WorldWideScience

Sample records for amp responsive element

  1. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  2. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  3. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  4. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  5. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Science.gov (United States)

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  6. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  7. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  8. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  9. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  10. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Science.gov (United States)

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  11. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  12. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  13. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  14. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  16. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  17. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  18. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  19. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Science.gov (United States)

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  20. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  1. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Directory of Open Access Journals (Sweden)

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  2. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Directory of Open Access Journals (Sweden)

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  3. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Science.gov (United States)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  4. Inhibition of Cyclic Adenosine Monophosphate (cAMP-response Element-binding Protein (CREB-binding Protein (CBP/β-Catenin Reduces Liver Fibrosis in Mice

    Directory of Open Access Journals (Sweden)

    Yosuke Osawa

    2015-11-01

    Full Text Available Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4- or bile duct ligation (BDL-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis.

  5. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  6. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Science.gov (United States)

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  7. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  8. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  9. Bicarbonate-responsive “soluble” adenylyl cyclase defines a nuclear cAMP microdomain

    Science.gov (United States)

    Zippin, Jonathan H.; Farrell, Jeanne; Huron, David; Kamenetsky, Margarita; Hess, Kenneth C.; Fischman, Donald A.; Levin, Lonny R.; Buck, Jochen

    2004-01-01

    Bicarbonate-responsive “soluble” adenylyl cyclase resides, in part, inside the mammalian cell nucleus where it stimulates the activity of nuclear protein kinase A to phosphorylate the cAMP response element binding protein (CREB). The existence of this complete and functional, nuclear-localized cAMP pathway establishes that cAMP signals in intracellular microdomains and identifies an alternate pathway leading to CREB activation. PMID:14769862

  10. Circadian expression of steroidogenic cytochromes P450 in the mouse adrenal gland--involvement of cAMP-responsive element modulator in epigenetic regulation of Cyp17a1.

    Science.gov (United States)

    Košir, Rok; Zmrzljak, Ursula Prosenc; Bele, Tanja; Acimovic, Jure; Perse, Martina; Majdic, Gregor; Prehn, Cornelia; Adamski, Jerzy; Rozman, Damjana

    2012-05-01

    The cytochrome P450 (CYP) genes Cyp51, Cyp11a1, Cyp17a1, Cyb11b1, Cyp11b2 and Cyp21a1 are involved in the adrenal production of corticosteroids, whose circulating levels are circadian. cAMP signaling plays an important role in adrenal steroidogenesis. By using cAMP responsive element modulator (Crem) knockout mice, we show that CREM isoforms contribute to circadian expression of steroidogenic CYPs in the mouse adrenal gland. Most striking was the CREM-dependent hypomethylation of the Cyp17a1 promoter at zeitgeber time 12, which resulted in higher Cyp17a1 mRNA and protein expression in the knockout adrenal glands. The data indicate that products of the Crem gene control the epigenetic repression of Cyp17 in mouse adrenal glands. © 2011 The Authors Journal compilation © 2011 FEBS.

  11. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  12. An AP-2 element acts synergistically with the cyclic AMP- and Phorbol ester-inducible enhancer of the human proenkephalin gene

    Energy Technology Data Exchange (ETDEWEB)

    Hyman, S.E.; Comb, M.; Pearlberg, J.; Goodman, H.M.

    1989-01-01

    An enhancer with two DNA elements, one containing the sequence CGTCA, is required for cyclic AMP-and phorbol ester-inducible transcription of the human proenkephalin gene. The authors report that an AP-2 element located adjacent to the enhancer acts synergistically with it to confer maximal response to cyclic AMP and phorbol esters.

  13. cAMP response element binding protein1 is essential for activation of steroyl co-enzyme a desaturase 1 (Scd1 in mouse lung type II epithelial cells.

    Directory of Open Access Journals (Sweden)

    Nisha Antony

    Full Text Available Cyclic AMP Response Element-Binding Protein 1 (Creb1 is a transcription factor that mediates cyclic adenosine 3', 5'-monophosphate (cAMP signalling in many tissues. Creb1(-/- mice die at birth due to respiratory failure and previous genome-wide microarray analysis of E17.5 Creb1(-/- fetal mouse lung identified important Creb1-regulated gene targets during lung development. The lipogenic enzymes stearoyl-CoA desaturase 1 (Scd1 and fatty acid synthase (Fasn showed highly reduced gene expression in Creb1(-/- lungs. We therefore hypothesized that Creb1 plays a crucial role in the transcriptional regulation of genes involved in pulmonary lipid biosynthetic pathways during lung development. In this study we confirmed that Scd1 and Fasn mRNA levels were down regulated in the E17.5 Creb1(-/- mouse lung while the lipogenic-associated transcription factors SrebpF1, C/ebpα and Pparγ were increased. In vivo studies using germline (Creb1(-/- and lung epithelial-specific (Creb1(EpiΔ/Δ Creb1 knockout mice showed strongly reduced Scd1, but not Fasn gene expression and protein levels in lung epithelial cells. In vitro studies using mouse MLE-15 epithelial cells showed that forskolin-mediated activation of Creb1 increased both Scd1 gene expression and protein synthesis. Additionally, MLE15 cells transfected with a dominant-negative ACreb vector blocked forskolin-mediated stimulation of Scd1 gene expression. Lipid profiling in MLE15 cells showed that dominant-negative ACreb suppressed forskolin-induced desaturation of ether linked lipids to produce plasmalogens, as well as levels of phosphatidylethanolamine, ceramide and lysophosphatidylcholine. Taken together these results demonstrate that Creb1 is essential for the induction and maintenance of Scd1 in developing fetal mouse lung epithelial cells.

  14. Suppressing cAMP response element-binding protein transcription shortens the duration of status epilepticus and decreases the number of spontaneous seizures in the pilocarpine model of epilepsy.

    Science.gov (United States)

    Zhu, Xinjian; Dubey, Deepti; Bermudez, Camilo; Porter, Brenda E

    2015-12-01

    Current epilepsy therapies directed at altering the function of neurotransmitter receptors or ion channels, or release of synaptic vesicles fail to prevent seizures in approximately 30% of patients. A better understanding of the molecular mechanism underlying epilepsy is needed to provide new therapeutic targets. The activity of cyclic AMP (cAMP) response element-binding protein (CREB), a major transcription factor promoting CRE-mediated transcription, increases following a prolonged seizure called status epilepticus. It is also increased in the seizure focus of patients with medically intractable focal epilepsy. Herein we explored the effect of acute suppression of CREB activity on status epilepticus and spontaneous seizures in a chronic epilepsy model. Pilocarpine chemoconvulsant was used to induce status epilepticus. To suppress CREB activity, a transgenic mouse line expressing an inducible dominant negative mutant of CREB (CREB(IR) ) with a serine to alanine 133 substitution was used. Status epilepticus and spontaneous seizures of transgenic and wild-type mice were analyzed using video-electroencephalography (EEG) to assess the effect of CREB suppression on seizures. Our findings indicate that activation of CREB(IR) shortens the duration of status epilepticus. The frequency of spontaneous seizures decreased in mice with chronic epilepsy during CREB(IR) induction; however, the duration of the spontaneous seizures was unchanged. Of interest, we found significantly reduced levels of phospho-CREB Ser133 upon activation of CREB(IR) , supporting prior work suggesting that binding to the CRE site is important for CREB phosphorylation. Our results suggest that CRE transcription supports seizure activity both during status epilepticus and in spontaneous seizures. Thus, blocking of CRE transcription is a novel target for the treatment of epilepsy. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

  15. Connexin31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex.

    Science.gov (United States)

    Dere, E; Zheng-Fischhöfer, Q; Viggiano, D; Gironi Carnevale, U A; Ruocco, L A; Zlomuzica, A; Schnichels, M; Willecke, K; Huston, J P; Sadile, A G

    2008-05-02

    Neuronal gap junctions in the brain, providing intercellular electrotonic signal transfer, have been implicated in physiological and behavioral correlates of learning and memory. In connexin31.1 (Cx31.1) knockout (KO) mice the coding region of the Cx31.1 gene was replaced by a LacZ reporter gene. We investigated the impact of Cx31.1 deficiency on open-field exploration, the behavioral response to an odor, non-selective attention, learning and memory performance, and the levels of memory-related proteins in the hippocampus, striatum and the piriform cortex. In terms of behavior, the deletion of the Cx31.1 coding DNA in the mouse led to increased exploratory behaviors in a novel environment, and impaired one-trial object recognition at all delays tested. Despite strong Cx31.1 expression in the peripheral and central olfactory system, Cx31.1 KO mice exhibited normal behavioral responses to an odor. We found increased levels of acetylcholine esterase (AChE) and cAMP response element-binding protein (CREB) in the striatum of Cx31.1 KO mice. In the piriform cortex the Cx31.1 KO mice had an increased heterogeneity of CREB expression among neurons. In conclusion, gap-junctions featuring the Cx31.1 protein might be involved in open-field exploration as well as object memory and modulate levels of AChE and CREB in the striatum and piriform cortex.

  16. Regulation of cyclooxygenase-2 expression by cAMP response element and mRNA stability in a human airway epithelial cell line exposed to zinc

    Science.gov (United States)

    Exposure to zinc-laden particulate matter in ambient and occupational settings has been associated with proinflammatory responses in the lung. Cyclooxygenase 2-derived eicosanoids are important modulators of airway inflammation. In this study, we characterized the transcriptional...

  17. Sodium phenylbutyrate enhances astrocytic neurotrophin synthesis via protein kinase C (PKC)-mediated activation of cAMP-response element-binding protein (CREB): implications for Alzheimer disease therapy.

    Science.gov (United States)

    Corbett, Grant T; Roy, Avik; Pahan, Kalipada

    2013-03-22

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser(133)) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD.

  18. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    Science.gov (United States)

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-05

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  20. Glycogen Synthase Kinase 3α Is the Main Isoform That Regulates the Transcription Factors Nuclear Factor-Kappa B and cAMP Response Element Binding in Bovine Endothelial Cells Infected with Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Octavio Silva-García

    2018-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutive enzyme implicated in the regulation of cytokine expression and the inflammatory response during bacterial infections. Mammals have two GSK3 isoforms named GSK3α and GSK3β that plays different but often overlapping functions. Although the role of GSK3β in cytokine regulation during the inflammatory response caused by bacteria is well described, GSK3α has not been found to participate in this process. Therefore, we tested if GSK3α may act as a regulatory isoform in the cytokine expression by bovine endothelial cells infected with Staphylococcus aureus because this bacterium is one of the major pathogens that cause tissue damage associated with inflammatory dysfunction. Interestingly, although both isoforms were phosphorylated–inactivated, we consistently observed a higher phosphorylation of GSK3α at Ser21 than that of GSK3β at Ser9 after bacterial challenge. During a temporal course of infection, we characterized a molecular switch from pro-inflammatory cytokine expression (IL-8, promoted by nuclear factor-kappa B (NF-κB, at an early stage (2 h to an anti-inflammatory cytokine expression (IL-10, promoted by cAMP response element binding (CREB, at a later stage (6 h. We observed an indirect effect of GSK3α activity on NF-κB activation that resulted in a low phosphorylation of CREB at Ser133, a decreased interaction between CREB and the co-activator CREB-binding protein (CBP, and a lower expression level of IL-10. Gene silencing of GSK3α and GSK3β with siRNA indicated that GSK3α knockout promoted the interaction between CREB and CBP that, in turn, increased the expression of IL-10, reduced the interaction of NF-κB with CBP, and reduced the expression of IL-8. These results indicate that GSK3α functions as the primary isoform that regulates the expression of IL-10 in endothelial cells infected with S. aureus.

  1. The glutamate carboxypeptidase AMP1 mediates abscisic acid and abiotic stress responses in Arabidopsis.

    Science.gov (United States)

    Shi, Yiting; Wang, Zheng; Meng, Pei; Tian, Siqi; Zhang, Xiaoyan; Yang, Shuhua

    2013-07-01

    ALTERED MERISTEM PROGRAM1 (AMP1) encodes a glutamate carboxypeptidase that plays an important role in shoot apical meristem development and phytohormone homeostasis. We isolated a new mutant allele of AMP1, amp1-20, from a screen for abscisic acid (ABA) hypersensitive mutants and characterized the function of AMP1 in plant stress responses. amp1 mutants displayed ABA hypersensitivity, while overexpression of AMP1 caused ABA insensitivity. Moreover, endogenous ABA concentration was increased in amp1-20- and decreased in AMP1-overexpressing plants under stress conditions. Application of ABA reduced the AMP1 protein level in plants. Interestingly, amp1 mutants accumulated excess superoxide and displayed hypersensitivity to oxidative stress. The hypersensitivity of amp1 to ABA and oxidative stress was partially rescued by reactive oxygen species (ROS) scavenging agent. Furthermore, amp1 was tolerant to freezing and drought stress. The ABA hypersensitivity and freezing tolerance of amp1 was dependent on ABA signaling. Moreover, amp1 had elevated soluble sugar content and showed hypersensitivity to high concentrations of sugar. By contrast, the contents of amino acids were changed in amp1 mutant compared to the wild-type. This study suggests that AMP1 modulates ABA, oxidative and abotic stress responses, and is involved in carbon and amino acid metabolism in Arabidopsis. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  2. Proteomic signatures implicate cAMP in light and temperature responses in Arabidopsis thaliana

    KAUST Repository

    Thomas, Ludivine; Marondedze, Claudius; Ederli, Luisa; Pasqualini, Stefania; Gehring, Christoph A

    2013-01-01

    The second messenger 3'-5'-cyclic adenosine monophosphate (cAMP) and adenylyl cyclases (ACs), enzymes that catalyse the formation of cAMP from ATP, are increasingly recognized as important signaling molecules in a number of physiological responses

  3. Proteomic signatures implicate cAMP in light and temperature responses in Arabidopsis thaliana

    KAUST Repository

    Thomas, Ludivine

    2013-05-01

    The second messenger 3\\'-5\\'-cyclic adenosine monophosphate (cAMP) and adenylyl cyclases (ACs), enzymes that catalyse the formation of cAMP from ATP, are increasingly recognized as important signaling molecules in a number of physiological responses in higher plants. Here we used proteomics to identify cAMP-dependent protein signatures in Arabidopsis thaliana and identify a number of differentially expressed proteins with a role in light- and temperature-dependent responses, notably photosystem II subunit P-1, plasma membrane associated cation-binding protein and chaperonin 60 β. Based on these proteomics results we conclude that, much like in cyanobacteria, algae and fungi, cAMP may have a role in light signaling and the regulation of photosynthesis as well as responses to temperature and we speculate that ACs could act as light and/or temperature sensors in higher plants. Biological significance: This current study is significant since it presents the first proteomic response to cAMP, a novel and key second messenger in plants. It will be relevant to researchers in plant physiology and in particular those with an interest in second messengers and their role in biotic and abiotic stress responses. © 2013 Elsevier B.V.

  4. cAMP-response Element-binding Protein (CREB) and NF-κB Transcription Factors Are Activated during Prolonged Hypoxia and Cooperatively Regulate the Induction of Matrix Metalloproteinase MMP1*

    Science.gov (United States)

    Nakayama, Koh

    2013-01-01

    Responses to low levels of oxygen (hypoxia) are essential to maintain homeostasis. During the hypoxic response, gene expression is altered by various transcription factors. The transcription factor, hypoxia-inducible factor (HIF), plays a central role in the hypoxic response. The α subunit of HIF, which is actively degraded during normoxia, becomes stabilized during hypoxia, which leads to HIF activation. A microarray analysis of HeLa cells showed that expression of matrix metalloproteinase 1 (MMP1) was markedly induced during prolonged hypoxia. CREB and NF-κB binding sites were identified in the MMP1 promoter region between 1945 and 1896 nucleotides upstream of the transcription start site. Assays with luciferase reporters demonstrated that HIF activity was induced during the early phase of hypoxia, whereas CREB and NF-κB were activated during the later (prolonged) phase. Depletion of CREB and/or NF-κB reduced MMP1 induction during prolonged hypoxia both at the mRNA and protein levels. A chromatin immunoprecipitation assay demonstrated binding of CREB and NF-κB to the MMP1 promoter. Finally, cell migration and invasion on a collagen matrix and pulmonary metastasis in nude mice were inhibited after depletion of CREB and NF-κB in MDA-MB-231 cells. Taken together, these results suggest that the cooperative action of CREB and NF-κB plays an important role to induce MMP1 expression during prolonged hypoxia and regulates cell migration and invasion in cancer cells. PMID:23775082

  5. Nonequivalence of the magnetostatic potential energy corresponding to the Ampère and Grassmann current element force formulas

    International Nuclear Information System (INIS)

    Minteer, Timothy M

    2013-01-01

    The equivalence of the Ampère and Grassmann (Biot–Savart/Lorentz) current element force formulas is well established. However, when the magnetostatic potential energy corresponding to these force formulas is evaluated, the formulas are found to be nonequivalent. The historical current element force formulas are first presented. The magnetostatic potential energy corresponding to these historical current element force formulas are then analysed. The end result establishes the Grassmann and Neumann current element force formulas as the only commonly referenced formulas giving the correct magnetostatic potential energy for circuital currents. (paper)

  6. Cyclic AMP response element binding protein and brain-derived ...

    Indian Academy of Sciences (India)

    Madhu

    learning tasks and memory (Bramham and Messaoudi 2005). Thus, BDNF is involved in structural remodeling, neuronal .... in hippocampal-dependent learning and memory (Tyler et al 2002; Mizuno and Giese 2005) may play a ..... neurons in the olfactory bulb; J. Neurosci. 25 10105–10118. Gould E and Tanapat P 1999 ...

  7. Review Cyclic AMP response element binding protein and brain ...

    Indian Academy of Sciences (India)

    Madhu

    Several types of adult-onset stressors, including physical and psychosocial stressors ... stress-induced atrophy with antidepressant therapy in animal models (Watanabe et ..... (Strauss et al 2005) and geriatric depression (Hwang et al. 2005).

  8. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Science.gov (United States)

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  9. The Interplay between Cyclic AMP, MAPK, and NF-κB Pathways in Response to Proinflammatory Signals in Microglia

    Directory of Open Access Journals (Sweden)

    Mousumi Ghosh

    2015-01-01

    Full Text Available Cyclic AMP is an important intracellular regulator of microglial cell homeostasis and its negative perturbation through proinflammatory signaling results in microglial cell activation. Though cytokines, TNF-α and IL-1β, decrease intracellular cyclic AMP, the mechanism by which this occurs is poorly understood. The current study examined which signaling pathways are responsible for decreasing cyclic AMP in microglia following TNF-α stimulation and sought to identify the role cyclic AMP plays in regulating these pathways. In EOC2 microglia, TNF-α produced a dramatic reduction in cyclic AMP and increased cyclic AMP-dependent PDE activity that could be antagonized by Rolipram, myristoylated-PKI, PD98059, or JSH-23, implicating a role for PDE4, PKA, MEK, and NF-κB in this regulation. Following TNF-α there were significant increases in iNOS and COX-2 immunoreactivity, phosphorylated ERK1/2 and NF-κB-p65, IκB degradation, and NF-κB p65 nuclear translocation, which were reduced in the presence of high levels of cyclic AMP, indicating that reductions in cyclic AMP during cytokine stimulation are important for removing its inhibitory action on NF-κB activation and subsequent proinflammatory gene expression. Further elucidation of the signaling crosstalk involved in decreasing cyclic AMP in response to inflammatory signals may provide novel therapeutic targets for modulating microglial cell activation during neurological injury and disease.

  10. Analysis of Biot-Savart’s law in comparison with Ampère’s force between current elements

    Directory of Open Access Journals (Sweden)

    Hugo Shigueo Tanaka dos Santos

    2017-12-01

    Full Text Available Nowadays, we use Biot-Savart’s Law and Grassmann’s force to study the magnetic fields effects. We can observe that this force apparently do not always satisfy the principle of action and reaction. In contrast, Ampère’s force always satisfies this principle explicitly and always along the straight line connecting the two currents elements. The present work presents a historic analysis of the development of these two forces, which have been developed based on interpretations of the Ørsted’s experiment. We also compare these two forces in order to verify if both have the same result. We show that the Grassmann’s expression, in fact, does not satisfy to the principle of action and reaction. Ampère’s force not only follows the principle of action and reaction in the strongest way, but it also explains the phenomena based action at a distance, which is easier to be observed and has many other powerful results, not only in the electromagnetism. In order to compare these two approaches, we calculate the force that an infinite rectilinear wire exerts on a loop of conductive material, both with current.

  11. Bronchodilator responses after methacholine and adenosine 5'-monophosphate (AMP) challenges in children with asthma: their relationships with eosinophil markers.

    Science.gov (United States)

    Yoo, Young; Seo, Sung Chul; Kim, Young Il; Chung, Bo Hyun; Song, Dae Jin; Choung, Ji Tae

    2012-09-01

    Bronchodilator responsiveness (BDR) and eosinophilic inflammation are characteristic features of asthma. Objective. The aim of this study was to compare the relationships of BDR after methacholine challenge or adenosine 5'-monophosphate (AMP) challenge to blood eosinophil markers in children with asthma. Methacholine and AMP challenges were performed on 69 children with mild intermittent to moderate persistent asthma. BDR was calculated as the change in forced expiratory volume in 1 second, expressed as percentage change of the value immediately after the each challenge and the value after inhalation of salbutamol. Serum total IgE levels, blood eosinophil counts, and serum eosinophil cationic protein (ECP) levels were determined for each subject. A positive relationship between serum total IgE levels and BDR was found only after the AMP challenge (R(2) = 0.345, p = .001) rather than after the methacholine challenge (R(2) = 0.007, p = .495). Peripheral blood eosinophil counts correlated more significantly with BDR after AMP challenge (R(2) = 0.212, p = .001) than BDR after methacholine challenge (R(2) = 0.002, p = .724). Both BDR after methacholine challenge (R(2) = 0.063, p = .038) and BDR after AMP challenge (R(2) = 0.192, p = .001) were significantly correlated with serum ECP levels. BDR after AMP challenge may be more closely related to eosinophilic inflammation, compared with that after methacholine challenge.

  12. Methacholine and adenosine 5'-monophosphate (AMP) responsiveness, and the presence and degree of atopy in children with asthma.

    Science.gov (United States)

    Suh, Dong I; Lee, Ju K; Kim, Chang K; Koh, Young Y

    2011-02-01

    The relationship between atopy and bronchial hyperresponsiveness (BHR), both key features of asthma, remains to be clarified. BHR is commonly evaluated by bronchial challenges using direct and indirect stimuli. The aim of this study was to investigate the degree of BHR to methacholine (direct stimulus) and adenosine 5'-monophosphate (AMP) (indirect stimulus) according to the presence and degree of atopy in children with asthma. We performed a retrospective analysis of data from 120 children presenting with a diagnosis of asthma. These children were characterized by skin-prick tests (SPTs), spirometry and bronchial challenges with methacholine and AMP. Atopy was defined by at least one positive reaction to SPTs, and its degree was measured using serum total IgE levels, number of positive SPTs and atopic scores (sum of graded wheal size). A provocative concentration causing a 20% decline in FEV(1) (PC(20) ) was determined for each challenge. Patients with atopy(n=94) had a significantly lower AMP PC(20) than non-atopic patients (n=26), whereas methacholine PC(20) was not different between the two groups. Among the patients with atopy, there was no association between methacholine PC(20) and any atopy parameter. In contrast, a significant association was found between AMP PC(20) and the degree of atopy reflected in serum total IgE, number of positive SPTs and atopic scores (anova trend test, p=0.002, 0.001, 0.003, respectively). AMP responsiveness was associated with the presence and degree of atopy, whereas such a relationship was not observed for methacholine responsiveness. These findings suggest that atopic status may be better reflected by bronchial responsiveness assessed by AMP than by methacholine. © 2011 John Wiley & Sons A/S.

  13. Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses

    Directory of Open Access Journals (Sweden)

    Geneviève Pèépin

    2017-10-01

    Full Text Available Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1 by low-dose camptothecin (CPT can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40 large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development.

  14. Ohmyungsamycins promote antimicrobial responses through autophagy activation via AMP-activated protein kinase pathway.

    Science.gov (United States)

    Kim, Tae Sung; Shin, Yern-Hyerk; Lee, Hye-Mi; Kim, Jin Kyung; Choe, Jin Ho; Jang, Ji-Chan; Um, Soohyun; Jin, Hyo Sun; Komatsu, Masaaki; Cha, Guang-Ho; Chae, Han-Jung; Oh, Dong-Chan; Jo, Eun-Kyeong

    2017-06-13

    The induction of host cell autophagy by various autophagy inducers contributes to the antimicrobial host defense against Mycobacterium tuberculosis (Mtb), a major pathogenic strain that causes human tuberculosis. In this study, we present a role for the newly identified cyclic peptides ohmyungsamycins (OMS) A and B in the antimicrobial responses against Mtb infections by activating autophagy in murine bone marrow-derived macrophages (BMDMs). OMS robustly activated autophagy, which was essentially required for the colocalization of LC3 autophagosomes with bacterial phagosomes and antimicrobial responses against Mtb in BMDMs. Using a Drosophila melanogaster-Mycobacterium marinum infection model, we showed that OMS-A-induced autophagy contributed to the increased survival of infected flies and the limitation of bacterial load. We further showed that OMS triggered AMP-activated protein kinase (AMPK) activation, which was required for OMS-mediated phagosome maturation and antimicrobial responses against Mtb. Moreover, treating BMDMs with OMS led to dose-dependent inhibition of macrophage inflammatory responses, which was also dependent on AMPK activation. Collectively, these data show that OMS is a promising candidate for new anti-mycobacterial therapeutics by activating antibacterial autophagy via AMPK-dependent signaling and suppressing excessive inflammation during Mtb infections.

  15. Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses.

    Science.gov (United States)

    Pépin, Geneviève; Nejad, Charlotte; Ferrand, Jonathan; Thomas, Belinda J; Stunden, H James; Sanij, Elaine; Foo, Chwan-Hong; Stewart, Cameron R; Cain, Jason E; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P

    2017-10-03

    Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1) by low-dose camptothecin (CPT) can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS) detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40) large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development. IMPORTANCE Recent studies suggest that low-dose DNA-damaging compounds traditionally used in cancer therapy can have opposite effects on antiviral responses, either suppressing (with the example of CPT) or potentiating (with the example of doxorubicin) them. Our work demonstrates that the minor DNA damage promoted by low-dose CPT can also trigger strong antiviral responses, dependent on the presence of viral oncogenes. Taken together, these results call for caution in the therapeutic use of low-dose chemotherapy agents to modulate antiviral responses in humans. Copyright © 2017 Pépin et al.

  16. AMP-activated protein kinase reduces inflammatory responses and cellular senescence in pulmonary emphysema.

    Science.gov (United States)

    Cheng, Xiao-Yu; Li, Yang-Yang; Huang, Cheng; Li, Jun; Yao, Hong-Wei

    2017-04-04

    Current drug therapy fails to reduce lung destruction of chronic obstructive pulmonary disease (COPD). AMP-activated protein kinase (AMPK) has emerged as an important integrator of signals that control energy balance and lipid metabolism. However, there are no studies regarding the role of AMPK in reducing inflammatory responses and cellular senescence during the development of emphysema. Therefore, we hypothesize that AMPK reduces inflammatroy responses, senescence, and lung injury. To test this hypothesis, human bronchial epithelial cells (BEAS-2B) and small airway epithelial cells (SAECs) were treated with cigarette smoke extract (CSE) in the presence of a specific AMPK activator (AICAR, 1 mM) and inhibitor (Compound C, 5 μM). Elastase injection was performed to induce mouse emphysema, and these mice were treated with a specific AMPK activator metformin as well as Compound C. AICAR reduced, whereas Compound C increased CSE-induced increase in IL-8 and IL-6 release and expression of genes involved in cellular senescence. Knockdown of AMPKα1/α2 increased expression of pro-senescent genes (e.g., p16, p21, and p66shc) in BEAS-2B cells. Prophylactic administration of an AMPK activator metformin (50 and 250 mg/kg) reduced while Compound C (4 and 20 mg/kg) aggravated elastase-induced airspace enlargement, inflammatory responses and cellular senescence in mice. This is in agreement with therapeutic effect of metformin (50 mg/kg) on airspace enlargement. Furthermore, metformin prophylactically protected against but Compound C further reduced mitochondrial proteins SOD2 and SIRT3 in emphysematous lungs. In conclusion, AMPK reduces abnormal inflammatory responses and cellular senescence, which implicates as a potential therapeutic target for COPD/emphysema.

  17. Cyclic AMP Receptor Protein Acts as a Transcription Regulator in Response to Stresses in Deinococcus radiodurans.

    Directory of Open Access Journals (Sweden)

    Su Yang

    Full Text Available The cyclic AMP receptor protein family of transcription factors regulates various metabolic pathways in bacteria, and also play roles in response to environmental changes. Here, we identify four homologs of the CRP family in Deinococcus radiodurans, one of which tolerates extremely high levels of oxidative stress and DNA-damaging reagents. Transcriptional levels of CRP were increased under hydrogen peroxide (H2O2 treatment during the stationary growth phase, indicating that CRPs function in response to oxidative stress. By constructing all CRP single knockout mutants, we found that the dr0997 mutant showed the lowest tolerance toward H2O2, ultraviolet radiation, ionizing radiation, and mitomycin C, while the phenotypes of the dr2362, dr0834, and dr1646 mutants showed slight or no significant differences from those of the wild-type strain. Taking advantage of the conservation of the CRP-binding site in many bacteria, we found that transcription of 18 genes, including genes encoding chromosome-partitioning protein (dr0998, Lon proteases (dr0349 and dr1974, NADH-quinone oxidoreductase (dr1506, thiosulfate sulfurtransferase (dr2531, the DNA repair protein UvsE (dr1819, PprA (dra0346, and RecN (dr1447, are directly regulated by DR0997. Quantitative real-time polymerase chain reaction (qRT-PCR analyses showed that certain genes involved in anti-oxidative responses, DNA repair, and various cellular pathways are transcriptionally attenuated in the dr0997 mutant. Interestingly, DR0997 also regulate the transcriptional levels of all CRP genes in this bacterium. These data suggest that DR0997 contributes to the extreme stress resistance of D. radiodurans via its regulatory role in multiple cellular pathways, such as anti-oxidation and DNA repair pathways.

  18. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  19. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  20. Antimicrobial Peptides (AMPs

    Directory of Open Access Journals (Sweden)

    Mehrzad Sadredinamin

    2016-04-01

    Full Text Available Antimicrobial peptides (AMPs are extensive group of molecules that produced by variety tissues of invertebrate, plants, and animal species which play an important role in their immunity response. AMPs have different classifications such as; biosynthetic machines, biological sources, biological functions, molecular properties, covalent bonding patterns, three dimensional structures, and molecular targets.These molecules have multidimensional properties including antimicrobial activity, antiviral activity, antifungal activity, anti-parasite activity, biofilm control, antitumor activity, mitogens activity and linking innate to adaptive immunity that making them promising agents for therapeutic drugs. In spite of this advantage of AMPs, their clinical developments have some limitation for commercial development. But some of AMPs are under clinical trials for the therapeutic purpose such as diabetic foot ulcers, different bacterial infections and tissue damage. In this review, we emphasized on the source, structure, multidimensional properties, limitation and therapeutic applications of various antimicrobial peptides.

