicida, devido ao eficiente controle. Os resultados evidenciam maior tolerância das plantas de Tifton 85 ao glyphosate em relação às plantas de B. brizantha, possibilitando o controle desta espécie em pastagem estabelecida de Tifton 85, sem causar danos à forrageira cultivada.This study aimed to evaluate Tifton 85 and Brachiaria brizantha tolerance glyphosate and verity Brachiaria brizantha control in an established Tifton 85 pasture area. Rates of 0; 720; 1

  5. MUSME Conference

    CERN Document Server

    Martinez, Eusebio

    2015-01-01

    This volume contains the Proceedings of MUSME 2014, held at Huatulco in Oaxaca, Mexico, October 2014. Topics include analysis and synthesis of mechanisms; dynamics of multibody systems; design algorithms for mechatronic systems; simulation procedures and results; prototypes and their performance; robots and micromachines; experimental validations; theory of mechatronic simulation; mechatronic systems; and control of mechatronic systems. The MUSME symposium on Multibody Systems and Mechatronics was held under the auspices of IFToMM, the International Federation for Promotion of Mechanism and Machine Science, and FeIbIM, the Iberoamerican Federation of Mechanical Engineering. Since the first symposium in 2002, MUSME events have been characterised by the way they stimulate the integration between the various mechatronics and multibody systems dynamics disciplines, present a forum for facilitating contacts among researchers and students mainly in South American countries, and serve as a joint conference for the ...

  6. Conference Proceedings

    International Nuclear Information System (INIS)

    This volume contains the unedited proceedings of the Second Annual Conference on Managing Electricity Price Volatility. There were a total of eleven papers presented, dealing with a variety of issues affecting price volatility. Subjects treated included: new power generation development in Alberta; an analysis of electricity supply and demand to predict future price volatility; the effect of government intervention in the Alberta electricity market; risk management in volatile energy markets; an analysis of Alberta's capacity to supply its own internal electric power needs; the impact of increased electricity import and export capacity on price fluctuation in Alberta; improving market liquidity in Alberta; using weather derivatives to offset price risk; the impact of natural gas prices on electricity price volatility; capitalizing on advancements in online trading; and strategies for businesses to keep operating through times of price volatility. In most cases only overhead viewgraphs are available

  7. Mechanisms of metal-induced centrosome amplification.

    Science.gov (United States)

    Holmes, Amie L; Wise, John Pierce

    2010-12-01

    Exposure to toxic and carcinogenic metals is widespread; however, their mechanisms of action remain largely unknown. One potential mechanism for metal-induced carcinogenicity and toxicity is centrosome amplification. Here we review the mechanisms for metal-induced centrosome amplification, including arsenic, chromium, mercury and nano-titanium dioxide. PMID:21118148

  8. Mechanisms of Metal-Induced Centrosome Amplification

    OpenAIRE

    Holmes, Amie L.; Wise, John Pierce

    2010-01-01

    Exposure to toxic and carcinogenic metals is widespread; however, their mechanisms of action remain largely unknown. One potential mechanism for metal-induced carcinogenicity and toxicity is centrosome amplification. Here, we review the mechanisms for metal-induced centrosome amplification, including arsenic, chromium, mercury and nano-titanium dioxide.

  9. Glyphosate Resistance of C3 and C4 Weeds under Rising Atmospheric CO2

    Science.gov (United States)

    Fernando, Nimesha; Manalil, Sudheesh; Florentine, Singarayer K.; Chauhan, Bhagirath S.; Seneweera, Saman

    2016-01-01

    The present paper reviews current knowledge on how changes of plant metabolism under elevated CO2 concentrations (e[CO2]) can affect the development of the glyphosate resistance of C3 and C4 weeds. Among the chemical herbicides, glyphosate, which is a non-selective and post-emergence herbicide, is currently the most widely used herbicide in global agriculture. As a consequence, glyphosate resistant weeds, particularly in major field crops, are a widespread problem and are becoming a significant challenge to future global food production. Of particular interest here it is known that the biochemical processes involved in photosynthetic pathways of C3 and C4 plants are different, which may have relevance to their competitive development under changing environmental conditions. It has already been shown that plant anatomical, morphological, and physiological changes under e[CO2] can be different, based on (i) the plant’s functional group, (ii) the available soil nutrients, and (iii) the governing water status. In this respect, C3 species are likely to have a major developmental advantage under a CO2 rich atmosphere, by being able to capitalize on the overall stimulatory effect of e[CO2]. For example, many tropical weed grass species fix CO2 from the atmosphere via the C4 photosynthetic pathway, which is a complex anatomical and biochemical variant of the C3 pathway. Thus, based on our current knowledge of CO2 fixing, it would appear obvious that the development of a glyphosate-resistant mechanism would be easier under an e[CO2] in C3 weeds which have a simpler photosynthetic pathway, than for C4 weeds. However, notwithstanding this logical argument, a better understanding of the biochemical, genetic, and molecular measures by which plants develop glyphosate resistance and how e[CO2] affects these measures will be important before attempting to innovate sustainable technology to manage the glyphosate-resistant evolution of weeds under e[CO2]. Such information will be

  10. Glyphosate Resistance of C3 and C4 Weeds under Rising Atmospheric CO2.

    Science.gov (United States)

    Fernando, Nimesha; Manalil, Sudheesh; Florentine, Singarayer K; Chauhan, Bhagirath S; Seneweera, Saman

    2016-01-01

    The present paper reviews current knowledge on how changes of plant metabolism under elevated CO2 concentrations (e[CO2]) can affect the development of the glyphosate resistance of C3 and C4 weeds. Among the chemical herbicides, glyphosate, which is a non-selective and post-emergence herbicide, is currently the most widely used herbicide in global agriculture. As a consequence, glyphosate resistant weeds, particularly in major field crops, are a widespread problem and are becoming a significant challenge to future global food production. Of particular interest here it is known that the biochemical processes involved in photosynthetic pathways of C3 and C4 plants are different, which may have relevance to their competitive development under changing environmental conditions. It has already been shown that plant anatomical, morphological, and physiological changes under e[CO2] can be different, based on (i) the plant's functional group, (ii) the available soil nutrients, and (iii) the governing water status. In this respect, C3 species are likely to have a major developmental advantage under a CO2 rich atmosphere, by being able to capitalize on the overall stimulatory effect of e[CO2]. For example, many tropical weed grass species fix CO2 from the atmosphere via the C4 photosynthetic pathway, which is a complex anatomical and biochemical variant of the C3 pathway. Thus, based on our current knowledge of CO2 fixing, it would appear obvious that the development of a glyphosate-resistant mechanism would be easier under an e[CO2] in C3 weeds which have a simpler photosynthetic pathway, than for C4 weeds. However, notwithstanding this logical argument, a better understanding of the biochemical, genetic, and molecular measures by which plants develop glyphosate resistance and how e[CO2] affects these measures will be important before attempting to innovate sustainable technology to manage the glyphosate-resistant evolution of weeds under e[CO2]. Such information will be of

  11. Risk Perception and Social Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Smith, R.E. [Environment Agency (United Kingdom)

    2001-07-01

    This paper seeks to consider social amplification as it applies to risk perception. Perceptions of the magnitude of a risk are conditioned by issues such as the degree of uncertainty in probability and consequences, the nature of the consequences and the relative weightings placed on probability and consequences. Risk perceptions are also influenced by factors such as confidence in the operator of an industrial process, trust in the regulator and the perceived fairness of regulatory decision-making. Different people may hold different views about these issues and there may also be difficulties in communication. The paper identifies and discusses self-reinforcing mechanisms, which will be labelled 'lock-in' here. They appear to apply in many situations where social amplification is observed. Historically, the term 'lock-in' has been applied mainly in the technological context but, in this paper, four types of lock-in are identified, namely scientific/technological, economic, social and institutional lock-in. One type of lock-in tends to lead to the next and all are buttressed by people's general acceptance of the familiar, fear of the unknown and resistance to change. The regulator seeks to make decisions which achieve the common good rather than supporting or perpetuating any set of vested interests. In this regard the locked-in positions of stakeholders, whether organisations, interest groups, or individual members of the public, are obstacles and challenges. Existing methods of consultation are unsatisfactory in terms of achieving a proper and productive level of dialogue with stakeholders.

  12. Identificação de biótipos de azevém (Lolium multiflorum resistentes ao herbicida glyphosate em pomares de maçã Identification of glyphosate-resistant ryegrass (Lolium multiflorum biotypes in apple orchards

    Directory of Open Access Journals (Sweden)

    L. Vargas

    2004-12-01

    Full Text Available O glyphosate é um herbicida de amplo espectro utilizado há mais de 15 anos em pomares de maçã na região de Vacaria-RS, para manejo da vegetação nas linhas da cultura. São realizadas, em geral, três a quatro aplicações por ciclo e a dose normalmente utilizada é de 720 a 1.080 g e.a. ha-1 de glyphosate (2 a 3 L ha-1 do produto comercial. O azevém (Lolium multiflorum é uma planta daninha comum em pomares e, tradicionalmente, sensível ao glyphosate. Entretanto, nos últimos anos a ocorrência de plantas de azevém que, após receberem o tratamento com glyphosate, não manifestam sintomas significativos de toxicidade sugere que elas adquiriram resistência ao produto. Assim, com o objetivo de avaliar a resposta de uma população de plantas de azevém ao glyphosate, foram realizados três experimentos: um em campo e dois em casa de vegetação. No experimento em campo os tratamentos avaliados constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880, 5.760 e 11.520 g e.a. ha-1, e os herbicidas paraquat, glufosinate, haloxyfop e diclofop foram empregados como produtos-padrão, aplicados em dois estádios vegetativos do azevém. No experimento em casa de vegetação, os tratamentos constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880 e 5.760 g e.a. ha-1 mais os herbicidas testemunhas, aplicados sobre plantas do biótipo considerado resistente e de um sensível. No segundo experimento realizado em casa de vegetação foram avaliados tratamentos contendo glyphosate (720, 1.440, 2.880, 720 + 720 e 720 + 1.440 g e.a. ha-1, em aplicações únicas e seqüenciais, mais os herbicidas paraquat, glufosinate, haloxyfop, clethodim, sethoxydim, diclofop, fenoxaprop, fluazifop, paraquat + diuron, atrazine + simazine, trifluralin e metolachlor. A toxicidade dos tratamentos herbicidas foi avaliada aos 15, 30 e 45 DAT (dias após tratamento. Os resultados obtidos nos experimentos em campo e em casa de vegetação, de forma

  13. Seletividade de formulações de glyphosate a Trichogramma pretiosum (Hymenoptera: Trichogrammatidae Side-effects of glyphosate formulations on Trichogramma pretiosum (Hymenoptera: Trichogrammatidae

    Directory of Open Access Journals (Sweden)

    F.P. Giolo

    2005-09-01

    Full Text Available O estudo foi conduzido para avaliar a seletividade de oito formulações de glyphosate (Roundup®, Roundup® WG, Roundup® Transorb, Polaris®, Gliz® 480 CS, Glifosato Nortox®, Glifosato 480 Agripec® e Zapp® Qi registradas no Brasil sobre o parasitóide de ovos Trichogramma pretiosum (Hym., Trichogrammatidae. Os experimentos consistiram na exposição de adultos do parasitóide a resíduos secos das formulações pulverizadas sobre placas de vidro, na concentração de 14,4 mg L-1 de equivalente ácido de glyphosate. O tratamento controle recebeu água destilada. Ovos do hospedeiro alternativo Anagasta kuehniella (Lep., Pyralidae foram ofertados para parasitismo. A capacidade de parasitismo por fêmea de T. pretiosum e a redução na capacidade, comparada com o tratamento controle, foram utilizadas para estimar a toxicidade do produto. As formulações foram classificadas em quatro categorias, conforme a redução no parasitismo: inócuo (99%. Os produtos fitossanitários afetaram diferentemente a capacidade de parasitismo de T. pretiosum. A seletividade das formulações de glyphosate foi dependente do tipo de sal. Aquelas à base de sal potássico (Zapp® Qi e de sal de amônio (Roundup® WG foram levemente nocivas a adultos do parasitóide. As demais à base de sal isopropilamina (Roundup®, Polaris®, Gliz® 480 CS, Glifosato Nortox®, Glifosato 480 Agripec® e Roundup® Transorb foram moderadamente nocivas a adultos de T. pretiosum.A study was carried out in the laboratory to investigate the side-effects reported in Brazil of eight glyphosate formulations (Roundup®, Roundup® WG, Roundup® Transorb, Polaris®, Gliz® 480 CS, Glifosato Nortox®, Glifosato 480 Agripec® and Zapp® Qi on the egg parasitoid Trichogramma pretiosum (Hym., Trichogrammatidae. The experiments were carried out by exposing the adult parasitoids to fresh pesticide residues applied on glass plates at a concentration of 14.4 mg L-1 of acid equivalent of glyphosate

  14. Respiração microbiana do solo sob doses de glyphosate e de imazapyr Microbial respiration under doses of glyphosate and imazapyr

    Directory of Open Access Journals (Sweden)

    Adailson P. de Souza

    1999-12-01

    Full Text Available A degradação microbiana dos herbicidas no solo é influenciada por diversos fatores, dentre esses as características físicas e químicas do solo e da própria molécula, que agem continuamente determinando a sua magnitude. Em razão da grande variabilidade de respostas apresentadas por essas moléculas no solo e das poucas informações sobre o seu comportamento em ambientes tropicais, no que diz respeito a sua degradação, é que foi realizada uma série de experimentos, em laboratório, objetivando verificar a resposta da atividade microbiana do solo, pelo método da evolução do CO2 do solo, sob doses crescentes do glyphosate e do imazapyr (0; 4; 8 e 12 L ha-1 do produto comercial Roundup S.Aq.C. e Arsenal 250 S.Aq.C., respectivamente, em solos de diferentes texturas e composição química, sob três conteúdos de umidade (40, 70 e 100% do equivalente de umidade. Os resultados obtidos permitiram concluir que: a a microbiota do solo é capaz de utilizar o glyphosate e o imazapyr como fontes de carbono; b a umidade do solo influencia a capacidade de os microrganismos degradarem o glyphosate e o imazapyr; c a umidade de 40%, nos solos avaliados, proporcionou as menores respostas da atividade dos microrganismos, independentemente das doses dos herbicidas; e d o efeito das doses do imazapyr sobre a atividade microbiana do solo é influenciado pelas características físicas e químicas dos solos.The microbial degradation of herbicides in soil is affected by several factors such as the chemical and physical characteristics of the soil and the proper molecule which act continuously determining the degradation magnitude. Considering the large variability of the responses presented by these molecules in the soil as well as the scarce information about their behavior in tropical environments relatively to their degradation, a series of experiments was carried out under laboratory conditions aiming to verify the response of soil microbial

  15. 草甘膦对土壤微生物的影响%Effects of glyphosate on soil microorganisms

    Institute of Scientific and Technical Information of China (English)

    陶波; 蒋凌雪; 沈晓峰; 栾凤侠; 邱丽娟

    2011-01-01

    Black soil in northeast region of China was used to investigate the effects of glyphosate on soil respiration, soil cultural bacteria, Rhizobium japonicum and Fusarium oxysporum, to provide a theoretical basis for the evaluation of environmental safety of glyphosate. The results showed that increasing glyphosate concentration increased the inhibition on soil respiration. When glyphosate concentration in soil were ling · kg-1 , 10mg · kg-1 and 100 mg · kg-1 , the risk index were 1.20, 0. 322 and 0.076, which were less than the standard index of 20.Glyphosate influenced quantities of soil fungi and actinomycetes. High glyphosate concentration increased the inhibition to population of soil cultural bacteria. With the extended application of glyphosate, soil fungus, bacteria and actinomycetes populations had been restored. Actinomycetes were more sensitive to glyphosate than fungus and bacteria, and soil bacteria had a strong tolerance or degrading ability to glyphosate. Glyphosate impacted on inhibiting Rhizobium japonicum and Fusarium oxysporum, and the inhibition of Rhizobium japonicum was in direct proportion with the concentration of glyphosate. Low glyphosate concentration promoted Fusarium oxysporum populations,while high concentration inhibited them. The extended application time of glyphosate decreased the inhibition of glyphosate on Rhizobium japonicum and Fusarium oxysporum.%以东北地区黑土为材料,探讨草甘膦对土壤呼吸、土壤可培养菌种群数量、大豆固氮根瘤菌和大豆根腐镰刀菌数量的影响.研究结果表明,随着草甘膦浓度的加大,土壤呼吸的抑制作用增强,土壤中草甘膦含量为1mg·kg-1、10mg·kg-1、100mg·kg-1时,危害系数分别为1.20、0.322、0.076,远小于无危害标准系数20,确定草甘膦对土壤微生物低毒或无实际危害.不同浓度的草甘膦对土壤真菌、放线菌种群数量具有一定影响.土壤可培养菌种群数量随草甘膦浓度的升高抑制作

  16. Effects of glyphosate and the glyphosate based herbicides Roundup Original(®) and Roundup Transorb(®) on respiratory morphophysiology of bullfrog tadpoles.

    Science.gov (United States)

    Rissoli, Rafael Zanelli; Abdalla, Fabio Camargo; Costa, Monica Jones; Rantin, Francisco Tadeu; McKenzie, David John; Kalinin, Ana Lucia

    2016-08-01

    Glyphosate-based herbicides are widely used in agriculture and are commonly found in water bodies. Roundup Original(®) (RO) contains an isopropylamine glyphosate (GLY) salt containing the surfactant POEA, while Roundup Transorb R(®) (RTR) contains a potassium salt of GLY with unknown surfactants. Both contain different compositions of so-called "inert" ingredients, more toxic than glyphosate. Amphibian tadpoles often experience variations in O2 availability in their aquatic habitats; an ability to tolerate hypoxia can condition their survival and fitness. We evaluated the impacts of sublethal concentrations of GLY (1 mg L(-1)), RO (1 mg L(-1) GLY a.e) and RTR (1 mg L(-1) GLY a.e) on metabolic rate (V·O2 - mLO2 Kg1 h(-1)) of bullfrog tadpoles during normoxia and graded hypoxia, and related this to morphology of their skin, their major site of gas exchange. In control (CT) V·O2 remained unaltered from normoxia until 40 mmHg, indicating a critical O2 tension between 40 and 20 mmHg. GLY significantly reduced V·O2, possibly due to epidermal hypertrophy, which increased O2 diffusion distance to O2 uptake. In contrast, RTR increased V·O2 during hypoxia, indicating an influence of "inert" compounds and surfactants. V·O2 of RO did not differ from CT, suggesting that any increase in V·O2 caused by exposure was antagonized by epidermal hypertrophy. Indeed, all herbicides caused marked alterations in skin morphology, with cell and epithelium wall presenting hyperplasia or hypertrophy and chromatid rupture. In summary, GLY, RO and RTR exert different effects in bullfrog tadpoles, in particular the surfactants and inert compounds appear to influence oxygen uptake. PMID:27160633

  17. Conference summaries

    International Nuclear Information System (INIS)

    The summaries were derived from presentations, interviews and discussions at the conference. The summaries are given at two levels, overall for the conference and for specific sessions as follows: 1) Overall Conference: 'A Sound Scientific Basis for Serious Decisions; 2) Sessions on EC Policy and Socio-Political Issues: 'Promoting Safety and Protecting Society'; 3) Session on P and T: 'Partitioning and Transmutation: A Technical Fix or Technical Training?'; 4) Sessions on Geological Disposal and Research Networking: 'No Technical Barriers to Geological Disposal'. First an overall summary of Euradwaste '04 is presented. Significant progress was made on the technical and scientific basis for geological disposal of radioactive waste during the European Commission's Fifth EURATOM Framework Programme for Research (FP5). Deep geological disposal is technically feasible now and can demonstrate the guarantees of long-term isolation and protection of the public. In parallel, socio-political studies have produced methodologies for constructive dialogue with potential host communities that reflect the honesty and openness expected by a democratic society. A harmonized legislative framework for nuclear safety and waste disposal across the enlarged European Union is currently being discussed. Disposal in deep (> 300 metre) geological repositories, the favoured strategy in Europe for long-lived high-level radioactive waste, is now possible. The Sessions on EC Policy and Socio-Political Issues are summarized as follows. The opening day of Euradwaste '04 focused on European Commission policy, including the proposed Directives on disposal of radioactive waste and nuclear safety and socio-political aspects including governance and decision making, public perception/acceptance of waste disposal and its sustainability. A decision on the proposed package will now be made after Union enlargement. Public agreement on the siting of disposal facilities is controversial and more important

  18. Efeitos de diferentes formulações comerciais de glyphosate sobre estirpes de Bradyrhizobium Effects of different glyphosate commercial formulations on Bradyrhizobium strains

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2004-06-01

    Full Text Available O objetivo deste trabalho foi avaliar efeitos de formulações comerciais de glyphosate sobre estirpes de Bradyrhizobium, em condições de laboratório. As formulações foram aplicadas na concentração de 43,2 µg L-1 do equivalente ácido. As bactérias foram inoculadas em meio de cultura à base de manitol e extrato de levedura (YM. O efeito do herbicida no crescimento das estirpes de Bradyrhizobium foi avaliado mediante leitura da densidade ótica em espectrofotômetro. Avaliou-se o crescimento das estirpes de B. japonicum SEMIA 5079 e de B. elkanii SEMIA 5019 e SEMIA 587 sob efeito de nove formulações de glyphosate: Zapp Qi®, Roundup®, Roundup Multiação®, Roundup Transorb®, Roundup WG®, Trop®, Agrisato®, glyphosate técnico [padrão de N-(phosphonomethyl glycina] e controle sem adição de herbicida (testemunha para as estirpes. Foram utilizadas seis repetições. Confeccionaram-se curvas de crescimento para cada estirpe. Pelos resultados, pôde-se observar que todas as formulações de glyphosate causaram efeitos diferenciados sobre as estirpes de Bradyrhizobium SEMIA 5019, SEMIA 5079 e SEMIA 587. Constatou-se que a formulação Zapp Qi foi a menos tóxica às estirpes de Bradyrhizobium avaliadas. A maior toxicidade foi observada para Roundup Transorb, que provocou reduções no crescimento acima de 94% para todas as estirpes de Bradyrhizobium estudadas. Não se observou correlação entre o tipo de sal - isopropilamina, amônio ou potássico, presentes na formulação herbicida - e o grau de inibição no crescimento das estirpes. SEMIA 587 foi a estirpe menos tolerante à maioria das formulações testadas, porém SEMIA 5019 foi a mais sensível ao glyphosate padrão, sem adição de sais ou de outros aditivos.This work aimed to evaluate the effects of glyphosate commercial formulations on Bradyrhizobium strains under laboratory conditions. The formulations were applied in the concentration of 43.2 µg L-1 of the a.e. and

  19. Efeitos de diferentes formulações comerciais de glyphosate sobre estirpes de Bradyrhizobium Effects of different glyphosate commercial formulations on Bradyrhizobium strains

    OpenAIRE

    J.B. Santos; Jacques, R.J.S.; S.O. Procópio; M.C.M. Kasuya; A.A. Silva; E.A. Santos

    2004-01-01

    O objetivo deste trabalho foi avaliar efeitos de formulações comerciais de glyphosate sobre estirpes de Bradyrhizobium, em condições de laboratório. As formulações foram aplicadas na concentração de 43,2 µg L-1 do equivalente ácido. As bactérias foram inoculadas em meio de cultura à base de manitol e extrato de levedura (YM). O efeito do herbicida no crescimento das estirpes de Bradyrhizobium foi avaliado mediante leitura da densidade ótica em espectrofotômetro. Avaliou-se o crescimento das e...

  20. Variabilidade genética e sensibilidade de acessos de Pistia stratiotes ao herbicida glyphosate Genetic variability and sensitivity of Pistia stratiotes accesses to glyphosate

    OpenAIRE

    E.A.S. Cícero; R.A. Pitelli; J.A.D. Sena; A.S. Ferraudo

    2007-01-01

    A alface-d'água (Pistia stratiotes) é uma das principais entre as macrófitas aquáticas que causam problemas em corpos hídricos no Brasil e são consideradas como plantas daninhas. O presente trabalho foi realizado com os objetivos de conhecer melhor a variabilidade genética dessa macrófita e relacionar essa variabilidade com a resposta à aplicação do herbicida glyphosate. Para isso, foram coletados indivíduos em 12 corpos hídricos em diferentes cidades do território nacional (Americana, Cambar...

  1. Seletividade do halosulfuron isolado ou em mistura com glyphosate para culturas anuais Selectivity of halosulfuron alone or in mixture with glyphosate for annual crops

    OpenAIRE

    L.S. Souza; Martins, D; D. Camposilvan; E.D. Velini; Palma, V.

    2001-01-01

    O objetivo do presente trabalho foi avaliar a seletividade do herbicida halosulfuron isoladamente e na mistura com glyphosate, aplicados em pré e pós-emergência, para culturas de verão (milho, feijão, algodão e soja) e para culturas de inverno (aveia-preta, azevém, centeio, trigo e triticale). Foram instalados dois experimentos em campo, nas Fazendas Experimentais do Lageado e de São Manuel - UNESP - Botucatu-SP - Brasil. Os tratamentos foram constituídos da aplicação isolada do herbicida hal...

  2. Danos visuais e anatômicos causados pelo glyphosate em folhas de Eucalyptus grandis Visible and anatomic damages caused by glyphosate in Eucalyptus grandis leaves

    OpenAIRE

    L.D. Tuffi Santos; B.F Sant'anna-Santos; R.M.S.A. Meira; R.A.S. Tiburcio; F.A. Ferreira; C.A.D. Melo; E.F.S. Silva

    2008-01-01

    A sintomatologia é um dos principais critérios adotados para avaliar os danos causados por fatores bióticos e abióticos em plantas. Contudo, aspectos microscópicos são necessários na compreensão dos mecanismos de intoxicação e no diagnóstico precoce da injúria. Objetivou-se no presente estudo avaliar os efeitos da deriva simulada de quatro formulações comerciais de glyphosate (Scout®, Roundup NA®, Roundup transorb® e Zapp QI®) sobre a morfoanatomia foliar de seis clones de Eucalyptus grandis ...

  3. Prediction of the glyphosate sorption coefficient across two loamy agricultural fields

    DEFF Research Database (Denmark)

    Paradelo Pérez, Marcos; Norgaard, Trine; Møldrup, Per;

    2015-01-01

    sorption coefficient, Kd, from easily measurable soil properties in two loamy, agricultural fields in Denmark: Estrup and Silstrup. Forty-five soil samples in Estrup and 65 in Silstrup were collected from the surface in a rectangular grid of 15×15-m from each field, and selected soil properties and...... glyphosate sorption coefficients were determined. Multiple linear regression (MLR) analyses were performed using nine geo-referenced soil properties as variables to identify the parameters related with glyphosate sorption. Scenarios considered in the analyses included: (i) each field separately, (ii) both...... fields together, and (iii) northern and southern sections of the field in Silstrup. Considering correlations with all possible sets of the same nine geo-referenced properties, a best-four set of parameters was identified for each model scenario. The best-four set for the field in Estrup included clay...

  4. Genotoxicity of mixtures of glyphosate and atrazine and their environmental transformation products before and after photoactivation.

    Science.gov (United States)

    Roustan, A; Aye, M; De Meo, M; Di Giorgio, C

    2014-08-01

    The photo-inducible cytogenetic toxicity of glyphosate, atrazine, aminomethyl phosphoric acid (AMPA), desethyl-atrazine (DEA), and their various mixtures was assessed by the in vitro micronucleus assay on CHO-K1 cells. Results demonstrated that the cytogenetic potentials of pesticides greatly depended on their physico-chemical environment. The mixture made with the four pesticides exhibited the most potent cytogenetic toxicity, which was 20-fold higher than those of the most active compound AMPA, and 100-fold increased after light-irradiation. Intracellular ROS assessment suggested the involvement of oxidative stress in the genotoxic impact of pesticides and pesticide mixtures. This study established that enhanced cytogenetic activities could be observed in pesticide mixtures containing glyphosate, atrazine, and their degradation products AMPA and DEA. It highlighted the importance of cocktail effects in environmental matrices, and pointed out the limits of usual testing strategies based on individual molecules, to efficiently estimate environmental risks. PMID:24875917

  5. Evaluation of carcinogenic potential of the herbicide glyphosate, drawing on tumor incidence data from fourteen chronic/carcinogenicity rodent studies.

    Science.gov (United States)

    Greim, Helmut; Saltmiras, David; Mostert, Volker; Strupp, Christian

    2015-03-01

    Abstract Glyphosate, an herbicidal derivative of the amino acid glycine, was introduced to agriculture in the 1970s. Glyphosate targets and blocks a plant metabolic pathway not found in animals, the shikimate pathway, required for the synthesis of aromatic amino acids in plants. After almost forty years of commercial use, and multiple regulatory approvals including toxicology evaluations, literature reviews, and numerous human health risk assessments, the clear and consistent conclusions are that glyphosate is of low toxicological concern, and no concerns exist with respect to glyphosate use and cancer in humans. This manuscript discusses the basis for these conclusions. Most toxicological studies informing regulatory evaluations are of commercial interest and are proprietary in nature. Given the widespread attention to this molecule, the authors gained access to carcinogenicity data submitted to regulatory agencies and present overviews of each study, followed by a weight of evidence evaluation of tumor incidence data. Fourteen carcinogenicity studies (nine rat and five mouse) are evaluated for their individual reliability, and select neoplasms are identified for further evaluation across the data base. The original tumor incidence data from study reports are presented in the online data supplement. There was no evidence of a carcinogenic effect related to glyphosate treatment. The lack of a plausible mechanism, along with published epidemiology studies, which fail to demonstrate clear, statistically significant, unbiased and non-confounded associations between glyphosate and cancer of any single etiology, and a compelling weight of evidence, support the conclusion that glyphosate does not present concern with respect to carcinogenic potential in humans. PMID:25716480

  6. Exposure to a glyphosate-based herbicide during pregnancy and lactation induces neurobehavioral alterations in rat offspring.