  1. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  2. Changes in the Arabidopsis thaliana Proteome Implicate cAMP in Biotic and Abiotic Stress Responses and Changes in Energy Metabolism

    KAUST Repository

    Alquraishi, May Majed; Gehring, Christoph A; Marondedze, Claudius

    2016-01-01

    The second messenger 3′,5′-cyclic adenosine monophosphate (cAMP) is increasingly recognized as having many different roles in plant responses to environmental stimuli. To gain further insights into these roles, Arabidopsis thaliana cell suspension culture was treated with 100 nM of cell permeant 8-bromo-cAMP for 5 or 10 min. Here, applying mass spectrometry and comparative proteomics, 20 proteins were identified as differentially expressed and we noted a specific bias in proteins with a role in abiotic stress, particularly cold and salinity, biotic stress as well as proteins with a role in glycolysis. These findings suggest that cAMP is sufficient to elicit specific stress responses that may in turn induce complex changes to cellular energy homeostasis.

  3. Changes in the Arabidopsis thaliana Proteome Implicate cAMP in Biotic and Abiotic Stress Responses and Changes in Energy Metabolism

    KAUST Repository

    Alquraishi, May Majed

    2016-06-01

    The second messenger 3′,5′-cyclic adenosine monophosphate (cAMP) is increasingly recognized as having many different roles in plant responses to environmental stimuli. To gain further insights into these roles, Arabidopsis thaliana cell suspension culture was treated with 100 nM of cell permeant 8-bromo-cAMP for 5 or 10 min. Here, applying mass spectrometry and comparative proteomics, 20 proteins were identified as differentially expressed and we noted a specific bias in proteins with a role in abiotic stress, particularly cold and salinity, biotic stress as well as proteins with a role in glycolysis. These findings suggest that cAMP is sufficient to elicit specific stress responses that may in turn induce complex changes to cellular energy homeostasis.

  4. Effects of exogenous cyclic AMP on growth characteristics and radiation response of Reuber H35 hepatoma cells

    International Nuclear Information System (INIS)

    van Rijn, J.; van Den Berg, J.; van Meeteren, A.; van Wijk, R.

    1983-01-01

    Reuber H35 rat hepatoma cells, clone KRC, were used to study the effect of cyclic AMP on radiation-induced cell death. Treatment of logarithmically growing cultures with 0.5 mM cAMP for 17 hr prior to irradiation resulted in a decreased cell survival. Similar results were obtained with cultures irradiated after treatment with Bt 2 cAMP. Treatment of H35 cells with cAMP or Bt 2 cAMP caused inhibition of their proliferation and resulted in an accumulation of cells in early S phase and depletion of G2-phase cells. In synchronized cultures cells were relatively radioresistant during their S phase. In addition to single-dose treatment with X rays, the effect of Bt 2 cAMP on radiation-induced cell death was studied during fractionated irradiation wtih 2.5 Gy per day. This fractionated irradiation resulted in a dose-reduction factor of 1.6 at the 10% survival level and a 10-fold decrease in the surviving cell population due to the cooperative effects of Bt 2 cAMP on growth rate and radiation survival. The effect of cAMP on radiation-induced mitotic delay was also studied. It appeared that where cAMP had on effect on the progression of G2 cells into mitosis, it prevented cells from recovery from the X-ray mitotic delay in G2

  5. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  6. Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

    International Nuclear Information System (INIS)

    Kasai, Ayumi; Yao, Jian; Yamauchi, Kozue; Hiramatsu, Nobuhiko; Hayakawa, Kunihiro; Meng, Yiman; Maeda, Shuichiro; Kitamura, Masanori

    2006-01-01

    In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE cyp ) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR MMTV ) to improve sensitivity of assays. We found that DRE cyp -LTR MMTV responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE cyp -LTR MMTV and not involved in this process. In contrast to the effect of dioxin, the activation of DRE cyp -LTR MMTV by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE cyp , LTR MMTV nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE cyp with LTR MMTV causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE cyp -LTR MMTV -based bioassays for detection and quantification of dioxins and dioxin-like compounds

  7. Application and optimization of the tenderization of pig Longissimus dorsi muscle by adenosine 5'-monophosphate (AMP) using the response surface methodology.

    Science.gov (United States)

    Deng, Shaoying; Wang, Daoying; Zhang, Muhan; Geng, Zhiming; Sun, Chong; Bian, Huan; Xu, Weimin; Zhu, Yongzhi; Liu, Fang; Wu, Haihong

    2016-03-01

    Based on single factor experiments, NaCl concentration, adenosine 5'-monophosphate (AMP) concentration and temperature were selected as independent variables for a three-level Box-Behnken experimental design, and the shear force and cooking loss were response values for regression analysis. According to the statistical models, it showed that all independent variables had significant effects on shear force and cooking loss, and optimal values were at the NaCl concentration of 4.15%, AMP concentration of 22.27 mmol/L and temperature of 16.70°C, which was determined with three-dimensional response surface diagrams and contour plots. Under this condition, the observed shear force and cooking loss were 0.625 kg and 8.07%, respectively, exhibiting a good agreement with their predicted values, showing the good applicability and feasibility of response surface methodology (RSM) for improving pork tenderness. Compared with control pig muscles, AMP combined with NaCl treatment demonstrated significant effects on improvement of meat tenderness and reduction of cooking loss. Therefore, AMP could be regarded as an effective tenderization agent for pork. © 2015 Japanese Society of Animal Science.

  8. Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses

    OpenAIRE

    Pépin, Geneviève; Nejad, Charlotte; Ferrand, Jonathan; Thomas, Belinda J.; Stunden, H. James; Sanij, Elaine; Foo, Chwan-Hong; Stewart, Cameron R.; Cain, Jason E.; Bardin, Philip G.; Williams, Bryan R. G.; Gantier, Michael P.

    2017-01-01

    ABSTRACT Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1) by low-dose camptothecin (CPT) can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through c...

  9. DisA and c-di-AMP act at the intersection between DNA-damage response and stress homeostasis in exponentially growing Bacillus subtilis cells.

    Science.gov (United States)

    Gándara, Carolina; Alonso, Juan C

    2015-03-01

    Bacillus subtilis contains two vegetative diadenylate cyclases, DisA and CdaA, which produce cyclic di-AMP (c-di-AMP), and one phosphodiesterase, GdpP, that degrades it into a linear di-AMP. We report here that DisA and CdaA contribute to elicit repair of DNA damage generated by alkyl groups and H2O2, respectively, during vegetative growth. disA forms an operon with radA (also termed sms) that encodes a protein distantly related to RecA. Among different DNA damage agents tested, only methyl methane sulfonate (MMS) affected disA null strain viability, while radA showed sensitivity to all of them. A strain lacking both disA and radA was as sensitive to MMS as the most sensitive single parent (epistasis). Low c-di-AMP levels (e.g. by over-expressing GdpP) decreased the ability of cells to repair DNA damage caused by MMS and in less extent by H2O2, while high levels of c-di-AMP (absence of GdpP or expression of sporulation-specific diadenylate cyclase, CdaS) increased cell survival. Taken together, our results support the idea that c-di-AMP is a crucial signalling molecule involved in DNA repair with DisA and CdaA contributing to modulate different DNA damage responses during exponential growth. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Polarized Th1 and Th2 cells are less responsive to negative feedback by receptors coupled to the AC/cAMP system compared to freshly isolated T cells

    NARCIS (Netherlands)

    Heijink, Irene H; Vellenga, Edo; Borger, Peter; Postma, Dirkje S; Monchy, Jan G R de; Kauffman, Henk F

    1 The adenylyl cyclase (AC)/cyclic adenosine monophosphate (cAMP) system is known to negatively regulate transcriptional activity of T cells, thereby possibly modulating T-cell-mediated responses at the sites of inflammation. Effects of cAMP have been widely studied in freshly isolated T cells and

  11. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

    Directory of Open Access Journals (Sweden)

    Yan Wang

    2015-01-01

    Full Text Available Rheumatoid arthritis (RA is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.

  12. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes.

    Science.gov (United States)

    Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

    2015-01-01

    Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.

  13. Decreased hepatic response to glucagon, adrenergic agonists, and cAMP in glycogenolysis, gluconeogenesis, and glycolysis in tumor-bearing rats.

    Science.gov (United States)

    Biazi, Giuliana R; Frasson, Isabele G; Miksza, Daniele R; de Morais, Hely; de Fatima Silva, Flaviane; Bertolini, Gisele L; de Souza, Helenir M

    2018-05-15

    The response to glucagon and adrenaline in cancer cachexia is poorly known. The aim of this study was to investigate the response to glucagon, adrenergic agonists (α and β) and cyclic adenosine monophosphate (cAMP) on glycogenolysis, gluconeogenesis, and glycolysis in liver perfusion of Walker-256 tumor-bearing rats with advanced cachexia. Liver ATP content was also investigated. Rats without tumor (healthy) were used as controls. Agonists α (phenylephrine) and β (isoproterenol) adrenergic, instead of adrenaline, and cAMP, the second messenger of glucagon and isoproterenol, were used in an attempt to identify mechanisms involved in the responses. Glucagon (1 nM) stimulated glycogenolysis and gluconeogenesis and inhibited glycolysis in the liver of healthy and tumor-bearing rats, but their effects were lower in tumor-bearing rats. Isoproterenol (20 µM) stimulated glycogenolysis, gluconeogenesis, and glycolysis in healthy rats and had virtually no effect in tumor-bearing rats. cAMP (9 µM) also stimulated glycogenolysis and gluconeogenesis and inhibited glycolysis in healthy rats but had practically no effect in tumor-bearing rats. Phenylephrine (2 µM) stimulated glycogenolysis and gluconeogenesis and inhibited glycolysis and these effects were also lower in tumor-bearing rats than in healthy. Liver ATP content was lower in tumor-bearing rats. In conclusion, tumor-bearing rats with advanced cachexia showed a decreased hepatic response to glucagon, adrenergic agonists (α and β), and cAMP in glycogenolysis, gluconeogenesis, and glycolysis, which may be due to a reduced rate of regulatory enzyme phosphorylation caused by the low ATP levels in the liver. © 2018 Wiley Periodicals, Inc.

  14. cAMP and EPAC are key players in the regulation of the signal transduction pathway involved in the α-hemolysin autophagic response.

    Directory of Open Access Journals (Sweden)

    María Belén Mestre

    Full Text Available Staphylococcus aureus is a microorganism that causes serious diseases in the human being. This microorganism is able to escape the phagolysosomal pathway, increasing intracellular bacterial survival and killing the eukaryotic host cell to spread the infection. One of the key features of S. aureus infection is the production of a series of virulence factors, including secreted enzymes and toxins. We have shown that the pore-forming toxin α-hemolysin (Hla is the S. aureus-secreted factor responsible for the activation of the autophagic pathway and that this response occurs through a PI3K/Beclin1-independent form. In the present report we demonstrate that cAMP has a key role in the regulation of this autophagic response. Our results indicate that cAMP is able to inhibit the autophagy induced by Hla and that PKA, the classical cAMP effector, does not participate in this regulation. We present evidence that EPAC and Rap2b, through calpain activation, are the proteins involved in the regulation of Hla-induced autophagy. Similar results were obtained in cells infected with different S. aureus strains. Interestingly, in this report we show, for the first time to our knowledge, that both EPAC and Rap2b are recruited to the S. aureus-containing phagosome. We believe that our findings have important implications in understanding innate immune processes involved in intracellular pathogen invasion of the host cell.

  15. Cyclic AMP Regulates Bacterial Persistence through Repression of the Oxidative Stress Response and SOS-Dependent DNA Repair in Uropathogenic Escherichia coli.

    Science.gov (United States)

    Molina-Quiroz, Roberto C; Silva-Valenzuela, Cecilia; Brewster, Jennifer; Castro-Nallar, Eduardo; Levy, Stuart B; Camilli, Andrew

    2018-01-09

    Bacterial persistence is a transient, nonheritable physiological state that provides tolerance to bactericidal antibiotics. The stringent response, toxin-antitoxin modules, and stochastic processes, among other mechanisms, play roles in this phenomenon. How persistence is regulated is relatively ill defined. Here we show that cyclic AMP, a global regulator of carbon catabolism and other core processes, is a negative regulator of bacterial persistence in uropathogenic Escherichia coli , as measured by survival after exposure to a β-lactam antibiotic. This phenotype is regulated by a set of genes leading to an oxidative stress response and SOS-dependent DNA repair. Thus, persister cells tolerant to cell wall-acting antibiotics must cope with oxidative stress and DNA damage and these processes are regulated by cyclic AMP in uropathogenic E. coli IMPORTANCE Bacterial persister cells are important in relapsing infections in patients treated with antibiotics and also in the emergence of antibiotic resistance. Our results show that in uropathogenic E. coli , the second messenger cyclic AMP negatively regulates persister cell formation, since in its absence much more persister cells form that are tolerant to β-lactams antibiotics. We reveal the mechanism to be decreased levels of reactive oxygen species, specifically hydroxyl radicals, and SOS-dependent DNA repair. Our findings suggest that the oxidative stress response and DNA repair are relevant pathways to target in the design of persister-specific antibiotic compounds. Copyright © 2018 Molina-Quiroz et al.

  16. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  17. The μ opioid agonist morphine modulates potentiation of capsaicin-evoked TRPV1 responses through a cyclic AMP-dependent protein kinase A pathway

    Directory of Open Access Journals (Sweden)

    Roberts-Thomson Sarah J

    2006-07-01

    Full Text Available Abstract Background The vanilloid receptor 1 (TRPV1 is critical in the development of inflammatory hyperalgesia. Several receptors including G-protein coupled prostaglandin receptors have been reported to functionally interact with the TRPV1 through a cAMP-dependent protein kinase A (PKA pathway to potentiate TRPV1-mediated capsaicin responses. Such regulation may have significance in inflammatory pain. However, few functional receptor interactions that inhibit PKA-mediated potentiation of TRPV1 responses have been described. Results In the present studies we investigated the hypothesis that the μ opioid receptor (MOP agonist morphine can modulate forskolin-potentiated capsaicin responses through a cAMP-dependent PKA pathway. HEK293 cells were stably transfected with TRPV1 and MOP, and calcium (Ca2+ responses to injection of the TRPV1 agonist capsaicin were monitored in Fluo-3-loaded cells. Pre-treatment with morphine did not inhibit unpotentiated capsaicin-induced Ca2+ responses but significantly altered capsaicin responses potentiated by forskolin. TRPV1-mediated Ca2+ responses potentiated by the direct PKA activator 8-Br-cAMP and the PKC activator Phorbol-12-myristate-13-acetatewere not modulated by morphine. Immunohistochemical studies confirmed that the TRPV1 and MOP are co-expressed on cultured Dorsal Root Ganglion neurones, pointing towards the existence of a functional relationship between the G-protein coupled MOP and nociceptive TRPV1. Conclusion The results presented here indicate that the opioid receptor agonist morphine acts via inhibition of adenylate cyclase to inhibit PKA-potentiated TRPV1 responses. Targeting of peripheral opioid receptors may therefore have therapeutic potential as an intervention to prevent potentiation of TRPV1 responses through the PKA pathway in inflammation.

  18. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  19. Magnolol Alleviates Inflammatory Responses and Lipid Accumulation by AMP-Activated Protein Kinase-Dependent Peroxisome Proliferator-Activated Receptor α Activation

    Directory of Open Access Journals (Sweden)

    Ye Tian

    2018-02-01

    Full Text Available Magnolol (MG is a kind of lignin isolated from Magnolia officinalis, which serves several different biological functions, such as antifungal, anticancer, antioxidant, and hepatoprotective functions. This study aimed to evaluate the protective effect of MG against oleic acid (OA-induced hepatic steatosis and inflammatory damage in HepG2 cells and in a tyloxapol (Ty-induced hyperlipidemia mouse model. Our findings indicated that MG can effectively inhibit OA-stimulated tumor necrosis factor α (TNF-α secretion, reactive oxygen species generation, and triglyceride (TG accumulation. Further study manifested that MG significantly suppressed OA-activated mitogen-activated protein kinase (MAPK and nuclear factor-kappa B (NF-κB signaling pathways and that these inflammatory responses can be negated by pretreatment with inhibitors of extracellular regulated protein kinase and c-Jun N-terminal kinase (U0126 and SP600125, respectively. In addition, MG dramatically upregulated peroxisome proliferator-activated receptor α (PPARα translocation and reduced sterol regulatory element-binding protein 1c (SREBP-1c protein synthesis and excretion, both of which are dependent upon the phosphorylation of adenosine monophosphate (AMP-activated protein kinase (AMPK, acetyl-CoA carboxylase, and AKT kinase (AKT. However, MG suspended the activation of PPARα expression and was thus blocked by pretreatment with LY294002 and compound c (specific inhibitors of AKT and AMPK. Furthermore, MG clearly alleviated serum TG and total cholesterol release; upregulated AKT, AMPK, and PPARα expression; suppressed SREBP-1c generation; and alleviated hepatic steatosis and dyslipidemia in Ty-induced hyperlipidemia mice. Taken together, these results suggest that MG exerts protective effects against steatosis, hyperlipidemia, and the underlying mechanism, which may be closely associated with AKT/AMPK/PPARα activation and MAPK/NF-κB/SREBP-1c inhibition.

  20. Relationships of methacholine and adenosine 5'-monophosphate (AMP) responsiveness to the postbronchodilator FEV₁/FVC ratio in children with asthma.

    Science.gov (United States)

    Suh, Dong In; Choi, Sun Hee; Lee, Ju Kyung; Kim, Jin-Tack; Koh, Young Yull

    2011-05-01

    Airway remodeling has been assumed to cause bronchial hyperresponsiveness (BHR). A low postbronchodilator FEV₁/FVC ratio has been suggested to be a functional surrogate marker of airway remodeling in asthma. BHR is commonly assessed by bronchial challenges using direct or indirect stimuli. The aim of this study was to compare BHR to methacholine and adenosine 5'-monophosphate (AMP) with regard to their relationship with a marker of airway remodeling in children with asthma. Methacholine and AMP challenge tests were performed in 129 children with asthma, aged 12 years, and a provocative concentration causing a 20% fall in FEV₁ (PC₂₀) was calculated for each challenge. All subjects also underwent pre- and postbronchodilator spirometry. A postbronchodilator FEV₁/FVC ratio below the lower limits of normal was used as a marker of airway remodeling. A low postbronchodilator FEV₁/FVC ratio was found in 17 subjects (13.2%). These subjects had a significantly lower methacholine PC₂₀ (geometric mean: 0.63 mg/mL, range of 1 SD: 0.17-2.29) than those (n = 112) with a normal postbronchodilator FEV₁/FVC ratio (2.42 mg/mL, 0.57-10.32, p = .000), whereas AMP PC₂₀ was similar between the two groups (22.1 mg/mL, 3.9-125.9 vs. 27.7 mg/mL, 4.2-183.5, p = .231). In the whole group of subjects, methacholine PC₂₀, but not AMP PC₂₀, correlated significantly with the postbronchodilator FEV₁/FVC ratio (r = 0.340, p = .000, and r = 0.056, p = .526, respectively). Our results provide evidence, though indirect, that BHR to methacholine is related to airway remodeling in children with asthma and suggest that BHR to methacholine may be a better marker of airway remodeling than BHR to AMP.

  1. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    International Nuclear Information System (INIS)

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki

    2007-01-01

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway

  2. Cyclic AMP in rat pancreatic islets

    International Nuclear Information System (INIS)

    Grill, V.; Borglund, E.; Cerasi, E.; Uppsala Univ.

    1977-01-01

    The incorporation of [ 3 H]adenine into cyclic AMP was studied in rat pancreatic islets under varying conditions of labeling. Prolonging the exposure to [ 3 H]adenine progressively augmented the islet cyclic [ 3 H]AMP level. Islets labeled for different periods of time and subsequently incubated (without adenine) in the presence of D-glucose or cholera toxin showed stimulations of intra-islet cyclic [ 3 H]AMP that were proportionate to the levels of radioactive nucleotide present under non-stimulatory conditions. Labeling the islets in a high glucose concentration (27.7 mM) did not modify the nucleotide responses to glucose or cholera toxin. The specific activity of cyclic [ 3 H]AMP, determined by simultaneous assay of cyclic [ 3 H]AMP and total cyclic AMP, was not influenced by glucose or cholera toxin. Glucose had no effect on the specific activity of labeled ATP

  3. Electrophysiological and biochemical studies of slow responses to serotonin and dopamine of snail identified neurons. Mediating role of the cyclic AMP

    International Nuclear Information System (INIS)

    Deterre, Philippe

    1983-01-01

    In this research thesis, the electrophysiological study of slow incoming currents induced in some identified neurons of the Helix aspersa snail by serotonin and dopamine shows that they are associated with a decrease of a potassium conductance involved in the modulation of the action potential duration. By means of enzymatic tests performed on a single cell, and of electrophysiological experiments, the author shows that the cyclic AMP is an intracellular mediator involved in the genesis of these slow responses. Moreover, the obtained results show that serotonin and dopamine act by binding to specific receptors, and that these receptors activate the adenylate-cyclase through a GTP binding protein [fr

  4. Immunization with Tc52 or its amino terminal domain adjuvanted with c-di-AMP induces Th17+Th1 specific immune responses and confers protection against Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Marina N Matos

    2017-02-01

    Full Text Available The development of new adjuvants enables fine modulation of the elicited immune responses. Ideally, the use of one or more adjuvants should result in the induction of a protective immune response against the specific pathogen. We have evaluated the immune response and protection against Trypanosoma cruzi infection in mice vaccinated with recombinant Tc52 or its N- and C-terminal domains (NTc52 and CTc52 adjuvanted either with the STING (Stimulator of Interferon Genes agonist cyclic di-AMP (c-di-AMP, a pegylated derivative of α-galactosylceramide (αGC-PEG, or oligodeoxynucleotides containing unmethylated CpG motifs (ODN-CpG. All groups immunized with the recombinant proteins plus adjuvant: Tc52+c-di-AMP, NTc52+c-di-AMP, CTc52+c-di-AMP, NTc52+c-di-AMP+αGC-PEG, NTc52+CpG, developed significantly higher anti-Tc52 IgG titers than controls. Groups immunized with c-di-AMP and Tc52, NTc52 or CTc52 showed the highest Tc52-specific IgA titers in nasal lavages. All groups immunized with the recombinant proteins plus adjuvant developed a strong specific cellular immune response in splenocytes and lymph node cells with significant differences for groups immunized with c-di-AMP and Tc52, NTc52 or CTc52. These groups also showed high levels of Tc52-specific IL-17 and IFN-γ producing cells, while NTc52+CpG group only showed significant difference with control in IFN-γ producing cells. Groups immunized with c-di-AMP and Tc52, NTc52 or CTc52 developed predominantly a Th17 and Th1immune response, whereas for NTc52+CpG it was a dominant Th1 response. It was previously described that αGC-PEG inhibits Th17 differentiation by activating NKT cells. Thus, in this work we have also included a group immunized with both adjuvants (NTc52+c-di-AMP+αGC-PEG with the aim to modulate the Th17 response induced by c-di-AMP. This group showed a significant reduction in the number of Tc52-specific IL-17 producing splenocytes, as compared to the group NTc52+c-di-AMP, which has

  5. Cell-type-specific responses of RT4 neural cell lines to dibutyryl-cAMP: branch determination versus maturation

    International Nuclear Information System (INIS)

    Droms, K.; Sueoka, N.

    1987-01-01

    This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP

  6. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

    OpenAIRE

    Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

    2015-01-01

    Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdow...

  7. DNA-Mediated Cyclic GMP-AMP Synthase-Dependent and -Independent Regulation of Innate Immune Responses.

    Science.gov (United States)

    Motani, Kou; Ito, Shinji; Nagata, Shigekazu

    2015-05-15

    Cytoplasmic DNA activates cyclic GMP-AMP synthase (cGAS) to produce cyclic 2'-5'3'-5'GMP-AMP dinucleotide (2'5 'cGAMP). The binding of 2'5'cGAMP to an adaptor protein, stimulator of IFN genes (STING), activates a transcription factor, IFN regulatory factor 3, leading to the induction of IFN and chemokine gene expression. In this study, we found that the 2'5'cGAMP-dependent STING activation induced highly upregulated CXCL10 gene expression. Formation of a distinct STING dimer, which was detected by native PAGE, was induced by 2'5'cGAMP, but not 3'-5'3'-5'cGAMP. Analysis of DNase II(-/-) mice, which constitutively produce IFN-β and CXCL10, showed the accumulation of 2'5'cGAMP in their fetal livers and spleens, suggesting that the undigested DNA accumulating in DNase II(-/-) cells may have leaked from the lysosomes into the cytoplasm. The DNase II(-/-) mouse embryonic fibroblasts produced 2'5'cGAMP in a cGAS-dependent manner during apoptotic cell engulfment. However, cGAS deficiency did not impair the STING-dependent upregulation of CXCL10 in DNase II(-/-) mouse embryonic fibroblasts that was induced by apoptotic cell engulfment or DNA lipofection. These results suggest the involvement of a cGAS-independent additional DNA sensor(s) that induces the STING-dependent activation of innate immunity. Copyright © 2015 by The American Association of Immunologists, Inc.

  8. AMP (Activity Manipulation Program)

    International Nuclear Information System (INIS)

    Engle, W.W. Jr.

    1976-03-01

    AMP is a FORTRAN IV program written to handle energy-group structured activity factors such as sources, conversion factors, and response functions, as used by ANISN, DOT III, and other nuclear reactor and shielding codes. Activities may be retrieved from ANISN-type cross-section and activity sets found on cards and tapes, and from tabular-type sets on cards. They may be altered by change of group structure, multiplication by a constant, or multiplication by delta E (the group-energy interval), and then output to ANISN-type cards or tape and tabular-type cards. A full edit of input and output activities is always printed by group and activity number

  9. AMP-activated protein kinase regulates lymphocyte responses to metabolic stress but is largely dispensable for immune cell development and function.

    Science.gov (United States)

    Mayer, Alice; Denanglaire, Sébastien; Viollet, Benoit; Leo, Oberdan; Andris, Fabienne

    2008-04-01

    AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, represents an energy sensor able to adapt cellular metabolism in response to nutritional environmental variations. TCR stimulation activates AMPK, a regulatory event that is known to stimulate ATP-producing processes, possibly in anticipation of the increased energetic needs associated with cell division and expression of effector function. Taking advantage of the selective expression of the AMPKalpha1 catalytic subunit in lymphoid cells, we have analyzed the in vitro and in vivo capacity of lymphocytes lacking AMPK activity (AMPKalpha1-KO cells) to respond to metabolic stress and to initiate and sustain an immune response. AMPKalpha1-KO cells displayed increasing sensitivity to energetic stress in vitro, and were found unable to maintain adequate ATP levels in response to ATP synthase inhibition. These cells were, however, able to respond to antigen stimulation in vitro, as shown by optimal proliferation and cytokine production. Similarly, AMPKalpha1-KO mice were fully immunocompetent in vivo and displayed normal cell proliferation, humoral, cytotoxic and delayed-type hypersensitivity (DTH) responses following antigen injection. In conclusion, AMPK represents an important enzyme allowing lymphocytes to resist a mild energy crisis in vitro, but is largely dispensable for activation and expression of effector function in response to antigen stimulation.

  10. Inhibitory effects of ginseng total saponin on up-regulation of cAMP pathway induced by repeated administration of morphine.

    Science.gov (United States)

    Seo, Jeong-Ju; Lee, Jae-Woong; Lee, Wan-Kyu; Hong, Jin-Tae; Lee, Chong-Kil; Lee, Myung-Koo; Oh, Ki-Wan

    2008-02-01

    We have reported that ginseng total saponin (GTS) inhibited the development of physical and psychological dependence on morphine. However, the possible molecular mechanisms of GTS are unclear. Therefore, this study was undertaken to understand the possible molecular mechanism of GTS on the inhibitory effects of morphine-induced dependence. It has been reported that the up-regulated cAMP pathway in the LC of the mouse brain after repeated administration of morphine contributes to the feature of withdrawals. GTS inhibited up-regulation of cAMP pathway in the LC after repeated administration of morphine in this experiment. GTS inhibited cAMP levels and protein expression of protein kinase A (PKA). In addition, GTS inhibited the increase of cAMP response element binding protein (CREB) phosphorylation. Therefore, we conclude that the inhibitory effects of GTS on morphine-induced dependence might be mediated by the inhibition of cAMP pathway.

  11. AMP is an adenosine A1 receptor agonist.

    Science.gov (United States)

    Rittiner, Joseph E; Korboukh, Ilia; Hull-Ryde, Emily A; Jin, Jian; Janzen, William P; Frye, Stephen V; Zylka, Mark J

    2012-02-17

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5'-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5'-monophosphonate, ACP) directly activated the adenosine A(1) receptor (A(1)R). In contrast, AMP only activated the adenosine A(2B) receptor (A(2B)R) after hydrolysis to adenosine by ecto-5'-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A(1)R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A(1)R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A(1)R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A(1)R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine.

  12. Existence of multiple receptors in single neurons: responses of single bullfrog olfactory neurons to many cAMP-dependent and independent odorants.

    Science.gov (United States)

    Kashiwayanagi, M; Shimano, K; Kurihara, K

    1996-11-04

    The responses of single bullfrog olfactory neurons to various odorants were measured with the whole-cell patch clamp which offers direct information on cellular events and with the ciliary recording technique to obtain stable quantitative data from many neurons. A large portion of single olfactory neurons (about 64% and 79% in the whole-cell recording and in the ciliary recording, respectively) responded to many odorants with quite diverse molecular structures, including both odorants previously indicated to be cAMP-dependent (increasing) and independent odorants. One odorant elicited a response in many cells; e.g. hedione and citralva elicited the response in 100% and 92% of total neurons examined with the ciliary recording technique. To confirm that a single neuron carries different receptors or transduction pathways, the cross-adaptation technique was applied to single neurons. Application of hedione to a single neuron after desensitization of the current in response to lyral or citralva induced an inward current with a similar magnitude to that applied alone. It was suggested that most single olfactory neurons carry multiple receptors and at least dual transduction pathways.

  13. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  14. Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

    Science.gov (United States)

    Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

    2016-01-01

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

  15. Assisted Medical Procedures (AMP)

    Data.gov (United States)

    National Aeronautics and Space Administration — DOCUMENTATION, DEVELOPMENT, AND PROGRESS The AMP was initially being developed as part the Advanced Integrated Clinical System (AICS)-Guided Medical Procedure System...

  16. AMP-activated protein kinase is involved in the activation of the Fanconi anemia/BRCA pathway in response to DNA interstrand crosslinks.