    Science.gov (United States)

    Gallegos, Cristina E; Bartos, Mariana; Bras, Cristina; Gumilar, Fernanda; Antonelli, Marta C; Minetti, Alejandra

    2016-03-01

    The impact of sub-lethal doses of herbicides on human health and the environment is a matter of controversy. Due to the fact that evidence particularly of the effects of glyphosate on the central nervous system of rat offspring by in utero exposure is scarce, the purpose of the present study was to assess the neurobehavioral effects of chronic exposure to a glyphosate-containing herbicide during pregnancy and lactation. To this end, pregnant Wistar rats were exposed through drinking water to 0.2% or 0.4% of a commercial formulation of glyphosate (corresponding to a concentration of 0.65 or 1.30g/L of glyphosate, respectively) during pregnancy and lactation and neurobehavioral alterations in offspring were analyzed. The postnatal day on which each pup acquired neonatal reflexes (righting, cliff aversion and negative geotaxis) and that on which eyes and auditory canals were fully opened were recorded for the assessment of sensorimotor development. Locomotor activity and anxiety levels were monitored via open field test and plus maze test, respectively, in 45- and 90-day-old offspring. Pups exposed to a glyphosate-based herbicide showed early onset of cliff aversion reflex and early auditory canal opening. A decrease in locomotor activity and in anxiety levels was also observed in the groups exposed to a glyphosate-containing herbicide. Findings from the present study reveal that early exposure to a glyphosate-based herbicide affects the central nervous system in rat offspring probably by altering mechanisms or neurotransmitter systems that regulate locomotor activity and anxiety. PMID:26632987

  7. Potential use of soil-born fungi isolated from treated soil in Indonesia to degrade glyphosate herbicide

    Directory of Open Access Journals (Sweden)

    N. Arfarita

    2014-01-01

    Full Text Available The glyphosate herbicide is the most common herbicides used in palm-oil plantations and other agricultural in Indonesial. In 2020, Indonesian government to plan the development of oil palm plantations has reached 20 million hectares of which now have reached 6 million hectares. It means that a huge chemicals particularly glyphosate has been poured into the ground and continues to pollute the soil. However, there is no report regarding biodegradation of glyphosate-contaminated soils using fungal strain especially in Indonesia. This study was to observe the usage of Round Up as selection agent for isolation of soil-born fungi capable to grow on glyphosate as a sole source of phosphorus. Five fungal strains were able to grow consistently in the presence of glyphosate as the sole phosphorus source and identified as Aspergillus sp. strain KRP1, Fusarium sp. strain KRP2, Verticillium sp. strain KRP3, Acremoniumsp. strain GRP1 and Scopulariopsis sp. strain GRP2. This indicates as their capability to utilize and degrade this herbicide. We also used standard medium as control and get seventeen fungal strains. The seventeen fungal strains were identified as species of Botrytis, Fusarium, Aspergillus, Penicillium, Verticillium, Trichoderma and Paecilomyces. These results show the reduction in the number of fungal strains on solid medium containing glyphosate. Of the five isolated fungal species, Verticillium sp. strain KRP3 and Scopulariopsis sp. strain GRP2 were selected for further study based on their highest ratio of growth diameter. This study indicates that treatment of soil with glyphosate degrading fungus would be useful in some areas where this herbicide is extensively used

  8. Potential use of soil-born fungi isolated from treated soil in Indonesia to degrade glyphosate herbicide

    Directory of Open Access Journals (Sweden)

    N. Arfarita

    2014-01-01

    Full Text Available The glyphosate herbicide is the most common herbicides used in palm-oil plantations and other agricultural in Indonesial. In 2020, Indonesian government to plan the development of oil palm plantations has reached 20 million hectares of which now have reached 6 million hectares. It means that a huge chemicals particularly glyphosate has been poured into the ground and continues to pollute the soil. However, there is no report regarding biodegradation of glyphosate-contaminated soils using fungal strain especially in Indonesia. This study was to observe the usage of Round Up as selection agent for isolation of soil-born fungi capable to grow on glyphosate as a sole source of phosphorus. Five fungal strains were able to grow consistently in the presence of glyphosate as the sole phosphorus source and identified as Aspergillus sp. strain KRP1, Fusarium sp. strain KRP2, Verticillium sp. strain KRP3, Acremoniumsp. strain GRP1 and Scopulariopsis sp. strain GRP2. This indicates as their capability to utilize and degrade this herbicide. We also used standard medium as control and get seventeen fungal strains. The seventeen fungal strains were identified as species of Botrytis, Fusarium, Aspergillus, Penicillium, Verticillium, Trichoderma and Paecilomyces. These results show the reduction in the number of fungal strains on solid medium containing glyphosate. Of the five isolated fungal species, Verticillium sp. strain KRP3 and Scopulariopsis sp. strain GRP2 were selected for further study based on their highest ratio of growth diameter. This study indicates that treatment of soil with glyphosate degrading fungus would be useful in some areas where this herbicide is extensively used.

  9. Metallic complexes with glyphosate: a review; Complexos metalicos com o herbicida glifosato: revisao

    Energy Technology Data Exchange (ETDEWEB)

    Coutinho, Claudia F.B.; Mazo, Luiz Henrique [Sao Paulo Univ., Sao Carlos, SP (Brazil). Inst. de Quimica]. E-mail: claudiabreda@iqsc.usp.br

    2005-11-15

    We present studies involving metallic ions and the herbicide glyphosate. The metallic complexes of Cu(II), Zn(II), Mn(II), Ni(II), Cd(II), Pb(II), Cr(III), Fe(III), Co(III), ammonium, sodium, Ag(I), alkaline earth metals and of some lanthanides ions are described. The complexes are discussed in terms of their synthesis, identification, stability and structural properties, based on data from the current literature. (author)

  10. Intellectual property rights related to the genetically modified glyphosate tolerant soybeans in Brazil

    OpenAIRE

    Roberta L Rodrigues; Celso L. S Lage; Alexandre G. Vasconcellos

    2011-01-01

    The present work analyzes the different modalities of protection of the intellectual creations in the biotechnology agricultural field. Regarding the Brazilian legislations related to the theme (the Industrial Property Law - no. 9. 279/96 and the Plant Variety Protection Law - no. 9. 456/97), and based in the international treaties signed by Brazil, the present work points to the inclusions of each of them, as well as to their interfaces using as reference the case study of glyphosate toleran...

  11. Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance

    OpenAIRE

    Samsel, Anthony; Seneff, Stephanie

    2013-01-01

    Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the activ...

  12. Interactive Effects of Imazapyr plus Triclopyr ester and Imazapyr plus Glyphosate Mixtures on Woody Weed Seedlings

    OpenAIRE

    Nespeca, Mathew C.

    1997-01-01

    A rapid primary herbicide screening experiment was conducted to determine if synergism or antagonism occurs with imazapyr(Arsenal®) plus triclopyr ester (Garlon 4®) and imazapyr plus glyphosate(Accord®) mixtures applied to woody weed seedlings. Using a booth sprayer, 66 herbicide treatments were applied to greenhouse grown black cherry (Prunus serotina), winged elm (Ulmus alata), sweetgum (Liquidambar styraciflua), red maple (Acer rubrum), black ...

  13. Effects of pig slurry application on soil physical and chemical properties and glyphosate mobility

    Directory of Open Access Journals (Sweden)

    Daniela Aparecida de Oliveira

    2014-10-01

    Full Text Available Pig slurry applied to soil at different rates may affect soil properties and the mobility of chemical compounds within the soil. The purpose of this study was to evaluate the effects of rates of pig slurry application in agricultural areas on soil physical and chemical properties and on the mobility of glyphosate through the soil profile. The study was carried out in the 12th year of an experiment with pig slurry applied at rates of 0 (control, 50, 100 and 200 m³ ha-1 yr-1 on a Latossolo Vermelho distrófico (Hapludox soil. In the control, the quantities of P and K removed by harvested grains were replaced in the next crop cycle. Soil physical properties (bulk density, porosity, texture, and saturated hydraulic conductivity and chemical properties (organic matter, pH, extractable P, and exchangeable K were measured. Soil solution samples were collected at depths of 20, 40 and 80 cm using suction lysimeters, and glyphosate concentrations were measured over a 60-day period after slurry application. Soil physical and chemical properties were little affected by the pig slurry applications, but soil pH was reduced and P levels increased in the surface layers. In turn, K levels were increased in sub-surface layers. Glyphosate concentrations tended to decrease over time but were not affected by pig slurry application. The concentrations of glyphosate found in different depths show that the pratice of this application in agricultural soils has the potential for contamination of groundwater, especially when the water table is the surface and heavy rains occur immediately after application.

  14. Evaluation of the joint effect of glyphosate and dimethoate using a small-scale terrestrial ecosystem

    OpenAIRE

    Santos, MJG; Morgado, R; Ferreira, NGC; Soares, AMVM; Loureiro, S

    2011-01-01

    In the present work a small-scale terrestrial ecosystem (STEM) containing a soil collected from an agricultural field in Central Portugal was used to evaluate the effects of the combination of the herbicide glyphosate and the insecticide dimethoate. Earthworms (Eisenia andrei), isopods (Porcellionides pruinosus), turnip seeds (Brassica rapa), and bait-lamina strips were placed in the STEM. The results showed that the application of the recommended field dose of both pesticides did not cause a...

  15. Side-Effects of Glyphosate to the Parasitoid Telenomus remus Nixon (Hymenoptera: Platygastridae).

    Science.gov (United States)

    Stecca, C S; Bueno, A F; Pasini, A; Silva, D M; Andrade, K; Filho, D M Z

    2016-04-01

    The aim of this study was to compare the side-effects of glyphosate to the parasitoid Telenomus remus Nixon (Hymenoptera: Platygastridae) when parasitoids were exposed to this chemical at the pupal (inside host eggs) and adult stages. Bioassays were conducted under laboratory conditions according to the International Organization for Biological Control (IOBC) standard methods for testing side-effects of pesticides to egg parasitoids. Different glyphosate-based pesticides (Roundup Original®, Roundup Ready®, Roundup Transorb®, Roundup WG®, and Zapp Qi®) were tested at the same acid equivalent concentration. Treatments were classified following the IOBC toxicity categories as (1) harmless, (2) slightly harmful, (3) moderately harmful, and (4) harmful. When tested against T. remus adults, Roundup Original®, Roundup Ready®, Roundup Transorb®, and Roundup WG® reduced parasitism 2 days after parasitoid emergence, being classified as slightly harmful. Differently, when tested against T. remus pupae, all tested glyphosate-based products did not differ in their lethal effect and therefore did not reduce T. remus adult emergence or parasitism capacity, being classified as harmless. However, differences on sublethal toxicity were found. Parasitism of individuals emerging from parasitized eggs sprayed at the pupal stage of T. remus with Zapp Qi® was lower compared to control, but parasitism was still higher than 66%, and therefore, Zapp Qi® was still classified as harmless. In conclusion, all tested glyphosate-based products can be used in agriculture without negative impact to T. remus as none was classified as harmful or moderately harmful to this parasitoid when exposure occurred at the pupal or adult stages. PMID:26842914

  16. Efeito de formulações na absorção e translocação do glyphosate em soja transgênica Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2007-01-01

    Full Text Available Este trabalho teve como objetivo avaliar a absorção e translocação de glyphosate em diferentes formulações por plantas de soja (variedade CD 219RR. Para isso, aplicou-se o 14C-glyphosate misturado à calda em três formulações comerciais (Roundup Ready® e R. Transorb®, ambas contendo o sal de isopropilamina, e Zapp Qi��, formulado à base do sal potássico, quando as plantas apresentavam o segundo trifólio completamente expandido. Transcorridas 4, 16, 40 e 64 horas após a aplicação, as plantas foram coletadas e fracionadas, separando-se a folha de aplicação (trifólio, a parte aérea, as raízes e os nódulos radiculares. O 14C-glyphosate não-absorvido foi recuperado e contado por meio da lavagem da folha (metanol 80%. Entre as formulações foi observada variação na penetração e na translocação do 14C-glyphosate para as diferentes partes avaliadas. Todavia, em todas as formulações a maior absorção se deu nos intervalos posteriores a 16 horas da aplicação. Em relação ao total de herbicida encontrado nas plantas de soja, maior percentual na parte aérea foi observado quando se aplicou o Zapp Qi® (sal potássico e, nas raízes, o R. Transorb® (sal de isopropilamina. Detectou-se a presença de 14C glyphosate nos nódulos radiculares das plantas em todos os tratamentos, sendo o maior percentual observado quando se utilizou R. Transorb®, 40 horas após a aplicação (0,13% do total medido ou 0,4% considerando somente o total presente na planta. Os resultados reforçam a hipótese de que o glyphosate pode prejudicar a simbiose entre rizóbio e soja, uma vez que o microssimbionte também apresenta em seu metabolismo a EPSPS, sensível a esse herbicida.This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready® and R. Transorb® - both with isopropylamine salt

  17. Synthesis of {sup 15}N labeled glyphosate; Sintese do glifosato enriquecido com {sup 15}N

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Claudineia R. de; Bendassolli, Jose Albertino; Tavares, Glauco Arnold; Rossete, Alexssandra L.R.M.; Tagliassachi, Romulo Barbieri; Prestes, Cleuber Vieira [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil). Dept. de Isotopos Estaveis]. E-mail: crolivei@cena.usp.br

    2005-07-01

    Amongst the actually commercialized herbicides the Glyphosate is the most used in Brazil. Its efficiency as well as the others herbicides against undesirable weeds is harmed by its final composts left at the environment. Although studies has being carried out to improve the knowledge about the herbicides behavior at the environment its complexity has led them towards innumerous to new significant research work where the use of radiolabeled composts (radiative tracers) are recommended to evaluate their bio-availability in the soil. However is the use, the manipulation and the storage of radiolabeled composts is requires an extra care under chemical safety point of view. The use of non radiolabeled composts is a world tendency especially for field researches. Under this context the presented work describes a method for the synthesis of {sup 15}N labeled glyphosate. The {sup 15}N-herbicide was undertaken by phosphometilation with the phosphit dialquil and {sup 15}N-glycine. The tests where carried out through a micro scale production plant and of equimolars amounts. At these conditions it's was possible to reach approximately a 20% of yield. At the conclusion of a best operational condition its expected to offer another important toll that shall be used in glyphosate behavior at the environment and undesirably weeds. (author)

  18. An assessment of dietary exposure to glyphosate using refined deterministic and probabilistic methods.

    Science.gov (United States)

    Stephenson, C L; Harris, C A

    2016-09-01

    Glyphosate is a herbicide used to control broad-leaved weeds. Some uses of glyphosate in crop production can lead to residues of the active substance and related metabolites in food. This paper uses data on residue levels, processing information and consumption patterns, to assess theoretical lifetime dietary exposure to glyphosate. Initial estimates were made assuming exposure to the highest permitted residue levels in foods. These intakes were then refined using median residue levels from trials, processing information, and monitoring data to achieve a more realistic estimate of exposure. Estimates were made using deterministic and probabilistic methods. Exposures were compared to the acceptable daily intake (ADI)-the amount of a substance that can be consumed daily without an appreciable health risk. Refined deterministic intakes for all consumers were at or below 2.1% of the ADI. Variations were due to cultural differences in consumption patterns and the level of aggregation of the dietary information in calculation models, which allows refinements for processing. Probabilistic exposure estimates ranged from 0.03% to 0.90% of the ADI, depending on whether optimistic or pessimistic assumptions were made in the calculations. Additional refinements would be possible if further data on processing and from residues monitoring programmes were available. PMID:27371367

  19. Liming effect in the degradation of 14C-glyphosate in soils

    Energy Technology Data Exchange (ETDEWEB)

    Arantes, Sayonara A.C.M.; Lavorenti, Arquimedes [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz]. E-mails: samoreno@esalq.usp.br; alavoren@esalq.usp.br; Tornisielo, Valdemar L. [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil)]. E-mail: vltornis@cena.usp.br

    2007-07-01

    Liming is soil fertility management practice essential in tropical soils, in general extremely acidic. This practice, by influencing physical, chemical and biological features of soils may influence the behavior of organic molecules in soils. The glyphosate is one the most widely used pesticides in Brazil in several cultures to pest management control. Studies on its fate in soil are still incipient, mainly under the effect of liming practice The objective of the present study was to verify the effect of liming practice in the degradation of glyphosate in Red Latosol (LE) and Quartzarenic Neosol (RQ) soils and also in the microbial activity of the same soils. The experiment was conducted in a completely randomized design in a 2 x 2 factorial scheme, corresponding to two soils and two management conditions (with liming and without liming), with four replicates. The Radiometric technique was utilized to evaluate the evolution the {sup 14}CO{sub 2} at intervals of 7 days, during 70 days. The study of microbial activity was conducted parallel to the degradation experiment, using the methodology of radiolabelled glucose ({sup 14}C-glucose), which was measured at intervals of fourteen days, during 70 days. The results showed that in the studied soils, the liming increased the {sup 14}C-glyphosate mineralization and the microbial activity. (author)

  20. Systematic review and meta-analysis of glyphosate exposure and risk of lymphohematopoietic cancers

    Science.gov (United States)

    Chang, Ellen T.; Delzell, Elizabeth

    2016-01-01

    ABSTRACT This systematic review and meta-analysis rigorously examines the relationship between glyphosate exposure and risk of lymphohematopoietic cancer (LHC) including NHL, Hodgkin lymphoma (HL), multiple myeloma (MM), and leukemia. Meta-relative risks (meta-RRs) were positive and marginally statistically significant for the association between any versus no use of glyphosate and risk of NHL (meta-RR = 1.3, 95% confidence interval (CI) = 1.0–1.6, based on six studies) and MM (meta-RR = 1.4, 95% CI = 1.0–1.9; four studies). Associations were statistically null for HL (meta-RR = 1.1, 95% CI = 0.7–1.6; two studies), leukemia (meta-RR = 1.0, 95% CI = 0.6–1.5; three studies), and NHL subtypes except B-cell lymphoma (two studies each). Bias and confounding may account for observed associations. Meta-analysis is constrained by few studies and a crude exposure metric, while the overall body of literature is methodologically limited and findings are not strong or consistent. Thus, a causal relationship has not been established between glyphosate exposure and risk of any type of LHC. PMID:27015139

  1. Overcoming Hard Water Antagonistic to Glyphosate or Imazethapyr with Water Conditioners

    Directory of Open Access Journals (Sweden)

    Akbar ALIVERDI

    2014-06-01

    Full Text Available Carrier water quality may affect the activity of weak acid herbicides when concentrations of some cations are high. A dose-response experiment on glyphosate and imazethapyr activity, which were carried by the carrier types of distilled water and hard water, against jimsonweed were conducted to compare the water conditioning chemicals ammonium sulfate, ammonium nitrate, citric acid and potassium phosphate, with magnetized carrier as a new method. A magnetic field of 0.7 Tesla was applied to prepare the magnetized carrier. With the exception of potassium phosphate with imazethapyr, the activity of glyphosate and imazethapyr was significantly increased in the presence of the water conditioning methods when distilled water was used as the carrier. Ammonium sulfate was the most effective method. The activity of both herbicides was decreased when applied with hard water carrier. Potassium phosphate was not effective at reducing the antagonism of cations in the hard water carrier. In glyphosate, the performance of water conditioning methods in softening hard water carrier could be ranked as follows: ammonium sulfate (2.52-fold > magnetized carrier (2.12-fold ≥ citric acid (1.64-fold ≥ ammonium nitrate (1.39-fold > potassium phosphate (0.96-fold. In imazethapyr, this order was as follows: ammonium sulfate (2.99-fold > ammonium nitrate (2.66-fold > magnetized carrier (1.81-fold ≥ citric acid (1.64-fold > potassium phosphate (1.10-fold.

  2. Systematic review and meta-analysis of glyphosate exposure and risk of lymphohematopoietic cancers.

    Science.gov (United States)

    Chang, Ellen T; Delzell, Elizabeth

    2016-06-01

    This systematic review and meta-analysis rigorously examines the relationship between glyphosate exposure and risk of lymphohematopoietic cancer (LHC) including NHL, Hodgkin lymphoma (HL), multiple myeloma (MM), and leukemia. Meta-relative risks (meta-RRs) were positive and marginally statistically significant for the association between any versus no use of glyphosate and risk of NHL (meta-RR = 1.3, 95% confidence interval (CI) = 1.0-1.6, based on six studies) and MM (meta-RR = 1.4, 95% CI = 1.0-1.9; four studies). Associations were statistically null for HL (meta-RR = 1.1, 95% CI = 0.7-1.6; two studies), leukemia (meta-RR = 1.0, 95% CI = 0.6-1.5; three studies), and NHL subtypes except B-cell lymphoma (two studies each). Bias and confounding may account for observed associations. Meta-analysis is constrained by few studies and a crude exposure metric, while the overall body of literature is methodologically limited and findings are not strong or consistent. Thus, a causal relationship has not been established between glyphosate exposure and risk of any type of LHC. PMID:27015139

  3. Glyphosate and AMPA adsorption in soils: laboratory experiments and pedotransfer rules.

    Science.gov (United States)

    Sidoli, Pauline; Baran, Nicole; Angulo-Jaramillo, Rafael

    2016-03-01

    Adsorption of the herbicide glyphosate and its main metabolite AMPA (aminomethylphosphonic acid) was investigated on 17 different agricultural soils. Batch equilibration adsorption data are shown by Freundlich adsorption isotherms. Glyphosate adsorption is clearly affected by equilibration concentrations, but the nonlinear AMPA adsorption isotherms indicate saturation of the adsorption sites with increasing equilibrium concentrations. pHCaCl2 (i.e. experimental pH) is the major parameter governing glyphosate and AMPA adsorption in soils. However, considering pHCaCl2 values, available phosphate amount, and amorphous iron and aluminium oxide contents by using a nonlinear multiple regression equation, obtains the most accurate and powerful pedotransfer rule for predicting the adsorption constants for these two molecules. As amorphous iron and aluminium oxide contents in soil are not systematically determined, we also propose a pedotransfer rule with two variables-pHCaCl2 values and available phosphate amount-that remains acceptable for both molecules. Moreover, the use of the commonly measured pHwater or pHKCl values gives less accurate results compared to pHCaCl2 measurements. To our knowledge, this study is the first AMPA adsorption characterization for a significant number of temperate climate soils. PMID:26581693

  4. Efeitos de subdoses de glyphosate em plantas jovens de seringueira (Hevea brasiliensis Aubl.

    Directory of Open Access Journals (Sweden)

    Carla Caroline Magalhães Farias

    2012-04-01

    Full Text Available O presente trabalho teve como objetivo avaliar os efeitos fitotóxicos de subdoses de glyphosate em plantas jovens de seringueira (Hevea brasiliensis Aubl.. Um ano após o plantio das mudas, foram testadas três subdosagens de glyphosate, sendo: T1 86,4; T2 172,8 e T3 345,6 g e.a ha-1, e T4 testemunha sem aplicação. Aos 7, 14, 21, 28 e 180 dias após a aplicação (DAA do herbicida foram atribuídas notas para fitotoxicidade visual, sendo que na última avaliação foram feitas as medições do incremento em altura e diâmetro do tronco das plantas. A subdosagem de glyphosate em H. brasiliensis causou danos na dosagem de 345,6 g i.a ha-1, reduzindo o desenvolvimento das plantas em altura e diâmetro, no entanto, houve recuperação no crescimento dessas plantas, observado aos 180 dias após a aplicação do herbicida.

  5. Liming effect in the degradation of 14C-glyphosate in soils

    International Nuclear Information System (INIS)

    Liming is soil fertility management practice essential in tropical soils, in general extremely acidic. This practice, by influencing physical, chemical and biological features of soils may influence the behavior of organic molecules in soils. The glyphosate is one the most widely used pesticides in Brazil in several cultures to pest management control. Studies on its fate in soil are still incipient, mainly under the effect of liming practice The objective of the present study was to verify the effect of liming practice in the degradation of glyphosate in Red Latosol (LE) and Quartzarenic Neosol (RQ) soils and also in the microbial activity of the same soils. The experiment was conducted in a completely randomized design in a 2 x 2 factorial scheme, corresponding to two soils and two management conditions (with liming and without liming), with four replicates. The Radiometric technique was utilized to evaluate the evolution the 14CO2 at intervals of 7 days, during 70 days. The study of microbial activity was conducted parallel to the degradation experiment, using the methodology of radiolabelled glucose (14C-glucose), which was measured at intervals of fourteen days, during 70 days. The results showed that in the studied soils, the liming increased the 14C-glyphosate mineralization and the microbial activity. (author)

  6. Preparation and adsorption performance of MnO2/PAC composite towards aqueous glyphosate.

    Science.gov (United States)

    Cui, Hao; Li, Qin; Qian, Yan; Zhang, Qiu; Zhai, Jianping

    2012-09-01

    Glyphosate (N-phosphonomethylglycine (PMG)) is the organophosphate herbicide most widely used in the world, and industrial production of PMG generates large quantities of wastewater. A manganese dioxide-coated powdered activated carbon (MnO2/PAC) composite was synthesized and investigated for the adsorption of PMG from wastewater. The results of scanning electron microscopy (SEM) combined with energy-dispersive X-ray spectrometry (EDAX) revealed that MnO2 was formed on the surface of the carbon during the modification process. Batch adsorption results showed that the optimal pH for glyphosate adsorption on MnO2/PAC was 3.0. In the range 0.01(-1) molL(-1), glyphosate removal by MnO2/PAC decreased with an increase in ionic strength. Among the coexistent anions, only phosphate showed significant inhibition of PMG removal due to competitive complexation. Batch studies revealed that MnO2/PAC could reach a maximum PMG adsorption capacity of 283 mg g(-1). The Langmuir equilibrium model was found to be suitable for describing PMG sorption, and kinetic studies revealed that adsorption followed second-order rate kinetics. It was also proved that the adsorbed PMG could be effectively desorbed from MnO2/PAC in 1.0 molL(-1) NaOH. All of these results implied that the MnO2/PAC composite may be used as an effective adsorbent for recycling PMG from wastewater. PMID:23240199

  7. Metabolic profiling and enzyme analyses indicate a potential role of antioxidant systems in complementing glyphosate resistance in an Amaranthus palmeri biotype

    Science.gov (United States)

    Targeted metabolomic profiling and biochemical assays were employed to identify metabolite-level perturbations induced by glyphosate in susceptible (S) and resistant (R) biotypes of Amaranthus palmeri. Plants were treated with 0.4 kg ae ha-1 glyphosate and tissues were harvested at 8 and 72 hours af...

  8. Quantum Amplitude Amplification and Estimation

    CERN Document Server

    Brassard, G; Mosca, M; Tapp, A; Brassard, Gilles; Hoyer, Peter; Mosca, Michele; Tapp, Alain

    2000-01-01

    Consider a Boolean function $\\chi: X \\to \\{0,1\\}$ that partitions set $X$ between its good and bad elements, where $x$ is good if $\\chi(x)=1$ and bad otherwise. Consider also a quantum algorithm $\\mathcal A$ such that $A \\ket{0} = \\sum_{x\\in X} \\alpha_x \\ket{x}$ is a quantum superposition of the elements of $X$, and let $a$ denote the probability that a good element is produced if $A \\ket{0}$ is measured. If we repeat the process of running $A$, measuring the output, and using $\\chi$ to check the validity of the result, we shall expect to repeat $1/a$ times on the average before a solution is found. *Amplitude amplification* is a process that allows to find a good $x$ after an expected number of applications of $A$ and its inverse which is proportional to $1/\\sqrt{a}$, assuming algorithm $A$ makes no measurements. This is a generalization of Grover's searching algorithm in which $A$ was restricted to producing an equal superposition of all members of $X$ and we had a promise that a single $x$ existed such tha...

  9. Conference Papers

    International Nuclear Information System (INIS)

    A total of 18 papers were presented at the 2003 Annual Executive Conference of the Canadian Gas Association held at St. Andrews, NB, from June 25th to June 28th. Titles of the presentations were as follows: (1) 'Positioning natural gas in a transforming world' by Pierre Marcel Desjardins; (2) 'Positioning natural gas in a transforming world' by Jean-Paul Theoret; (3) 'Perceptions of natural gas' by Noel Sampson; (4) 'Energy efficiency as an opportunity for the natural gas industry' by Peter Love; (5) 'Natural gas R and D - NRCan perspective' by Graham R. Campbell; (6) 'Impact of earned media on corporate perceptions in the gas industry' by Michael Coates; (7) 'Moving forward with an initiative for natural gas technology innovation' by Emmanuel Morin; (8) 'Natural gas R and D - No more dodging the issue' by Chuck Szmurlo; (9) 'Meeting the technology needs of the gas industry and the gas consumer' by Stanley S. Borys; (10) 'Market signals' by John Wellard; (11) 'Future sources of Canadian natural gas' by Rick Hyndman; (12) 'The state of supply: Northeast U.S. perspective' by Tom Kiley; (13) 'AGA's priorities and perspectives' by Dick Reiten; (14) 'Global energy issues: Recent development in policy and business' by Gerald Doucet; (15) 'Keeping the distribution cart behind the horse: Why finding more offshore gas is much more important than completing the natural gas grid, including for New Brunswick' by Brian Lee Crowley; (16) 'Environmental opportunities and challenges for the gas industry' by Manfred Klein; (17) 'The potential for natural gas demand destruction' by Timothy Partridge; and (18) 'Pushing the envelope on gas supply' by Roland R. George. In most instances only speaking notes and view graphs are available

  10. Electrooxidación de glifosato sobre electrodos de níquel y cobre Electrooxidation of glyphosate on niquel and copper electrodes

    Directory of Open Access Journals (Sweden)

    Edgar Virgilio Sierra

    2008-01-01

    Full Text Available The electrochemical oxidation of glyphosate on an electrode of nickel and on one of copper was studied. With both electrodes electrochemical signals related to the glyphosate concentration were observed. However, the behaviour of the copper electrode was much better than that of the nickel electrode. A calibration curve was obtained of the electrical signal of this electrode as a function of the glyphosate concentration. The detection limit was 30 µM. In the case of nickel, an increase in the oxidation signal, which is related to the glyphosate concentration, was obtained. However, the results were less reproducible and additional information is necessary to propose an interaction mechanism between glyphosate and the electrode.

  11. A simplified approach to the determination of N-nitroso glyphosate in technical glyphosate using HPLC with post-derivatization and colorimetric detection.

    Science.gov (United States)

    Kim, Manuela; Stripeikis, Jorge; Iñón, Fernando; Tudino, Mabel

    2007-05-15

    A simple and sensitive HPLC post-derivatization method with colorimetric detection has been developed for the determination of N-nitroso glyphosate in samples of technical glyphosate. Separation of the analyte was accomplished using an anionic exchange resin (2.50mmx4.00mm i.d., 15mum particle size, functional group: quaternary ammonium salt) with Na(2)SO(4) 0.0075M (pH 11.5) (flow rate: 1.0mLmin(-1)) as mobile phase. After separation, the eluate was derivatized with a colorimetric reagent containing sulfanilamide 0.3% (w/v), [N-(1-naphtil)ethilendiamine] 0.03% (w/v) and HCl 4.5M in a thermostatized bath at 95 degrees C. Detection was performed at 546nm. All stages of the analytical procedure were optimized taking into account the concept of analytical minimalism: less operation times and costs; lower sample, reagents and energy consumption and minimal waste. The limit of detection (k=3) calculated for 10 blank replicates was 0.04mgL(-1) (0.8mgkg(-1)) in the solid sample which is lower than the maximum tolerable accepted by the Food and Agriculture Organization of the United Nations. PMID:19071724

  12. Comparative effects of technical-grade and a commercial formulation of glyphosate on the pigment content of periphytic algae.

    Science.gov (United States)

    Vera, María S; Juárez, Ángela B; Pizarro, Haydée N

    2014-10-01

    We investigated the potentially different effects of one of the most commonly used glyphosate formulations in Argentina, Glifosato Atanor(®), and the technical-grade glyphosate on the pigment content, as biomass indicators of the algal fraction in a freshwater periphytic community. A laboratory bioassay was carried out in 250-ml beakers. Two treatments were used: technical-grade glyphosate acid and Glifosato Atanor(®) (isopropylamine salt of glyphosate 48 % w/v), which were at a concentration of 3 mg active ingredient per liter. Treatments and the control (without herbicide) were replicated in triplicate. The concentrations of chlorophyll a and b and carotenes were determined at 0, 2, 6, 10, 24, 48, 96 and 192 h after herbicide addition. A significant increase in pigment content was observed for both herbicides after a 2-day exposure. Moreover, the formulation had little or no effect compared to the active ingredient, suggesting that the additives of Glifosato Atanor(®) may not enhance glyphosate toxicity. PMID:25129051

  13. Subtle effects of herbicide use in the context of genetically modified crops: a case study with glyphosate (Roundup).