    Science.gov (United States)

    Chun, Min Jeong; Kim, Sunshin; Hwang, Soo Kyung; Kim, Bong Sub; Kim, Hyoun Geun; Choi, Hae In; Kim, Jong Heon; Goh, Sung Ho; Lee, Chang-Hun

    2016-08-16

    Fanconi anemia complementation group (FANC) proteins constitute the Fanconi Anemia (FA)/BRCA pathway that is activated in response to DNA interstrand crosslinks (ICLs). We previously performed yeast two-hybrid screening to identify novel FANC-interacting proteins and discovered that the alpha subunit of AMP-activated protein kinase (AMPKα1) was a candidate binding partner of the FANCG protein, which is a component of the FA nuclear core complex. We confirmed the interaction between AMPKα and both FANCG using co-immunoprecipitation experiments. Additionally, we showed that AMPKα interacted with FANCA, another component of the FA nuclear core complex. AMPKα knockdown in U2OS cells decreased FANCD2 monoubiquitination and nuclear foci formation upon mitomycin C-induced ICLs. Furthermore, AMPKα knockdown enhanced cellular sensitivity to MMC. MMC treatment resulted in an increase in AMPKα phosphorylation/activation, indicating AMPK is involved in the cellular response to ICLs. FANCA was phosphorylated by AMPK at S347 and phosphorylation increased with MMC treatment. MMC-induced FANCD2 monoubiquitination and nuclear foci formation were compromised in a U2OS cell line that stably overexpressed the S347A mutant form of FANCA compared to wild-type FANCA-overexpressing cells, indicating a requirement for FANCA phosphorylation at S347 for proper activation of the FA/BRCA pathway. Our data suggest AMPK is involved in the activation of the FA/BRCA pathway.

  17. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  18. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  19. IP3-dependent intracellular Ca2+ release is required for cAMP-induced c-fos expression in hippocampal neurons

    International Nuclear Information System (INIS)

    Zhang, Wenting; Tingare, Asmita; Ng, David Chi-Heng; Johnson, Hong W.; Schell, Michael J.; Lord, Rebecca L.; Chawla, Sangeeta

    2012-01-01

    Highlights: ► cAMP-induced c-fos expression in hippocampal neurons requires a submembraneous Ca 2+ pool. ► The submembraneous Ca 2+ pool derives from intracellular ER stores. ► Expression of IP 3 -metabolizing enzymes inhibits cAMP-induced c-fos expression. ► SRE-mediated and CRE-mediated gene expression is sensitive to IP 3 -metabolizing enzymes. ► Intracellular Ca 2+ release is required for cAMP-induced nuclear translocation of TORC1. -- Abstract: Ca 2+ and cAMP are widely used in concert by neurons to relay signals from the synapse to the nucleus, where synaptic activity modulates gene expression required for synaptic plasticity. Neurons utilize different transcriptional regulators to integrate information encoded in the spatiotemporal dynamics and magnitude of Ca 2+ and cAMP signals, including some that are Ca 2+ -responsive, some that are cAMP-responsive and some that detect coincident Ca 2+ and cAMP signals. Because Ca 2+ and cAMP can influence each other’s amplitude and spatiotemporal characteristics, we investigated how cAMP acts to regulate gene expression when increases in intracellular Ca 2+ are buffered. We show here that cAMP-mobilizing stimuli are unable to induce expression of the immediate early gene c-fos in hippocampal neurons in the presence of the intracellular Ca 2+ buffer BAPTA-AM. Expression of enzymes that attenuate intracellular IP 3 levels also inhibited cAMP-dependent c-fos induction. Synaptic activity induces c-fos transcription through two cis regulatory DNA elements – the CRE and the SRE. We show here that in response to cAMP both CRE-mediated and SRE-mediated induction of a luciferase reporter gene is attenuated by IP 3 metabolizing enzymes. Furthermore, cAMP-induced nuclear translocation of the CREB coactivator TORC1 was inhibited by depletion of intracellular Ca 2+ stores. Our data indicate that Ca 2+ release from IP 3 -sensitive pools is required for cAMP-induced transcription in hippocampal neurons.

  20. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  1. [Prognostic significance of the cyclic AMP concentration in acute leukemias].

    Science.gov (United States)

    Paietta, E; Mittermayer, K; Schwarzmeier, J D

    1979-01-01

    In patients with acute leukemia (myeloblastic, lymphoblastic, undifferentiated) proliferation kinetics and cyclic adenosine-3', 5'-monophosphate (cAMP) concentration of the leukemic cells were studied for their significance in the prediction of responsiveness to cytostatic therapy. Patients with good clinical response had significantly faster turnover and lower cAMP-levels than those who failed to respond to treatment.

  2. The interplay between cyclic AMP and insulin during obesity development

    DEFF Research Database (Denmark)

    Borkowski, Kamil

    Insulin and cAMP signalling are related to two opposite metabolic responses. Insulin secretion is elicited in response to food availability and trigger catabolic processes like lipogenesis and glycogen synthesis with a purpose of energy storage. On the other hand cAMP signalling is associated...

  3. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  4. Activation of the adenylyl cyclase/cyclic AMP/protein kinase A pathway in endothelial cells exposed to cyclic strain

    Science.gov (United States)

    Cohen, C. R.; Mills, I.; Du, W.; Kamal, K.; Sumpio, B. E.

    1997-01-01

    The aim of this study was to assess the involvement of the adenylyl cyclase/cyclic AMP/protein kinase A pathway (AC) in endothelial cells (EC) exposed to different levels of mechanical strain. Bovine aortic EC were seeded to confluence on flexible membrane-bottom wells. The membranes were deformed with either 150 mm Hg (average 10% strain) or 37.5 mm Hg (average 6% strain) vacuum at 60 cycles per minute (0.5 s strain; 0.5 s relaxation) for 0-60 min. The results demonstrate that at 10% average strain (but not 6% average strain) there was a 1.5- to 2.2-fold increase in AC, cAMP, and PKA activity by 15 min when compared to unstretched controls. Further studies revealed an increase in cAMP response element binding protein in EC subjected to the 10% average strain (but not 6% average strain). These data support the hypothesis that cyclic strain activates the AC/cAMP/PKA signal transduction pathway in EC which may occur by exceeding a strain threshold and suggest that cyclic strain may stimulate the expression of genes containing cAMP-responsive promoter elements.

  5. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection

    Directory of Open Access Journals (Sweden)

    Benjamin A. Diner

    2016-11-01

    Full Text Available The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS. Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1 and human cytomegalovirus (HCMV infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses.

  6. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  7. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  8. Timing is critical for effective glucocorticoid receptor mediated repression of the cAMP-induced CRH gene.

    Directory of Open Access Journals (Sweden)

    Siem van der Laan

    Full Text Available Glucocorticoid negative feedback of the hypothalamus-pituitary-adrenal axis is mediated in part by direct repression of gene transcription in glucocorticoid receptor (GR expressing cells. We have investigated the cross talk between the two main signaling pathways involved in activation and repression of corticotrophin releasing hormone (CRH mRNA expression: cyclic AMP (cAMP and GR. We report that in the At-T20 cell-line the glucocorticoid-mediated repression of the cAMP-induced human CRH proximal promoter activity depends on the relative timing of activation of both signaling pathways. Activation of the GR prior to or in conjunction with cAMP signaling results in an effective repression of the cAMP-induced transcription of the CRH gene. In contrast, activation of the GR 10 minutes after onset of cAMP treatment, results in a significant loss of GR-mediated repression. In addition, translocation of ligand-activated GR to the nucleus was found as early as 10 minutes after glucocorticoid treatment. Interestingly, while both signaling cascades counteract each other on the CRH proximal promoter, they synergize on a synthetic promoter containing 'positive' response elements. Since the order of activation of both signaling pathways may vary considerably in vivo, we conclude that a critical time-window exists for effective repression of the CRH gene by glucocorticoids.

  9. Protein kinase N2 regulates AMP kinase signaling and insulin responsiveness of glucose metabolism in skeletal muscle.

    Science.gov (United States)

    Ruby, Maxwell A; Riedl, Isabelle; Massart, Julie; Åhlin, Marcus; Zierath, Juleen R

    2017-10-01

    Insulin resistance is central to the development of type 2 diabetes and related metabolic disorders. Because skeletal muscle is responsible for the majority of whole body insulin-stimulated glucose uptake, regulation of glucose metabolism in this tissue is of particular importance. Although Rho GTPases and many of their affecters influence skeletal muscle metabolism, there is a paucity of information on the protein kinase N (PKN) family of serine/threonine protein kinases. We investigated the impact of PKN2 on insulin signaling and glucose metabolism in primary human skeletal muscle cells in vitro and mouse tibialis anterior muscle in vivo. PKN2 knockdown in vitro decreased insulin-stimulated glucose uptake, incorporation into glycogen, and oxidation. PKN2 siRNA increased 5'-adenosine monophosphate-activated protein kinase (AMPK) signaling while stimulating fatty acid oxidation and incorporation into triglycerides and decreasing protein synthesis. At the transcriptional level, PKN2 knockdown increased expression of PGC-1α and SREBP-1c and their target genes. In mature skeletal muscle, in vivo PKN2 knockdown decreased glucose uptake and increased AMPK phosphorylation. Thus, PKN2 alters key signaling pathways and transcriptional networks to regulate glucose and lipid metabolism. Identification of PKN2 as a novel regulator of insulin and AMPK signaling may provide an avenue for manipulation of skeletal muscle metabolism. Copyright © 2017 the American Physiological Society.

  10. The role of cAMP in synaptic homeostasis in response to environmental temperature challenges and hyperexcitability mutations

    Directory of Open Access Journals (Sweden)

    Atsushi eUeda

    2015-02-01

    Full Text Available Homeostasis is the ability of physiological systems to regain functional balance following environment or experimental insults and synaptic homeostasis has been demonstrated in various species following genetic or pharmacological disruptions. Among environmental challenges, homeostatic responses to temperature extremes are critical to animal survival under natural conditions. We previously reported that axon terminal arborization in Drosophila larval neuromuscular junctions is enhanced at elevated temperatures; however, the amplitude of excitatory junctional potentials (EJPs remains unaltered despite the increase in synaptic bouton numbers. Here we determine the cellular basis of this homeostatic adjustment in larvae reared at high temperature (HT, 29 ˚C. We found that synaptic current focally recorded from individual synaptic boutons was unaffected by rearing temperature (30 ˚C. However, HT rearing decreased the quantal size (amplitude of spontaneous miniature EJPs, or mEJPs, which compensates for the increased number of synaptic releasing sites to retain a normal EJP size. The quantal size decrease is accounted for by a decrease in input resistance of the postsynaptic muscle fiber, indicating an increase in membrane area that matches the synaptic growth at HT. Interestingly, a mutation in rutabaga (rut encoding adenylyl cyclase (AC exhibited no obvious changes in quantal size or input resistance of postsynaptic muscle cells after HT rearing, suggesting an important role for rut AC in temperature-induced synaptic homeostasis in Drosophila. This extends our previous finding of rut-dependent synaptic homeostasis in hyperexcitable mutants, e.g. slowpoke (slo. In slo larvae, the lack of BK channel function is partially ameliorated by upregulation of presynaptic Sh IA current to limit excessive transmitter release in addition to postsynaptic glutamate receptor recomposition that reduces the quantal size.

  11. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  12. Phosphorylation of translation factors in response to anoxia in turtles, Trachemys scripta elegans: role of the AMP-activated protein kinase and target of rapamycin signalling pathways.

    Science.gov (United States)

    Rider, Mark H; Hussain, Nusrat; Dilworth, Stephen M; Storey, Kenneth B

    2009-12-01

    Long-term survival of oxygen deprivation by animals with well-developed anoxia tolerance depends on multiple biochemical adaptations including strong metabolic rate depression. We investigated whether the AMP-activated protein kinase (AMPK) could play a regulatory role in the suppression of protein synthesis that occurs when turtles experience anoxic conditions. AMPK activity and the phosphorylation state of ribosomal translation factors were measured in liver, heart, red muscle and white muscle of red-eared slider turtles (Trachemys scripta elegans) subjected to 20 h of anoxic submergence. AMPK activity increased twofold in white muscle of anoxic turtles compared with aerobic controls but remained unchanged in liver and red muscle, whereas in heart AMPK activity decreased by 40%. Immunoblotting with phospho-specific antibodies revealed that eukaryotic elongation factor-2 phosphorylation at the inactivating Thr56 site increased six- and eightfold in red and white muscles from anoxic animals, respectively, but was unchanged in liver and heart. The phosphorylation state of the activating Thr389 site of p70 ribosomal protein S6 kinase was reduced under anoxia in red muscle and heart but was unaffected in liver and white muscle. Exposure to anoxia decreased 40S ribosomal protein S6 phosphorylation in heart and promoted eukaryotic initiation factor 4E-binding protein-1 (4E-BP1) dephosphorylation in red muscle, but surprisingly increased 4E-BP1 phosphorylation in white muscle. The changes in phosphorylation state of translation factors suggest that organ-specific patterns of signalling and response are involved in achieving the anoxia-induced suppression of protein synthesis in turtles.

  13. AMP language reference manual

    International Nuclear Information System (INIS)

    Drouffe, J.M.

    1982-06-01

    The use of a program for symbolic calculations named AMP (Algebraic Manipulation Program) is described. Its main features are: high speed heart for usual algebraic calculations; conversational capability; derivation, substitutions, matricial calculus, expansions, non commutative algebrae...; possibility to define new symbols and associated rules; possibility to create and use external libraries; written for IBM/370 like computers

  14. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection.

    Science.gov (United States)

    Diner, Benjamin A; Lum, Krystal K; Toettcher, Jared E; Cristea, Ileana M

    2016-11-15

    The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. How mammalian cells detect and respond to DNA viruses that replicate in the nucleus is poorly understood. Here, we decipher the distinct functions of two viral DNA sensors, IFI16 and cGAS, during active immune signaling upon infection with two herpesviruses, herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV). We show that IFI16

  15. AMP Deaminase 3 Deficiency Enhanced 5′-AMP Induction of Hypometabolism

    Science.gov (United States)

    Daniels, Isadora Susan; O′Brien, William G.; Nath, Vinay; Zhao, Zhaoyang; Lee, Cheng Chi

    2013-01-01

    A hypometabolic state can be induced in mice by 5′-AMP administration. Previously we proposed that an underlying mechanism for this hypometabolism is linked to reduced erythrocyte oxygen transport function due to 5′-AMP uptake altering the cellular adenylate equilibrium. To test this hypothesis, we generated mice deficient in adenosine monophosphate deaminase 3 (AMPD3), the key catabolic enzyme for 5′-AMP in erythrocytes. Mice deficient in AMPD3 maintained AMPD activities in all tissues except erythrocytes. Developmentally and morphologically, the Ampd3−/− mice were indistinguishable from their wild type siblings. The levels of ATP, ADP but not 5′-AMP in erythrocytes of Ampd3−/− mice were significantly elevated. Fasting blood glucose levels of the Ampd3−/− mice were comparable to wild type siblings. In comparison to wild type mice, the Ampd3−/− mice displayed a deeper hypometabolism with a significantly delayed average arousal time in response to 5′-AMP administration. Together, these findings demonstrate a central role of AMPD3 in the regulation of 5′-AMP mediated hypometabolism and further implicate erythrocytes in this behavioral response. PMID:24066180

  16. The alpha2-5'AMP-activated protein kinase is a site 2 glycogen synthase kinase in skeletal muscle and is responsive to glucose loading

    DEFF Research Database (Denmark)

    Jørgensen, Sebastian B; Nielsen, Jakob N.; Birk, Jesper Bratz

    2004-01-01

    The 5'AMP-activated protein kinase (AMPK) is a potential antidiabetic drug target. Here we show that the pharmacological activation of AMPK by 5-aminoimidazole-1-beta-4-carboxamide ribofuranoside (AICAR) leads to inactivation of glycogen synthase (GS) and phosphorylation of GS at Ser 7 (site 2). ...

  17. AMP Is an Adenosine A1 Receptor Agonist*

    Science.gov (United States)

    Rittiner, Joseph E.; Korboukh, Ilia; Hull-Ryde, Emily A.; Jin, Jian; Janzen, William P.; Frye, Stephen V.; Zylka, Mark J.

    2012-01-01

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5′-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5′-monophosphonate, ACP) directly activated the adenosine A1 receptor (A1R). In contrast, AMP only activated the adenosine A2B receptor (A2BR) after hydrolysis to adenosine by ecto-5′-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A1R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A1R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A1R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A1R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine. PMID:22215671

  18. Expression of PKA inhibitor (PKI) gene abolishes cAMP-mediated protection to endothelial barrier dysfunction.

    Science.gov (United States)

    Lum, H; Jaffe, H A; Schulz, I T; Masood, A; RayChaudhury, A; Green, R D

    1999-09-01

    We investigated the hypothesis that cAMP-dependent protein kinase (PKA) protects against endothelial barrier dysfunction in response to proinflammatory mediators. An E1-, E3-, replication-deficient adenovirus (Ad) vector was constructed containing the complete sequence of PKA inhibitor (PKI) gene (AdPKI). Infection of human microvascular endothelial cells (HMEC) with AdPKI resulted in overexpression of PKI. Treatment with 0.5 microM thrombin increased transendothelial albumin clearance rate (0.012 +/- 0.003 and 0.035 +/- 0.005 microl/min for control and thrombin, respectively); the increase was prevented with forskolin + 3-isobutyl-1-methylxanthine (F + I) treatment. Overexpression of PKI resulted in abrogation of the F + I-induced inhibition of the permeability increase. However, with HMEC infected with ultraviolet-inactivated AdPKI, the F + I-induced inhibition was present. Also, F + I treatment of HMEC transfected with reporter plasmid containing the cAMP response element-directed transcription of the luciferase gene resulted in an almost threefold increase in luciferase activity. Overexpression of PKI inhibited this induction of luciferase activity. The results show that Ad-mediated overexpression of PKI in endothelial cells abrogated the cAMP-mediated protection against increased endothelial permeability, providing direct evidence that cAMP-dependent protein kinase promotes endothelial barrier function.

  19. Activation of cAMP-dependent signaling pathway induces mouse organic anion transporting polypeptide 2 expression.

    Science.gov (United States)

    Chen, Chuan; Cheng, Xingguo; Dieter, Matthew Z; Tanaka, Yuji; Klaassen, Curtis D

    2007-04-01

    Rodent Oatp2 is a hepatic uptake transporter for such compounds as cardiac glycosides. In the present study, we found that fasting resulted in a 2-fold induction of Oatp2 expression in liver of mice. Because the cAMP-protein kinase A (PKA) signaling pathway is activated during fasting, the role of this pathway in Oatp2 induction during fasting was examined. In Hepa-1c1c7 cells, adenylyl cyclase activator forskolin as well as two cellular membrane-permeable cAMP analogs, dibutyryl cAMP and 8-bromo-cAMP, induced Oatp2 mRNA expression in a time- and dose-dependent manner. These three chemicals induced reporter gene activity in cells transfected with a luciferase reporter gene construct containing a 7.6-kilobase (kb) 5'-flanking region of mouse Oatp2. Transient transfection of cells with 5'-deletion constructs derived from the 7.6-kb Oatp2 promoter reporter gene construct, as well as 7.6-kb constructs in which a consensus cAMP response element (CRE) half-site CGTCA (-1808/-1804 bp) was mutated or deleted, confirms that this CRE site was required for the induction of luciferase activity by forskolin. Luciferase activity driven by the Oatp2 promoter containing this CRE site was induced in cells cotransfected with a plasmid encoding the protein kinase A catalytic subunit. Cotransfection of cells with a plasmid encoding the dominant-negative CRE binding protein (CREB) completely abolished the inducibility of the reporter gene activity by forskolin. In conclusion, induction of Oatp2 expression in liver of fasted mice may be caused by activation of the cAMP-dependent signaling pathway, with the CRE site (-1808/-1804) and CREB being the cis- and trans-acting factors mediating the induction, respectively.

  20. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  2. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  3. Effect of sevoflurane on the ATPase activity of hippocampal neurons in a rat model of cerebral ischemia-reperfusion injury via the cAMP-PKA signaling pathway.

    Science.gov (United States)

    Liu, Tie-Jun; Zhang, Jin-Cun; Gao, Xiao-Zeng; Tan, Zhi-Bin; Wang, Jian-Jun; Zhang, Pan-Pan; Cheng, Ai-Bin; Zhang, Shu-Bo

    2018-01-01

    We aim to investigate the effects of sevoflurane on the ATPase activity of the hippocampal neurons in rats with cerebral ischemia-reperfusion injury (IRI) via the cyclic adenosine monophosphate (cAMP) and protein kinase A (PKA) signaling pathway. Sixty rats were assigned into the normal, model and sevoflurane groups (n = 20, the latter two groups were established as focal cerebral IRI models). The ATPase activity was detected using an ultramicro Na (+)-K (+)-ATP enzyme kit. Immunohistochemical staining was used to detect the positive protein expression of cAMP and PKA. The hippocampal neurons were assigned to the normal, IRI, IRI + sevoflurane, IRI + forskolin, IRI + H89 and IRI + sevoflurane + H89 groups. qRT-PCR and Western blotting were performed for the expressions of cAMP, PKA, cAMP-responsive element-binding protein (CREB) and brain derived neurotrophic factor (BDNF). The normal and sevoflurane groups exhibited a greater positive protein expression of cAMP and PKA than the model group. Compared with the normal group, the expressions of cAMP, PKA, CREB and BDNF all reduced in the IRI, model and IRI + H89 groups. The sevoflurane group showed higher cAMP, PKA, CREB and BDNF expressions than the model group. Compared with the IRI group, ATPase activity and expressions of cAMP, PKA, CREB and BDNF all increased in the normal, IRI + sevoflurane and IRI + forskolin groups but decreased in the IRI + H89 group. It suggests that sevoflurane could enhance ATPase activity in hippocampal neurons of cerebral IRI rats through activating cAMP-PKA signaling pathway. Copyright © 2017. Published by Elsevier Taiwan.

  4. The freeze-thaw stress response of the yeast Saccharomyces cerevisiae is growth phase specific and is controlled by nutritional state via the RAS-cyclic AMP signal transduction pathway.

    Science.gov (United States)

    Park, J I; Grant, C M; Attfield, P V; Dawes, I W

    1997-10-01

    The ability of cells to survive freezing and thawing is expected to depend on the physiological conditions experienced prior to freezing. We examined factors affecting yeast cell survival during freeze-thaw stress, including those associated with growth phase, requirement for mitochondrial functions, and prior stress treatment(s), and the role played by relevant signal transduction pathways. The yeast Saccharomyces cerevisiae was frozen at -20 degrees C for 2 h (cooling rate, less than 4 degrees C min-1) and thawed on ice for 40 min. Supercooling occurred without reducing cell survival and was followed by freezing. Loss of viability was proportional to the freezing duration, indicating that freezing is the main determinant of freeze-thaw damage. Regardless of the carbon source used, the wild-type strain and an isogenic petite mutant ([rho 0]) showed the same pattern of freeze-thaw tolerance throughout growth, i.e., high resistance during lag phase and low resistance during log phase, indicating that the response to freeze-thaw stress is growth phase specific and not controlled by glucose repression. In addition, respiratory ability and functional mitochondria are necessary to confer full resistance to freeze-thaw stress. Both nitrogen and carbon source starvation led to freeze-thaw tolerance. The use of strains affected in the RAS-cyclic AMP (RAS-cAMP) pathway or supplementation of an rca1 mutant (defective in the cAMP phosphodiesterase gene) with cAMP showed that the freeze-thaw response of yeast is under the control of the RAS-cAMP pathway. Yeast did not adapt to freeze-thaw stress following repeated freeze-thaw treatment with or without a recovery period between freeze-thaw cycles, nor could it adapt following pretreatment by cold shock. However, freeze-thaw tolerance of yeast cells was induced during fermentative and respiratory growth by pretreatment with H2O2, cycloheximide, mild heat shock, or NaCl, indicating that cross protection between freeze-thaw stress

  5. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  6. cAMP/PKA signalling reinforces the LATS–YAP pathway to fully suppress YAP in response to actin cytoskeletal changes

    Science.gov (United States)

    Kim, Minchul; Kim, Miju; Lee, Seunghee; Kuninaka, Shinji; Saya, Hideyuki; Lee, Ho; Lee, Sookyung; Lim, Dae-Sik

    2013-01-01

    Actin cytoskeletal damage induces inactivation of the oncoprotein YAP (Yes-associated protein). It is known that the serine/threonine kinase LATS (large tumour suppressor) inactivates YAP by phosphorylating its Ser127 and Ser381 residues. However, the events downstream of actin cytoskeletal changes that are involved in the regulation of the LATS–YAP pathway and the mechanism by which LATS differentially phosphorylates YAP on Ser127 and Ser381 in vivo have remained elusive. Here, we show that cyclic AMP (cAMP)-dependent protein kinase (PKA) phosphorylates LATS and thereby enhances its activity sufficiently to phosphorylate YAP on Ser381. We also found that PKA activity is involved in all contexts previously reported to trigger the LATS–YAP pathway, including actin cytoskeletal damage, G-protein-coupled receptor activation, and engagement of the Hippo pathway. Inhibition of PKA and overexpression of YAP cooperate to transform normal cells and amplify neural progenitor pools in developing chick embryos. We also implicate neurofibromin 2 as an AKAP (A-kinase-anchoring protein) scaffold protein that facilitates the function of the cAMP/PKA–LATS–YAP pathway. Our study thus incorporates PKA as novel component of the Hippo pathway. PMID:23644383

  7. YC-1 potentiates cAMP-induced CREB activation and nitric oxide production in alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Tsong-Long, E-mail: htl@mail.cgu.edu.tw [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Chinese Herbal Medicine Research Team, Healthy Aging Research Center, Chang Gung University, Kweishan, Taoyuan, Taiwan (China); Tang, Ming-Chi [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Kuo, Liang-Mou [Department of General Surgery, Chang Gung Memorial Hospital at Chia-Yi, Taiwan (China); Chang, Wen-De; Chung, Pei-Jen; Chang, Ya-Wen; Fang, Yao-Ching [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China)

    2012-04-15

    Alveolar macrophages play significant roles in the pathogenesis of several inflammatory lung diseases. Increases in exhaled nitric oxide (NO) are well documented to reflect disease severity in the airway. In this study, we investigated the effect of 3-(5′-hydroxymethyl-2′-furyl)-1-benzyl indazole (YC-1), a known activator of soluble guanylyl cyclase, on prostaglandin (PG)E{sub 1} (a stable PGE{sub 2} analogue) and forskolin (a adenylate cyclase activator) induced NO production and inducible NO synthase (iNOS) expression in rat alveolar macrophages (NR8383). YC-1 did not directly cause NO production or iNOS expression, but drastically potentiated PGE{sub 1}- or forskolin-induced NO production and iNOS expression in NR8383 alveolar macrophages. Combination treatment with YC-1 and PGE{sub 1} significantly increased phosphorylation of the cAMP response element-binding protein (CREB), but not nuclear factor (NF)-κB activation. The combined effect on NO production, iNOS expression, and CREB phosphorylation was reversed by a protein kinase (PK)A inhibitor (H89), suggesting that the potentiating functions were mediated through a cAMP/PKA signaling pathway. Consistent with this, cAMP analogues, but not the cGMP analogue, caused NO release, iNOS expression, and CREB activation. YC-1 treatment induced an increase in PGE{sub 1}-induced cAMP formation, which occurred through the inhibition of cAMP-specific phosphodiesterase (PDE) activity. Furthermore, the combination of rolipram (an inhibitor of PDE4), but not milronone (an inhibitor of PDE3), and PGE{sub 1} also triggered NO production and iNOS expression. In summary, YC-1 potentiates PGE{sub 1}-induced NO production and iNOS expression in alveolar macrophages through inhibition of cAMP PDE activity and activation of the cAMP/PKA/CREB signaling pathway. Highlights: ► YC-1 potentiated PGE1-induced iNOS expression in alveolar macrophages. ► The combination of YC-1 and PGE1 increased CREB but not NFκB activation.

  8. AMP N1-Oxide, a Unique Compound of Royal Jelly, Induces Neurite Outgrowth from PC12 Vells via Signaling by Protein Kinase A Independent of that by Mitogen-Activated Protein Kinase

    Directory of Open Access Journals (Sweden)

    Noriko Hattori

    2010-01-01

    Full Text Available Earlier we identified adenosine monophosphate (AMP N1-oxide as a unique compound of royal jelly (RJ that induces neurite outgrowth (neuritegenesis from cultured rat pheochromocytoma PC12 cells via the adenosine A2A receptor. Now, we found that AMP N1-oxide stimulated the phosphorylation of not only mitogen-activated protein kinase (MAPK but also that of cAMP/calcium-response element-binding protein (CREB in a dose-dependent manner. Inhibition of MAPK activation by a MEK inhibitor, PD98059, did not influence the AMP N1-oxide-induced neuritegenesis, whereas that of protein kinase A (PKA by a selective inhibitor, KT5720, significantly reduced neurite outgrowth. AMP N1-oxide also had the activity of suppressing the growth of PC12 cells, which correlated well with the neurite outgrowth-promoting activity. KT5720 restored the growth of AMP N1-oxide-treated PC12 cells. It is well known that nerve growth factor suppresses proliferation of PC12 cells before causing stimulation of neuronal differentiation. Thus, AMP N1-oxide elicited neuronal differentiation of PC12 cells, as evidenced by generation of neurites, and inhibited cell growth through adenosine A2A receptor-mediated PKA signaling, which may be responsible for characteristic actions of RJ.

  9. cAMP signalling in the vasculature: the role of Epac (exchange protein directly activated by cAMP).

    Science.gov (United States)

    Roberts, Owain Llŷr; Dart, Caroline

    2014-02-01

    The second messenger cAMP plays a central role in mediating vascular smooth muscle relaxation in response to vasoactive transmitters and in strengthening endothelial cell-cell junctions that regulate the movement of solutes, cells and macromolecules between the blood and the surrounding tissue. The vasculature expresses three cAMP effector proteins: PKA (protein kinase A), CNG (cyclic-nucleotide-gated) ion channels, and the most recently discovered Epacs (exchange proteins directly activated by cAMP). Epacs are a family of GEFs (guanine-nucleotide-exchange factors) for the small Ras-related GTPases Rap1 and Rap2, and are being increasingly implicated as important mediators of cAMP signalling, both in their own right and in parallel with the prototypical cAMP target PKA. In the present paper, we review what is currently known about the role of Epac within blood vessels, particularly with regard to the regulation of vascular tone, endothelial barrier function and inflammation.

  10. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  11. Brain-derived neurotrophic factor is produced by skeletal muscle cells in response to contraction and enhances fat oxidation via activation of AMP-activated protein kinase

    DEFF Research Database (Denmark)

    Matthews, V B; Åström, Maj-Brit; Chan, M H S

    2009-01-01

    C12 skeletal muscle cells were electrically stimulated to mimic contraction. L6 myotubes and isolated rat extensor digitorum longus muscles were treated with BDNF and phosphorylation of the proteins AMP-activated protein kinase (AMPK) (Thr(172)) and acetyl coenzyme A carboxylase beta (ACCbeta) (Ser...... kinase (p44/42 Thr(202)/Tyr(204)) phosphorylation in these muscles. In addition, phosphorylation of ACCbeta was markedly elevated in the Bdnf electroporated muscles. CONCLUSIONS/INTERPRETATION: These data identify BDNF as a contraction-inducible protein in skeletal muscle that is capable of enhancing...

  12. Osthole Enhances Osteogenesis in Osteoblasts by Elevating Transcription Factor Osterix via cAMP/CREB Signaling In Vitro and In Vivo

    Directory of Open Access Journals (Sweden)

    Zhong-Rong Zhang

    2017-06-01

    Full Text Available Anabolic anti-osteoporotic agents are desirable for treatment and prevention of osteoporosis and fragility fractures. Osthole is a coumarin derivative extracted from the medicinal herbs Cnidium monnieri (L. Cusson and Angelica pubescens Maxim.f. Osthole has been reported with osteogenic and anti-osteoporotic properties, whereas the underlying mechanism of its benefit still remains unclear. The objective of the present study was to investigate the osteopromotive action of osthole on mouse osteoblastic MC3T3-E1 cells and on mouse femoral fracture repair, and to explore the interaction between osthole-induced osteopromotive effect and cyclic adenosine monophosphate (cAMP elevating effect. Osthole treatment promoted osteogenesis in osteoblasts by enhancing alkaline phosphatase (ALP activity and mineralization. Oral gavage of osthole enhanced fracture repair and increased bone strength. Mechanistic study showed osthole triggered the cAMP/CREB pathway through the elevation of the intracellular cAMP level and activation of the phosphorylation of the cAMP response element-binding protein (CREB. Blockage of cAMP/CREB downstream signals with protein kinase A (PKA inhibitor KT5720 partially suppressed osthole-mediated osteogenesis by inhibiting the elevation of transcription factor, osterix. In conclusion, osthole shows osteopromotive effect on osteoblasts in vitro and in vivo. Osthole-mediated osteogenesis is related to activation of the cAMP/CREB signaling pathway and downstream osterix expression.

  13. Embryonic cholesterol esterification is regulated by a cyclic AMP-dependent pathway in yolk sac membrane-derived endodermal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Siou-Huei Wang

    Full Text Available During avian embryonic development, endodermal epithelial cells (EECs absorb yolk through the yolk sac membrane. Sterol O-acyltransferase (SOAT is important for esterification and yolk lipid utilization during development. Because the major enzyme for yolk sac membrane cholesteryl ester synthesis is SOAT1, we cloned the avian SOAT1 promoter and elucidated the cellular functions of SOAT1. Treatments with either glucagon, isobutylmethylxanthine (IBMX, an adenylate cyclase activator (forskolin, a cAMP analog (dibutyryl-cAMP, or a low glucose concentration all increased SOAT1 mRNA accumulation in EECs from Japanese quail, suggesting that SOAT1 is regulated by nutrients and hormones through a cAMP-dependent pathway. Activity of protein kinase A (PKA was increased by IBMX, whereas co-treatment with the PKA inhibitor, H89 negated the increase in PKA activity. Cyclic AMP-induced EECs had greater cholesterol esterification than untreated EECs. By promoter deletion and point-mutation, the cAMP-response element (-349 to -341 bp was identified as critical in mediating transcription of SOAT1. In conclusion, expression of SOAT1 was regulated by a cAMP-dependent pathway and factors that increase PKA will increase SOAT1 to improve the utilization of lipids in the EECs and potentially modify embryonic growth.

  14. Inhibition of the cAMP/PKA/CREB Pathway Contributes to the Analgesic Effects of Electroacupuncture in the Anterior Cingulate Cortex in a Rat Pain Memory Model.

    Science.gov (United States)

    Shao, Xiao-Mei; Sun, Jing; Jiang, Yong-Liang; Liu, Bo-Yi; Shen, Zui; Fang, Fang; Du, Jun-Ying; Wu, Yuan-Yuan; Wang, Jia-Ling; Fang, Jian-Qiao

    2016-01-01

    Pain memory is considered as endopathic factor underlying stubborn chronic pain. Our previous study demonstrated that electroacupuncture (EA) can alleviate retrieval of pain memory. This study was designed to observe the different effects between EA and indomethacin (a kind of nonsteroid anti-inflammatory drugs, NSAIDs) in a rat pain memory model. To explore the critical role of protein kinase A (PKA) in pain memory, a PKA inhibitor was microinjected into anterior cingulate cortex (ACC) in model rats. We further investigated the roles of the cyclic adenosine monophosphate (cAMP), PKA, cAMP response element-binding protein (CREB), and cAMP/PKA/CREB pathway in pain memory to explore the potential molecular mechanism. The results showed that EA alleviates the retrieval of pain memory while indomethacin failed. Intra-ACC microinjection of a PKA inhibitor blocked the occurrence of pain memory. EA reduced the activation of cAMP, PKA, and CREB and the coexpression levels of cAMP/PKA and PKA/CREB in the ACC of pain memory model rats, but indomethacin failed. The present findings identified a critical role of PKA in ACC in retrieval of pain memory. We propose that the proper mechanism of EA on pain memory is possibly due to the partial inhibition of cAMP/PKA/CREB signaling pathway by EA.

  15. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  16. Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

    Science.gov (United States)

    Shepard, A R; Zhang, W; Eberhardt, N L

    1994-01-21

    We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

  17. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  18. Preferential hydrophobic interactions are responsible for a preference of D-amino acids in the aminoacylation of 5'-AMP with hydrophobic amino acids

    Science.gov (United States)

    Lacey, J. C. Jr; Wickramasinghe, N. S.; Sabatini, R. S.

    1992-01-01

    We have studied the chemistry of aminoacyl AMP to model reactions at the 3' terminus of aminoacyl tRNA for the purpose of understanding the origin of protein synthesis. The present studies relate to the D, L preference in the esterification of 5'-AMP. All N-acetyl amino acids we studied showed faster reaction of the D-isomer, with a generally decreasing preference for D-isomer as the hydrophobicity of the amino acid decreased. The beta-branched amino acids, Ile and Val, showed an extreme preference for D-isomer. Ac-Leu, the gamma-branched amino acid, showed a slightly low D/L ratio relative to its hydrophobicity. The molecular basis for these preferences for D-isomer is understandable in the light of our previous studies and seems to be due to preferential hydrophobic interaction of the D-isomer with adenine. The preference for hydrophobic D-amino acids can be decreased by addition of an organic solvent to the reaction medium. Conversely, peptidylation with Ac-PhePhe shows a preference for the LL isomer over the DD isomer.

  19. The Popeye Domain Containing Genes and cAMP Signaling

    Directory of Open Access Journals (Sweden)

    Thomas Brand

    2014-05-01

    Full Text Available 3'-5'-cyclic adenosine monophosphate (cAMP is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs. Initially, it was thought that protein kinase A (PKA exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC and hyperpolarizing cyclic nucleotide-gated (HCN channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins.

  20. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  1. Linderane Suppresses Hepatic Gluconeogenesis by Inhibiting the cAMP/PKA/CREB Pathway Through Indirect Activation of PDE 3 via ERK/STAT3

    Directory of Open Access Journals (Sweden)

    Wei Xie

    2018-05-01

    Full Text Available The role of phosphodiesterase 3 (PDE3, a cyclic AMP (cAMP-degrading enzyme, in modulating gluconeogenesis remains unknown. Here, linderane, a natural compound, was found to inhibit gluconeogenesis by activating hepatic PDE3 in rat primary hepatocytes. The underlying molecular mechanism and its effects on whole-body glucose and lipid metabolism were investigated. The effect of linderane on gluconeogenesis, cAMP content, phosphorylation of cAMP-response element-binding protein (CREB and PDE activity were examined in cultured primary hepatocytes and C57BL/6J mice. The precise mechanism by which linderane activates PDE3 and inhibits the cAMP pathway was explored using pharmacological inhibitors. The amelioration of metabolic disorders was observed in ob/ob mice. Linderane inhibited gluconeogenesis, reduced phosphoenolpyruvate carboxykinase (Pck1 and glucose-6-phosphatase (G6pc gene expression, and decreased intracellular cAMP concentration and CREB phosphorylation in rat primary hepatocytes under both basal and forskolin-stimulated conditions. In rat primary hepatocytes, it also increased total PDE and PDE3 activity but not PDE4 activity. The suppressive effect of linderane on the cAMP pathway and gluconeogenesis was abolished by the non-specific PDE inhibitor 3-isobutyl-1-methylxanthine (IBMX and the specific PDE3 inhibitor cilostazol. Linderane indirectly activated PDE3 through extracellular regulated protein kinase 1/2 (ERK1/2 and signal transducer and activator of transcription 3 (STAT3 activation. Linderane improved glucose and lipid metabolism after chronic oral administration in ob/ob mice. Our findings revealed linderane as an indirect PDE3 activator that suppresses gluconeogenesis through cAMP pathway inhibition and has beneficial effects on metabolic syndromes in ob/ob mice. This investigation highlighted the potential for PDE3 activation in the treatment of type 2 diabetes.

  2. Cyclic AMP (cAMP)-mediated stimulation of adipocyte differentiation requires the synergistic action of Epac- and cAMP-dependent protein kinase-dependent processes

    DEFF Research Database (Denmark)

    Petersen, Rasmus Koefoed; Madsen, Lise; Pedersen, Lone Møller

    2008-01-01

    AMP-dependent stimulation of adipocyte differentiation. Epac, working via Rap, acted synergistically with cAMP-dependent protein kinase (protein kinase A [PKA]) to promote adipogenesis. The major role of PKA was to down-regulate Rho and Rho-kinase activity, rather than to enhance CREB phosphorylation. Suppression of Rho......-kinase impaired proadipogenic insulin/insulin-like growth factor 1 signaling, which was restored by activation of Epac. This interplay between PKA and Epac-mediated processes not only provides novel insight into the initiation and tuning of adipocyte differentiation, but also demonstrates a new mechanism of c......AMP signaling whereby cAMP uses both PKA and Epac to achieve an appropriate cellular response....

  3. Microgravity changes in heart structure and cyclic-AMP metabolism

    Science.gov (United States)

    Philpott, D. E.; Fine, A.; Kato, K.; Egnor, R.; Cheng, L.

    1985-01-01

    The effects of microgravity on cardiac ultrastructure and cyclic AMP metabolism in tissues of rats flown on Spacelab 3 are reported. Light and electron microscope studies of cell structure, measurements of low and high Km phosphodiesterase activity, cyclic AMP-dependent protein kinase activity, and regulatory subunit compartmentation show significant deviations in flight animals when compared to ground controls. The results indicate that some changes have occurred in cellular responses associated with catecholamine receptor interactions and intracellular signal processing.

  4. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  5. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  6. Sleutelmag en amp

    Directory of Open Access Journals (Sweden)

    P. J. Rossouw

    1985-06-01

    Full Text Available As die Heidelbergse Kategismus (Sondag 31 handel oor die sleutels van die Koninkryk, dan word die betrokkenheid van die ampte slegs per implikasie veronderstel. Meer eksplisiet word die amp en sleutelmag in die Nederlandse Geloofsbelydenis gekoppel; “ons glo dat hierdie ware kerk ooreenkomstig die geestelike bestuurswyse wat ons Here ons in sy Woord geleer het, geregeer moet word... hulle (moet sorg dra dat die ware godsdiens onderhou (word, die ware leer orals versprei, die oortreders op geestelike wyse vermaan en in toom gehou (word... (N.G.B. art. 30 en: “Ons glo verder dat die regeerders van die kerk, al is dit nuttig en goed om onder mekaar ’n bepaalde orde tot instandhouding van die liggaam van die kerk in te stel en te handhaaf, tog noukeurig moet oppas om nie af te wyk van wat Christus, ons enigste Meester, vir ons ingestel het nie... Ons aanvaar derhalwe slegs wat kan dien om eendrag en eenheid te bewaar en te bevorder, en om alles in gehoorsaamheid van God te onderhou. Daarvoor is nodig die ban en alles wat daarmee saamhang, toegepas ooreenkomstig die Woord van God” (N.G.B. art. 32.

  7. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  8. Activation of AMP-activated protein kinase in response to temperature elevation shows seasonal variation in the zebra mussel, Dreissena polymorpha.

    Science.gov (United States)

    Jost, Jennifer A; Keshwani, Sarah S; Abou-Hanna, Jacob J

    2015-04-01

    Global climate change is affecting ectothermic species, and a variety of studies are needed on thermal tolerances, especially from cellular and physiological perspectives. This study utilized AMP-activated protein kinase (AMPK), a key regulator of cellular energy levels, to examine the effects of high water temperatures on zebra mussel (Dreissena polymorpha) physiology. During heating, AMPK activity increased as water temperature increased to a point, and maximum AMPK activity was detected at high, but sublethal, water temperatures. This pattern varied with season, suggesting that cellular mechanisms of seasonal thermal acclimatization affect basic metabolic processes during sublethal heat stress. There was a greater seasonal variation in the water temperature at which maximum AMPK activity was measured than in lethal water temperature. Furthermore, baseline AMPK activity varied significantly across seasons, most likely reflecting altered metabolic states during times of growth and reproduction. In addition, when summer-collected mussels were lab-acclimated to winter and spring water temperatures, patterns of heat stress mirrored those of field-collected animals. These data suggest that water temperature is the main driver of the seasonal variation in physiology. This study concluded that AMPK activity, which reflects changes in energy supply and demand during heat stress, can serve as a sensitive and early indicator of temperature stress in mussels. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  10. [Physiopathology of cAMP/PKA signaling in neurons].

    Science.gov (United States)

    Castro, Liliana; Yapo, Cedric; Vincent, Pierre

    2016-01-01

    Cyclic adenosine monophosphate (cAMP) and the cyclic-AMP dependent protein kinase (PKA) regulate a plethora of cellular functions in virtually all eukaryotic cells. In neurons, the cAMP/PKA signaling cascade controls a number of biological properties such as axonal growth, synaptic transmission, regulation of excitability or long term changes in the nucleus. Genetically-encoded optical biosensors for cAMP or PKA considerably improved our understanding of these processes by providing a real-time measurement in living neurons. In this review, we describe the recent progresses made in the creation of biosensors for cAMP or PKA activity. These biosensors revealed profound differences in the amplitude of the cAMP signal evoked by neuromodulators between various neuronal preparations. These responses can be resolved at the level of individual neurons, also revealing differences related to the neuronal type. At the subcellular level, biosensors reported different signal dynamics in domains like dendrites, cell body, nucleus and axon. Combining this imaging approach with pharmacology or genetical models points at phosphodiesterases and phosphatases as critical regulatory proteins. Biosensor imaging will certainly help understand the mechanism of action of current drugs as well as help in devising novel therapeutic strategies for neuropsychiatric diseases. © Société de Biologie, 2017.

  11. Airborne Multisensor Pod System (AMPS) data management overview

    Energy Technology Data Exchange (ETDEWEB)

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  12. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  13. Activation of PKA in cell requires higher concentration of cAMP than in vitro: implications for compartmentalization of cAMP signalling.

    Science.gov (United States)

    Koschinski, Andreas; Zaccolo, Manuela

    2017-10-26

    cAMP is a ubiquitous second messenger responsible for the cellular effects of multiple hormones and neurotransmitters via activation of its main effector, protein kinase A (PKA). Multiple studies have shown that the basal concentration of cAMP in several cell types is about 1 μM. This value is well above the reported concentration of cAMP required to half-maximally activate PKA, which measures in the 100-300 nM range. Several hypotheses have been suggested to explain this apparent discrepancy including inaccurate measurements of intracellular free cAMP, inaccurate measurement of the apparent activation constant of PKA or shielding of PKA from bulk cytosolic cAMP via localization of the enzyme to microdomains with lower basal cAMP concentration. However, direct experimental evidence in support of any of these models is limited and a firm conclusion is missing. In this study we use multiple FRET-based reporters for the detection of cAMP and PKA activity in intact cells and we establish that the sensitivity of PKA to cAMP is almost twenty times lower when measured in cell than when measured in vitro. Our findings have important implications for the understanding of compartmentalized cAMP signalling.

  14. Cyclic GMP-AMP Displays Mucosal Adjuvant Activity in Mice

    OpenAIRE

    Škrnjug, Ivana; Guzmán, Carlos Alberto; Ruecker, Christine

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice....

  15. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  16. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  18. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  19. Ru (amp)(bipy)Cl

    Indian Academy of Sciences (India)

    Administrator

    [RuV(amp)(bipy)O]+ intermediate complex which leads to the high affinity for hydrogen atom/hydride abstraction. Acknowledgement. We gratefully acknowledge the financial support from the Department of Science &. Technology, Government of India. We are thankful to Shri Hardyal Singh for his encouragement. Reference.

  20. 3' : 5'-Cyclic AMP-dependent 3'

    NARCIS (Netherlands)

    Mato, José M.; Krens, Frans A.; Haastert, Peter J.M. van; Konijn, Theo M.

    1977-01-01

    Suspensions of 3':5'-cyclic AMP (cAMP)-sensitive cells of Dictyostelium discoideum responded to a cAMP pulse with increased 3':5'-cyclic GMP (cGMP) levels. Under the assay conditions used (2 × 10^8 cells per ml in 10 mM phosphate buffer, pH 6.0) cAMP (5 × 10-8 M final concentration) increased cGMP

  1. Chemotaxis to cyclic AMP and folic acid is mediated by different G proteins in Dictyostelium discoideum

    NARCIS (Netherlands)

    Kesbeke, Fanja; Haastert, Peter J.M. van; Wit, René J.W. de; Snaar-Jagalska, B. Ewa

    1990-01-01

    Mutant Frigid A (fgdA) of Dictyostelium discoideum is defective in a functional Gα2 subunit of a G protein and is characterized by a complete blockade of the cyclic AMP-mediated sensory transduction steps, including cyclic AMP relay, chemotaxis and the cyclic GMP response. Folic acid-mediated

  2. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP

    NARCIS (Netherlands)

    Kortenoeven, M.L.A.; van den Brand, M.; Wetzels, J.F.M.; Deen, P.M.T.

    2011-01-01

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined

  3. Cyclic AMP-Responsive Element-Binding Protein (CREB is Critical in Autoimmunity by Promoting Th17 but Inhibiting Treg Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Xiaohu Wang

    2017-11-01

    Full Text Available The molecular mechanisms that govern differential T cell development into pro-inflammatory Th17 vs. regulatory T (Treg cells remain unclear. Here, we show that selective deletion of CREB in T cells or Th17 cells impaired Th17 cell differentiation in vitro and in vivo, and led to resistance to autoimmune diseases. Mechanistically, CREB, activated by CD3-PKC-ϴ signaling, plays a key role in regulating Th17 cell differentiation, at least in part through directly binding to the Il17-Il17f gene locus. Unexpectedly, although dispensable for FOXP3 expression and for the homeostasis and suppressive function of thymus-derived Treg cells, CREB negatively regulates the survival of TGF-β-induced Treg cells, and deletion of CREB resulted in increased FOXP3+ Treg cells in the intestine and protection in a colitis model. Thus, CREB is critical in autoimmune diseases by promoting Th17 cell and inhibiting de novo Treg cell generation.

  4. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    International Nuclear Information System (INIS)

    Zuloaga, R.; Fuentes, E.N.; Molina, A.; Valdés, J.A.

    2013-01-01

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP 3 /calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation

  5. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    Energy Technology Data Exchange (ETDEWEB)

    Zuloaga, R. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Fuentes, E.N.; Molina, A. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile); Valdés, J.A., E-mail: jvaldes@unab.cl [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile)

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  6. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  7. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  8. Different cAMP sources are critically involved in G protein-coupled receptor CRHR1 signaling.

    Science.gov (United States)

    Inda, Carolina; Dos Santos Claro, Paula A; Bonfiglio, Juan J; Senin, Sergio A; Maccarrone, Giuseppina; Turck, Christoph W; Silberstein, Susana

    2016-07-18

    Corticotropin-releasing hormone receptor 1 (CRHR1) activates G protein-dependent and internalization-dependent signaling mechanisms. Here, we report that the cyclic AMP (cAMP) response of CRHR1 in physiologically relevant scenarios engages separate cAMP sources, involving the atypical soluble adenylyl cyclase (sAC) in addition to transmembrane adenylyl cyclases (tmACs). cAMP produced by tmACs and sAC is required for the acute phase of extracellular signal regulated kinase 1/2 activation triggered by CRH-stimulated CRHR1, but only sAC activity is essential for the sustained internalization-dependent phase. Thus, different cAMP sources are involved in different signaling mechanisms. Examination of the cAMP response revealed that CRH-activated CRHR1 generates cAMP after endocytosis. Characterizing CRHR1 signaling uncovered a specific link between CRH-activated CRHR1, sAC, and endosome-based signaling. We provide evidence of sAC being involved in an endocytosis-dependent cAMP response, strengthening the emerging model of GPCR signaling in which the cAMP response does not occur exclusively at the plasma membrane and introducing the notion of sAC as an alternative source of cAMP. © 2016 Inda et al.

  9. DRD2/AKT1 interaction on D2 c-AMP independent signaling, attentional processing, and response to olanzapine treatment in schizophrenia.

    Science.gov (United States)

    Blasi, Giuseppe; Napolitano, Francesco; Ursini, Gianluca; Taurisano, Paolo; Romano, Raffaella; Caforio, Grazia; Fazio, Leonardo; Gelao, Barbara; Di Giorgio, Annabella; Iacovelli, Luisa; Sinibaldi, Lorenzo; Popolizio, Teresa; Usiello, Alessandro; Bertolino, Alessandro

    2011-01-18

    The D2/AKT1/GSK-3β signaling pathway has been involved in the downstream intracellular effects of dopamine, in the pathophysiology of cognitive deficits and related brain activity in schizophrenia, as well as in response to treatment with antipsychotics. Polymorphisms in the D2 (DRD2 rs1076560) and AKT1 (AKT1 rs1130233) genes have been associated with their respective protein expression and with higher-order cognition and brain function, including attention. Given the strong potential for their relationship, we investigated the interaction of these polymorphisms on multiple molecular and in vivo phenotypes associated with this signaling pathway. We measured AKT1 and GSK-3β proteins and phosphorylation in human peripheral blood mononuclear cells, functional MRI cingulate response during attentional control, behavioral accuracy during sustained attention, and response to 8 wk of treatment with olanzapine in a total of 190 healthy subjects and 66 patients with schizophrenia. In healthy subjects, we found that the interaction between the T allele of DRD2 rs1076560 and the A allele of AKT1 rs1130233 was associated with reduced AKT1 protein levels and reduced phosphorylation of GSK-3β, as well as with altered cingulate response and reduced behavioral accuracy during attentional processing. On the other hand, interaction of these two alleles was associated with greater improvement of Positive and Negative Syndrome Scale scores in patients with schizophrenia after treatment with olanzapine. The present results indicate that these functional polymorphisms are epistatically associated with multiple phenotypes of relevance to schizophrenia. Our results also lend support to further investigation of this downstream molecular pathway in the etiology and treatment of this disorder.

  10. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    Science.gov (United States)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  11. cAMP Stimulates Transepithelial Short-Circuit Current and Fluid Transport Across Porcine Ciliary Epithelium.

    Science.gov (United States)

    Cheng, Angela King-Wah; Civan, Mortimer M; To, Chi-Ho; Do, Chi-Wai

    2016-12-01

    To investigate the effects of cAMP on transepithelial electrical parameters and fluid transport across porcine ciliary epithelium. Transepithelial electrical parameters were determined by mounting freshly isolated porcine ciliary epithelium in a modified Ussing chamber. Similarly, fluid movement across intact ciliary body was measured with a custom-made fluid flow chamber. Addition of 1, 10, and 100 μM 8-Br-cAMP (cAMP) to the aqueous side (nonpigmented ciliary epithelium, NPE) induced a sustained increase in short-circuit current (Isc). Addition of niflumic acid (NFA) to the aqueous surface effectively blocked the cAMP-induced Isc stimulation. The administration of cAMP to the stromal side (pigmented ciliary epithelium, PE) triggered a significant stimulation of Isc only at 100 μM. No additive effect was observed with bilateral application of cAMP. Likewise, forskolin caused a significant stimulation of Isc when applied to the aqueous side. Concomitantly, cAMP and forskolin increased fluid transport across porcine ciliary epithelium, and this stimulation was effectively inhibited by aqueous NFA. Depleting Cl- in the bathing solution abolished the baseline Isc and inhibited the subsequent stimulation by cAMP. Pretreatment with protein kinase A (PKA) blockers (H89/KT5720) significantly inhibited the cAMP- and forskolin-induced Isc responses. Our results suggest that cAMP triggers a sustained stimulation of Cl- and fluid transport across porcine ciliary epithelium; Cl- channels in the NPE cells are potentially a cellular site for this PKA-sensitive cAMP-mediated response.

  12. AMP affects intracellular Ca2+ signaling, migration, cytokine secretion and T cell priming capacity of dendritic cells.

    Directory of Open Access Journals (Sweden)

    Elisabeth Panther

    Full Text Available The nucleotide adenosine-5'-monophosphate (AMP can be released by various cell types and has been shown to elicit different cellular responses. In the extracellular space AMP is dephosphorylated to the nucleoside adenosine which can then bind to adenosine receptors. However, it has been shown that AMP can also activate A(1 and A(2a receptors directly. Here we show that AMP is a potent modulator of mouse and human dendritic cell (DC function. AMP increased intracellular Ca(2+ concentration in a time and dose dependent manner. Furthermore, AMP stimulated actin-polymerization in human DCs and induced migration of immature human and bone marrow derived mouse DCs, both via direct activation of A(1 receptors. AMP strongly inhibited secretion of TNF-α and IL-12p70, while it enhanced production of IL-10 both via activation of A(2a receptors. Consequently, DCs matured in the presence of AMP and co-cultivated with naive CD4(+CD45RA(+ T cells inhibited IFN-γ production whereas secretion of IL-5 and IL-13 was up-regulated. An enhancement of Th2-driven immune response could also be observed when OVA-pulsed murine DCs were pretreated with AMP prior to co-culture with OVA-transgenic naïve OTII T cells. An effect due to the enzymatic degradation of AMP to adenosine could be ruled out, as AMP still elicited migration and changes in cytokine secretion in bone-marrow derived DCs generated from CD73-deficient animals and in human DCs pretreated with the ecto-nucleotidase inhibitor 5'-(alpha,beta-methylene diphosphate (APCP. Finally, the influence of contaminating adenosine could be excluded, as AMP admixed with adenosine desaminase (ADA was still able to influence DC function. In summary our data show that AMP when present during maturation is a potent regulator of dendritic cell function and point out the role for AMP in the pathogenesis of inflammatory disorders.

  13. Dopamine receptors modulate cytotoxicity of natural killer cells via cAMP-PKA-CREB signaling pathway.

    Directory of Open Access Journals (Sweden)

    Wei Zhao

    Full Text Available Dopamine (DA, a neurotransmitter in the nervous system, has been shown to modulate immune function. We have previously reported that five subtypes of DA receptors, including D1R, D2R, D3R, D4R and D5R, are expressed in T lymphocytes and they are involved in regulation of T cells. However, roles of these DA receptor subtypes and their coupled signal-transduction pathway in modulation of natural killer (NK cells still remain to be clarified. The spleen of mice was harvested and NK cells were isolated and purified by negative selection using magnetic activated cell sorting. After NK cells were incubated with various drugs for 4 h, flow cytometry measured cytotoxicity of NK cells against YAC-1 lymphoma cells. NK cells expressed the five subtypes of DA receptors at mRNA and protein levels. Activation of D1-like receptors (including D1R and D5R with agonist SKF38393 enhanced NK cell cytotoxicity, but activation of D2-like receptors (including D2R, D3R and D4R with agonist quinpirole attenuated NK cells. Simultaneously, SKF38393 elevated D1R and D5R expression, cAMP content, and phosphorylated cAMP-response element-binding (CREB level in NK cells, while quinpirole reduced D3R and D4R expression, cAMP content, and phosphorylated CREB level in NK cells. These effects of SKF38393 were blocked by SCH23390, an antagonist of D1-like receptors, and quinpirole effects were abolished by haloperidol, an antagonist of D2-like receptors. In support these results, H89, an inhibitor of phosphokinase A (PKA, prevented the SKF38393-dependent enhancement of NK cells and forskolin, an activator of adenylyl cyclase (AC, counteracted the quinpirole-dependent suppression of NK cells. These findings show that DA receptor subtypes are involved in modulation of NK cells and suggest that D1-like receptors facilitate NK cells by stimulating D1R/D5R-cAMP-PKA-CREB signaling pathway and D2-like receptors suppress NK cells by inhibiting D3R/D4R-cAMP-PKA-CREB signaling pathway. The

  14. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  15. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  16. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  17. Effects of sodium ions on rat thyrocyte (FRTL-5 cells) swelling- and thyrotropin-activated taurine efflux dependent on cAMP and Epac.

    Science.gov (United States)

    Fugelli, Kjell

    2016-03-01

    Cellular osmolyte release is important in preventing water accumulation and swelling. However, the signaling pathways that detect volume increase and activate solute efflux are still not fully understood. We investigated efflux activation of the osmolyte taurine which is actively accumulated in rat thyrocytes (FRTL-5). Efflux of accumulated [(3)H]taurine was stimulated by cellular swelling and thyrotropin (TSH). These effects were significantly diminished in cells having reduced TSH receptor concentrations. Phosphodiesterase inhibitors (IBMX, Rolipram) enhanced both responses. An analog of forskolin (FSK; 7-deacetyl-7-[O-(N-methylpiperazino)-γ-butyryl] dihydrochloride) and an analog of cAMP, specific for activating exchange protein activated directly by cAMP (Epac; 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate, acetoxymethyl ester), significantly stimulated [(3)H]taurine efflux. A cAMP analog specific for activating protein kinase A (PKA; N6-benzoyladenosine-3',5'-cyclic monophosphate, acetoxymethyl ester) had no significant stimulatory effect on [(3)H]taurine efflux rate. The amiloride analog, 5-(N-ethyl-N-isopropyl)-amiloride, which inhibits a TSH-stimulated Na(+)/H(+) exchanger, enhanced (100 %) and ouabain inhibited (50 %) the TSH-stimulated [(3)H]taurine efflux rate. The effect of FSK on efflux was strongly potentiated by Na(+)-free iso-osmotic conditions and by osmolality/cell volume that affected also the db-cAMP-stimulated efflux. The TSH receptors and downstream elements of the signaling pathway comprising adenylyl cyclase, cAMP and Epac appeared to mediate the hormone-induced signal for [(3)H]taurine efflux from FRTL-5 cells. With less evidence, the cell volume/osmolality-induced [(3)H]taurine efflux cascade appeared to share some of the hormone signaling elements and to modulate the hormone signaling pathway at two levels through cellular Na(+).

  18. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  19. Cellular regulation of basal and FSH-stimulated cyclic AMP production in irradiated rat testes

    International Nuclear Information System (INIS)

    Kangasniemi, M.; Kaipia, A.; Toppari, J.; Mali, P.; Huhtaniemi, I.; Parvinen, M.