    Science.gov (United States)

    Blackburn, Lynda G; Boutin, Céline

    2003-01-01

    Research on the effects of glyphosate and seed germination spans 30 years. Despite several studies reporting detrimental effects of the herbicide on seedling germination and growth, glyphosate is still being registered for use as a weed killer and preharvest desiccant. Its nonselective nature and low chance of species developing resistance has lead to the development of genetically modified crops tolerant to the herbicide which also raises concerns about increased reliance on herbicide use, and subtle ecological impact. This paper presents the result of a literature review on past studies mostly, on crop species, and the results of a new experiment performed with emphasis on noncrop species. The new experimental part attempted to determine whether glyphosate (Roundup) would have an effect on the germination and growth of the F1 generation of seeds produced by plants sprayed with the herbicide. It was designed to mirror spray drift which might affect noncrop plants in nontarget drift zones. Of the 11 species tested using treatments of 0% (control), 1%, 10% or 100% of a 890 g a.i./ha label rate solution sprayed near seed maturity, seven showed a significant effect of the glyphosate treatment on germination and/or growth characteristics. Results of this experiment together with several previous studies reviewed in this paper suggest that there are significant effects to keep in mind when using herbicides such as glyphosate as severe ecological changes could occur. PMID:12739874

  14. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis

    Science.gov (United States)

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S.; Bilalis, Dimitrios

    2016-01-01

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate in various parts of the world. The objective of the present study was to investigate the effect of environmental conditions (temperature and light) on the expression levels of the EPSPS gene and two major ABC-transporter genes (M10 and M11) on glyphosate susceptible (GS) and glyphosate resistant (GR) horseweed populations, collected from several regions across Greece. Real-time PCR was conducted to determine the expression level of the aforementioned genes when glyphosate was applied at normal (1×; 533 g·a.e.·ha−1) and high rates (4×, 8×), measured at an early one day after treatment (DAT) and a later stage (four DAT) of expression. Plants were exposed to light or dark conditions, at three temperature regimes (8, 25, 35 °C). GR plants were made sensitive when exposed to 8 °C with light; those sensitized plants behaved biochemically (shikimate accumulation) and molecularly (expression of EPSPS and ABC-genes) like the GS plants. Results from the current study show the direct link between the environmental conditions and the induction level of the above key genes that likely affect the efficiency of the proposed mechanism of glyphosate resistance. PMID:27104532

  15. A simple and green analytical method for determination of glyphosate in commercial formulations and water by diffuse reflectance spectroscopy

    Science.gov (United States)

    da Silva, Aline Santana; Fernandes, Flávio Cesar Bedatty; Tognolli, João Olímpio; Pezza, Leonardo; Pezza, Helena Redigolo

    2011-09-01

    This article describes a simple, inexpensive, and environmentally friendly method for the monitoring of glyphosate using diffuse reflectance spectroscopy. The proposed method is based on reflectance measurements of the colored compound produced from the spot test reaction between glyphosate and p-dimethylaminocinnamaldehyde ( p-DAC) in acid medium, using a filter paper as solid support. Experimental designs were used to optimize the analytical conditions. All reflectance measurements were carried out at 495 nm. Under optimal conditions, the glyphosate calibration graphs obtained by plotting the optical density of the reflectance signal (A R) against the concentration were linear in the range 50-500 μg mL -1, with a correlation coefficient of 0.9987. The limit of detection (LOD) for glyphosate was 7.28 μg mL -1. The technique was successfully applied to the direct determination of glyphosate in commercial formulations, as well as in water samples (river water, pure water and mineral drinking water) after a previous clean-up or pre-concentration step. Recoveries were in the ranges 93.2-102.6% and 91.3-102.9% for the commercial formulations and water samples, respectively.

  16. Characterization of electrochemiluminescence of tris(2,2'-bipyridine)ruthenium(II) with glyphosate as coreactant in aqueous solution

    International Nuclear Information System (INIS)

    Glyphosate, a phosphorus-containing amino acid type herbicide was used as a coreactant for studying of electrochemiluminescence (ECL) reaction of tris(2,2'-bipyridyl)ruthenium(II) [Ru(bpy)32+] in an aqueous solution. In a phosphate buffer solution of pH 8, glyphosate itself was known to be electrochemically inactive at glassy carbon electrode, however, it participated in a homogeneous chemical reaction with the electrogenerated Ru(bpy)33+, and resulted in producing Ru(bpy)32+ species at the electrode surface. Kinetic and mechanistic information for the catalysis of glyphosate oxidation were evaluated by the steady-state voltammetric measurement with an ultramicroelectrode. The simulated cyclic voltammogram based on this mechanism was in good agreement with that obtained experimentally. ECL reaction of Ru(bpy)32+/glyphosate system was found to be strongly dependent on the media pH. In a pH region of 5-9, an ECL wave appeared at ca. +1.1 V vs. Ag/AgCl, which was caused by the generation of *Ru(bpy)32+ via a Ru(bpy)33+-mediated oxidation of glyphosate. When pH >10, a second ECL wave was observed at ca. +1.35 V vs. Ag/AgCl, which was believed to be associated with a reaction between Ru(bpy)33+ and the species from direct oxidation of GLYP at a GC electrode surface.

  17. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis.

    Science.gov (United States)

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S; Bilalis, Dimitrios

    2016-01-01

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate in various parts of the world. The objective of the present study was to investigate the effect of environmental conditions (temperature and light) on the expression levels of the EPSPS gene and two major ABC-transporter genes (M10 and M11) on glyphosate susceptible (GS) and glyphosate resistant (GR) horseweed populations, collected from several regions across Greece. Real-time PCR was conducted to determine the expression level of the aforementioned genes when glyphosate was applied at normal (1×; 533 g·a.e.·ha(-1)) and high rates (4×, 8×), measured at an early one day after treatment (DAT) and a later stage (four DAT) of expression. Plants were exposed to light or dark conditions, at three temperature regimes (8, 25, 35 °C). GR plants were made sensitive when exposed to 8 °C with light; those sensitized plants behaved biochemically (shikimate accumulation) and molecularly (expression of EPSPS and ABC-genes) like the GS plants. Results from the current study show the direct link between the environmental conditions and the induction level of the above key genes that likely affect the efficiency of the proposed mechanism of glyphosate resistance. PMID:27104532

  18. Sorption, desorption and mineralisation of the herbicides glyphosate and MCPA in samples from two Danish soil and subsurface profiles

    International Nuclear Information System (INIS)

    The vertical distribution of the sorption, desorption and mineralisation of glyphosate and MCPA was examined in samples from two contrasting soil and subsurface profiles, obtained from a sandy agricultural site and a non-agricultural clay rich site. The highest mineralisation of [14C-methylen]glyphosate, with 9.3-14.7% degraded to 14CO2 within 3 months was found in the deepest sample from the clay site. In the deeper parts of the sandy profile high sorption and low desorption of glyphosate coincided with no or minor mineralisation indicating a limited glyphosate bioavailability. MCPA was readily mineralised except in the deepest samples from both sites. The highest MCPA mineralisation was detected just below the surface layers with 72% or 44% degraded to 14CO2 at the sandy or the clay sites, respectively. MCPA sorped to a minor extent in all samples and no indications of sorption-controlled mineralisation was revealed. None of the herbicides were mineralised under anoxic conditions. - Natural attenuation potential of the herbicides glyphosate and MCPA was assessed in soil and subsurface profiles

  19. Leaching of glyphosate and AMPA under two soil management practices in Burgundy vineyards (Vosne-Romanee, 21-France)

    International Nuclear Information System (INIS)

    Some drinking water reservoirs under the vineyards of Burgundy are contaminated with herbicides. Thus the effectiveness of alternative soil management practices, such as grass cover, for reducing the leaching of glyphosate and its metabolite, AMPA, through soils was studied. The leaching of both molecules was studied in structured soil columns under outdoor conditions for 1 year. The soil was managed under two vineyard soil practices: a chemically treated bare calcosol, and a vegetated calcosol. After 680 mm of rainfall, the vegetated calcosol leachates contained lower amounts of glyphosate and AMPA (0.02% and 0.03%, respectively) than the bare calcosol leachates (0.06% and 0.15%, respectively). No glyphosate and only low amounts of AMPA (<0.01%) were extracted from the soil. Glyphosate, and to a greater extent, AMPA, leach through the soils; thus, both molecules may be potential contaminants of groundwater. However, the alternative soil management practice of grass cover could reduce groundwater contamination by the pesticide. - Glyphosate and AMPA leached in greater amounts through a chemically treated bare calcosol than through a vegetated calcosol

  20. Isothermal DNA amplification in vitro: the helicase-dependent amplification system.

    Science.gov (United States)

    Jeong, Yong-Joo; Park, Kkothanahreum; Kim, Dong-Eun

    2009-10-01

    Since the development of polymerase chain reaction, amplification of nucleic acids has emerged as an elemental tool for molecular biology, genomics, and biotechnology. Amplification methods often use temperature cycling to exponentially amplify nucleic acids; however, isothermal amplification methods have also been developed, which do not require heating the double-stranded nucleic acid to dissociate the synthesized products from templates. Among the several methods used for isothermal DNA amplification, the helicase-dependent amplification (HDA) is discussed in this review with an emphasis on the reconstituted DNA replication system. Since DNA helicase can unwind the double-stranded DNA without the need for heating, the HDA system provides a very useful tool to amplify DNA in vitro under isothermal conditions with a simplified reaction scheme. This review describes components and detailed aspects of current HDA systems using Escherichia coli UvrD helicase and T7 bacteriophage gp4 helicase with consideration of the processivity and efficiency of DNA amplification. PMID:19629390

  1. Glyphosate Use in Forest Plantations Uso de Glifosato en Plantaciones Forestales

    Directory of Open Access Journals (Sweden)

    Marcelo Kogan

    2010-12-01

    Full Text Available Under Chilean conditions the lack of weed control at forest tree establishment results in an average of at least 60% less biomass accumulation during the first year of growth of radiate pine or eucaliptus, and glyphosate offers a series of advantages in forestry weed management because its activity in both herbaceous weed groups, monocots and dicots, as well as annuals, biennials and perennials. Also, its efficacy in woody undesirable vegetation makes glyphosate a very important herbicide that can be applied to control herbaceous and woody weeds as pre-planting and during the second or third years of trees growth as strip applications. The aim of this review is to discuss the main uses of glyphosate in reforestation worldwide, during the first 2 yr after tree establishment, as broadcast application over the top of the forest trees and the most important factors that could affect glyphosate efficacy as a forest herbicide, like weed growth stage, application technique, volume and water quality, rainfastness, dew effect and the use of extra adjuvant with formulated glyphosate.Bajo las condiciones chilenas la falta de control de malezas al establecimiento de los árboles resulta en un promedio de al menos 60% menos acumulación de biomasa durante el primer año de crecimiento de pino radiata o eucalipto, y glifosato ofrece una serie de ventajas en el manejo de malezas forestales debido a su actividad en ambos grupos de malezas herbáceas, monocotiledóneas y dicotiledóneas, así como anuales, bianuales y perennes. Además, su eficacia en la vegetación leñosa indeseable hace al glifosato un herbicida muy importante que puede ser aplicado para controlar malezas herbáceas y leñosas en pre-plantación y durante el segundo o tercer año de crecimiento de los árboles como aplicaciones en franja. El objetivo de esta revisión es discutir los principales usos de glifosato en reforestación a lo largo del mundo, durante los primeros 2 años despu

  2. Can Anomalous Amplification be Attained without Postselection?

    Science.gov (United States)

    Martínez-Rincón, Julián; Liu, Wei-Tao; Viza, Gerardo I.; Howell, John C.

    2016-03-01

    We present a parameter estimation technique based on performing joint measurements of a weak interaction away from the weak-value-amplification approximation. Two detectors are used to collect full statistics of the correlations between two weakly entangled degrees of freedom. Without discarding of data, the protocol resembles the anomalous amplification of an imaginary-weak-value-like response. The amplification is induced in the difference signal of both detectors allowing robustness to different sources of technical noise, and offering in addition the advantages of balanced signals for precision metrology. All of the Fisher information about the parameter of interest is collected. A tunable phase controls the strength of the amplification response. We experimentally demonstrate the proposed technique by measuring polarization rotations in a linearly polarized laser pulse. We show that in the presence of technical noise the effective sensitivity and precision of a split detector is increased when compared to a conventional continuous-wave balanced detection technique.

  3. Privacy amplification for quantum key distribution

    International Nuclear Information System (INIS)

    This paper examines classical privacy amplification using a universal family of hash functions. In quantum key distribution, the adversary's measurement can wait until the choice of hash functions is announced, and so the adversary's information may depend on the choice. Therefore the existing result on classical privacy amplification, which assumes the independence of the choice from the other random variables, is not applicable to this case. This paper provides a security proof of privacy amplification which is valid even when the adversary's information may depend on the choice of hash functions. The compression rate of the proposed privacy amplification can be taken to be the same as that of the existing one with an exponentially small loss in secrecy of a final key. (fast track communication)

  4. Danos visuais e anatômicos causados pelo glyphosate em folhas de Eucalyptus grandis Visible and anatomic damages caused by glyphosate in Eucalyptus grandis leaves

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2008-03-01

    Full Text Available A sintomatologia é um dos principais critérios adotados para avaliar os danos causados por fatores bióticos e abióticos em plantas. Contudo, aspectos microscópicos são necessários na compreensão dos mecanismos de intoxicação e no diagnóstico precoce da injúria. Objetivou-se no presente estudo avaliar os efeitos da deriva simulada de quatro formulações comerciais de glyphosate (Scout®, Roundup NA®, Roundup transorb® e Zapp QI® sobre a morfoanatomia foliar de seis clones de Eucalyptus grandis (UFV01, UFV02, UFV03, UFV04, UFV05 e UFV06. Após a aplicação do glyphosate na dose de 129,6 g ha-1, acompanhou-se diariamente o surgimento de sintomas, e aos 14 dias coletaram-se amostras de folhas aparentemente sadias para as análises microscópicas. Todos os clones apresentaram cloroses e necroses a partir do quarto dia de exposição, independentemente da formulação utilizada. O clone UFV04 não apresentou injúrias anatômicas. Nos demais clones, os herbicidas ocasionaram plasmólise, colapso celular, hipertrofia e formação de tecido de cicatrização, porém não foram diagnosticadas variações na espessura das folhas. Visualmente, o Roundup transorb® foi o herbicida que provocou maior intoxicação nas plantas. Anatomicamente, plantas expostas ao Roundup NA® apresentaram maior número de danos. O clone UFV06 foi o mais sensível à ação das formulações testadas, considerando-se tanto a análise visual quanto a anatômica. Os resultados confirmam o valor diagnóstico da análise visual e prognóstico da anatomia vegetal, sendo o estudo conjunto desses parâmetros fundamental para avaliar a sensibilidade entre os clones e o potencial fitotóxico de herbicidas.Symptomatology is one of the most important criteria used to determine the damages caused by biotic and abiotic factors in plants. However, microscopic aspects are needed to elucidate intoxication mechanisms and early injury diagnosis. This work aimed to evaluate the

  5. Control of glyphosate resistant hairy fleabane (Conyza bonariensis with dicamba and 2,4-D Controle de buva (Conyza bonariensis resistente ao glyphosate com dicamba e 2,4-D

    Directory of Open Access Journals (Sweden)

    D.J. Soares

    2012-06-01

    Full Text Available Auxyn type herbicides such as dicamba and 2,4-D are alternative herbicides that can be used to control glyphosate-resistant hairy fleabane. With the forthcoming possibility of releasing dicamba-resistant and 2,4-D-resistant crops, use of these growth regulator herbicides will likely be an alternative that can be applied to the control of glyphosate resistant hairy fleabane (Conyza bonariensis. The objective of this research was to model the efficacy, through dose-response curves, of glyphosate, 2,4-D, isolated dicamba and glyphosatedicamba combinations to control a brazilian hairy fleabane population resistant to glyphosate. The greenhouse dose-response studies were conducted as a completely randomized experimental design, and the rates used for dose response curve construction were 0, 120, 240, 480, 720 and 960 g a.i. ha-1 for 2,4-D, dicamba and the dicamba combination, with glyphosate at 540 g a.e. ha-1. The rates for glyphosate alone were 0, 180, 360, 540, 720 and 960 g a.e. ha-1. Herbicides were applied when the plants were in a vegetative stage with 10 to 12 leaves and height between 12 and 15 cm. Hairy fleabane had low sensitivity to glyphosate, with poor control even at the 960 g a.e. ha-1 rate. Dicamba and 2,4-D were effective in controlling the studied hairy fleabane. Hairy fleabane responds differently to 2,4-D and dicamba. The combination of glyphosate and dicamba was not antagonistic to hairy fleabane control, and glyphosate may cause an additive effect on the control, despite the population resistance.Os herbicidas mimetizadores de auxinas como dicamba e 2,4-D são alternativas para o controle de buva resistente ao glyphosate. Com a possível futura liberação comercial de culturas resistentes ao dicamba e 2,4-D, a aplicação destes herbicidas reguladores de crescimento será uma provável alternativa de controle de buva resistente ao glyphosate. O objetivo desta pesquisa foi modelar por meio de curvas de dose-resposta a efic

  6. Rolling circle amplification of metazoan mitochondrialgenomes

    Energy Technology Data Exchange (ETDEWEB)

    Simison, W. Brian; Lindberg, D.R.; Boore, J.L.