    1990-01-01

    Basal and follicle-stimulating hormone (FSH)-stimulated cyclic AMP (cAMP) productions by seminiferous tubular segments from irradiated adult rats were investigated at defined stages of the epithelial cycle when specific spermatogenic cells were low in number. Seven days post-irradiation, depletion of spermatogonia did not influence the basal cAMP production, but FSH response increased in stages II-VIII. Seventeen days post-irradiation when spermatocytes were low in number, there was a small increase in basal cAMP level in stages VII-VIII and FSH-stimulated cAMP production increased in stages VII-XII and XIII-I. At 38 days when pachytene spermatocytes and round spermatids (steps 1-6) were low in number, a decreased basal cAMP production was measured in stages II-VI and IX-XII. FSH-stimulated cAMP output increased in stages VII-XII but decreased in stages II-VI. At 52 days when all spermatids were low in number, basal cAMP levels decreased in all stages of the cycle, whereas FSH response was elevated only in stages VII-XII. All spermatogenic cell types seem to have an effect on cAMP production by the seminiferous tubule in a stage-specific fashion. Germ cells appear to regulate Sertoli cell FSH response in a paracrine way, and a part of cAMP may originate from spermatids stimulated by an unknown FSH-dependent Sertoli cell factor. The FSH-dependent functions may control such phenomena as spermatogonial proliferation, final maturation of spermatids, and onset of meiosis

  20. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  1. In Vivo Cardiovascular Pharmacology of 2′,3′-cAMP, 2′-AMP, and 3′-AMP in the Rat

    Science.gov (United States)

    Mi, Zaichuan

    2013-01-01

    The naturally occurring purine 2′,3′-cAMP is metabolized in vitro to 2′-AMP and 3′-AMP, which are subsequently metabolized to adenosine. Whether in vivo 2′,3′-cAMP, 2′-AMP, or 3′-AMP are rapidly converted to adenosine and exert rapid effects via adenosine receptors is unknown. To address this question, we compared the cardiovascular and renal effects of 2′,3′-cAMP, 2′-AMP, 3′-AMP, 3′,5′-cAMP, 5′-AMP, and adenosine in vivo in the rat. Purines were infused intravenously while monitoring mean arterial blood pressure (MABP), heart rate (HR), cardiac output, and renal and mesenteric blood flows. Total peripheral (TPR), renal vascular (RVR), and mesenteric vascular (MVR) resistances were calculated. Urine was collected for determination of urine excretion rate [urine volume (UV)]. When sufficient urine was available, the sodium excretion rate (Na+ER) and glomerular filtration rate (GFR) were determined. 2′,3′-cAMP, 2′-AMP, and 3′-AMP dose-dependently and profoundly reduced MABP, HR, TPR, and MVR with efficacy and potency similar to adenosine and 5′-AMP. These effects of 2′,3′-cAMP, 2′-AMP, and 3′-AMP were attenuated by blockade of adenosine receptors with 1,3-dipropyl-8-(p-sulfophenyl)xanthine. 2′,3′-cAMP, 2′-AMP, 3′-AMP, adenosine, and 5′-AMP variably affected RVR, but profoundly (nearly 100%) decreased UV at higher doses. GFR and Na+ER could be measured at the lower doses and were suppressed by 2′,3′-cAMP, 2′-AMP, and 3′-AMP, but not by adenosine or 5′-AMP. 2′,3′-cAMP increased urinary excretion rates of 2′-AMP, 3′-AMP, and adenosine. 3′,5′-cAMP exerted no adverse hemodynamic effects yet increased urinary adenosine as efficiently as 2′,3′-cAMP. Conclusions: In vivo 2′,3′-cAMP is rapidly converted to adenosine. Because both cAMPs increase adenosine in the urinary compartment, these agents may provide unique therapeutic opportunities. PMID:23759508

  2. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  3. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Science.gov (United States)

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  4. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  5. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    Directory of Open Access Journals (Sweden)

    Nicole M Warrington

    2015-07-01

    Full Text Available A relationship between cyclic adenosine 3’, 5’-monophosphate (cAMP levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor risk in individuals with Neurofibromatosis type 1 (NF1. Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex.

  6. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  7. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  8. Identification of a specific assembly of the G protein Golf as a critical and regulated module of dopamine and adenosine-activated cAMP pathways in the striatum

    Directory of Open Access Journals (Sweden)

    Denis eHervé

    2011-08-01

    Full Text Available In the principal neurons of striatum (medium spiny neurons, MSNs, cAMP pathway is primarily activated through the stimulation of dopamine D1 and adenosine A2A receptors, these receptors being mainly expressed in striatonigral and striatopallidal MSNs, respectively. Since cAMP signaling pathway could be altered in various physiological and pathological situations, including drug addiction and Parkinson’s disease, it is of crucial importance to identify the molecular components involved in the activation of this pathway. In MSNs, cAMP pathway activation is not dependent on the classical Gs GTP-binding protein but requires a specific G protein subunit heterotrimer containing Galpha-olf/beta2/gamma7 in particular association with adenylate cyclase type 5. This assembly forms an authentic functional signaling unit since loss of one of its members leads to defects of cAMP pathway activation in response to D1 or A2A receptor stimulation, inducing dramatic impairments of behavioral responses dependent on these receptors. Interestingly, D1 receptor-dependent cAMP signaling is modulated by the neuronal levels of Galpha-olf, indicating that Galpha-olf represents the rate-limiting step in this signaling cascade and could constitute a critical element for regulation of D1 receptor responses. In both Parkinsonian patients and several animal models of Parkinson’s disease, the lesion of dopamine neurons produces a prolonged elevation of Galpha-olf levels. This observation gives an explanation for the cAMP pathway hypersensitivity to D1 stimulation, occurring despite an unaltered D1 receptor density. In conclusion, alterations in the highly specialized assembly of Galpha-olf/beta2/gamma7 subunits can happen in pathological conditions, such as Parkinson’s disease, and it could have important functional consequences in relation to changes in D1 receptor signaling in the striatum.

  9. Competitive cAMP Antagonists for cAMP-Receptor Proteins

    NARCIS (Netherlands)

    Haastert, Peter J.M. van; Driel, Roel van; Jastorff, Bernd; Baraniak, Janina; Stec, Wojciech J.; Wit, René J.W. de

    1984-01-01

    The two exocyclic oxygen atoms at phosphorus of cAMP have been replaced by a sulfur atom or by a dimethylamino group. These substitutions introduce chirality at the phosphorus atom; therefore, two diastereoisomers are known for each derivative: (SP)-cAMPS, (RP)-cAMPS, (SP)-cAMPN(CH3)2, and

  10. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  11. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  12. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  13. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  14. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  15. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  16. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  17. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  18. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  19. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  20. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  1. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

    Science.gov (United States)

    Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

    2004-01-01

    AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

  2. Sustained exposure to catecholamines affects cAMP/PKA compartmentalised signalling in adult rat ventricular myocytes.

    Science.gov (United States)

    Fields, Laura A; Koschinski, Andreas; Zaccolo, Manuela

    2016-07-01

    In the heart compartmentalisation of cAMP/protein kinase A (PKA) signalling is necessary to achieve a specific functional outcome in response to different hormonal stimuli. Chronic exposure to catecholamines is known to be detrimental to the heart and disrupted compartmentalisation of cAMP signalling has been associated to heart disease. However, in most cases it remains unclear whether altered local cAMP signalling is an adaptive response, a consequence of the disease or whether it contributes to the pathogenetic process. We have previously demonstrated that isoforms of PKA expressed in cardiac myocytes, PKA-I and PKA-II, localise to different subcellular compartments and are selectively activated by spatially confined pools of cAMP, resulting in phosphorylation of distinct downstream targets. Here we investigate cAMP signalling in an in vitro model of hypertrophy in primary adult rat ventricular myocytes. By using a real time imaging approach and targeted reporters we find that that sustained exposure to catecholamines can directly affect cAMP/PKA compartmentalisation. This appears to involve a complex mechanism including both changes in the subcellular localisation of individual phosphodiesterase (PDE) isoforms as well as the relocalisation of PKA isoforms. As a result, the preferential coupling of PKA subsets with different PDEs is altered resulting in a significant difference in the level of cAMP the kinase is exposed to, with potential impact on phosphorylation of downstream targets. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  5. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  6. Cyclic GMP-AMP Containing Mixed Phosphodiester Linkages Is An Endogenous High Affinity Ligand for STING

    OpenAIRE

    Zhang, Xu; Shi, Heping; Wu, Jiaxi; Zhang, Xuewu; Sun, Lijun; Chen, Chuo; Chen, Zhijian J.

    2013-01-01

    The presence of microbial or self DNA in the cytoplasm of mammalian cells is a danger signal detected by the DNA sensor cyclic-GMP-AMP (cGAMP) synthase (cGAS), which catalyzes the production of cGAMP that in turn serves as a second messenger to activate innate immune responses. Here we show that endogenous cGAMP in mammalian cells contains two distinct phosphodiester linkages, one between 2′-OH of GMP and 5′-phosphate of AMP, and the other between 3′-OH of AMP and 5′-phosphate of GMP. This mo...

  7. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  8. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  9. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  10. Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation

    Science.gov (United States)

    Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.

    2013-01-01

    An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367

  11. Software Design Document for the AMP Nuclear Fuel Performance Code

    International Nuclear Information System (INIS)

    Philip, Bobby; Clarno, Kevin T.; Cochran, Bill

    2010-01-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  12. Mechanism for iron control of the Vibrio fischeri luminescence system: involvement of cyclic AMP and cyclic AMP receptor protein and modulation of DNA level.

    Science.gov (United States)

    Dunlap, P V

    1992-07-01

    Iron controls luminescence in Vibrio fischeri by an indirect but undefined mechanism. To gain insight into that mechanism, the involvement of cyclic AMP (cAMP) and cAMP receptor protein (CRP) and of modulation of DNA levels in iron control of luminescence were examined in V. fischeri and in Escherichia coli containing the cloned V. fischeri lux genes on plasmids. For V. fischeri and E. coli adenylate cyclase (cya) and CRP (crp) mutants containing intact lux genes (luxR luxICDABEG), presence of the iron chelator ethylenediamine-di(o-hydroxyphenyl acetic acid) (EDDHA) increased expression of the luminescence system like in the parent strains only in the cya mutants in the presence of added cAMP. In the E. coli strains containing a plasmid with a Mu dl(lacZ) fusion in luxR, levels of beta-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the lux operon promoter) were both 2-3-fold higher in the presence of EDDHA in the parent strain, and for the mutants this response to EDDHA was observed only in the cya mutant in the presence of added cAMP. Therefore, cAMP and CRP are required for the iron restriction effect on luminescence, and their involvement in iron control apparently is distinct from the known differential control of transcription from the luxR and luxICDABEG promoters by cAMP-CRP. Furthermore, plasmid and chromosomal DNA levels were higher in E. coli and V. fischeri in the presence of EDDHA. The higher DNA levels correlated with an increase in expression of chromosomally encoded beta-galactosidase in E. coli and with a higher level of autoinducer in cultures of V. fischeri. These results implicate cAMP-CRP and modulation of DNA levels in the mechanism of iron control of the V. fischeri luminescence system.

  13. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  14. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  15. Intrusion Detection amp Prevention Systems - Sourcefire Snort

    Directory of Open Access Journals (Sweden)

    Rajesh Vuppala

    2015-08-01

    Full Text Available Information security is a challenging issue for all business organizations today amidst increasing cyber threats. While there are many alternative intrusion detection amp prevention systems available to choose from selecting the best solution to implement to detect amp prevent cyber-attacks is a difficult task. The best solution is of the one that gets the best reviews and suits the organizations needs amp budget. In this review paper we summarize various classes of intrusion detection and prevention systems compare features of alternative solutions and make recommendation for implementation of one as the best solution for business organization in Fiji.

  16. Schwann Cells Metabolize Extracellular 2′,3′-cAMP to 2′-AMP

    Science.gov (United States)

    Verrier, Jonathan D.; Kochanek, Patrick M.

    2015-01-01

    The 3′,5′-cAMP–adenosine pathway (3′,5′-cAMP→5′-AMP→adenosine) and the 2′,3′-cAMP–adenosine pathway (2′,3′-cAMP→2′-AMP/3′-AMP→adenosine) are active in the brain. Oligodendrocytes participate in the brain 2′,3′-cAMP–adenosine pathway via their robust expression of 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; converts 2′,3′-cAMP to 2′-AMP). Because Schwann cells also express CNPase, it is conceivable that the 2′,3′-cAMP–adenosine pathway exists in the peripheral nervous system. To test this and to compare the 2′,3′-cAMP–adenosine pathway to the 3′,5′-cAMP–adenosine pathway in Schwann cells, we examined the metabolism of 2′,3′-cAMP, 2′-AMP, 3′-AMP, 3′,5′-cAMP, and 5′-AMP in primary rat Schwann cells in culture. Addition of 2′,3′-cAMP (3, 10, and 30 µM) to Schwann cells increased levels of 2′-AMP in the medium from 0.006 ± 0.002 to 21 ± 2, 70 ± 3, and 187 ± 10 nM/µg protein, respectively; in contrast, Schwann cells had little ability to convert 2′,3′-cAMP to 3′-AMP or 3′,5′-cAMP to either 3′-AMP or 5′-AMP. Although Schwann cells slightly converted 2′,3′-cAMP and 2′-AMP to adenosine, they did so at very modest rates (e.g., 5- and 3-fold, respectively, more slowly compared with our previously reported studies in oligodendrocytes). Using transected myelinated rat sciatic nerves in culture medium, we observed a time-related increase in endogenous intracellular 2′,3′-cAMP and extracellular 2′-AMP. These findings indicate that Schwann cells do not have a robust 3′,5′-cAMP–adenosine pathway but do have a 2′,3′-cAMP–adenosine pathway; however, because the pathway mostly involves 2′-AMP formation rather than 3′-AMP, and because the conversion of 2′-AMP to adenosine is slow, metabolism of 2′,3′-cAMP mostly results in the accumulation of 2′-AMP. Accumulation of 2′-AMP in peripheral nerves postinjury could have

  17. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  18. Effect of cholera toxin on cAMP levels and Na+ influx in isolated intestinal epithelial cells

    International Nuclear Information System (INIS)

    Hyun, C.S.; Kimmich, G.A.

    1982-01-01

    Freshly isolated chicken intestinal cells contain approximately 20 pmol adenosine 3',5'-cyclic monophosphate (cAMP)/mg cellular protein. Incubation with 3 μg/ml cholera toxin (CT) at 37 0 C induces an elevation of cellular cAMP beginning 10-15 min after initial exposure. The response is linear with time for 40-50 min and causes a six- to eightfold increase over control levels at steady state. Dibutyryl cAMP and agents that increase cAMP production inhibit Na + influx into the isolated enterocytes. Chlorpromazine completely abolishes the toxin-induced elevation of cAMP in the isolated cells and also reverses the effect on Na + entry. The data provide evidence for a cAMP-mediated control of intestinal cell Na + uptake, which may represent the mechanistic basis for the antiabsorptive effect of CT on Na + during induction of intestinal secretory activity. Studies on the time-dependent effects of chlorpromazine on both intracellular cAMP concentration and Na + influx suggest that the reactivation of the Na + transport system after cAMP-induced inhibition is slow relative to the disappearance of cAMP

  19. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  1. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  2. Warmer amps for the LHC

    CERN Multimedia

    Anaïs Schaeffer

    2012-01-01

    CERN is working together with an Italian company to develop superconducting cables that can function at temperatures of up to 25 K (-248°C). This will make it possible to move LHC magnet power supplies out of the tunnel, protecting them from exposure to the showers of very high-energy particles produced by the accelerator.   Figure 1: devices of this type, which measure approximately 10 metres in length, are inserted between the accelerating magnets at different points along the LHC. When it comes to consuming electricity, the magnets that steer particles through large accelerators can be characterised with just one word: greedy. For the LHC, the total current can reach 1.5 million amps. At the present time, this current is brought in via copper cables of up to 10 cm in diameter. In the tunnel, these cables connect the current leads - which provide the transition between the ambient-temperature cables and the magnets in their bath of superfluid helium - to the power supply. In the a...

  3. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  4. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  5. Understanding cAMP-dependent allostery by NMR spectroscopy: comparative analysis of the EPAC1 cAMP-binding domain in its apo and cAMP-bound states.

    Science.gov (United States)

    Mazhab-Jafari, Mohammad T; Das, Rahul; Fotheringham, Steven A; SilDas, Soumita; Chowdhury, Somenath; Melacini, Giuseppe

    2007-11-21

    cAMP (adenosine 3',5'-cyclic monophosphate) is a ubiquitous second messenger that activates a multitude of essential cellular responses. Two key receptors for cAMP in eukaryotes are protein kinase A (PKA) and the exchange protein directly activated by cAMP (EPAC), which is a recently discovered guanine nucleotide exchange factor (GEF) for the small GTPases Rap1 and Rap2. Previous attempts to investigate the mechanism of allosteric activation of eukaryotic cAMP-binding domains (CBDs) at atomic or residue resolution have been hampered by the instability of the apo form, which requires the use of mixed apo/holo systems, that have provided only a partial picture of the CBD apo state and of the allosteric networks controlled by cAMP. Here, we show that, unlike other eukaryotic CBDs, both apo and cAMP-bound states of the EPAC1 CBD are stable under our experimental conditions, providing a unique opportunity to define at an unprecedented level of detail the allosteric interactions linking two critical functional sites of this CBD. These are the phosphate binding cassette (PBC), where cAMP binds, and the N-terminal helical bundle (NTHB), which is the site of the inhibitory interactions between the regulatory and catalytic regions of EPAC. Specifically, the combined analysis of the cAMP-dependent changes in chemical shifts, 2 degrees structure probabilities, hydrogen/hydrogen exchange (H/H) and hydrogen/deuterium exchange (H/D) protection factors reveals that the long-range communication between the PBC and the NTHB is implemented by two distinct intramolecular cAMP-signaling pathways, respectively, mediated by the beta2-beta3 loop and the alpha6 helix. Docking of cAMP into the PBC perturbs the NTHB inner core packing and the helical probabilities of selected NTHB residues. The proposed model is consistent with the allosteric role previously hypothesized for L273 and F300 based on site-directed mutagenesis; however, our data show that such a contact is part of a

  6. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  7. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  8. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  9. 21 CFR 862.1230 - Cyclic AMP test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230....1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to measure the level of adenosine 3′, 5′-monophosphate (cyclic AMP) in plasma, urine, and other body fluids...

  10. 42 CFR 447.504 - Determination of AMP.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Determination of AMP. 447.504 Section 447.504... AMP. (a) AMP means, with respect to a covered outpatient drug of a manufacturer (including those sold... wholesalers for drugs distributed to the retail pharmacy class of trade. AMP shall be determined without...

  11. S-AMP for non-linear observation models

    DEFF Research Database (Denmark)

    Cakmak, Burak; Winther, Ole; Fleury, Bernard H.

    2015-01-01

    Recently we presented the S-AMP approach, an extension of approximate message passing (AMP), to be able to handle general invariant matrix ensembles. In this contribution we extend S-AMP to non-linear observation models. We obtain generalized AMP (GAMP) as the special case when the measurement...

  12. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  13. Increasing the flexibility of the LANCE cAMP detection kit.

    Science.gov (United States)

    Hunter, Morag Rose; Glass, Michelle

    2015-01-01

    The detection of cAMP signalling is a common endpoint in the study of G-protein coupled receptors. A number of commercially available kits enable easy detection of cAMP. These kits are based on competition for a cAMP binding site on an antibody or cAMP binding protein and as such have a limited dynamic range. Here, we describe the optimisation of the commercially-available LANCE cAMP detection kit (PerkinElmer) to enable detection in cell lysates. This kit has been designed for use with live cells, with detection reagents applied to cells without wash steps. The standard protocol therefore requires that all assay reagents are compatible with the antibody and the final fluorescent detection stage, limiting the range of assay media and test compounds that can be utilised. The entire experiment must be repeated if cAMP levels fall outside the limited dynamic range. Here we describe a modified protocol that enables the assay to be performed on cell lysates, thereby overcoming these limitations. In this modified protocol, cells are stimulated for a cAMP response in standard media/buffers, washed and then lysed. The cell lysate is then assayed using a modified protocol for the LANCE cAMP detection kit. Samples were tested for stability following a freeze-thaw cycle. The modified LANCE cAMP detection protocol gives a reproducible measurement of cAMP in cell lysate. Lysate samples remain stable when stored at -80°C. Separating the stimulation and detection phases of this cAMP assay allows a vast array of cell stimulation conditions to be tested. The lysate-modified protocol for the LANCE cAMP detection kit therefore increases the flexibility, versatility and convenience of the assay. As samples are insensitive to freeze-thaw, it enables retesting of samples under different dilution conditions to ensure that all samples remain within the dynamic range of the standard curve. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. PDE2A2 regulates mitochondria morphology and apoptotic cell death via local modulation of cAMP/PKA signalling.

    Science.gov (United States)

    Monterisi, Stefania; Lobo, Miguel J; Livie, Craig; Castle, John C; Weinberger, Michael; Baillie, George; Surdo, Nicoletta C; Musheshe, Nshunge; Stangherlin, Alessandra; Gottlieb, Eyal; Maizels, Rory; Bortolozzi, Mario; Micaroni, Massimo; Zaccolo, Manuela

    2017-05-02

    cAMP/PKA signalling is compartmentalised with tight spatial and temporal control of signal propagation underpinning specificity of response. The cAMP-degrading enzymes, phosphodiesterases (PDEs), localise to specific subcellular domains within which they control local cAMP levels and are key regulators of signal compartmentalisation. Several components of the cAMP/PKA cascade are located to different mitochondrial sub-compartments, suggesting the presence of multiple cAMP/PKA signalling domains within the organelle. The function and regulation of these domains remain largely unknown. Here, we describe a novel cAMP/PKA signalling domain localised at mitochondrial membranes and regulated by PDE2A2. Using pharmacological and genetic approaches combined with real-time FRET imaging and high resolution microscopy, we demonstrate that in rat cardiac myocytes and other cell types mitochondrial PDE2A2 regulates local cAMP levels and PKA-dependent phosphorylation of Drp1. We further demonstrate that inhibition of PDE2A, by enhancing the hormone-dependent cAMP response locally, affects mitochondria dynamics and protects from apoptotic cell death.

  15. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  16. Interaction of biodegradative threonine dehydratase (TD) of Escherichia coli with 8-azido-AMP, a photoaffinity analog of AMP

    International Nuclear Information System (INIS)

    Patil, R.V.; Datta, P.

    1987-01-01

    Stimulation of TD activity by AMP (Ka = 40 μM) is known to accompany the conversion of monomeric form of the enzyme to its tetramer and a decrease in the Km for threonine. In comparison, 8-azido-AMP (N 3 AMP) simulated TD activity only partially, lowered the Km for threonine and stabilized a dimeric form of the protein. Competition experiments revealed that N 3 AMP exerted an apparent dominant effect in counteracting the AMP-mediated enzyme activation, indicating complex mutual interactions between these ligands. UV irradiation of TD with increasing concentrations of 3 H-N 3 AMP (up to 150 μM) resulted in gradual loss of enzyme activity and concomitant incorporation of N 3 AMP into protein; upon complete inactivation, 0.75 mol of N 3 AMP was bound per mol tetramer. The presence of AMP during photolysis reduced the extent of enzyme inactivation as well as the incorporation of N 3 AMP into protein. Photolabeling of TD with 20 μM 3 H-N 3 AMP revealed one labeled tryptic peptide; at higher N 3 AMP concentrations (>300 μM), two labeled peptides were found, one of which was identical to that found with low N 3 AMP concentration. The cumulative results suggest that N 3 AMP can act as an allosteric modifier and that the peptide labeled at low N 3 AMP may represent the AMP binding site on the protein molecule

  17. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  18. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  19. Inducible cAMP early repressor acts as a negative regulator for kindling epileptogenesis and long-term fear memory.

    Science.gov (United States)

    Kojima, Nobuhiko; Borlikova, Gilyana; Sakamoto, Toshiro; Yamada, Kazuyuki; Ikeda, Toshio; Itohara, Shigeyoshi; Niki, Hiroaki; Endo, Shogo

    2008-06-18

    Long-lasting neuronal plasticity as well as long-term memory (LTM) requires de novo synthesis of proteins through dynamic regulation of gene expression. cAMP-responsive element (CRE)-mediated gene transcription occurs in an activity-dependent manner and plays a pivotal role in neuronal plasticity and LTM in a variety of species. To study the physiological role of inducible cAMP early repressor (ICER), a CRE-mediated gene transcription repressor, in neuronal plasticity and LTM, we generated two types of ICER mutant mice: ICER-overexpressing (OE) mice and ICER-specific knock-out (KO) mice. Both ICER-OE and ICER-KO mice show no apparent abnormalities in their development and reproduction. A comprehensive battery of behavioral tests revealed no robust changes in locomotor activity, sensory and motor functions, and emotional responses in the mutant mice. However, long-term conditioned fear memory was attenuated in ICER-OE mice and enhanced in ICER-KO mice without concurrent changes in short-term fear memory. Furthermore, ICER-OE mice exhibited retardation of kindling development, whereas ICER-KO mice exhibited acceleration of kindling. These results strongly suggest that ICER negatively regulates the neuronal processes required for long-term fear memory and neuronal plasticity underlying kindling epileptogenesis, possibly through suppression of CRE-mediated gene transcription.

  20. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  1. Preserved cardiac function despite marked impairment of cAMP generation.

    Directory of Open Access Journals (Sweden)

    Mei Hua Gao

    Full Text Available So many clinical trials of positive inotropes have failed, that it is now axiomatic that agents that increase cAMP are deleterious to the failing heart. An alternative strategy is to alter myocardial Ca(2+ handling or myofilament response to Ca(2+ using agents that do not affect cAMP. Although left ventricular (LV function is tightly linked to adenylyl cyclase (AC activity, the beneficial effects of AC may be independent of cAMP and instead stem from effects on Ca(2+ handling. Here we ask whether an AC mutant molecule that reduces LV cAMP production would have favorable effects on LV function through its effects on Ca(2+ handling alone.We generated transgenic mice with cardiac-directed expression of an AC6 mutant (AC6mut. Cardiac myocytes showed impaired cAMP production in response to isoproterenol (74% reduction; p<0.001, but LV size and function were normal. Isolated hearts showed preserved LV function in response to isoproterenol stimulation. AC6mut expression was associated with increased sarcoplasmic reticulum Ca(2+ uptake and the EC50 for SERCA2a activation was reduced. Cardiac myocytes isolated from AC6mut mice showed increased amplitude of Ca(2+ transients in response to isoproterenol (p = 0.0001. AC6mut expression also was associated with increased expression of LV S100A1 (p = 0.03 and reduced expression of phospholamban protein (p = 0.01.LV AC mutant expression is associated with normal cardiac function despite impaired cAMP generation. The mechanism appears to be through effects on Ca(2+ handling - effects that occur despite diminished cAMP.

  2. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  3. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  4. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  5. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  7. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  8. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  9. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  10. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  11. cAMP-dependent Protein Kinase (PKA) Signaling Is Impaired in the Diabetic Heart.

    Science.gov (United States)

    Bockus, Lee B; Humphries, Kenneth M

    2015-12-04

    Diabetes mellitus causes cardiac dysfunction and heart failure that is associated with metabolic abnormalities and autonomic impairment. Autonomic control of ventricular function occurs through regulation of cAMP-dependent protein kinase (PKA). The diabetic heart has suppressed β-adrenergic responsiveness, partly attributable to receptor changes, yet little is known about how PKA signaling is directly affected. Control and streptozotocin-induced diabetic mice were therefore administered 8-bromo-cAMP (8Br-cAMP) acutely to activate PKA in a receptor-independent manner, and cardiac hemodynamic function and PKA signaling were evaluated. In response to 8Br-cAMP treatment, diabetic mice had impaired inotropic and lusitropic responses, thus demonstrating postreceptor defects. This impaired signaling was mediated by reduced PKA activity and PKA catalytic subunit content in the cytoplasm and myofilaments. Compartment-specific loss of PKA was reflected by reduced phosphorylation of discrete substrates. In response to 8Br-cAMP treatment, the glycolytic activator PFK-2 was robustly phosphorylated in control animals but not diabetics. Control adult cardiomyocytes cultured in lipid-supplemented media developed similar changes in PKA signaling, suggesting that lipotoxicity is a contributor to diabetes-induced β-adrenergic signaling dysfunction. This work demonstrates that PKA signaling is impaired in diabetes and suggests that treating hyperlipidemia is vital for proper cardiac signaling and function. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. cAMP-dependent Protein Kinase (PKA) Signaling Is Impaired in the Diabetic Heart*

    Science.gov (United States)

    Bockus, Lee B.; Humphries, Kenneth M.

    2015-01-01

    Diabetes mellitus causes cardiac dysfunction and heart failure that is associated with metabolic abnormalities and autonomic impairment. Autonomic control of ventricular function occurs through regulation of cAMP-dependent protein kinase (PKA). The diabetic heart has suppressed β-adrenergic responsiveness, partly attributable to receptor changes, yet little is known about how PKA signaling is directly affected. Control and streptozotocin-induced diabetic mice were therefore administered 8-bromo-cAMP (8Br-cAMP) acutely to activate PKA in a receptor-independent manner, and cardiac hemodynamic function and PKA signaling were evaluated. In response to 8Br-cAMP treatment, diabetic mice had impaired inotropic and lusitropic responses, thus demonstrating postreceptor defects. This impaired signaling was mediated by reduced PKA activity and PKA catalytic subunit content in the cytoplasm and myofilaments. Compartment-specific loss of PKA was reflected by reduced phosphorylation of discrete substrates. In response to 8Br-cAMP treatment, the glycolytic activator PFK-2 was robustly phosphorylated in control animals but not diabetics. Control adult cardiomyocytes cultured in lipid-supplemented media developed similar changes in PKA signaling, suggesting that lipotoxicity is a contributor to diabetes-induced β-adrenergic signaling dysfunction. This work demonstrates that PKA signaling is impaired in diabetes and suggests that treating hyperlipidemia is vital for proper cardiac signaling and function. PMID:26468277

  13. Proliferation kinetics and cyclic AMP as prognostic factors in adult acute leukemia.

    Science.gov (United States)

    Paietta, E; Mittermayer, K; Schwarzmeier, J

    1980-07-01

    In 41 adult patients with acute leukemia (myeloblastic, lymphoblastic, and undifferentiated), proliferation kinetics (as determined by double-label autoradiography) and cyclic adenosine 3',5'-monophosphate (cAMP) concentration were studied for their significance in the prediction of responsiveness to cytostatic therapy. Patients with good clinical response had significantly shorter turnover times and higher labeling indices in the bone marrow than did those who failed to respond to treatment. Cases for which cell kinetics did not correlate with clinical response were explained by variance in the distribution of leukemic blasts between the proliferative cell cycle and the resting pool. Good clinical response was also found to be associated with low levels of cAMP in leukemic cells prior to therapy, whereas high cAMP contents predicted failure. Low cAMP concentrations, however, did not necessarily correlate with short turnover times and vice versa. This might be due to fluctuations of the cAMP concentrations during the cell cycle.