    2005-07-31

    Here we report the successful use of rolling circle amplification (RCA) for the amplification of complete metazoan mt genomes to make a product that is amenable to high-throughput genome sequencing techniques. The benefits of RCA over PCR are many and with further development and refinement of RCA, the sequencing of organellar genomics will require far less time and effort than current long PCR approaches.

  7. Efeitos da dessecação com glyphosate e chlorimuron-ethyl na comunidade infestante e na produtividade da soja Effects of dissection with glyphosate and chlorimuron-ethyl on weed community and soybean yield

    Directory of Open Access Journals (Sweden)

    L.B Carvalho

    2009-12-01

    Full Text Available O efeito de dessecantes sobre o período anterior à interferência (PAI pode auxiliar na tomada de decisão para o manejo das plantas daninhas. O objetivo desta pesquisa foi verificar se a adição de chlorimuron-ethyl ao glyphosate, para dessecação em pré-semeadura, altera a extensão do PAI na soja. O experimento foi realizado em Jaboticabal-SP, Brasil, submetendo-se o cultivar Monsoy 7908RR a oito períodos de convivência com plantas daninhas, além de testemunhas no mato e no limpo, nos quais foram aplicados dois grupos de tratamentos: glyphosate e glyphosate + chlorimuron-ethyl. Em cada período, foram calculados o índice de importância relativa e os índices de diversidade e equitabilidade; por meio da análise de regressão dos dados de produtividade de grãos, determinou-se o PAI. Digitaria insularis, Acanthospermum hispidum, Raphanus raphanistrum e Commelina benghalensis apresentaram maior importância relativa. Os índices de diversidade e equitabilidade oscilaram durante os períodos, e a diferença entre as plantas daninhas fundamentou-se no acúmulo de massa seca. O PAI na soja no tratamento com glyphosate foi de 37 dias após a semeadura (DAS e de 51 DAS naquele com glyphosate + chlorimuron-ethyl. A adição de chlorimuron-ethyl ao glyphosate permite que a cultura conviva mais tempo com as plantas daninhas sem que ocorra redução significativa na produtividade.The effects of burndown herbicides on the period before weed interference (PBI may provide support to weed management decision-making. The objective of this research was to verify whether the PBI is affected by the application of glyphosate plus chlorimuron-ethyl to pre-sowing burndown in soybean. The experiment was carried out in Jaboticabal-SP, Brazil, submitting the cultivar Monsoy 7908RR to eight coexistence periods with weeds, maintaining weedy and-weed-free checks, which were applied to two groups of treatments: glyphosate and glyphosate + chlorimuron-ethyl. At

  8. Herbicidas alternativos para controle de biótipos de Conyza bonariensis e C. canadensis resistentes ao glyphosate Alternative herbicides to control glyphosate-resistant biotypes of Conyza bonariensis and C. canadensis

    Directory of Open Access Journals (Sweden)

    M.S. Moreira

    2010-01-01

    Full Text Available Após sucessivos anos, aplicações do herbicida glyphosate em pomares de citros no Estado de São Paulo selecionaram biótipos resistentes de Conyza bonariensis e C. canadensis. Na ocorrência de plantas daninhas resistentes em uma área agrícola, tornam-se necessárias mudanças nas práticas de manejo para obtenção de adequado controle das populações resistentes, bem como para a redução da pressão de seleção sobre outras espécies. Assim, este trabalho foi realizado com o objetivo de identificar herbicidas alternativos para controle de biótipos de Conyza spp. resistentes ao herbicida glyphosate, com aplicações em diferentes estádios fenológicos da planta daninha. Três experimentos foram conduzidos em campo, em pomares de citros em formação, sobre plantas de buva em estádio fenológico de dez folhas e no pré-florescimento. Para plantas no estádio de dez folhas, controle satisfatório foi obtido com aplicações de glyphosate + bromacil + diuron (1.440 + 1.200 + 1.200 g ha-1, glyphosate + atrazina (1.440 + 1.500 g ha-1 e glyphosate + diuron (1.440 + 1.500 g ha-1. Quando em estádio de pré-florescimento de Conyza spp., a aplicação do herbicida amônio-glufosinato, na dose de 400 g ha-1, isolado ou associado a MSMA, bromacil+diuron, metsulfuron, carfentrazone e paraquat, foi a alternativa viável para controle dos biótipos resistentes ao glyphosate.After successive years, glyphosate applications on São Paulo-Brazil citrus orchards selected resistant biotypes of Conyza bonariensis and C. canadensis. The occurrence of herbicide-resistant weed biotypes at some agricultural area makes it necessary to change the management practices to reach effective control of the selected resistant populations, as well as to reduce selection pressure on the other species. Thus, this work aimed to identify the alternative herbicides to control glyphosate-resistant biotypes of Conyza spp., with applications at different weed phenological

  9. Distribuição de glyphosate e acúmulo de nutrientes em biótipos de azevém Glyphosate distribution and nutrient accumulation in ryegrass biotypes

    OpenAIRE

    E.A. Ferreira; Silva, A. A.; M. R. Reis; J.B. Santos; de Oliveira, J. A.; Vargas, L.; K.R. Khouri; A.A. Guimarães

    2008-01-01

    Objetivou-se neste trabalho avaliar o acúmulo de nutrientes e a translocação de glyphosate em biótipos de azevém. Para isso, foram montados dois ensaios: no primeiro aplicou-se 14C-glyphosate, adicionando 10 µL da calda sobre a face adaxial da primeira folha com lígula totalmente visível, quando as plantas de azevém apresentavam três perfilhos. A quantidade de glyphosate absorvido, translocado e exsudado foi avaliada 64 horas após aplicação, por meio da medição da radiação emitida pelo 14C-gl...

  10. The Research on the Quality Control of Nitro Glyphosate of Glyphosate TC%草甘膦原药中亚硝基草甘膦的质量控制研究

    Institute of Scientific and Technical Information of China (English)

    蔡黎克; 周玉良; 杨新东

    2012-01-01

    By using optimization method,depending on the production process of glyphosate TC detection analysis,different production processes between the nitroso glyphosate content differences were found out,and through the process of adjustment to reduce the product of nitroso glyphosate content,the quality of the products was improved effectively.%通过运用优化的方法,对不同生产工艺的草甘膦原药进行检测分析,找出了不同生产工艺间亚硝基草甘膦含量的差异,并通过对工艺的调整降低了草甘膦原药中亚硝基草甘膦的含量,有效提高了产品的质量

  11. Associações entre o herbicida glyphosate e inseticidas na cultura da soja Roundup Ready® Associations among glyphosate and insecticides in Roundup Ready® soybean

    Directory of Open Access Journals (Sweden)

    F.A. Petter

    2007-01-01

    Full Text Available Este trabalho teve o objetivo de avaliar os efeitos da associação do herbicida glyphosate com 10 inseticidas de diferentes grupos químicos sobre a cultura da soja Roundup Ready® (cultivar Monsoy 8585 RR®, o controle de plantas daninhas e o controle da lagarta-da-soja (Anticarsia gemmatalis. O experimento foi realizado em lavoura no município de Nova Xavantina - MT, no período de novembro de 2005 a abril de 2006, em solo classificado como Latossolo Vermelho distrófico. O delineamento experimental utilizado foi o de blocos ao acaso, em esquema fatorial 11 x 2, sendo os fatores constituídos por 11 tratamentos inseticidas [lambdacyhalothrin (3,75 g ha-1; permethrin (12,50 g ha-1; methamidophos (300,00 g ha-1; chlorpyriphos (240,00 g ha-1; acephate (150,00 g ha-1; endosulfan (175,00 g ha-1; methomyl (107,50 g ha-1; lufenuron (7,50 g ha-1; triflumuron (14,40 g ha-1; spinosad (24,00 g ha-1; e testemunha sem inseticida], com ou sem a adição (mistura em tanque de 960 g e.a. ha-1 de glyphosate, formando 22 tratamentos, conduzidos em quatro repetições. Os tratamentos foram aplicados 30 dias depois da emergência da cultura. A mistura do herbicida glyphosate com o inseticida chlorpyriphos causou fitotoxicidade inicial à cultura da soja RR®. O controle das plantas daninhas Chamaesyce hirta, Alternanthera tenella, Euphorbia heterophylla e Cenchrus echinatus não foi afetado pelas misturas de glyphosate com todos os inseticidas avaliados. A adição do glyphosate à calda de aplicação prejudicou a eficiência inicial dos inseticidas methomyl, methamidophos, chlorpyriphos e acephate no controle de Anticarsia gemmatalis, porém incrementou o controle dessa praga quando associado aos inseticidas spinosad, lambdacyhalothrin e lufenuron. A combinação de glyphosate com os inseticidas methamidophos, chlorpyriphos, lufenuron, triflumuron e spinosad proporcionou os maiores níveis de produtividade de grãos da soja RR®.This research aimed to

  12. Doses efficaces en glyphosate et en 2,4-D pour le contrôle chimique des laitue d'eau (Pistia stratiotes, Linn.) et toxicité du glyphosate vis-à-vis des tilapias (Sarotherodon melanotheron).

    OpenAIRE

    N. Etien; Kaba, N.; Amon Kothias, J.B.

    1991-01-01

    Les effets toxiques des herbicides Round up (glyphosate)et 2,4-D (herbazol) ont été testés puis comparés sur des échantillons de salade d'eau (Pistia stratiotes, Linn., Aracées) mis en culture dans des aquariums en verre. Le glyphosate paraît plus toxique sur ces plantes que le 2,4-D. Il a été donc testé sur des juvéniles de tilapias Sarotherodon melanotheron.La dose léthale chez le tilapia (CL50=13.25mg.l-1) est 18,37 et 74 fois environ plus élevée que la dose toxique de glyphosate chez les ...

  13. Onshore seismic amplifications due to bathymetric features

    Science.gov (United States)

    Rodríguez-Castellanos, A.; Carbajal-Romero, M.; Flores-Guzmán, N.; Olivera-Villaseñor, E.; Kryvko, A.

    2016-08-01

    We perform numerical calculations for onshore seismic amplifications, taking into consideration the effect of bathymetric features on the propagation of seismic movements. To this end, the boundary element method is applied. Boundary elements are employed to irradiate waves and, consequently, force densities can be obtained for each boundary element. From this assumption, Huygens’ principle is applied, and since the diffracted waves are built at the boundary from which they are radiated, this idea is equivalent to Somigliana’s representation theorem. The application of boundary conditions leads to a linear system being obtained (Fredholm integral equations). Several numerical models are analyzed, with the first one being used to verify the proposed formulation, and the others being used to estimate onshore seismic amplifications due to the presence of bathymetric features. The results obtained show that compressional waves (P-waves) generate onshore seismic amplifications that can vary from 1.2 to 5.2 times the amplitude of the incident wave. On the other hand, the shear waves (S-waves) can cause seismic amplifications of up to 4.0 times the incident wave. Furthermore, an important result is that in most cases the highest seismic amplifications from an offshore earthquake are located on the shoreline and not offshore, despite the seafloor configuration. Moreover, the influence of the incident angle of seismic waves on the seismic amplifications is highlighted.

  14. Amplification uncertainty relation for probabilistic amplifiers

    Science.gov (United States)

    Namiki, Ryo

    2015-09-01

    Traditionally, quantum amplification limit refers to the property of inevitable noise addition on canonical variables when the field amplitude of an unknown state is linearly transformed through a quantum channel. Recent theoretical studies have determined amplification limits for cases of probabilistic quantum channels or general quantum operations by specifying a set of input states or a state ensemble. However, it remains open how much excess noise on canonical variables is unavoidable and whether there exists a fundamental trade-off relation between the canonical pair in a general amplification process. In this paper we present an uncertainty-product form of amplification limits for general quantum operations by assuming an input ensemble of Gaussian-distributed coherent states. It can be derived as a straightforward consequence of canonical uncertainty relations and retrieves basic properties of the traditional amplification limit. In addition, our amplification limit turns out to give a physical limitation on probabilistic reduction of an Einstein-Podolsky-Rosen uncertainty. In this regard, we find a condition that probabilistic amplifiers can be regarded as local filtering operations to distill entanglement. This condition establishes a clear benchmark to verify an advantage of non-Gaussian operations beyond Gaussian operations with a feasible input set of coherent states and standard homodyne measurements.

  15. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    Science.gov (United States)

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  16. Conference this! Lead Pipers compare conference experiences

    Directory of Open Access Journals (Sweden)

    Editorial Board

    2010-04-01

    Full Text Available As library travel budgets are increasingly slashed around the country, it’s a tough time for conference-going. In this group post, we compare notes about the conferences we’ve attended, which have been our favorites, and why. We hope this will generate creative ideas on good conferences (online or in-person to look forward to, and maybe offer [...

  17. Effects of glyphosate and polyoxyethylenamine on growth and energetic reserves in the freshwater crayfish Cherax quadricarinatus (Decapoda, Parastacidae).

    Science.gov (United States)

    Frontera, Jimena L; Vatnick, Itzick; Chaulet, Anouk; Rodríguez, Enrique M

    2011-11-01

    Freshwater crayfish Cherax quadricarinatus have a high commercial value and are cultured in farms where they are potentially exposed to pesticides. Therefore, we examined the sublethal effects of a 50-day exposure to glyphosate acid and polyoxyethylenamine (POEA), both alone and in a 3:1 mixture, on the growth and energetic reserves in muscle, hepatopancreas and hemolymph of growing juvenile crayfish. Exposure to two different glyphosate and POEA mixtures caused lower somatic growth and decreased muscle protein levels. These effects, caused by both compounds interacting in the mixture, could also be synergistic because they were expressed even at the lowest concentration. The decrease in protein levels could be related to the greater use of other energy reserves. This hypothesis is supported by the decrease in muscle glycogen stores due to glyphosate exposure and the decrease in lipid reserves associated with exposure to POEA. PMID:21424220

  18. Comparison of the in vivo and in vitro genotoxicity of glyphosate isopropylamine salt in three different organisms

    Directory of Open Access Journals (Sweden)

    Carlos Alvarez-Moya

    2014-01-01

    Full Text Available There is considerable controversy with regard to the genotoxicity of glyphosate, with some reports stating that this compound is non-toxic for fish, birds and mammals. In this work, we used the comet assay to examine the genotoxicity of glyphosate isopropylamine (0.7, 7, 70 and 700 µM in human lymphocytes, erythrocytes of Oreochromis niloticus and staminal nuclei of Tradescantia (4430 in vitro and in vivo. Cells, nuclei and fish that had and had not been exposed to 5 mM N-nitrosodiethylamine (NDEA were used as positive and negative controls, respectively. Significant (p 7 µM, whereas in vitro, glyphosphate was genotoxic in human lymphocytes and Tradescantia hairs at > 0.7 µM. These results indicate that glyphosate is genotoxic in the cells and organisms studied at concentrations of 0.7-7 µM.

  19. Fate of the herbicides glyphosate, glufosinate-ammonium, phenmedipham, ethofumesate and metamitron in two Finnish arable soils.

    Science.gov (United States)

    Laitinen, Pirkko; Siimes, Katri; Eronen, Liisa; Rämö, Sari; Welling, Leena; Oinonen, Seija; Mattsoff, Leona; Ruohonen-Lehto, Marja

    2006-06-01

    The fate of five herbicides (glyphosate, glufosinate-ammonium, phenmedipham, ethofumesate and metamitron) was studied in two Finnish sugar beet fields for 26 months. Soil types were sandy loam and clay. Two different herbicide-tolerant sugar beet cultivars and three different herbicide application schedules were used. Meteorological data were collected throughout the study and soil properties were thoroughly analysed. An extensive data set of herbicide residue concentrations in soil was collected. Five different soil depths were sampled. The study was carried out using common Finnish agricultural practices and represents typical sugar beet cultivation conditions in Finland. The overall observed order of persistence was ethofumesate > glyphosate > phenmedipham > metamitron > glufosinate-ammonium. Only ethofumesate and glyphosate persisted until the subsequent spring. Seasonal variation in herbicide dissipation was very high and dissipation ceased almost completely during winter. During the 2 year experiment no indication of potential groundwater pollution risk was obtained, but herbicides may cause surface water pollution. PMID:16628542

  20. Control of glyphosate resistant hairy fleabane (Conyza bonariensis) with dicamba and 2,4-D Controle de buva (Conyza bonariensis) resistente ao glyphosate com dicamba e 2,4-D

    OpenAIRE

    D.J. Soares; Oliveira, W. S.; R.F. López-Ovejero; P.J. Christoffoleti

    2012-01-01

    Auxyn type herbicides such as dicamba and 2,4-D are alternative herbicides that can be used to control glyphosate-resistant hairy fleabane. With the forthcoming possibility of releasing dicamba-resistant and 2,4-D-resistant crops, use of these growth regulator herbicides will likely be an alternative that can be applied to the control of glyphosate resistant hairy fleabane (Conyza bonariensis). The objective of this research was to model the efficacy, through dose-response curves, of glyphosa...