  14. Decoding spatial and temporal features of neuronal cAMP/PKA signaling with FRET biosensors.

    Science.gov (United States)

    Castro, Liliana R V; Guiot, Elvire; Polito, Marina; Paupardin-Tritsch, Daniéle; Vincent, Pierre

    2014-02-01

    Cyclic adenosine monophosphate (cAMP) and the cyclic-AMP-dependent protein kinase (PKA) regulate a plethora of cellular functions in virtually all eukaryotic cells. In neurons, the cAMP/PKA signaling cascade controls a number of biological properties such as axonal growth, pathfinding, efficacy of synaptic transmission, regulation of excitability, or long term changes. Genetically encoded optical biosensors for cAMP or PKA are considerably improving our understanding of these processes by providing a real-time measurement in living neurons. In this review, we describe the recent progress made in the creation of biosensors for cAMP or PKA activity. These biosensors revealed profound differences in the amplitude of the cAMP signal evoked by neuromodulators between various neuronal preparations. These responses can be resolved at the level of individual neurons, also revealing differences related to the neuronal type. At the sub-cellular level, biosensors reported different signal dynamics in domains like dendrites, cell body, nucleus, and axon. Combining this imaging approach with pharmacology or genetic models points at phosphodiesterases and phosphatases as critical regulatory proteins. Biosensor imaging will certainly emerge as a forefront tool to decipher the subtle mechanics of intracellular signaling. This will certainly help us to understand the mechanism of action of current drugs and foster the development of novel molecules for neuropsychiatric diseases. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Down-regulation of Cell Surface Cyclic AMP Receptors and Desensitization of Cyclic AMP-stimulated Adenylate Cyclase by Cyclic AMP in Dictyostelium discoideum. Kinetics and Concentration Dependence

    NARCIS (Netherlands)

    Haastert, Peter J.M. van

    1987-01-01

    cAMP binds to Dictyostelium discoideum surface receptors and induces a transient activation of adenylate cyclase, which is followed by desensitization. cAMP also induces a loss of detectable surface receptors (down-regulation). Cells were incubated with constant cAMP concentrations, washed free of

  16. AMP Affects Intracellular Ca2+ Signaling, Migration, Cytokine Secretion and T Cell Priming Capacity of Dendritic Cells

    Science.gov (United States)

    Panther, Elisabeth; Dürk, Thorsten; Ferrari, Davide; Di Virgilio, Francesco; Grimm, Melanie; Sorichter, Stephan; Cicko, Sanja; Herouy, Yared; Norgauer, Johannes; Idzko, Marco; Müller, Tobias

    2012-01-01

    The nucleotide adenosine-5′-monophosphate (AMP) can be released by various cell types and has been shown to elicit different cellular responses. In the extracellular space AMP is dephosphorylated to the nucleoside adenosine which can then bind to adenosine receptors. However, it has been shown that AMP can also activate A1 and A2a receptors directly. Here we show that AMP is a potent modulator of mouse and human dendritic cell (DC) function. AMP increased intracellular Ca2+ concentration in a time and dose dependent manner. Furthermore, AMP stimulated actin-polymerization in human DCs and induced migration of immature human and bone marrow derived mouse DCs, both via direct activation of A1 receptors. AMP strongly inhibited secretion of TNF-α and IL-12p70, while it enhanced production of IL-10 both via activation of A2a receptors. Consequently, DCs matured in the presence of AMP and co-cultivated with naive CD4+CD45RA+ T cells inhibited IFN-γ production whereas secretion of IL-5 and IL-13 was up-regulated. An enhancement of Th2-driven immune response could also be observed when OVA-pulsed murine DCs were pretreated with AMP prior to co-culture with OVA-transgenic naïve OTII T cells. An effect due to the enzymatic degradation of AMP to adenosine could be ruled out, as AMP still elicited migration and changes in cytokine secretion in bone-marrow derived DCs generated from CD73-deficient animals and in human DCs pretreated with the ecto-nucleotidase inhibitor 5′-(alpha,beta-methylene) diphosphate (APCP). Finally, the influence of contaminating adenosine could be excluded, as AMP admixed with adenosine desaminase (ADA) was still able to influence DC function. In summary our data show that AMP when present during maturation is a potent regulator of dendritic cell function and point out the role for AMP in the pathogenesis of inflammatory disorders. PMID:22624049

  17. DREAM mediates cAMP-dependent, Ca2+-induced stimulation of GFAP gene expression and regulates cortical astrogliogenesis.

    Science.gov (United States)

    Cebolla, Beatriz; Fernández-Pérez, Antonio; Perea, Gertrudis; Araque, Alfonso; Vallejo, Mario

    2008-06-25

    In the developing mouse brain, once the generation of neurons is mostly completed during the prenatal period, precisely coordinated signals act on competent neural precursors to direct their differentiation into astrocytes, which occurs mostly after birth. Among these signals, those provided by neurotrophic cytokines and bone morphogenetic proteins appear to have a key role in triggering the neurogenic to gliogenic switch and in regulating astrocyte numbers. In addition, we have reported previously that the neurotrophic peptide pituitary adenylate cyclase-activating polypeptide (PACAP) is able to promote astrocyte differentiation of cortical precursors via activation of a cAMP-dependent pathway. Signals acting on progenitor cells of the developing cortex to generate astrocytes activate glial fibrillary acidic protein (GFAP) gene expression, but the transcriptional mechanisms that regulate this activation are unclear. Here, we identify the previously known transcriptional repressor downstream regulatory element antagonist modulator (DREAM) as an activator of GFAP gene expression. We found that DREAM occupies specific sites on the GFAP promoter before and after differentiation is initiated by exposure of cortical progenitor cells to PACAP. PACAP raises intracellular calcium concentration via a mechanism that requires cAMP, and DREAM-mediated transactivation of the GFAP gene requires the integrity of calcium-binding domains. Cortical progenitor cells from dream(-/-) mice fail to express GFAP in response to PACAP. Moreover, the neonatal cortex of dream(-/-) mice exhibits a reduced number of astrocytes and increased number of neurons. These results identify the PACAP-cAMP-Ca(2+)-DREAM cascade as a new pathway to activate GFAP gene expression during astrocyte differentiation.

  18. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  19. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  20. Involvement of Phosphorylated "Apis Mellifera" CREB in Gating a Honeybee's Behavioral Response to an External Stimulus

    Science.gov (United States)

    Gehring, Katrin B.; Heufelder, Karin; Feige, Janina; Bauer, Paul; Dyck, Yan; Ehrhardt, Lea; Kühnemund, Johannes; Bergmann, Anja; Göbel, Josefine; Isecke, Marlene; Eisenhardt, Dorothea

    2016-01-01

    The transcription factor cAMP-response element-binding protein (CREB) is involved in neuronal plasticity. Phosphorylation activates CREB and an increased level of phosphorylated CREB is regarded as an indicator of CREB-dependent transcriptional activation. In honeybees ("Apis mellifera") we recently demonstrated a particular high…

  1. Functional desensitization to isoproterenol without reducing cAMP production in canine failing cardiocytes.

    Science.gov (United States)

    Laurent, C E; Cardinal, R; Rousseau, G; Vermeulen, M; Bouchard, C; Wilkinson, M; Armour, J A; Bouvier, M

    2001-02-01

    To corroborate alterations in the functional responses to beta-adrenergic receptor (beta-AR) stimulation with changes in beta-AR signaling in failing cardiomyocytes, contractile and L-type Ca(2+) current responses to isoproterenol along with stimulated cAMP generation were compared among cardiomyocytes isolated from canines with tachycardia-induced heart failure or healthy hearts. The magnitude of shortening of failing cardiomyocytes was significantly depressed (by 22 +/- 4.4%) under basal conditions, and the maximal response to isoproterenol was significantly reduced (by 45 +/- 18%). Similar results were obtained when the responses in the rate of contraction and rate of relaxation to isoproterenol were considered. The L-type Ca(2+) current amplitude measured in failing cardiomyocytes under basal conditions was unchanged, but the responses to isoproterenol were significantly reduced compared with healthy cells. Isoproterenol-stimulated cAMP generation was similar in sarcolemmal membranes derived from the homogenates of failing (45 +/- 6.8) and healthy cardiomyocytes (52 +/- 8.5 pmol cAMP. mg protein(-1). min(-1)). However, stimulated cAMP generation was found to be significantly reduced when the membranes were derived from the homogenates of whole tissue (failing: 67 +/- 8.1 vs. healthy: 140 +/- 27.8 pmol cAMP. mg protein(-1). min(-1)). Total beta-AR density was not reduced in membranes derived from either whole tissue or isolated cardiomyocyte homogenates, but the beta(1)/beta(2) ratio was significantly reduced in the former (failing: 45/55 vs. healthy: 72/28) without being altered in the latter (failing: 72/28, healthy: 77/23). We thus conclude that, in tachycardia-induced heart failure, reduction in the functional responses of isolated cardiomyocytes to beta-AR stimulation may be attributed to alterations in the excitation-contraction machinery rather than to limitation of cAMP generation.

  2. Modulation of cAMP levels by high-fat diet and curcumin and regulatory effects on CD36/FAT scavenger receptor/fatty acids transporter gene expression.

    Science.gov (United States)

    Zingg, Jean-Marc; Hasan, Syeda T; Nakagawa, Kiyotaka; Canepa, Elisa; Ricciarelli, Roberta; Villacorta, Luis; Azzi, Angelo; Meydani, Mohsen

    2017-01-02

    Curcumin, a polyphenol from turmeric (Curcuma longa), reduces inflammation, atherosclerosis, and obesity in several animal studies. In Ldlr -/- mice fed a high-fat diet (HFD), curcumin reduces plasma lipid levels, therefore contributing to a lower accumulation of lipids and to reduced expression of fatty acid transport proteins (CD36/FAT, FABP4/aP2) in peritoneal macrophages. In this study, we analyzed the molecular mechanisms by which curcumin (500, 1000, 1500 mg/kg diet, for 4 months) may influence plasma and tissue lipid levels in Ldlr -/- mice fed an HFD. In liver, HFD significantly suppressed cAMP levels, and curcumin restored almost normal levels. Similar trends were observed in adipose tissues, but not in brain, skeletal muscle, spleen, and kidney. Treatment with curcumin increased phosphorylation of CREB in liver, what may play a role in regulatory effects of curcumin in lipid homeostasis. In cell lines, curcumin increased the level of cAMP, activated the transcription factor CREB and the human CD36 promoter via a sequence containing a consensus CREB response element. Regulatory effects of HFD and Cur on gene expression were observed in liver, less in skeletal muscle and not in brain. Since the cAMP/protein kinase A (PKA)/CREB pathway plays an important role in lipid homeostasis, energy expenditure, and thermogenesis by increasing lipolysis and fatty acid β-oxidation, an increase in cAMP levels induced by curcumin may contribute to its hypolipidemic and anti-atherosclerotic effects. © 2016 BioFactors, 43(1):42-53, 2017. © 2016 International Union of Biochemistry and Molecular Biology.

  3. cAMP/PKA-CREB-BDNF signaling pathway in hippocampus mediates cyclooxygenase 2-induced learning/memory deficits of rats subjected to chronic unpredictable mild stress.

    Science.gov (United States)

    Luo, Ying; Kuang, Shengnan; Li, Huan; Ran, Dongzhi; Yang, Junqing

    2017-05-30

    To investigate the mechanism of cyclooxygenase 2 (COX2) in learning and memory impairments in rats subjected to chronic unpredictable mild stress (CUMS), meloxicam was used intragastrically to inhibit the activity of cyclooxygenase 2. Moreover, cyclooxygenase 2 over-expressing or RNA interfere lentivirus was injected intraventricularly to increase or decrease the enzyme's expression, respectively. The body weights and sucrose consumption were used to analyze depressive behaviors, while the Morris water maze and step-down-type passive avoidance tests were carried out to evaluate the learning-memory functions. The levels of inflammatory cytokines were measured to estimate inflammation and the contents of cyclic adenosine monophosphate (cAMP) were used to measure the levels of the second messenger. Changes in cyclooxygenase 2 mRNA levels were analyzed using reverse transcription polymerase chain reaction. Moreover, the expression of cyclooxygenase 2, brain-derived neurotrophic factor (BDNF), prostaglandins receptor 3 (EP3), protein kinase A (PKA), cAMP response element binding protein (CREB), and phosphorylated CREB were estimated using immunohistochemical staining or western blotting. The results showed that CUMS led to significant depressive-like behaviors and learning and memory dysfunctions. Also, the cAMP levels decreased significantly, while levels of inflammatory cytokines and prostaglandins E2 increased significantly. The expressions of PKA, BDNF, phosphorylated CREB/CREB declined and cyclooxygenase 2 was increased. Meloxicam and cyclooxygenase 2 RNA interfere lentivirus reversed the changes caused by CUMS while cyclooxygenase 2-overexpressing lentivirus worsened these abnormalities. The findings also showed that CUMS increased cyclooxygenase 2 expression, which can cause learning and memory impairments, mainly through activating the hippocampal neuronal cAMP/PKA-CREB-BDNF signaling pathways.

  4. Anxiety and depression with neurogenesis defects in exchange protein directly activated by cAMP 2-deficient mice are ameliorated by a selective serotonin reuptake inhibitor, Prozac

    Science.gov (United States)

    Zhou, L; Ma, S L; Yeung, P K K; Wong, Y H; Tsim, K W K; So, K F; Lam, L C W; Chung, S K

    2016-01-01

    Intracellular cAMP and serotonin are important modulators of anxiety and depression. Fluoxetine, a selective serotonin reuptake inhibitor (SSRI) also known as Prozac, is widely used against depression, potentially by activating cAMP response element-binding protein (CREB) and increasing brain-derived neurotrophic factor (BDNF) through protein kinase A (PKA). However, the role of Epac1 and Epac2 (Rap guanine nucleotide exchange factors, RAPGEF3 and RAPGEF4, respectively) as potential downstream targets of SSRI/cAMP in mood regulations is not yet clear. Here, we investigated the phenotypes of Epac1 (Epac1−/−) or Epac2 (Epac2−/−) knockout mice by comparing them with their wild-type counterparts. Surprisingly, Epac2−/− mice exhibited a wide range of mood disorders, including anxiety and depression with learning and memory deficits in contextual and cued fear-conditioning tests without affecting Epac1 expression or PKA activity. Interestingly, rs17746510, one of the three single-nucleotide polymorphisms (SNPs) in RAPGEF4 associated with cognitive decline in Chinese Alzheimer's disease (AD) patients, was significantly correlated with apathy and mood disturbance, whereas no significant association was observed between RAPGEF3 SNPs and the risk of AD or neuropsychiatric inventory scores. To further determine the detailed role of Epac2 in SSRI/serotonin/cAMP-involved mood disorders, we treated Epac2−/− mice with a SSRI, Prozac. The alteration in open field behavior and impaired hippocampal cell proliferation in Epac2−/− mice were alleviated by Prozac. Taken together, Epac2 gene polymorphism is a putative risk factor for mood disorders in AD patients in part by affecting the hippocampal neurogenesis. PMID:27598965

  5. Endogenous Parathyroid Hormone Promotes Fracture Healing by Increasing Expression of BMPR2 through cAMP/PKA/CREB Pathway in Mice

    Directory of Open Access Journals (Sweden)

    Wei Zhou

    2017-06-01

    Full Text Available Background/Aims: Endogenous parathyroid hormone (PTH plays an important role in fracture healing. This study investigated whether endogenous PTH regulates fracture healing by bone morphogenetic protein (BMP and/or the transforming growth factor-β (TGF-β signaling pathway. Methods: Eight-week-old wild-type (WT and PTH-knockout (PTH KO male mice were selected, and models of open right-femoral fracture were constructed. Fracture healing and callus characteristics of mice in the two groups were compared by X-ray, micro-computed tomography, histological, and immunohistochemical examinations. Bone marrow mesenchymal stem cells (BMMSCs of 8-week-old WT and PTHKO male mice were obtained and induced into osteoblasts and chondrocytes. Results: We found that expression levels of Runt-related transcription factor (RUNX2, bone morphogenetic protein-receptor-type Ⅱ (BMPR2, phosphorylated Smad 1/5/8, and phosphorylated cyclic adenosine monophosphate-responsive element binding protein (CREB in the callus of PTHKO mice were significantly decreased, whereas no significant difference in expression of SOX9, TGF-βR2,or pSMAD2/3 was observed between PTHKO and WT mice. Additionally, the activity of osteoblast alkaline phosphatase was low at 7 days post-induction, and was upregulated by addition of PTH or dibutyryl cyclic adenosine monophosphate (dbcAMP to the cell culture. Furthermore, H89 (protein kinase A inhibitoreliminated the simulating effects of PTH and dbcAMP, and a low concentration of cyclic adenosine monophosphate (cAMP was observed in PTHKO mouse BMMSCs. Conclusion: These results suggested that endogenous PTH enhanced BMPR2 expression by a cAMP/PKA/CREB pathway in osteoblasts, and increased RUNX2 expression through transduction of the BMP/pSMAD1/5/8 signaling pathway.

  6. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  7. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  8. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  9. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  10. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  11. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  12. Isolation and characterization of cAMP-free and cAMP-bound forms of bovine heart type II cAMP-dependent protein kinase

    International Nuclear Information System (INIS)

    Cobb, C.E.

    1986-01-01

    Bovine heart type II cAMP-dependent protein kinase holoenzyme (cAMP-PK) was purified to homogeneity as determined by denaturing SDS-PAGE. An HPLC-DEAE purification step resolved two distinct peaks of cAMP-dependent kinase activity, which were designated Peak 1 and Peak 2 based on their order of elution. They had the same Stoke's radii and had very similar sedimentation coefficients. As determined by densitometric scanning of SDS-PAGE brands, by their mobility on denaturing PAGE, and by the ratios of equilibrium [ 3 H] cAMP binding to maximal kinase activity, the subunit stoichiometry of the two peaks was the same. In a cAMP assay it was found that Peak 1 holoenzyme was cAMP-free, but half of the Peak 2 holoenzyme cAMP binding sites contained cAMP. Dissociation assays indicated that the cAMP was equally distributed in binding Site 1 and Site 2 of Peak 2. Although SDS-PAGE analysis ruled out conversions by proteolysis or autophosphorylation-dephosphorylation, Peak 1 could be partially converted to Peak 2 by the addition of subsaturating amounts of cAMP, and Peak 2 could be partially converted to Peak 1 by aging. The interconvertibility of the two holoenzyme peaks strongly suggested that the difference between the two peaks was caused by the presence of cAMP in Peak 2

  13. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  14. Regulation of cyclic AMP by extracellular ATP in cultured brain capillary endothelial cells

    Science.gov (United States)

    Anwar, Zubeya; Albert, Jennifer L; Gubby, Sharon E; Boyle, John P; Roberts, Jonathon A; Webb, Tania E; Boarder, Michael R

    1999-01-01

    In primary unpassaged rat brain capillary endothelial cell cultures (RBECs), using reverse-transcriptase PCR with primers specific for P2Y receptor subtypes, we detected mRNA for P2Y2, P2Y4 and P2Y6, but not P2Y1 receptors.None of the various nucleotides tested reduced forskolin elevated cyclic AMP levels in RBECs. ATP and ATPγS, as well as adenosine, enhanced cyclic AMP accumulation in the presence of forskolin.Comparison of the concentration response curves to ATPγS with those for ATP and adenosine, at different incubation times, indicated that the response to purine nucleotides was not wholly dependent on conversion to adenosine. Adenosine deaminase abolished the response to adenosine but only reduced the response to ATP by about 50%. These results suggest the participation of a receptor responsive to nucleotides.Isobutylmethylxanthine and 8-sulphophenyltheophylline prevented the cyclic AMP response, while neither 8-cyclopentyl-1,3-dipropylxanthine nor SCH58261 were effective antagonists. 2-chloradenosine gave a robust response, but neither 2-chloro-N6-cyclopentyladenosine nor CGS 21680 were agonists.These results show that adenosine and ATP can elevate the cyclic AMP levels of brain endothelial cells by acting on receptors which have a pharmacology apparently distinct from known P2Y and adenosine receptors. PMID:10510459

  15. Cyclic GMP-AMP displays mucosal adjuvant activity in mice.

    Directory of Open Access Journals (Sweden)

    Ivana Škrnjug

    Full Text Available The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity--a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines.

  16. Cyclic GMP-AMP displays mucosal adjuvant activity in mice.

    Science.gov (United States)

    Škrnjug, Ivana; Guzmán, Carlos Alberto; Rueckert, Christine; Ruecker, Christine

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity--a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines.

  17. Dietary α-lactalbumin induced fatty liver by enhancing nuclear liver X receptor αβ/sterol regulatory element-binding protein-1c/PPARγ expression and minimising PPARα/carnitine palmitoyltransferase-1 expression and AMP-activated protein kinase α phosphorylation associated with atherogenic dyslipidaemia, insulin resistance and oxidative stress in Balb/c mice.

    Science.gov (United States)

    López-Oliva, María Elvira; Garcimartin, Alba; Muñoz-Martínez, Emilia

    2017-12-01

    The effect and the role played by dietary α-lactalbumin (α-LAC) on hepatic fat metabolism are yet to be fully elucidated. We reported previously that α-LAC intake induced atherogenic dyslipidaemia in Balb/c mice. The aim of the present study was to investigate if this atherogenic effect could be due to a possible α-LAC-induced hepatic steatosis. We examine the ability of dietary α-LAC to induce liver steatosis, identifying the molecular mechanisms underlying hepatic lipid metabolism in association with the lipid profile, peripheral insulin resistance (IR) and changes in the hepatic oxidative environment. Male Balb/c mice (n 6) were fed with diets containing either chow or 14 % α-LAC for 4 weeks. The α-LAC-fed mice developed abdominal adiposity and IR. Moderate liver steatosis with increased TAG and NEFA contents was correlated with atherogenic dyslipidaemia. There was increased nuclear expression of liver X receptor αβ (LXRαβ), sterol regulatory element-binding protein-1c (SREBP-1c) and PPARγ transcription factors and of the cytosolic enzymes acetyl-CoA carboxylase 1 (ACC1) and fatty acid synthase involved in the hepatic de novo lipogenesis. The opposite was found for the nuclear receptor PPARα and the mitochondrial enzyme carnitine palmitoyltransferase-1 (CPT-1), leading to reduced fatty acid β-oxidation (FAO). These changes were associated with a significant decrease in both p-Thr172-AMP-activated protein kinase α (AMPKα) (inactivation) and p-Ser79-ACC1 (activation) and with a more oxidative liver environment increasing lipid peroxidation and protein oxidation and reducing GSH:GSSG ratio in the α-LAC-fed mice. In conclusion, 4 weeks of 14 % α-LAC feeding induced liver steatosis associated with atherogenic dyslipidaemia, IR and oxidative stress by enhancing nuclear LXRαβ/SREBP-1c/PPARγ expression and diminishing PPARα/CPT-1 expression and AMPKα phosphorylation shifting the hepatic FAO toward fatty acid synthesis in Balb/c mice.

  18. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  19. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  20. MAST: a Mega Amp Spherical Tokamak

    International Nuclear Information System (INIS)

    Darke, A.C.; Harbar, J.R.; Hay, J.H.; Hicks, J.B.; Hill, J.W.; McKenzie, J.S.; Morris, A.W.; Nightingale, M.P.S.; Todd, T.N.; Voss, G.M.; Watkins, J.R.

    1995-01-01

    The highly successful tight aspect ratio tokamak research pioneered on the START machine at Culham, together with the attractive possibilities of the concept, suggest a larger device should be considered. The design of a Mega Amp Spherical Tokamak is described, operating at much higher currents and over longer pulses than START and compatible with strong additional heating. (orig.)

  1. NIKHEF: AmPS of electron beam

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Now operational at the Dutch National Institute for Nuclear Physics and High Energy Physics (NIKHEF), Amsterdam, is a new tool for studying the electromagnetic properties of nuclei. Called AmPS - Amsterdam pulse stretcher - this ring provides experiments with a smoother, almost continuous supply of electrons

  2. Requirement of cAMP signaling for Schwann cell differentiation restricts the onset of myelination.

    Directory of Open Access Journals (Sweden)

    Ketty Bacallao

    Full Text Available Isolated Schwann cells (SCs respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1. To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC agonists and antagonists revealed that selective transmembrane AC (tmAC activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC, a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the

  3. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  4. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  6. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  7. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  8. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  9. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  10. 7 CFR 772.14 - Reamortization of AMP loans.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity date...

  11. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  12. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    Science.gov (United States)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  13. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  14. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  15. Early effects of synthetic bovine parathyroid hormone and synthetic salmon calcitonin on urinary excretion of cyclic AMP, phosphate and calcium in man.

    Science.gov (United States)

    Caniggia, A; Gennari, C; Vattimo, A; Nardi, P; Nuti, R; Galli, M

    1976-04-20

    Bovine synthetic parathyroid hormone infused intravenously in man increased both the urinary excretion of cyclic AMP and the urinary excretion of phosphate whereas a Salmon synthetic calcitonin infusion increased the urinary excretion of phosphate without change in urinary excretion of cyclic AMP. These data are consistent with the hypothesis that different renal mechanisms are involved in the response to each hormone.

  16. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  17. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  18. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  19. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  20. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  1. Characterisation of endogenous A2A and A2B receptor-mediated cyclic AMP responses in HEK 293 cells using the GloSensor™ biosensor: Evidence for an allosteric mechanism of action for the A2B-selective antagonist PSB 603.

    Science.gov (United States)

    Goulding, Joelle; May, Lauren T; Hill, Stephen J

    2018-01-01

    Endogenous adenosine A 2B receptors (A 2B AR) mediate cAMP accumulation in HEK 293 cells. Here we have used a biosensor to investigate the mechanism of action of the A 2B AR antagonist PSB 603 in HEK 293 cells. The A 2A agonist CGS 21680 elicited a small response in these cells (circa 20% of that obtained with NECA), suggesting that they also contain a small population of A 2A receptors. The responses to NECA and adenosine were antagonised by PSB 603, but not by the selective A 2A AR antagonist SCH 58261. In contrast, CGS 21680 responses were not antagonised by high concentrations of PSB 603, but were sensitive to inhibition by SCH 58261. Analysis of the effect of increasing concentrations of PSB 603 on the response to NECA indicated a non-competitive mode of action yielding a marked reduction in the NECA E MAX with no significant effect on EC 50 values. Kinetics analysis of the effect of PSB 603 on the A 2B AR-mediated NECA responses confirmed a saturable effect that was consistent with an allosteric mode of antagonism. The possibility that PSB 603 acts as a negative allosteric modulator of A 2B AR suggests new approaches to the development of therapeutic agents to treat conditions where adenosine levels are high. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  3. cAMP signaling in skeletal muscle adaptation: hypertrophy, metabolism, and regeneration

    Science.gov (United States)

    Stewart, Randi

    2012-01-01

    Among organ systems, skeletal muscle is perhaps the most structurally specialized. The remarkable subcellular architecture of this tissue allows it to empower movement with instructions from motor neurons. Despite this high degree of specialization, skeletal muscle also has intrinsic signaling mechanisms that allow adaptation to long-term changes in demand and regeneration after acute damage. The second messenger adenosine 3′,5′-monophosphate (cAMP) not only elicits acute changes within myofibers during exercise but also contributes to myofiber size and metabolic phenotype in the long term. Strikingly, sustained activation of cAMP signaling leads to pronounced hypertrophic responses in skeletal myofibers through largely elusive molecular mechanisms. These pathways can promote hypertrophy and combat atrophy in animal models of disorders including muscular dystrophy, age-related atrophy, denervation injury, disuse atrophy, cancer cachexia, and sepsis. cAMP also participates in muscle development and regeneration mediated by muscle precursor cells; thus, downstream signaling pathways may potentially be harnessed to promote muscle regeneration in patients with acute damage or muscular dystrophy. In this review, we summarize studies implicating cAMP signaling in skeletal muscle adaptation. We also highlight ligands that induce cAMP signaling and downstream effectors that are promising pharmacological targets. PMID:22354781

  4. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    Science.gov (United States)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  5. Adenylate Kinase and AMP Signaling Networks: Metabolic Monitoring, Signal Communication and Body Energy Sensing

    Directory of Open Access Journals (Sweden)

    Andre Terzic

    2009-04-01

    Full Text Available Adenylate kinase and downstream AMP signaling is an integrated metabolic monitoring system which reads the cellular energy state in order to tune and report signals to metabolic sensors. A network of adenylate kinase isoforms (AK1-AK7 are distributed throughout intracellular compartments, interstitial space and body fluids to regulate energetic and metabolic signaling circuits, securing efficient cell energy economy, signal communication and stress response. The dynamics of adenylate kinase-catalyzed phosphotransfer regulates multiple intracellular and extracellular energy-dependent and nucleotide signaling processes, including excitation-contraction coupling, hormone secretion, cell and ciliary motility, nuclear transport, energetics of cell cycle, DNA synthesis and repair, and developmental programming. Metabolomic analyses indicate that cellular, interstitial and blood AMP levels are potential metabolic signals associated with vital functions including body energy sensing, sleep, hibernation and food intake. Either low or excess AMP signaling has been linked to human disease such as diabetes, obesity and hypertrophic cardiomyopathy. Recent studies indicate that derangements in adenylate kinase-mediated energetic signaling due to mutations in AK1, AK2 or AK7 isoforms are associated with hemolytic anemia, reticular dysgenesis and ciliary dyskinesia. Moreover, hormonal, food and antidiabetic drug actions are frequently coupled to alterations of cellular AMP levels and associated signaling. Thus, by monitoring energy state and generating and distributing AMP metabolic signals adenylate kinase represents a unique hub within the cellular homeostatic network.

  6. Cyclic AMP-receptor protein activates aerobactin receptor IutA expression in Vibrio vulnificus.

    Science.gov (United States)

    Kim, Choon-Mee; Kim, Seong-Jung; Shin, Sung-Heui

    2012-04-01

    The ferrophilic bacterium Vibrio vulnificus can utilize the siderophore aerobactin of Escherichia coli for iron acquisition via its specific receptor IutA. This siderophore piracy by V. vulnificus may contribute to its survival and proliferation, especially in mixed bacterial environments. In this study, we examined the effects of glucose, cyclic AMP (cAMP), and cAMP-receptor protein (Crp) on iutA expression in V. vulnificus. Glucose dose-dependently repressed iutA expression. A mutation in cya encoding adenylate cyclase required for cAMP synthesis severely repressed iutA expression, and this change was recovered by in trans complementing cya or the addition of exogenous cAMP. Furthermore, a mutation in crp encoding Crp severely repressed iutA expression, and this change was recovered by complementing crp. Accordingly, glucose deprivation under iron-limited conditions is an environmental signal for iutA expression, and Crp functions as an activator that regulates iutA expression in response to glucose availability.

  7. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  8. Release from Xenopus oocyte prophase I meiotic arrest is independent of a decrease in cAMP levels or PKA activity.

    Science.gov (United States)

    Nader, Nancy; Courjaret, Raphael; Dib, Maya; Kulkarni, Rashmi P; Machaca, Khaled

    2016-06-01

    Vertebrate oocytes arrest at prophase of meiosis I as a result of high levels of cyclic adenosine monophosphate (cAMP) and protein kinase A (PKA) activity. In Xenopus, progesterone is believed to release meiotic arrest by inhibiting adenylate cyclase, lowering cAMP levels and repressing PKA. However, the exact timing and extent of the cAMP decrease is unclear, with conflicting reports in the literature. Using various in vivo reporters for cAMP and PKA at the single-cell level in real time, we fail to detect any significant changes in cAMP or PKA in response to progesterone. More interestingly, there was no correlation between the levels of PKA inhibition and the release of meiotic arrest. Furthermore, we devised conditions whereby meiotic arrest could be released in the presence of sustained high levels of cAMP. Consistently, lowering endogenous cAMP levels by >65% for prolonged time periods failed to induce spontaneous maturation. These results argue that the release of oocyte meiotic arrest in Xenopus is independent of a reduction in either cAMP levels or PKA activity, but rather proceeds through a parallel cAMP/PKA-independent pathway. © 2016. Published by The Company of Biologists Ltd.