  1. Controle químico de biótipos de buva (Conyza canadensis e Conyza bonariensis resistentes ao glyphosate Chemical Control of glyphosate-resistant horseweed (Conyza Canadensis and hairy fleabane (Conyza bonariensis biotypes

    Directory of Open Access Journals (Sweden)

    Micheli Satomi Yamauti

    2010-09-01

    Full Text Available Estudos foram conduzidos na Estação Experimental de Citricultura de Bebedouro, SP para avaliar a resposta de biótipos de buva resistentes aos herbicidas glyphosate, bromacil + diuron, diuron e paraquat isolados e em mistura, e o efeito de uma aplicação seqüencial com glyphosate. O delineamento foi o de blocos casualizados com quatro repetições e sete tratamentos.. Os herbicidas foram aplicados com pulverizador costal, à pressão constante (mantido por CO2 comprimido, munido com barra com três bicos do tipo TT110015 com um consumo de calda equivalente a 150 L ha-1. O controle foi avaliado visualmente, através de escala percentual de notas. Para o controle geral das plantas daninhas os melhores resultados foram obtidos com diuron isolado e com glyphosate em mistura com bromacil + diuron, enquanto para o controle da buva não houve diferença entre os tratamentos. Depois da aplicação seqüencial, o melhor tratamento para o controle de buva foi com diuron e bromacil+diuron.Studies were conducted at Estação Experimental de Citricultura de Bebedouro, SP to evaluate the response of glyphosate-resistant horseweed and hairy fleabane biotypes to herbicides glyphosate, bromacil + diuron, diuron e paraquat isolated and in mixture and effect of a sequential application of glyphosate. The experimental design was of complete randomized blocks with four replication and seven treatments. The herbicides were applied with costal sprayer, constant pressure with three nozzles TT110015, the equivalent spray volume was 150 L ha-1. The control was visually evaluated, trough percentile note scale. The best results were obtained to general control of weed with diuron isolated and glyphosate in mixture with bromacil + diuron while to glyphosate-resistant horseweed and hairy fleabane there was no difference between the treatments. After sequential application to Conyza sp control, the best treatment was obtained associated with diuron and bromacil+diuron.

  2. Resistência ao glyphosate em biótipos de buva (Conyza spp.) das regiões oeste e sudoeste do Paraná Resistance to glyphosate in Conyza spp. biotypes in western and southwestern Parana, Brazil

    OpenAIRE

    M.M. Trezzi; R.A. Vidal; E Xavier; D Rosin; A.A. Balbinot Jr.; M.A Prates

    2011-01-01

    A resistência ao glyphosate em biótipos de Conyza spp. em áreas de lavoura das regiões oeste e sudoeste do Paraná causa grandes dificuldades ao manejo e, consequentemente, problemas econômicos e ambientais. Este experimento objetivou determinar a existência de resistência ao herbicida glyphosate em biótipos de buva (Conyza spp.) suspeitos, coletados em lavouras das regiões oeste e sudoeste do Paraná, comparando-os com biótipos suscetíveis. O delineamento experimental utilizado foi inteirament...

  3. Controle químico de biótipos de buva (Conyza canadensis e Conyza bonariensis) resistentes ao glyphosate Chemical Control of glyphosate-resistant horseweed (Conyza Canadensis) and hairy fleabane (Conyza bonariensis) biotypes

    OpenAIRE

    Micheli Satomi Yamauti; Arthur Arrobas Martins Barroso; Marcelo Claro de Souza

    2010-01-01

    Estudos foram conduzidos na Estação Experimental de Citricultura de Bebedouro, SP para avaliar a resposta de biótipos de buva resistentes aos herbicidas glyphosate, bromacil + diuron, diuron e paraquat isolados e em mistura, e o efeito de uma aplicação seqüencial com glyphosate. O delineamento foi o de blocos casualizados com quatro repetições e sete tratamentos.. Os herbicidas foram aplicados com pulverizador costal, à pressão constante (mantido por CO2 comprimido), munido com barra com três...

  4. Heat induces gene amplification in cancer cells

    International Nuclear Information System (INIS)

    Highlights: ► This study discovered that heat exposure (hyperthermia) results in gene amplification in cancer cells. ► Hyperthermia induces DNA double strand breaks. ► DNA double strand breaks are considered to be required for the initiation of gene amplification. ► The underlying mechanism of heat-induced gene amplification is generation of DNA double strand breaks. -- Abstract: Background: Hyperthermia plays an important role in cancer therapy. However, as with radiation, it can cause DNA damage and therefore genetic instability. We studied whether hyperthermia can induce gene amplification in cancer cells and explored potential underlying molecular mechanisms. Materials and methods: (1) Hyperthermia: HCT116 colon cancer cells received water-submerged heating treatment at 42 or 44 °C for 30 min; (2) gene amplification assay using N-(phosphoacetyl)-L-aspartate (PALA) selection of cabamyl-P-synthetase, aspartate transcarbarmylase, dihydro-orotase (cad) gene amplified cells; (3) southern blotting for confirmation of increased cad gene copies in PALA-resistant cells; (4) γH2AX immunostaining to detect γH2AX foci as an indication for DNA double strand breaks. Results: (1) Heat exposure at 42 or 44 °C for 30 min induces gene amplification. The frequency of cad gene amplification increased by 2.8 and 6.5 folds respectively; (2) heat exposure at both 42 and 44 °C for 30 min induces DNA double strand breaks in HCT116 cells as shown by γH2AX immunostaining. Conclusion: This study shows that heat exposure can induce gene amplification in cancer cells, likely through the generation of DNA double strand breaks, which are believed to be required for the initiation of gene amplification. This process may be promoted by heat when cellular proteins that are responsible for checkpoints, DNA replication, DNA repair and telomere functions are denatured. To our knowledge, this is the first study to provide direct evidence of hyperthermia induced gene amplification.

  5. Heat induces gene amplification in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Bin, E-mail: yanbin@mercyhealth.com [Department of Radiation Oncology, University of Mississippi Medical Center, Jackson, MS 39213 (United States); Mercy Cancer Center, Mercy Medical Center-North Iowa, Mason City, IA 50401 (United States); Ouyang, Ruoyun [Department of Respiratory Medicine, The Second Xiangya Hospital, Xinagya School of Medicine, Central South University, Changsha 410011 (China); Huang, Chenghui [Department of Radiation Oncology, University of Mississippi Medical Center, Jackson, MS 39213 (United States); Department of Oncology, The Third Xiangya Hospital, Xinagya School of Medicine, Central South University, Changsha 410013 (China); Liu, Franklin [Department of Radiation Oncology, Duke University Medical Center, Durham, NC 27710 (United States); Neill, Daniel [Department of Radiation Oncology, University of Mississippi Medical Center, Jackson, MS 39213 (United States); Li, Chuanyuan [Dermatology, Duke University Medical Center, Durham, NC 27710 (United States); Dewhirst, Mark [Department of Radiation Oncology, Duke University Medical Center, Durham, NC 27710 (United States)

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer This study discovered that heat exposure (hyperthermia) results in gene amplification in cancer cells. Black-Right-Pointing-Pointer Hyperthermia induces DNA double strand breaks. Black-Right-Pointing-Pointer DNA double strand breaks are considered to be required for the initiation of gene amplification. Black-Right-Pointing-Pointer The underlying mechanism of heat-induced gene amplification is generation of DNA double strand breaks. -- Abstract: Background: Hyperthermia plays an important role in cancer therapy. However, as with radiation, it can cause DNA damage and therefore genetic instability. We studied whether hyperthermia can induce gene amplification in cancer cells and explored potential underlying molecular mechanisms. Materials and methods: (1) Hyperthermia: HCT116 colon cancer cells received water-submerged heating treatment at 42 or 44 Degree-Sign C for 30 min; (2) gene amplification assay using N-(phosphoacetyl)-L-aspartate (PALA) selection of cabamyl-P-synthetase, aspartate transcarbarmylase, dihydro-orotase (cad) gene amplified cells; (3) southern blotting for confirmation of increased cad gene copies in PALA-resistant cells; (4) {gamma}H2AX immunostaining to detect {gamma}H2AX foci as an indication for DNA double strand breaks. Results: (1) Heat exposure at 42 or 44 Degree-Sign C for 30 min induces gene amplification. The frequency of cad gene amplification increased by 2.8 and 6.5 folds respectively; (2) heat exposure at both 42 and 44 Degree-Sign C for 30 min induces DNA double strand breaks in HCT116 cells as shown by {gamma}H2AX immunostaining. Conclusion: This study shows that heat exposure can induce gene amplification in cancer cells, likely through the generation of DNA double strand breaks, which are believed to be required for the initiation of gene amplification. This process may be promoted by heat when cellular proteins that are responsible for checkpoints, DNA replication, DNA repair and

  6. Low Prevalence of TP53 Mutations and MDM2 Amplifications in Pediatric Rhabdomyosarcoma

    Directory of Open Access Journals (Sweden)

    Simona Ognjanovic

    2012-01-01

    Full Text Available The tumor suppressor gene TP53 is the most commonly mutated gene in human cancer. The reported prevalence of mutations in rhabdomyosarcoma (RMS varies widely, with recent larger studies suggesting that TP53 mutations in pediatric RMS may be extremely rare. Overexpression of MDM2 also attenuates p53 function. We have performed TP53 mutation/MDM2 amplification analyses in the largest series analyzed thus far, including DNA isolated from 37 alveolar and 38 embryonal RMS tumor samples obtained from the Cooperative Human Tissue Network (CHTN. Available samples were frozen tumor tissues (N=48 and histopathology slides. TP53 mutations in exons 4–9 were analyzed by direct sequencing in all samples, and MDM2 amplification analysis was performed by differential PCR on a subset of 22 samples. We found only one sample (1/75, 1.3% carrying a TP53 mutation at codon 259 (p.D259Y and no MDM2 amplification. Two SNPs in the TP53 pathway, associated with accelerated tumor onset in germline TP53 mutation carriers, (TP53 SNP72 (rs no. 1042522 and MDM2 SNP309 (rs no. 2279744, were not found to confer earlier tumor onset. In conclusion, we confirm the extremely low prevalence of TP53 mutations/MDM2 amplifications in pediatric RMS (1.33% and 0%, respectively. The possible inactivation of p53 function by other mechanisms thus remains to be elucidated.

  7. 草甘膦使用与生态环境%Application and Ecological Environment of Glyphosate

    Institute of Scientific and Technical Information of China (English)

    苏少泉

    2011-01-01

    Since the commercialization of glyphosate-resistant crop in 1996, their total area had increased rapidly, and the gyphosate was widely used. This paper reviewed the influence of glyphosate on ecological environment.%从抗草甘膦作物1996年商品化种植以来,其种植面积迅速扩大,而草甘膦也得到广泛应用.评述了草甘膦对生态环境的影响.

  8. Strategies to control of sourgrass (Digitaria insularis glyphosate resistant in the out-of-season corn crop

    Directory of Open Access Journals (Sweden)

    Alexandre Gemelli

    2013-08-01

    Full Text Available The sourgrass (Digitaria insularis characteristics of aggressiveness and the existence of glyphosate resistant biotypes puts this weed in evidence in the Brazilian agricultural scenario In this regard, the present study aimed at the development and evaluation of strategies for the management of sourgrass (Digitaria insularis resistant to glyphosate in out-of-season corn crop. The use of paraquat in pre-harvest burn-down of soybean followed by the application of clethodim two days after harvesting soybeans provided flexibility to choose the herbicide used as post-emergent in corn.

  9. Use of isotopic tracers in studies on 14C-glyphosate performance on Cyperus rotundus in pot and field conditions

    International Nuclear Information System (INIS)

    The effect of surfactants and oil on bioefficacy of the herbicide, glyphosate in controlling Cyperus rotundus L. was evaluated using potted plants. A mixture of the commercial formulation, ''Roundup'' with 0.2% Triton X-100, 1% diesel oil and 1% of 4% aqueous ammonium sulfate produced the most penetration into the leaf. The results of the field experiments suggested that this mixture applied at a rate of 1.5 kg/ha glyphosate amended ''Roundup'' can effectively control C. rotundus in the field. (author)

  10. Resistência ao glyphosate em biótipos de buva (Conyza spp. das regiões oeste e sudoeste do Paraná Resistance to glyphosate in Conyza spp. biotypes in western and southwestern Parana, Brazil

    Directory of Open Access Journals (Sweden)

    M.M Trezzi

    2011-01-01

    Full Text Available A resistência ao glyphosate em biótipos de Conyza spp. em áreas de lavoura das regiões oeste e sudoeste do Paraná causa grandes dificuldades ao manejo e, consequentemente, problemas econômicos e ambientais. Este experimento objetivou determinar a existência de resistência ao herbicida glyphosate em biótipos de buva (Conyza spp. suspeitos, coletados em lavouras das regiões oeste e sudoeste do Paraná, comparando-os com biótipos suscetíveis. O delineamento experimental utilizado foi inteiramente casualizado, em esquema fatorial 12 x 8 x 3. Os fatores consistiram de 12 biótipos de buva, doses de glyphosate (0, 100, 180, 324, 583, 1.050, 1.888 e 3.345 g ha-1 e épocas de avaliação para a variável controle (7, 14 e 21 dias após a aplicação. Para as variáveis matéria verde e matéria seca, o esquema fatorial utilizado foi o 12 x 8. As variáveis avaliadas foram controle visual, matéria verde, matéria seca, C50, GR50 e fator de resistência. A dose de 3.345 g glyphosate ha-1 foi a que apresentou maior nível de controle dos biótipos, porém o controle dos biótipos suspeitos não foi efetivo, necessitando de doses mais altas. Todos os biótipos de buva suspeitos de resistência ao glyphosate tiveram essa característica confirmada. Entretanto, constatou-se grande amplitude de fatores de resistência, o que caracteriza a variabilidade entre os biótipos resistentes. Essas informações poderão ser utilizadas no planejamento de estratégias de manejo das populações resistentes e na prevenção da ocorrência de novas áreas com buva resistente ao glyphosate.Glyphosate-resistant biotypes of Conyza spp. (hairy fleabane, horseweed in crop areas in the western and southwestern regions of the state of Paraná, Brazil, cause great management, economic, and environmental problems. This experiment aimed to determine the existence of horseweed biotypes resistant to glyphosate in the suspected populations collected from farms in western

  11. Efeito da deriva simulada de glyphosate no crescimento inicial de plantas de pinhão-manso Effect of simulated glyphosate drift on the initial growth of physic nut plants

    Directory of Open Access Journals (Sweden)