  9. S-AMP: Approximate Message Passing for General Matrix Ensembles

    DEFF Research Database (Denmark)

    Cakmak, Burak; Winther, Ole; Fleury, Bernard H.

    2014-01-01

    the approximate message-passing (AMP) algorithm to general matrix ensembles with a well-defined large system size limit. The generalization is based on the S-transform (in free probability) of the spectrum of the measurement matrix. Furthermore, we show that the optimality of S-AMP follows directly from its......We propose a novel iterative estimation algorithm for linear observation models called S-AMP. The fixed points of S-AMP are the stationary points of the exact Gibbs free energy under a set of (first- and second-) moment consistency constraints in the large system limit. S-AMP extends...

  10. Angiotensin II potentiates prostaglandin stimulation of cyclic AMP levels in intact bovine adrenal medulla cells but not adenylate cyclase in permeabilized cells.

    Science.gov (United States)

    Boarder, M R; Plevin, R; Marriott, D B

    1988-10-25

    The level of cyclic AMP in primary cultures of bovine adrenal medulla cells is elevated by prostaglandin E1. Angiotensin II is commonly reported to act on receptors linked to phosphoinositide metabolism or to inhibition of adenylate cyclase. We have investigated the effect of angiotensin II on prostaglandin E1-stimulated cyclic AMP levels in these primary cultures. Rather than reducing cyclic AMP levels, we have found that angiotensin II powerfully potentiates prostaglandin E1-stimulated cyclic AMP accumulation in intact cells, both in the presence and absence of phosphodiesterase inhibitors. The 50% maximal response was similar to that for stimulation of phosphoinositide breakdown by angiotensin II in these cultures. The potentiation of stimulated cyclic AMP levels was seen, although to a smaller maximum, with the protein kinase C (Ca2+/phospholipid-dependent enzyme) activating phorbol ester tetradecanoyl phorbolacetate and with the synthetic diacylglycerol 1-oleoyl-2-acetylglycerol; pretreatment (24 h) with active phorbol ester, which would be expected to diminish protein kinase C levels, attenuated the angiotensin II potentiation of cyclic AMP. Using digitonin-permeabilized cells we showed that adenylate cyclase activity was stimulated by prostaglandin E1 with the same dose-response relationship as was cyclic AMP accumulation in intact cells, but the permeabilized cells showed no response to angiotensin II. The results are discussed with respect to the hypothesis that the angiotensin II influence on cyclic AMP levels is mediated, in part, by diacylglycerol stimulation of protein kinase C.

  11. Differential regulation by AMP and ADP of AMPK complexes containing different γ subunit isoforms

    DEFF Research Database (Denmark)

    Ross, Fiona A; Jensen, Thomas Elbenhardt; Hardie, D Grahame

    2016-01-01

    The g subunits of heterotrimeric AMPK complexes contain the binding sites for the regulatory adenine nucleotides AMP, ADP and ATP. We addressed whether complexes containing different g isoforms display different responses to adenine nucleotides by generating cells stably expressing FLAG-tagged ve...

  12. Regulation of AMP-activated protein kinase by LKB1 and CaMKK in adipocytes

    DEFF Research Database (Denmark)

    Gormand, Amélie; Henriksson, Emma; Ström, Kristoffer

    2011-01-01

    AMP-activated protein kinase (AMPK) is a serine/threonine kinase that regulates cellular and whole body energy homeostasis. In adipose tissue, activation of AMPK has been demonstrated in response to a variety of extracellular stimuli. However, the upstream kinase that activates AMPK in adipocytes...

  13. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  14. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  15. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  16. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  17. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  18. 2′,3′-cAMP, 3′-AMP, and 2′-AMP inhibit human aortic and coronary vascular smooth muscle cell proliferation via A2B receptors

    Science.gov (United States)

    Ren, Jin; Gillespie, Delbert G.

    2011-01-01

    Rat vascular smooth muscle cells (VSMCs) from renal microvessels metabolize 2′,3′-cAMP to 2′-AMP and 3′-AMP, and these AMPs are converted to adenosine that inhibits microvascular VSMC proliferation via A2B receptors. The goal of this study was to test whether this mechanism also exists in VSMCs from conduit arteries and whether it is similarly expressed in human vs. rat VSMCs. Incubation of rat and human aortic VSMCs with 2′,3′-cAMP concentration-dependently increased levels of 2′-AMP and 3′-AMP in the medium, with a similar absolute increase in 2′-AMP vs. 3′-AMP. In contrast, in human coronary VSMCs, 2′,3′-cAMP increased 2′-AMP levels yet had little effect on 3′-AMP levels. In all cell types, 2′,3′-cAMP increased levels of adenosine, but not 5′-AMP, and 2′,3′-AMP inhibited cell proliferation. Antagonism of A2B receptors (MRS-1754), but not A1 (1,3-dipropyl-8-cyclopentylxanthine), A2A (SCH-58261), or A3 (VUF-5574) receptors, attenuated the antiproliferative effects of 2′,3′-cAMP. In all cell types, 2′-AMP, 3′-AMP, and 5′-AMP increased adenosine levels, and inhibition of ecto-5′-nucleotidase blocked this effect of 5′-AMP but not that of 2′-AMP nor 3′-AMP. Also, 2′-AMP, 3′-AMP, and 5′-AMP, like 2′,3′-cAMP, exerted antiproliferative effects that were abolished by antagonism of A2B receptors with MRS-1754. In conclusion, VSMCs from conduit arteries metabolize 2′,3′-cAMP to AMPs, which are metabolized to adenosine. In rat and human aortic VSMCs, both 2′-AMP and 3′-AMP are involved in this process, whereas, in human coronary VSMCs, 2′,3′-cAMP is mainly converted to 2′-AMP. Because adenosine inhibits VSMC proliferation via A2B receptors, local vascular production of 2′,3′-cAMP may protect conduit arteries from atherosclerosis. PMID:21622827

  19. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  20. The Monge-Ampère equation

    CERN Document Server

    Gutiérrez, Cristian E

    2016-01-01

    Now in its second edition, this monograph explores the Monge-Ampère equation and the latest advances in its study and applications. It provides an essentially self-contained systematic exposition of the theory of weak solutions, including regularity results by L. A. Caffarelli. The geometric aspects of this theory are stressed using techniques from harmonic analysis, such as covering lemmas and set decompositions. An effort is made to present complete proofs of all theorems, and examples and exercises are offered to further illustrate important concepts. Some of the topics considered include generalized solutions, non-divergence equations, cross sections, and convex solutions. New to this edition is a chapter on the linearized Monge-Ampère equation and a chapter on interior Hölder estimates for second derivatives. Bibliographic notes, updated and expanded from the first edition, are included at the end of every chapter for further reading on Monge-Ampère-type equations and their diverse applications in th...

  1. The Applied Mathematics for Power Systems (AMPS)

    Energy Technology Data Exchange (ETDEWEB)

    Chertkov, Michael [Los Alamos National Laboratory

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  2. Extended-spectrum β-lactamase/AmpC- and carbapenemase-producing Enterobacteriaceae in animals: a threat for humans?

    Science.gov (United States)

    Madec, J-Y; Haenni, M; Nordmann, P; Poirel, L

    2017-11-01

    There has been a great and long-term concern that extended-spectrum β-lactamase (ESBL)/AmpC- and carbapenemase-producing Enterobacteriaceae occurring in animals may constitute a public-health issue. A large number of factors with complex interrelations contribute to the spread of those bacteria among animals and humans. ESBL/AmpC- or carbapenemase-encoding genes are most often located on mobile genetic elements favouring their dissemination. Some shared reservoirs of ESBL/AmpC or carbapenemase genes, plasmids or clones have been identified and suggest cross-transmissions. Even though exposure to animals is regarded as a risk factor, evidence for a direct transfer of ESBL/AmpC-producing bacteria from animals to humans through close contacts is limited. Nonetheless, the size of the commensal ESBL/AmpC reservoir in non-human sources is dramatically rising. This may constitute an indirect risk to public health by increasing the gene pool from which pathogenic bacteria can pick up ESBL/AmpC/carbapenemase genes. The extent to which food contributes to potential transmission of ESBL/AmpC producers to humans is also not well established. Overall, events leading to the occurrence of ESBL/AmpC- and carbapenemase-encoding genes in animals seem very much multifactorial. The impact of animal reservoirs on human health still remains debatable and unclear; nonetheless, there are some examples of direct links that have been identified. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. Optimal Design for Reactivity Ratio Estimation: A Comparison of Techniques for AMPS/Acrylamide and AMPS/Acrylic Acid Copolymerizations

    Directory of Open Access Journals (Sweden)

    Alison J. Scott

    2015-11-01

    Full Text Available Water-soluble polymers of acrylamide (AAm and acrylic acid (AAc have significant potential in enhanced oil recovery, as well as in other specialty applications. To improve the shear strength of the polymer, a third comonomer, 2-acrylamido-2-methylpropane sulfonic acid (AMPS, can be added to the pre-polymerization mixture. Copolymerization kinetics of AAm/AAc are well studied, but little is known about the other comonomer pairs (AMPS/AAm and AMPS/AAc. Hence, reactivity ratios for AMPS/AAm and AMPS/AAc copolymerization must be established first. A key aspect in the estimation of reliable reactivity ratios is design of experiments, which minimizes the number of experiments and provides increased information content (resulting in more precise parameter estimates. However, design of experiments is hardly ever used during copolymerization parameter estimation schemes. In the current work, copolymerization experiments for both AMPS/AAm and AMPS/AAc are designed using two optimal techniques (Tidwell-Mortimer and the error-in-variables-model (EVM. From these optimally designed experiments, accurate reactivity ratio estimates are determined for AMPS/AAm (rAMPS = 0.18, rAAm = 0.85 and AMPS/AAc (rAMPS = 0.19, rAAc = 0.86.

  4. Induction of dopamine biosynthesis by l-DOPA in PC12 cells: implications of L-DOPA influx and cyclic AMP.

    Science.gov (United States)

    Jin, Chun Mei; Yang, Yoo Jung; Huang, Hai Shan; Lim, Sung Cil; Kai, Masaaki; Lee, Myung Koo

    2008-09-04

    The effects of 3,4-dihydroxyphenylalanine (l-DOPA) on dopamine biosynthesis and cytotoxicity were investigated in PC12 cells. l-DOPA treatment (20-200 microM) increased the levels of dopamine by 226%-504% after 3-6 h of treatment and enhanced the activities of tyrosine hydroxylase (TH) and aromatic l-amino acid decarboxylase (AADC). l-DOPA (20-200 muM) treatment led to a 562%-937% increase in l-DOPA influx at 1 h, which inhibited the activity of TH, but not AADC, during the same period. The extracellular releases of dopamine were also increased by 231%-570% after treatment with 20 and 200 microM l-DOPA for 0.5-3 h. l-DOPA at a concentration of 100-200 microM, but not 20 microM, exerted apoptotic cytotoxicity towards PC12 cells for 24-48 h. l-DOPA (20-200 microM) increased the intracellular cyclic AMP levels by 318%-557% after 0.5-1 h in a concentration-dependent manner. However, the elevated cyclic AMP levels by l-DOPA could not protect against l-DOPA (100-200 microM)-induced cytotoxicity after 24-48 h. In addition, l-DOPA (20-200 microM)-induced increases in cyclic AMP and dopamine were significantly reduced by treatment with SCH23390 (dopamine D(1) receptor antagonist). The increased levels of dopamine by l-DOPA were also reduced by H89 (protein kinase A, PKA, inhibitor) and GF109203X (protein kinase C inhibitor); however, the reduction by GF109203X was not significant. l-DOPA at 20-200 microM stimulated the phosphorylation of PKA and cyclic AMP-response element binding protein and induced the biosynthesis of the TH protein. These results indicate that 20-200 microM l-DOPA induces dopamine biosynthesis by two pathways. One pathway involves l-DOPA directly entering the cells to convert dopamine through AADC activity (l-DOPA decarboxylation). The other pathway involves l-DOPA and/or released dopamine activating TH to enhance dopamine biosynthesis by the dopamine D(1) receptor-cyclic AMP-PKA signaling system (dopamine biosynthesis by TH).

  5. The Cyclic AMP-Vfr Signaling Pathway in Pseudomonas aeruginosa Is Inhibited by Cyclic Di-GMP

    DEFF Research Database (Denmark)

    Almblad, Henrik; Harrison, Joe J; Rybtke, Morten

    2015-01-01

    infection give rise to rugose small colony variants (RSCVs), which are hyper-biofilm-forming mutants that commonly possess mutations that increase production of the biofilm-promoting secondary messenger cyclic di-GMP (c-di-GMP). We show that RSCVs display a decreased production of acute virulence factors...... as a direct result of elevated c-di-GMP content. Overproduction of c-di-GMP causes a decrease in the transcription of virulence factor genes that are regulated by the global virulence regulator Vfr. The low level of Vfr-dependent transcription is caused by a low level of its coactivator, cyclic AMP (c......AMP), which is decreased in response to a high level of c-di-GMP. Mutations that cause reversion of the RSCV phenotype concomitantly reactivate Vfr-cAMP signaling. Attempts to uncover the mechanism underlying the observed c-di-GMP-mediated lowering of cAMP content provided evidence that it is not caused...

  6. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  7. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  8. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  9. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  10. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  11. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  12. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  13. Regulatory action of catalpol from radix rehmanniae on β-adrenoceptor-cyclic AMP system

    International Nuclear Information System (INIS)

    Liu Qingfeng; Sun Qixiang; Hu Yaer; Xia Zongqin

    2004-01-01

    Objective: It has been proved in previous works from this laboratory that the Yin tonic effect of water extract of Radix Rehmanniae is closely related to its down-regulation effect on β adrenoceptor-cyclic AMP system. The purpose of this work is to investigate whether catalpol from Radix Rehmanniae is the effective active component of this plant drug. Methods: Catalpol was extracted from fresh Radix Rehmanniae by organic solvents and purified by low pressure silica gel column and recrystallization. Experimental mice were divided into 4 groups. Three groups of hyperthyroid mouse models were prepared with subcutaneous injection of T 3 and two of them were additionally fed oral catalpol at low and high dose respectively. One group receiving neither T 3 nor catalpol served as controls. Plasma cAMP levels in these mice were measured with RIA 10 min after subcutaneous injection of a single dose of isoproterenol. Results: After injection of catalpol, the plasma cAMP content rose markedly to above 700 pmol/ml in control mice while that of the hyperthyroid mice rose to a even higher levels. Simultaneous additional oral administration of catalpol with purity >97% for 6 days significantly lowered the cAMP level in hyperthyroid mice. With catalpol dose of 1.56 mg/mouse/d and 6.0 mg/mouse/d, the plasma cAMP levels were 978 ± 283 pmol/ml and 1070 ± 394 pmol/ml respectively, the values in the group without catalpol being 1408 ± 568 pmol/ml and 1491 ± 486 pmol/ml, both P<0.05. Conclusion: Catalpol can repeat the regulatory effect of water extract of Radix Rehmanniae on β adrenoceptor-cyclic AMP system, that is, down regulate the response of hyperthyroid mice to isoproterenol. This result suggests that catalpol is an effective active component of the Yin tonic effect of Radix Rehmanniae. (authors)

  14. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  16. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  17. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  18. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  19. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  1. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  2. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  3. Radioprotection of the rat parotid gland by cAMP

    International Nuclear Information System (INIS)

    Sodicoff, M.; Conger, A.D.

    1983-01-01

    Most earlier studies showing a radioprotective effect by cAMP show only slight degrees of protection. The present study demonstrates a substantial protective effect (DMF, 1.63) of exogenously administered cAMP on the rat parotid gland and supports the mechanism suggested previously for protection afforded the parotid glands by the β-adrenergic agonist isoproterenol, which is known to elevate endogenous intracellular cAMP

  4. Didactical formulation of the Ampère law

    International Nuclear Information System (INIS)

    Barchiesi, Dominique

    2014-01-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot–Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations. (letters and comments)

  5. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  6. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  7. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  8. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  9. Caffeine, cyclic AMP and postreplication repair of mammalian DNA

    International Nuclear Information System (INIS)

    Ehmann, U.K.

    1976-01-01

    The methylxanthines, caffeine and theophylline, inhibit postreplication repair of DNA in mammalian cells. Because they also inhibit cyclic AMP phosphodiesterase, it was thought that there might be some connection between concentrations of cyclic AMP and postreplication repair. This possibility was tested by performing DNA sedimentation experiments with a cyclic AMP-resistant mouse lymphoma cell mutant and its wild-type counterpart. The results show that there is no connection between cellular cyclic AMP concentrations and the rate of postreplication repair. Therefore, it is more likely that caffeine and theophylline inhibit postreplication repair by some other means, such as by binding to DNA

  10. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  11. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  12. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Motor Skill Learning Is Associated with Phase-Dependent Modifications in the Striatal cAMP/PKA/DARPP-32 Signaling Pathway in Rodents.

    Directory of Open Access Journals (Sweden)

    Yu Qian

    Full Text Available Abundant evidence points to a key role of dopamine in motor skill learning, although the underlying cellular and molecular mechanisms are still poorly understood. Here, we used a skilled-reaching paradigm to first examine changes in the expression of the plasticity-related gene Arc to map activity in cortico-striatal circuitry during different phases of motor skill learning in young animals. In the early phase, Arc mRNA was significantly induced in the medial prefrontal cortex (mPFC, cingulate cortex, primary motor cortex, and striatum. In the late phase, expression of Arc did not change in most regions, except in the mPFC and dorsal striatum. In the second series of experiments, we studied the learning-induced changes in the phosphorylation state of dopamine and cAMP-regulated phosphoprotein, 32k Da (DARPP-32. Western blot analysis of the phosphorylation state of DARPP-32 and its downstream target cAMP response element-binding protein (CREB in the striatum revealed that the early, but not late, phase of motor skill learning was associated with increased levels of phospho-Thr34-DARPP-32 and phospho-Ser133-CREB. Finally, we used the DARPP-32 knock-in mice with a point mutation in the Thr34 regulatory site (i.e., protein kinase A site to test the significance of this pathway in motor skill learning. In accordance with our hypothesis, inhibition of DARPP-32 activity at the Thr34 regulatory site strongly attenuated the motor learning rate and skilled reaching performance of mice. These findings suggest that the cAMP/PKA/DARPP-32 signaling pathway is critically involved in the acquisition of novel motor skills, and also demonstrate a dynamic shift in the contribution of cortico-striatal circuitry during different phases of motor skill learning.

  14. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  15. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  17. Earl Sutherland (1915-1974) [corrected] and the discovery of cyclic AMP.

    Science.gov (United States)

    Blumenthal, Stanley A

    2012-01-01

    In 1945, Earl Sutherland (1915-1974) [corrected] and associates began studies of the mechanism of hormone-induced glycogen breakdown in the liver. In 1956, their efforts culminated in the identification of cyclic AMP, an ancient molecule generated in many cell types in response to hormonal and other extracellular signals. Cyclic AMP, the original "second messenger," transmits such signals through pathways that regulate a diversity of cellular functions and capabilities: metabolic processes such as lipolysis and glycogenolysis; hormone secretion; the permeability of ion channels; gene expression; cell proliferation and survival. Indeed, it can be argued that the discovery of cyclic AMP initiated the study of intracellular signaling pathways, a major focus of contemporary biomedical inquiry. This review presents relevant details of Sutherland's career; summarizes key contributions of his mentors, Carl and Gerti Cori, to the knowledge of glycogen metabolism (contributions that were the foundation for his own research); describes the experiments that led to his identification, isolation, and characterization of cyclic AMP; assesses the significance of his work; and considers some aspects of the impact of cyclic nucleotide research on clinical medicine.

  18. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  19. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  20. Lipoic acid attenuates inflammation via cAMP and protein kinase A signaling.

    Directory of Open Access Journals (Sweden)

    Sonemany Salinthone

    2010-09-01

    Full Text Available Abnormal regulation of the inflammatory response is an important component of diseases such as diabetes, Alzheimer's disease and multiple sclerosis (MS. Lipoic acid (LA has been shown to have antioxidant and anti-inflammatory properties and is being pursued as a therapy for these diseases. We first reported that LA stimulates cAMP production via activation of G-protein coupled receptors and adenylyl cyclases. LA also suppressed NK cell activation and cytotoxicity. In this study we present evidence supporting the hypothesis that the anti-inflammatory properties of LA are mediated by the cAMP/PKA signaling cascade. Additionally, we show that LA oral administration elevates cAMP levels in MS subjects.We determined the effects of LA on IL-6, IL-17 and IL-10 secretion using ELISAs. Treatment with 50 µg/ml and 100 µg/ml LA significantly reduced IL-6 levels by 19 and 34%, respectively, in T cell enriched PBMCs. IL-17 levels were also reduced by 35 and 50%, respectively. Though not significant, LA appeared to have a biphasic effect on IL-10 production. Thymidine incorporation studies showed LA inhibited T cell proliferation by 90%. T-cell activation was reduced by 50% as measured by IL-2 secretion. Western blot analysis showed that LA treatment increased phosphorylation of Lck, a downstream effector of protein kinase A. Pretreatment with a peptide inhibitor of PKA, PKI, blocked LA inhibition of IL-2 and IFN gamma production, indicating that PKA mediates these responses. Oral administration of 1200 mg LA to MS subjects resulted in increased cAMP levels in PBMCs four hours after ingestion. Average cAMP levels in 20 subjects were 43% higher than baseline.Oral administration of LA in vivo resulted in significant increases in cAMP concentration. The anti-inflammatory effects of LA are mediated in part by the cAMP/PKA signaling cascade. These novel findings enhance our understanding of the mechanisms of action of LA.

  1. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  2. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  3. Coordinated induction of GST and MRP2 by cAMP in Caco-2 cells: Role of protein kinase A signaling pathway and toxicological relevance

    Energy Technology Data Exchange (ETDEWEB)

    Arana, Maite Rocío, E-mail: arana@ifise-conicet.gov.ar [Instituto de Fisiología Experimental (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas (UNR), Suipacha 570, 2000 Rosario (Argentina); Tocchetti, Guillermo Nicolás, E-mail: gtocchetti@live.com.ar [Instituto de Fisiología Experimental (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas (UNR), Suipacha 570, 2000 Rosario (Argentina); Domizi, Pablo, E-mail: domizi@ibr-conicet.gov.ar [Instituto de Biología Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas (UNR), Suipacha 570, 2000 Rosario (Argentina); Arias, Agostina, E-mail: agoarias@yahoo.com.ar [Instituto de Fisiología Experimental (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas (UNR), Suipacha 570, 2000 Rosario (Argentina); Rigalli, Juan Pablo, E-mail: jprigalli@gmail.com [Instituto de Fisiología Experimental (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas (UNR), Suipacha 570, 2000 Rosario (Argentina); Ruiz, María Laura, E-mail: ruiz@ifise-conicet.gov.ar [Instituto de Fisiología Experimental (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas (UNR), Suipacha 570, 2000 Rosario (Argentina); and others

    2015-09-01

    The cAMP pathway is a universal signaling pathway regulating many cellular processes including metabolic routes, growth and differentiation. However, its effects on xenobiotic biotransformation and transport systems are poorly characterized. The effect of cAMP on expression and activity of GST and MRP2 was evaluated in Caco-2 cells, a model of intestinal epithelium. Cells incubated with the cAMP permeable analog dibutyryl cyclic AMP (db-cAMP: 1,10,100 μM) for 48 h exhibited a dose–response increase in GST class α and MRP2 protein expression. Incubation with forskolin, an activator of adenylyl cyclase, confirmed the association between intracellular cAMP and upregulation of MRP2. Consistent with increased expression of GSTα and MRP2, db-cAMP enhanced their activities, as well as cytoprotection against the common substrate 1-chloro-2,4-dinitrobenzene. Pretreatment with protein kinase A (PKA) inhibitors totally abolished upregulation of MRP2 and GSTα induced by db-cAMP. In silico analysis together with experiments consisting of treatment with db-cAMP of Caco-2 cells transfected with a reporter construct containing CRE and AP-1 sites evidenced participation of these sites in MRP2 upregulation. Further studies involving the transcription factors CREB and AP-1 (c-JUN, c-FOS and ATF2) demonstrated increased levels of total c-JUN and phosphorylation of c-JUN and ATF2 by db-cAMP, which were suppressed by a PKA inhibitor. Co-immunoprecipitation and ChIP assay studies demonstrated that db-cAMP increased c-JUN/ATF2 interaction, with further recruitment to the region of the MRP2 promoter containing CRE and AP-1 sites. We conclude that cAMP induces GSTα and MRP2 expression and activity in Caco-2 cells via the PKA pathway, thus regulating detoxification of specific xenobiotics. - Highlights: • cAMP positively modulates the expression and activity of GST and MRP2 in Caco-2 cells. • Such induction resulted in increased cytoprotection against chemical injury. • PKA

  4. Coordinated induction of GST and MRP2 by cAMP in Caco-2 cells: Role of protein kinase A signaling pathway and toxicological relevance

    International Nuclear Information System (INIS)

    Arana, Maite Rocío; Tocchetti, Guillermo Nicolás; Domizi, Pablo; Arias, Agostina; Rigalli, Juan Pablo; Ruiz, María Laura

    2015-01-01

    The cAMP pathway is a universal signaling pathway regulating many cellular processes including metabolic routes, growth and differentiation. However, its effects on xenobiotic biotransformation and transport systems are poorly characterized. The effect of cAMP on expression and activity of GST and MRP2 was evaluated in Caco-2 cells, a model of intestinal epithelium. Cells incubated with the cAMP permeable analog dibutyryl cyclic AMP (db-cAMP: 1,10,100 μM) for 48 h exhibited a dose–response increase in GST class α and MRP2 protein expression. Incubation with forskolin, an activator of adenylyl cyclase, confirmed the association between intracellular cAMP and upregulation of MRP2. Consistent with increased expression of GSTα and MRP2, db-cAMP enhanced their activities, as well as cytoprotection against the common substrate 1-chloro-2,4-dinitrobenzene. Pretreatment with protein kinase A (PKA) inhibitors totally abolished upregulation of MRP2 and GSTα induced by db-cAMP. In silico analysis together with experiments consisting of treatment with db-cAMP of Caco-2 cells transfected with a reporter construct containing CRE and AP-1 sites evidenced participation of these sites in MRP2 upregulation. Further studies involving the transcription factors CREB and AP-1 (c-JUN, c-FOS and ATF2) demonstrated increased levels of total c-JUN and phosphorylation of c-JUN and ATF2 by db-cAMP, which were suppressed by a PKA inhibitor. Co-immunoprecipitation and ChIP assay studies demonstrated that db-cAMP increased c-JUN/ATF2 interaction, with further recruitment to the region of the MRP2 promoter containing CRE and AP-1 sites. We conclude that cAMP induces GSTα and MRP2 expression and activity in Caco-2 cells via the PKA pathway, thus regulating detoxification of specific xenobiotics. - Highlights: • cAMP positively modulates the expression and activity of GST and MRP2 in Caco-2 cells. • Such induction resulted in increased cytoprotection against chemical injury. • PKA

  5. cAMP-secretion coupling is impaired in diabetic GK/Par rat β-cells: a defect counteracted by GLP-1.

    Science.gov (United States)

    Dolz, Manuel; Movassat, Jamileh; Bailbé, Danielle; Le Stunff, Hervé; Giroix, Marie-Hélène; Fradet, Magali; Kergoat, Micheline; Portha, Bernard

    2011-11-01

    cAMP-raising agents with glucagon-like peptide-1 (GLP-1) as the first in class, exhibit multiple actions that are beneficial for the treatment of type 2 diabetic (T2D) patients, including improvement of glucose-induced insulin secretion (GIIS). To gain additional insight into the role of cAMP in the disturbed stimulus-secretion coupling within the diabetic β-cell, we examined more thoroughly the relationship between changes in islet cAMP concentration and insulin release in the GK/Par rat model of T2D. Basal cAMP content in GK/Par islets was significantly higher, whereas their basal insulin release was not significantly different from that of Wistar (W) islets. Even in the presence of IBMX or GLP-1, their insulin release did not significantly change despite further enhanced cAMP accumulation in both cases. The high basal cAMP level most likely reflects an increased cAMP generation in GK/Par compared with W islets since 1) forskolin dose-dependently induced an exaggerated cAMP accumulation; 2) adenylyl cyclase (AC)2, AC3, and G(s)α proteins were overexpressed; 3) IBMX-activated cAMP accumulation was less efficient and PDE-3B and PDE-1C mRNA were decreased. Moreover, the GK/Par insulin release apparatus appears less sensitive to cAMP, since GK/Par islets released less insulin at submaximal cAMP levels and required five times more cAMP to reach a maximal secretion rate no longer different from W. GLP-1 was able to reactivate GK/Par insulin secretion so that GIIS became indistinguishable from that of W. The exaggerated cAMP production is instrumental, since GLP-1-induced GIIS reactivation was lost in the presence the AC blocker 2',5'-dideoxyadenosine. This GLP-1 effect takes place in the absence of any improvement of the [Ca(2+)](i) response and correlates with activation of the cAMP-dependent PKA-dependent pathway.

  6. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  7. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  8. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  9. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  10. The CytR repressor antagonizes cyclic AMP-cyclic AMP receptor protein activation of the deoCp2 promoter of Escherichia coli K-12

    DEFF Research Database (Denmark)

    Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E

    1990-01-01

    We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...

  11. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  12. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  13. Acetic acid activates the AMP-activated protein kinase signaling pathway to regulate lipid metabolism in bovine hepatocytes.

    Directory of Open Access Journals (Sweden)

    Xinwei Li

    Full Text Available The effect of acetic acid on hepatic lipid metabolism in ruminants differs significantly from that in monogastric animals. Therefore, the aim of this study was to investigate the regulation mechanism of acetic acid on the hepatic lipid metabolism in dairy cows. The AMP-activated protein kinase (AMPK signaling pathway plays a key role in regulating hepatic lipid metabolism. In vitro, bovine hepatocytes were cultured and treated with different concentrations of sodium acetate (neutralized acetic acid and BML-275 (an AMPKα inhibitor. Acetic acid consumed a large amount of ATP, resulting in an increase in AMPKα phosphorylation. The increase in AMPKα phosphorylation increased the expression and transcriptional activity of peroxisome proliferator-activated receptor α, which upregulated the expression of lipid oxidation genes, thereby increasing lipid oxidation in bovine hepatocytes. Furthermore, elevated AMPKα phosphorylation reduced the expression and transcriptional activity of the sterol regulatory element-binding protein 1c and the carbohydrate responsive element-binding protein, which reduced the expression of lipogenic genes, thereby decreasing lipid biosynthesis in bovine hepatocytes. In addition, activated AMPKα inhibited the activity of acetyl-CoA carboxylase. Consequently, the triglyceride content in the acetate-treated hepatocytes was significantly decreased. These results indicate that acetic acid activates the AMPKα signaling pathway to increase lipid oxidation and decrease lipid synthesis in bovine hepatocytes, thereby reducing liver fat accumulation in dairy cows.