    N.V Costa

    2009-12-01

    Full Text Available Objetivou-se avaliar o efeito da deriva simulada do herbicida glyphosate no crescimento inicial de plantas de pinhão-manso (Jatropha curcas em casa de vegetação. Para simulação da deriva de glyphosate, utilizaram-se as seguintes doses: 0,0; 1,4; 2,8; 5,6; 11,3; 22,5; 45,0; 90,0; 180,0; e 360,0 g ha-1 de glyphosate, distribuídas em blocos casualizados, com quatro repetições. O glyphosate foi aplicado 51 dias após a semeadura, quando as plantas de pinhão-manso apresentavam entre 16 e 18 folhas completamente desenvolvidas e altura média de 45 cm. As aplicações das doses foram feitas com pulverizador costal pressurizado a CO 2, regulado para proporcionar 200 L ha-1. Os resultados indicam que a altura, o diâmetro do caule, a área foliar, bem como a massa seca de folha, caule e raiz das plantas de pinhão-manso, apresentaram reduções após a simulação da deriva de glyphosate, em relação à testemunha. Dessa forma, pode-se concluir que o desenvolvimento inicial das plantas de pinhão-manso foi influenciado pela deriva simulada de glyphosate; a deriva de doses superiores a 45,0 g ha-1 pode ser severamente prejudicial às plantas no período de 41 dias após a aplicação.This work aimed to evaluate the effect of simulated glyphosate drift on the initial growth of physic nut plants (Jatropha curcas under greenhouse conditions. The experimental design was a randomized block with four replications. To simulate drift, glyphosate was used at the following rates: 0.0, 1.4, 2.8, 5.6, 11.3, 22.5, 45.0, 90.0, 180.0 and 360.0 g ha-1, distributed in randomized blocks with four replications. Glyphosate was applied 51 days after sowing, when the plants displayed between 16 and 18 fully developed leaves and 45 cm height. A backpack sprayer was used, pressurized to CO2 and adjusted to provide spraying consumption of 200 L ha-1. The results indicated that height, stem diameter, leaf area and dry mass of leaf, stem and root of the physic nut plants

  12. Dessecação de plantas daninhas com glyphosate em mistura com ureia ou sulfato de amônio Weed desiccation with glyphosate mixed with urea or ammonium sulfate

    Directory of Open Access Journals (Sweden)

    S.J.P. Carvalho

    2009-06-01

    Full Text Available O glyphosate é um herbicida não-seletivo, sistêmico, usado para controle de plantas daninhas anuais e perenes em todo o mundo. A absorção da molécula do glyphosate ocorre pelos tecidos fotossinteticamente ativos das plantas, porém alguns fatores podem reduzir sua eficácia, como a morfologia e diversidade de espécies, chuva após aplicação, qualidade da água e misturas em tanque com outros defensivos, entre outros. Objetivou-se com este trabalho avaliar a influência da adição de sulfato de amônio ou ureia em calda na eficácia do herbicida glyphosate para dessecação de plantas daninhas. Dois experimentos foram desenvolvidos em Piracicaba - SP, com aplicações de glyphosate (720 e 1.440 g ha-1 isolado ou combinado com duas doses de sulfato de amônio (7,5 e 15,0 g L-1 ou ureia (2,5 e 5,0 g L-1 sobre as plantas daninhas: apaga-fogo (Alternanthera tenella e capim-massambará (Sorghum halepense. Para a espécie menos suscetível ao herbicida (capim-massambará, a adição de fontes nitrogenadas à menor dose de glyphosate acelerou a morte das plantas, elevando os níveis de controle em até 7,3% na avaliação de 21 dias após aplicação (DAA dos tratamentos. Contudo, os efeitos não foram observados nas avaliações de controle, massa fresca e seca, conduzidas aos 28 DAA. A dose recomendada de glyphosate para cada espécie proporcionou controle satisfatório, sem a necessidade de adição de sulfato de amônio ou ureia.Glyphosate is a non-selective systemic herbicide used to control annual and perennial weeds worldwide. Molecule absorption occurs through the plant's photosynthetically-active tissues; however, some factors might reduce its efficacy, such as morphology and specific diversity, rain after application, water quality and tank mixtures with other chemicals. Thus, this work aimed to evaluate the influence of ammonium sulfate or urea addiction to spray tank on glyphosate efficacy for weed desiccation. Two trials were

  13. A Highly Selective and Sensitive Fluorescence Detection Method of Glyphosate Based on an Immune Reaction Strategy of Carbon Dot Labeled Antibody and Antigen Magnetic Beads.

    Science.gov (United States)

    Wang, Duo; Lin, Bixia; Cao, Yujuan; Guo, Manli; Yu, Ying

    2016-08-01

    A sensitive fluorescence detection method for glyphosate (GLY) was established based on immune reaction. First, carbon dot labeled antibodies (lgG-CDs) which were able to specifically identify glyphosate were prepared with the environmentally friendly carbon dots (CDs) and glyphosate antibody (lgG). lgG-CDs could be used to in situ visualize the distribution of glyphosate in plant tissues. In order to eliminate the effects of excess lgG-CDs on the determination of GLY, antigen magnetic beads Fe3O4-GLY based on magnetic nanoparticles Fe3O4 and glyphosate were constructed and utilized to couple with the excess lgG-CDs. After magnetic separation to remove antigen magnetic beads, there was a linear relationship between the fluorescence intensity of lgG-CDs and the logarithmic concentration of glyphosate in the range of 0.01-80 μg/mL with a detection limit of 8 ng/mL. The method was used for the detection of glyphosate in Pearl River water, tea, and soil samples with satisfactory recovery ratio between 87.4% and 103.7%. PMID:27403652

  14. Conference summary: Experimnetal

    International Nuclear Information System (INIS)

    The conference is the 1995 International Conference on Strongly Correlated Electron Systems. The summary highlights research on the ''extended'' Doniach model, Kondo insulators, borocarbide superconductors, oxides (including cuprates), other phase transitions, and new materials

  15. Avaliação de formulações de glyphosate sobre soja Roundup Ready Effects of glyphosate formulations on transgenic soybean

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2007-03-01

    Full Text Available Avaliou-se neste trabalho o efeito da aplicação de três marcas comerciais de glyphosate - Roundup Ready® e R. Transorb®, formuladas à base do sal de isopropilamina, e Zapp Qi®, à base do sal potássico - sobre a soja transgênica (variedade CD 219RR, tolerante a esse herbicida . Aos 25 dias após a emergência, quando as plantas apresentavam o segundo trifólio completamente expandido (estádios V2-V3, foram aplicadas formulações do glyphosate na dose de 2.000 g ha-1. Avaliou-se a intoxica��ão das plantas aos 15 dias após a aplicação do herbicida, o número e massa seca de folíolos, o número de nódulos radiculares e o teor foliar de N, P, K, S, Ca, Mg, Fe, Cu, Zn e Mn, por ocasião do florescimento (59 dias após a emergência - DAE, e o rendimento de grãos ao final do ciclo (127 DAE. A partir de amostras de solo, também coletadas na etapa de florescimento da soja, avaliou-se a taxa de respiração basal do solo, o carbono da biomassa microbiana e quociente metabólico. O Roundup Transorb, formulado à base do sal de isopropilamina, foi mais prejudicial às plantas de soja RG, reduzindo o número de nódulos radiculares e o rendimento de grãos, além de promover maior efeito negativo sobre a microbiota do solo. Roundup Ready, à base do mesmo sal isopropilamina, não deve ser aplicado na soja RG em doses elevadas, haja visto ser capaz de alterar o teor de alguns nutrientes nas folhas da cultura, entre eles N, Ca, Mg, Fe e Cu, além de causar intoxicação nas plantas.This study aimed to evaluate the effects of three glyphosate formulations (Roundup Ready® and R. Transorb® - both with isopropylamine salt and Zapp Qi®, formulated as potassium salt, on transgenic soybean. CD 219RR variety soybean plants displaying the CP4Epsps gene, tolerant to glyphosate, were cultivated. At 25 days after emergence (DAE, when plants showed the second trifolium completely expanded (stadiums V2-V3 , formulations were applied at 2,000 g ha

  16. Seletividade do halosulfuron isolado ou em mistura com glyphosate para culturas anuais Selectivity of halosulfuron alone or in mixture with glyphosate for annual crops

    Directory of Open Access Journals (Sweden)

    L.S. Souza

    2001-12-01

    Full Text Available O objetivo do presente trabalho foi avaliar a seletividade do herbicida halosulfuron isoladamente e na mistura com glyphosate, aplicados em pré e pós-emergência, para culturas de verão (milho, feijão, algodão e soja e para culturas de inverno (aveia-preta, azevém, centeio, trigo e triticale. Foram instalados dois experimentos em campo, nas Fazendas Experimentais do Lageado e de São Manuel - UNESP - Botucatu-SP - Brasil. Os tratamentos foram constituídos da aplicação isolada do herbicida halosulfuron (100/150 g ha-1, em pré e pós-emergência, e em mistura de tanque halosulfuron + glyphosate NA e WG (100+4.000 g ha-1 e 100+2.000/4.000 g ha¹, respectivamente, em pré-emergência e em diferentes épocas de aplicação (2, 15 e 30 dias antes e 15 e 30 depois da semeadura. A intensidade da fitotoxicidade encontrada nas plantas das culturas de soja, milho, feijão, algodão e azevém foi devido à aplicação do herbicida halosulfuron, que esteve relacionada com dosagens, época e modo de aplicação. Quanto mais próximo da aplicação do halosulfuron em pós-emergência da semeadura das culturas, maiores foram as injúrias encontradas em suas plantas. Todos os tratamentos testados não proporcionaram sintomas de fitotoxicidade nas plantas de aveia-preta, centeio, trigo e triticale.The objective of this research was to evaluate the selectivity of halosulfuron alone and in mixture with glyphosate sprayed on pre and post emergence on summer crops soybean, corn, bean, cotton and for winter crops black oats, ryegrass, rye, wheat and X Triticosacale. Two experiments were carried out at Experimental Station and São Manuel - UNESP - Botucatu-SP - Brazil. The treatments consisted of halosulfuron herbicide (100/150 g ha-1 on pre and post emergence application, and in tank mix of halosulfuron+glyphosate NA and WG (100+4000 g ha¹ respectively on pre emergence application and in different timings: 2, 15 and 30 days before and 15 and 30 days after

  17. 抗草甘膦杂草的抗性机理研究进展%Advances on Resistance Mechanism of Glyphosate-Resistant Weeds

    Institute of Scientific and Technical Information of China (English)

    巩元勇; 郭书巧; 束红梅; 王庆南; 倪万潮

    2012-01-01

    草甘膦因其独特而优异的理化特性,自上市起便受到广泛的关注,现在已经成为全世界应用最广的除草剂之一.但是随着草甘膦抗性杂草的不断出现,草甘膦的应用前景受到严峻的挑战.文章综述了草甘膦生产及应用现状、草甘膦作用机理和草甘膦抗性杂草的发展,重点阐述了草甘膦抗性杂草的抗性机理.最后对如何通过延缓草甘膦抗性杂草的出现,保护草甘膦提出建议.%Glyphosate, because of its unique and excellent physical and chemical properties, has attracted much attention since it was commercialized. At present, glyphosate has become one of the most widely used herbicide around the world. But with the emergence of glyphosate - resistant weeds population, the application prospect of glyphosate has been seriously challenged. In this paper it was reviewed in the production and application status, the mechanism of action of glyphosate and the development of glyphosate — resistant weeds especially focused on introduction of the resistance mechanism of glyphosate - resistant weeds. Finally, how to delay the emergence of glyphosate - resistant weeds to protect the application of glyphosate has been also proposed in this paper.

  18. Direct and indirect effects of the glyphosate formulation Glifosato Atanor® on freshwater microbial communities.

    Science.gov (United States)

    Vera, María Solange; Di Fiori, Eugenia; Lagomarsino, Leonardo; Sinistro, Rodrigo; Escaray, Roberto; Iummato, María Mercedes; Juárez, Angela; Ríos de Molina, María del Carmen; Tell, Guillermo; Pizarro, Haydée

    2012-10-01

    Glyphosate-based formulations are among the most widely used herbicides in the world. The effect of the formulation Glifosato Atanor(®) on freshwater microbial communities (phytoplankton, bacterioplankton, periphyton and zooplankton) was assessed through a manipulative experiment using six small outdoor microcosms of small volume. Three of the microcosms were added with 3.5 mg l(-1) of glyphosate whereas the other three were left as controls without the herbicide. The treated microcosms showed a significant increase in total phosphorus, not fully explained by the glyphosate present in the Glifosato Atanor(®). Therefore, part of the phosphorus should have come from the surfactants of the formulation. The results showed significant direct and indirect effects of Glifosato Atanor(®) on the microbial communities. A single application of the herbicide caused a fast increase both in the abundance of bacterioplankton and planktonic picocyanobacteria and in chlorophyll a concentration in the water column. Although metabolic alterations related to oxidative stress were induced in the periphyton community, the herbicide favored its development, with a large contribution of filamentous algae typical of nutrient-rich systems, with shallow and calm waters. An indirect effect of the herbicide on the zooplankton was observed due to the increase in the abundance of the rotifer Lecane spp. as a consequence of the improved food availability given by picocyanobacteria and bacteria. The formulation affected directly a fraction of copepods as a target. It was concluded that the Glifosato Atanor(®) accelerates the deterioration of the water quality, especially when considering small-volume water systems. PMID:22539117

  19. Genotoxicity induced by Roundup® (Glyphosate) in tegu lizard (Salvator merianae) embryos.

    Science.gov (United States)

    Schaumburg, Laura G; Siroski, Pablo A; Poletta, Gisela L; Mudry, Marta D

    2016-06-01

    Environmental contaminants produce multiple adverse consequences at individual, population and ecosystem levels. High volumes of agrochemicals applied to great variety of crops, together with agricultural expansion, generate great concerns due to the impact for the environment and large risk implicated for wildlife. The lack of data on these threats is striking. The tegu lizard (Salvator merianae) is one of the species that live in environments under contaminant effects. Several characteristics allow proposing this species as a potential sentinel organism for the monitoring of pesticides in their habitat. The present study is the first report about genotoxicity in tegu lizard neonates after embryonic exposure to Roundup® (glyphosate 66.2%). The micronucleus test (MN), nuclear abnormalities (NAs) assay and comet assay (CA) were used as biomarkers of genotoxic effects induced in erythrocytes by topical exposure of the eggs to the glyphosate commercial formulation Roundup® (RU), in laboratory controlled conditions. A total of 96 eggs were distributed in six groups exposed to RU (50, 100, 200, 400, 800, 1600μg/egg), one positive control (PC; 200μg cyclophosphamide/egg) and one negative control (NC; distilled water). No teratogenic effects were observed in any of the exposed or control neonates. A significant increase in DNA damage was observed in all concentrations higher than 100μg/egg with respect to NC (p0.05). Our results provide new information about the undesirable effects of the glyphosate-based herbicide formulations RU on this lizard species that inhabits areas permanently exposed to several pesticide formulations. We consider of utmost necessity a strict regulation of the agrochemical application conditions in those environments near to places where wild populations of terrestrial and aquatic species live, in order to minimize the adverse effects on ecosystems. PMID:27155487

  20. Glyphosate-based herbicide exposure causes antioxidant defence responses in the fruit fly Drosophila melanogaster.

    Science.gov (United States)

    de Aguiar, Lais Mattos; Figueira, Fernanda Hernandes; Gottschalk, Marco Silva; da Rosa, Carlos Eduardo

    2016-01-01

    Glyphosate is a non-selective and post-emergent herbicide that affects plant growth. Animal exposure to this herbicide can lead to adverse effects, such as endocrine disruption, oxidative stress and behavioural disorders. Drosophilids have been utilized previously as an effective tool in toxicological tests. In the present study, the effects of a glyphosate-based herbicide (Roundup [Original]) were investigated regarding oxidative stress, the antioxidant defence system and acetylcholinesterase (AChE) activity in Drosophila melanogaster. Flies (of both genders) that were 1 to 3days old were exposed to different glyphosate concentrations (0.0mg/L=control, 1.0mg/L, 2.0mg/L, 5.0mg/L and 10.0mg/L) in the diet for 24h and 96h. After the exposure periods, reactive oxygen species (ROS) levels, antioxidant capacity against peroxyl radicals (ACAP) and lipid peroxidation (LPO) levels were quantified. In addition, the mRNA expression of antioxidant genes (i.e., keap1, sod, sod2, cat, irc, gclc, gclm, gss, trxt, trxr-1 and trxr-2) was evaluated via RT-PCR. Additionally, AChE activity was evaluated only after the 96h exposure period. The results indicated that Roundup exposure leads to a reduction in ROS levels in flies exposed for 96h. ACAP levels and gene expression of the antioxidant defence system exhibited an increase from 24h, while LPO did not show any significant alterations in both exposure periods. AChE activity was not affected following Roundup exposure. Our data suggest that Roundup exposure causes an early activation of the antioxidant defence system in D. melanogaster, and this can prevent subsequent damage caused by ROS. PMID:26980113