  14. Regularizing properties of Complex Monge-Amp\\`ere flows

    OpenAIRE

    Tô, Tat Dat

    2016-01-01

    We study the regularizing properties of complex Monge-Amp\\`ere flows on a K\\"ahler manifold $(X,\\omega)$ when the initial data are $\\omega$-psh functions with zero Lelong number at all points. We prove that the general Monge-Amp\\`ere flow has a solution which is immediately smooth. We also prove the uniqueness and stability of solution.

  15. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  16. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  17. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  18. Reward or its denial during the neonatal period affects adult spatial memory and hippocampal phosphorylated cAMP response element-binding protein levels of both the neonatal and adult rat.

    Science.gov (United States)

    Diamantopoulou, A; Stamatakis, A; Panagiotaropoulos, T; Stylianopoulou, F

    2011-05-05

    Early life experiences, particularly mother-infant interactions, have been shown to influence adult coping and learning abilities via gene-environment interactions. We have developed a paradigm, in which mother contact is used as either a positive or a negative reinforcer in a T-maze, during postnatal days 10-13. In both neonates receiving (RER) or denied (DER) the expected reward, exposure to the memory test in the absence of the mother resulted in a remarkable increase in the number of pCREB immunopositive cells, when compared to their corresponding levels 2 h after the completion of the training process, but also to the levels of naïve animals. In the CA3 area, the pattern of pCREB immunoreactivity, when evaluated 2 h after the completion of the training on postnatal day 13 seemed to distinguish between the two different neonatal experiences in the T-maze, with the DER pups showing higher levels of pCREB immunopositive cells than the RER. Exposure to the Morris Water Maze (MWM) during adulthood revealed a memory advantage of the DER animals compared to the RER and the animals not exposed to the neonatal experience. Relevantly, in the DER animals an increased number of pCREB immunopositive cells was observed in the CA3 area even 24 h after the end of MWM training. When also measured after exposure to the probe trial, the number of pCREB immunopositive cells was again higher in the DER compared to the RER animals. In conclusion, we show that a learning experience involving discrepancy during the particularly plastic neonatal period is able to induce long-term effects, which result in enhanced adult hippocampal dependent spatial memory. Furthermore, our data document a role of plasticity molecules like pCREB in mediating hippocampal dependent learning and detection of novelty not only in adulthood, but also more importantly in the neonatal period of the rat. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  19. Estradiol up-regulates L-type Ca2+ channels via membrane-bound estrogen receptor/phosphoinositide-3-kinase/Akt/cAMP response element-binding protein signaling pathway.

    Science.gov (United States)

    Yang, Xiaoyan; Mao, Xiaofang; Xu, Gao; Xing, Shasha; Chattopadhyay, Ansuman; Jin, Si; Salama, Guy

    2018-05-01

    In long QT syndrome type 2, women are more prone than men to the lethal arrhythmia torsades de pointes. We previously reported that 17β-estradiol (E2) up-regulates L-type Ca 2+ channels and current (I Ca,L ) (∼30%) in rabbit ventricular myocytes by a classic genomic mechanism mediated by estrogen receptor-α (ERα). In long QT syndrome type 2 (I Kr blockade or bradycardia), the higher Ca 2+ influx via I Ca,L causes Ca 2+ overload, spontaneous sarcoplasmic reticulum Ca 2+ release, and reactivation of I Ca,L that triggers early afterdepolarizations and torsades de pointes. The purpose of this study was to investigate the molecular mechanisms whereby E2 up-regulates I Ca,L , which are poorly understood. H9C2 and rat myocytes were incubated with E2 ± ER antagonist, or inhibitors of downstream transcription factors, for 24 hours, followed by western blots of Cav1.2α1C and voltage-clamp measurements of I Ca,L . Incubation of H9C2 cells with E2 (10-100 nM) increased I Ca,L density and Cav1.2α1C expression, which were suppressed by the ER antagonist ICI182,780 (1 μM). Enhanced I Ca,L and Cav1.2α1C expression by E2 was suppressed by inhibitors of phosphoinositide-3-kinase (Pi3K) (30 μM LY294002; P L via plasma membrane ER and by activating Pi3K, Akt, and CREB signaling. The promoter regions of the CACNA1C gene (human-rabbit-rat) contain adjacent/overlapping binding sites for p-CREB and ERα, which suggests a synergistic regulation by these pathways. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  20. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    DEFF Research Database (Denmark)

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.

    2015-01-01

    Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors...... as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult...... zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance...

  1. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  2. Resveratrol stimulates AMP kinase activity in neurons.

    Science.gov (United States)

    Dasgupta, Biplab; Milbrandt, Jeffrey

    2007-04-24

    Resveratrol is a polyphenol produced by plants that has multiple beneficial activities similar to those associated with caloric restriction (CR), such as increased life span and delay in the onset of diseases associated with aging. CR improves neuronal health, and the global beneficial effects of CR have been postulated to be mediated by the nervous system. One key enzyme thought to be activated during CR is the AMP-activated kinase (AMPK), a sensor of cellular energy levels. AMPK is activated by increases in the cellular AMP:ATP ratio, whereupon it functions to help preserve cellular energy. In this regard, the regulation of dietary food intake by hypothalamic neurons is mediated by AMPK. The suppression of nonessential energy expenditure by activated AMPK along with the CR mimetic and neuroprotective properties of resveratrol led us to hypothesize that neuronal activation of AMPK could be an important component of resveratrol activity. Here, we show that resveratrol activated AMPK in Neuro2a cells and primary neurons in vitro as well as in the brain. Resveratrol and the AMPK-activating compound 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR) promoted robust neurite outgrowth in Neuro2a cells, which was blocked by genetic and pharmacologic inhibition of AMPK. Resveratrol also stimulated mitochondrial biogenesis in an AMPK-dependent manner. Resveratrol-stimulated AMPK activity in neurons depended on LKB1 activity but did not require the NAD-dependent protein deacetylase SIRT1 during this time frame. These findings suggest that neuronal activation of AMPK by resveratrol could affect neuronal energy homeostasis and contribute to the neuroprotective effects of resveratrol.

  3. Control of Saccharomyces cerevisiae catalase T gene (CTT1) expression by nutrient supply via the RAS-cyclic AMP pathway.

    Science.gov (United States)

    Bissinger, P H; Wieser, R; Hamilton, B; Ruis, H

    1989-03-01

    In Saccharomyces cerevisiae, lack of nutrients triggers a pleiotropic response characterized by accumulation of storage carbohydrates, early G1 arrest, and sporulation of a/alpha diploids. This response is thought to be mediated by RAS proteins, adenylate cyclase, and cyclic AMP (cAMP)-dependent protein kinases. This study shows that expression of the S. cerevisiae gene coding for a cytoplasmic catalase T (CTT1) is controlled by this pathway: it is regulated by the availability of nutrients. Lack of a nitrogen, sulfur, or phosphorus source causes a high-level expression of the gene. Studies with strains with mutations in the RAS-cAMP pathway and supplementation of a rca1 mutant with cAMP show that CTT1 expression is under negative control by a cAMP-dependent protein kinase and that nutrient control of CTT1 gene expression is mediated by this pathway. Strains containing a CTT1-Escherichia coli lacZ fusion gene have been used to isolate mutants with mutations in the pathway. Mutants characterized in this investigation fall into five complementation groups. Both cdc25 and ras2 alleles were identified among these mutants.

  4. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  5. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  6. Validation of the 17-item Hamilton Depression Rating Scale definition of response for adults with major depressive disorder using equipercentile linking to Clinical Global Impression scale ratings: analysis of Pharmacogenomic Research Network Antidepressant Medication Pharmacogenomic Study (PGRN-AMPS) data.

    Science.gov (United States)

    Bobo, William V; Angleró, Gabriela C; Jenkins, Gregory; Hall-Flavin, Daniel K; Weinshilboum, Richard; Biernacka, Joanna M

    2016-05-01

    The study aimed to define thresholds of clinically significant change in 17-item Hamilton Depression Rating Scale (HDRS-17) scores using the Clinical Global Impression-Improvement (CGI-I) Scale as a gold standard. We conducted a secondary analysis of individual patient data from the Pharmacogenomic Research Network Antidepressant Medication Pharmacogenomic Study, an 8-week, single-arm clinical trial of citalopram or escitalopram treatment of adults with major depression. We used equipercentile linking to identify levels of absolute and percent change in HDRS-17 scores that equated with scores on the CGI-I at 4 and 8 weeks. Additional analyses equated changes in the HDRS-7 and Bech-6 scale scores with CGI-I scores. A CGI-I score of 2 (much improved) corresponded to an absolute decrease (improvement) in HDRS-17 total score of 11 points and a percent decrease of 50-57%, from baseline values. Similar results were observed for percent change in HDRS-7 and Bech-6 scores. Larger absolute (but not percent) decreases in HDRS-17 scores equated with CGI-I scores of 2 in persons with higher baseline depression severity. Our results support the consensus definition of response based on HDRS-17 scores (>50% decrease from baseline). A similar definition of response may apply to the HDRS-7 and Bech-6. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  8. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  9. Inhibitory action of certain cyclophosphate derivatives of cAMP on cAMP-dependent protein kinases

    NARCIS (Netherlands)

    Wit, René J.W. de; Hekstra, Doeke; Jastorff, Bernd; Stec, Wojciech J.; Baraniak, Janina; Driel, Roel van; Haastert, Peter J.M. van

    1984-01-01

    A series cAMP derivatives with modifications in the adenine, ribose and cyclophosphate moiety were screened for their binding affinity for the two types of cAMP-binding sites in mammalian protein kinase type I. In addition, the activation of the kinase by these analogs was monitored. The binding

  10. Endoplasmic reticulum (ER) stress and cAMP/PKA pathway mediated Zn-induced hepatic lipolysis.

    Science.gov (United States)

    Song, Yu-Feng; Hogstrand, Christer; Wei, Chuan-Chuan; Wu, Kun; Pan, Ya-Xiong; Luo, Zhi

    2017-09-01

    The present study was performed to determine the effect of Zn exposure influencing endoplasmic reticulum (ER) stress, explore the underlying molecular mechanism of Zn-induced hepatic lipolysis in a fish species of significance for aquaculture, yellow catfish Pelteobagrus fulvidraco. We found that waterborne Zn exposure evoked ER stress and unfolded protein response (UPR), and activated cAMP/PKA pathway, and up-regulated hepatic lipolysis. The increase in ER stress and lipolysis were associated with activation of cAMP/PKA signaling pathway. Zn also induced an increase in intracellular Ca 2+ level, which could be partially prevented by dantrolene (RyR receptor inhibitor) and 2-APB (IP3 receptor inhibitor), demonstrating that the disturbed Ca 2+ homeostasis in ER contributed to ER stress and dysregulation of lipolysis. Inhibition of ER stress by PBA attenuated UPR, inhibited the activation of cAMP/PKA pathway and resulted in down-regulation of lipolysis. Inhibition of protein kinase RNA-activated-like ER kinase (PERK) by GSK2656157 and inositol-requiring enzyme (IRE) by STF-083010 differentially influenced Zn-induced changes of lipid metabolism, indicating that PERK and IRE pathways played different regulatory roles in Zn-induced lipolysis. Inhibition of PKA by H89 blocked the Zn-induced activation of cAMP/PKA pathway with a concomitant inhibition of ER stress-mediated lipolysis. Taken together, our findings highlight the importance of the ER stress-cAMP/PKA axis in Zn-induced lipolysis, which provides new insights into Zn toxicology in fish and probably in other vertebrates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  12. Cyclic GMP-AMP Synthase is an Innate Immune Sensor of HIV and Other Retroviruses

    OpenAIRE

    Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J.

    2013-01-01

    Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic-GMP-AMP (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type-I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse transcribed HIV DNA triggers the...

  13. Nitric oxide switches on glycolysis through the AMP protein kinase and 6-phosphofructo-2-kinase pathway

    OpenAIRE

    Almeida Parra, Ángeles; Moncada, Salvador; Bolaños Hernández, Juan Pedro

    2004-01-01

    El óxido nítrico activa la glucolisis en los astrocitos a través de una cascada de señalización en la que interviene la AMP kinasa, que fosforila (y activa) la fosfofructokinasa-2, enzima responsable de la biosíntesis de fructosa-2, 6-bisfosfato, efector alostérico positivo de la fosfofructokinasa-1. Este mecanismo es citoprotector.

  14. Extracellular 2′,3′-cAMP Is a Source of Adenosine*

    OpenAIRE

    Jackson, Edwin K.; Ren, Jin; Mi, Zaichuan

    2009-01-01

    We discovered that renal injury releases 2′,3′-cAMP (positional isomer of 3′,5′-cAMP) into the interstitium. This finding motivated a novel hypothesis: renal injury leads to activation of an extracellular 2′,3′-cAMP-adenosine pathway (i.e. metabolism of extracellular 2′,3′-cAMP to 3′-AMP and 2′-AMP, which are metabolized to adenosine, a retaliatory metabolite). In isolated rat kidneys, arterial infusions of 2′,3′-cAMP (30 μmol/liter) increased the mean venous secretion of 3′-AMP (3,400-fold),...

  15. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  16. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  17. The small molecule triclabendazole decreases the intracellular level of cyclic AMP and increases resistance to stress in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Yong Joo Lee

    Full Text Available The Ras-adenylyl cyclase-protein kinase A nutrient-sensing pathway controls metabolism, proliferation and resistance to stress in Saccharomyces cerevisiae. The genetic disruption of this pathway increases resistance to a variety of stresses. We show here that the pharmacological inhibition of this pathway by the drug triclabendazole increases resistance to oxidants, heat stress and extends the chronological life. Evidence is presented that triclabendazole decreases the intracellular level of cyclic AMP by inhibiting adenylyl cyclase and triggers the parallel rapid translocation of the stress-resistance transcription factor Msn2 from the cytosol into the nucleus, as deduced from experiments employing a strain in which MSN2 is replaced with MSN2-GFP (GFP, green fluorescent protein. Msn2 and Msn4 are responsible for activating the transcription of numerous genes that encode proteins that protect cells from stress. The results are consistent with triclabendazole either inhibiting the association of Ras with adenylyl cyclase or directly inhibiting adenylyl cyclase, which in turn triggers Msn2/4 to enter the nucleus and activate stress-responsible element gene expression.

  18. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  19. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  20. [TRPM8 mediates PC-12 neuronal cell apoptosis induced by oxygen-glucose deprivation through cAMP-PKA/UCP4 signaling].

    Science.gov (United States)

    Li, Hong-Wei; Zhou, Bin; Zhang, Hai-Hong

    2016-08-20

    To explore the molecular mechanism responsible for apoptosis of PC-12 neuronal cells induced by oxygen-glucose deprivation (OGD). PC12 cells were exposed to OGD for 24 h to simulate ischemia-reperfusion injury. Flow cytometry was employed detect the cell apoptosis, and the expresions of TRPM8, UCP4, cAMP and PKA in the exposed cells were detected with RT-PCR and Western blotting. The changes in the expressions of Bax, Bcl-2, cAMP, PKA and UCP4 proteins were detected in the exposed cells in resposne to inhibition of TRPM8 and cAMP-PKA signal or over-expression of UCP4. OGD for 24 induced obvious apoptosis in PC-12 cells and caused TRPM8 over-expression and inhibition of UCP4 and cAMP-PKA signaling. Inhibiting TRPM8 expression reduced the cell apoptosis and up-regulated cAMP, p-PKA and UCP4 in the cells exposed to OGD. In cells exposed to OGD, inhibition of TRPM8 and cAMP-PKA signaling suppressed the expressio of UCP4 and increased the cell apoptosis. TRPM8 mediates OGD-induced PC12 cell apoptosis through cAMP-PKA/UCP4 signaling.

  1. Applications of AMPS-1D for solar cell simulation

    Science.gov (United States)

    Zhu, Hong; Kalkan, Ali Kaan; Hou, Jingya; Fonash, Stephen J.

    1999-03-01

    The AMPS-1D PC computer program is now used by over 70 groups world-wide for detector and solar cell analysis. It has proved to be a very powerful tool in understanding device operation and physics for single crystal, poly-crystalline and amorphous structures. For example, AMPS-1D has been successful in explaining the "red kink" [1] and the "transient effect" in CdS/CIGS poly-crystalline solar cells. It has been used to show that thin film poly-Si structures, with reasonable light trapping, are capable of competitive solar cell conversion efficiencies. In the case of a-Si:H structures, it has been used, for example, to settle the discrepancies in bandgap measurement, to predict the effective QE>1 phenomenon later seen in these materials [2], to determine the relative roles of interface and bulk properties, and to point the direction toward 16% triple junction structures. In general AMPS-1D is used for cell and detector design, material parameter sensitivity studies, and parameter extraction. Recently we have shown that it can be used to determine optimum structure and light and voltage biasing conditions in the material parameter extraction function. Information on AMPS can be found at www.psu.edu/dept/AMPS/amps_web/AMPS.html and at other web sites set up by user groups.

  2. AMP-18 Targets p21 to Maintain Epithelial Homeostasis.

    Science.gov (United States)

    Chen, Peili; Li, Yan Chun; Toback, F Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21 WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD.

  3. AMP-18 Targets p21 to Maintain Epithelial Homeostasis.

    Directory of Open Access Journals (Sweden)

    Peili Chen

    Full Text Available Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD. We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21 WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD.

  4. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  5. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  6. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  7. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  8. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  9. Imaging alterations of cardiomyocyte cAMP microdomains in disease

    Directory of Open Access Journals (Sweden)

    Alexander eFroese

    2015-08-01

    Full Text Available 3’,5’-cyclic adenosine monophosphate (cAMP is an important second messenger which regulates heart function by acting in distinct subcellular microdomains. Recent years have provided deeper mechanistic insights into compartmentalized cAMP signaling and its link to cardiac disease. In this mini review, we summarize newest developments in this field achieved by cutting-edge biochemical and biophysical techniques. We further compile the data from different studies into a bigger picture of so far uncovered alterations in cardiomyocyte cAMP microdomains which occur in compensated cardiac hypertrophy and chronic heart failure. Finally, future research directions and translational perspectives are briefly discussed.

  10. cAMP and forskolin decrease γ-aminobutyric acid-gated chloride flux in rat brain synaptoneurosomes

    International Nuclear Information System (INIS)

    Heuschneider, G.; Schwartz, R.D.

    1989-01-01

    The effects of the cyclic nucleotide cAMP on γ-aminobutyric acid-gated chloride channel function were investigated. The membrane-permeant cAMP analog N 6 , O 2' -dibutyryladenosine 3',5'-cyclic monophosphate inhibited muscimol-induced 36 Cl - uptake into rat cerebral cortical synaptoneurosomes in a concentration-dependent manner. The inhibition was due to a decrease in the maximal effect of muscimol, with no change in potency. Similar effects were observed with 8-(4-chlorophenylthio)adenosine 3',5'-cyclic monophosphate, 8-bromoadenosine 3',5'-cyclic monophosphate, and the phosphodiesterase inhibitor isobutylmethylxanthine. The effect of endogenous cAMP accumulation on the γ-aminobutyric acid-gated Cl - channel was studied with forskolin, an activator of adenylate cyclase. Under identical conditions, in the intact synaptoneurosomes, forskolin inhibited muscimol-induced 36 Cl - uptake and generated cAMP with similar potencies. Surprisingly, 1,9-dideoxyforskolin, which does not activate adenylate cyclase, also inhibited the muscimol response, suggesting that forskolin and its lipophilic derivatives may interact with the Cl - channel directly. The data suggest that γ-aminobutyric acid (GABA A ) receptor function in brain can be regulated by cAMP-dependent phosphorylation

  11. Phosphodiesterase inhibitors suppress Lactobacillus casei cell-wall-induced NF-κB and MAPK activations and cell proliferation through protein kinase A--or exchange protein activated by cAMP-dependent signal pathway.

    Science.gov (United States)

    Saito, Takekatsu; Sugimoto, Naotoshi; Ohta, Kunio; Shimizu, Tohru; Ohtani, Kaori; Nakayama, Yuko; Nakamura, Taichi; Hitomi, Yashiaki; Nakamura, Hiroyuki; Koizumi, Shoichi; Yachie, Akihiro

    2012-01-01

    Specific strains of Lactobacillus have been found to be beneficial in treating some types of diarrhea and vaginosis. However, a high mortality rate results from underlying immunosuppressive conditions in patients with Lactobacillus casei bacteremia. Cyclic AMP (cAMP) is a small second messenger molecule that mediates signal transduction. The onset and progression of inflammatory responses are sensitive to changes in steady-state cAMP levels. L. casei cell wall extract (LCWE) develops arteritis in mice through Toll-like receptor-2 signaling. The purpose of this study was to investigate whether intracellular cAMP affects LCWE-induced pathological signaling. LCWE was shown to induce phosphorylation of the nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways and cell proliferation in mice fibroblast cells. Theophylline and phosphodiesterase inhibitor increased intracellular cAMP and inhibited LCWE-induced cell proliferation as well as phosphorylation of NF-κB and MAPK. Protein kinase A inhibitor H89 prevented cAMP-induced MAPK inhibition, but not cAMP-induced NF-κB inhibition. An exchange protein activated by cAMP (Epac) agonist inhibited NF-κB activation but not MAPK activation. These results indicate that an increase in intracellular cAMP prevents LCWE induction of pathological signaling pathways dependent on PKA and Epac signaling.

  12. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  13. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  14. Activity of cAMP-dependent protein kinases and cAMP-binding proteins of rat kidney cytosol during dehydration

    International Nuclear Information System (INIS)

    Zelenina, M.N.; Solenov, E.I.; Ivanova, L.N.

    1985-01-01

    The activity of cAMP-dependent protein kinases, the binding of cAMP, and the spectrum of cAMP-binding proteins in the cytosol of the renal papilla was studied in intact rats and in rats after 24 h on a water-deprived diet. It was found that the activation of protein kinases by 10 -6 M cAMP is significantly higher in the experimental animals than in the intact animals. In chromatography on DEAE-cellulose, the positions of the peaks of specific reception of cAMP corresponded to the peaks of the regulatory subunits of cAMP-dependent protein kinases of types I and II. In this case, in intact animals more than 80% of the binding activity was detected in peaks II, whereas in rats subjected to water deprivation, more than 60% of the binding was observed in peak I. The general regulatory activity of the cytosol was unchanged in the experimental animals in comparison with intact animals. It is suggested that during dehydration there is an induction of the synthesis of the regulatory subunit of type I cAMP-dependent protein kinase in the renal papilla

  15. The NO/cGMP pathway inhibits transient cAMP signals through the activation of PDE2 in striatal neurons

    Directory of Open Access Journals (Sweden)

    Marina ePolito

    2013-11-01

    Full Text Available The NO-cGMP signaling plays an important role in the regulation of striatal function although the mechanisms of action of cGMP specifically in medium spiny neurons (MSNs remain unclear. Using genetically encoded fluorescent biosensors, including a novel Epac-based sensor (EPAC-SH150 with increased sensitivity for cAMP, we analyze the cGMP response to NO and whether it affected cAMP/PKA signaling in MSNs. The Cygnet2 sensor for cGMP reported large responses to NO donors in both striatonigral and striatopallidal MSNs, and this cGMP signal was controlled partially by PDE2. At the level of cAMP brief forskolin stimulations produced transient cAMP signals which differed between D1 and D2 medium spiny neurons. NO inhibited these cAMP transients through cGMP-dependent PDE2 activation, an effect that was translated and magnified downstream of cAMP, at the level of PKA. PDE2 thus appears as a critical effector of NO which modulates the post-synaptic response of MSNs to dopaminergic transmission.

  16. Proteomic analysis of cAMP-mediated signaling during differentiation of 3 T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Borkowski, Kamil; Wrzesinski, Krzysztow; Rogowska-Wrzesinska, Adelina

    2014-01-01

    Initiation of adipocyte differentiation is promoted by the synergistic action of insulin/insulin-like growth factor, glucocorticoids, and agents activating cAMP-dependent signaling. The action of cAMP is mediated via PKA and Epac, where at least part of the PKA function relates to strong repression...... a comprehensive evaluation of Epac-mediated processes and their interplay with PKA during the initiation of 3 T3-L1 preadipocyte differentiation using a combination of proteomics, molecular approaches, and bioinformatics. Proteomic analyses revealed 7 proteins specifically regulated in response to Epac activation......-dependent signaling thereby adding a novel facet to our understanding of cAMP-mediated potentiation of adipocyte differentiation....

  17. AMP-Activated Protein Kinase Directly Phosphorylates and Destabilizes Hedgehog Pathway Transcription Factor GLI1 in Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Yen-Hsing Li

    2015-07-01

    Full Text Available The Hedgehog (Hh pathway regulates cell differentiation and proliferation during development by controlling the Gli transcription factors. Cell fate decisions and progression toward organ and tissue maturity must be coordinated, and how an energy sensor regulates the Hh pathway is not clear. AMP-activated protein kinase (AMPK is an important sensor of energy stores and controls protein synthesis and other energy-intensive processes. AMPK is directly responsive to intracellular AMP levels, inhibiting a wide range of cell activities if ATP is low and AMP is high. Thus, AMPK can affect development by influencing protein synthesis and other processes needed for growth and differentiation. Activation of AMPK reduces GLI1 protein levels and stability, thus blocking Sonic-hedgehog-induced transcriptional activity. AMPK phosphorylates GLI1 at serines 102 and 408 and threonine 1074. Mutation of these three sites into alanine prevents phosphorylation by AMPK. This leads to increased GLI1 protein stability, transcriptional activity, and oncogenic potency.

  18. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  19. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  20. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  1. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  2. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  3. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  4. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  5. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  6. Designing Higher Education Curriculum to Increase Graduate Outcomes and Work Readiness: The Assessment and Mentoring Program (AMP)

    Science.gov (United States)

    Jenkinson, Kate A.; Benson, Amanda C.

    2016-01-01

    Pre-service teacher programs have a responsibility to equip graduating students with more than the minimum skill sets required by governing bodies. The Assessment and Mentoring Program (AMP) is a four-way collaborative mentoring learning community underpinned by social constructivism. Conducted in Victoria, Australia during the 2014-2016 academic…

  7. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  8. Cross-talk between signaling pathways can generate robust oscillations in calcium and cAMP.

    Directory of Open Access Journals (Sweden)

    Fernando Siso-Nadal

    Full Text Available BACKGROUND: To control and manipulate cellular signaling, we need to understand cellular strategies for information transfer, integration, and decision-making. A key feature of signal transduction is the generation of only a few intracellular messengers by many extracellular stimuli. METHODOLOGY/PRINCIPAL FINDINGS: Here we model molecular cross-talk between two classic second messengers, cyclic AMP (cAMP and calcium, and show that the dynamical complexity of the response of both messengers increases substantially through their interaction. In our model of a non-excitable cell, both cAMP and calcium concentrations can oscillate. If mutually inhibitory, cross-talk between the two second messengers can increase the range of agonist concentrations for which oscillations occur. If mutually activating, cross-talk decreases the oscillation range, but can generate 'bursting' oscillations of calcium and may enable better filtering of noise. CONCLUSION: We postulate that this increased dynamical complexity allows the cell to encode more information, particularly if both second messengers encode signals. In their native environments, it is unlikely that cells are exposed to one stimulus at a time, and cross-talk may help generate sufficiently complex responses to allow the cell to discriminate between different combinations and concentrations of extracellular agonists.

  9. AMP deaminase histochemical activity and immunofluorescent isozyme localization in rat skeletal muscle

    Science.gov (United States)

    Thompson, J. L.; Sabina, R. L.; Ogasawara, N.; Riley, D. A.

    1992-01-01

    The cellular distribution of AMP deaminase (AMPda) isozymes was documented for rat soleus and plantaris muscles, utilizing immunofluorescence microscopy and immunoprecipitation methods. AMPda is a ubiquitous enzyme existing as three distinct isozymes, A, B and C, which were initially purified from skeletal muscle, liver (and kidney), and heart, respectively. AMPda-A is primarily concentrated subsarcolemmally and intermyofibrillarly within muscle cells, while isozymes B and C are concentrated within non-myofiber elements of muscle tissue. AMPda-B is principally associated with connective tissues surrounding neural elements and the muscle spindle capsule, and AMPda-C is predominantly associated with circulatory elements, such as arterial and venous walls, capillary endothelium, and red blood cells. These specific localizations, combined with documented differences in kinetic properties, suggest multiple functional roles for the AMPda isozymes or temporal segregation of similar AMPda functions. Linkage of the AMPda substrate with adenosine production pathways at the AMP level and the localization of isozyme-C in vascular tissue suggest a regulatory role in the microcirculation.

  10. Cardiac cAMP: production, hydrolysis, modulation and detection

    Directory of Open Access Journals (Sweden)

    Cédric eBOULARAN

    2015-10-01

    Full Text Available Cyclic adenosine 3’,5’-monophosphate (cAMP modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors’ signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability.

  11. Amped Up! - Volume 1, No. 3, May/June 2015

    Energy Technology Data Exchange (ETDEWEB)

    None

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  12. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  13. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  14. Compartmentalized cAMP Signaling Associated With Lipid Raft and Non-raft Membrane Domains in Adult Ventricular Myocytes.

    Science.gov (United States)

    Agarwal, Shailesh R; Gratwohl, Jackson; Cozad, Mia; Yang, Pei-Chi; Clancy, Colleen E; Harvey, Robert D

    2018-01-01

    Aim: Confining cAMP production to discrete subcellular locations makes it possible for this ubiquitous second messenger to elicit unique functional responses. Yet, factors that determine how and where the production of this diffusible signaling molecule occurs are incompletely understood. The fluid mosaic model originally proposed that signal transduction occurs through random interactions between proteins diffusing freely throughout the plasma membrane. However, it is now known that the movement of membrane proteins is restricted, suggesting that the plasma membrane is segregated into distinct microdomains where different signaling proteins can be concentrated. In this study, we examined what role lipid raft and non-raft membrane domains play in compartmentation of cAMP signaling in adult ventricular myocytes. Methods and Results: The freely diffusible fluorescence resonance energy transfer-based biosensor Epac2-camps was used to measure global cytosolic cAMP responses, while versions of the probe targeted to lipid raft (Epac2-MyrPalm) and non-raft (Epac2-CAAX) domains were used to monitor local cAMP production near the plasma membrane. We found that β-adrenergic receptors, which are expressed in lipid raft and non-raft domains, produce cAMP responses near the plasma membrane that are distinctly different from those produced by E-type prostaglandin receptors, which are expressed exclusively in non-raft domains. We also found that there are differences in basal cAMP levels associated with lipid raft and non-raft domains, and that this can be explained by differences in basal adenylyl cyclase activity associated with each of these membrane environments. In addition, we found evidence that phosphodiesterases 2, 3, and 4 work together in regulating cAMP activity associated with both lipid raft and non-raft domains, while phosphodiesterase 3 plays a more prominent role in the bulk cytoplasmic compartment. Conclusion: These results suggest that different membrane

  15. Retinoic acid and cAMP inhibit rat hepatocellular carcinoma cell proliferation and enhance cell differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Ionta, M. [Instituto de Ciências Biomédicas, Universidade Federal de Alfenas, Alfenas MG (Brazil); Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP (Brazil); Rosa, M.C.; Almeida, R.B.; Freitas, V.M.; Rezende-Teixeira, P.; Machado-Santelli, G.M. [Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP (Brazil)

    2012-05-25

    Hepatocellular carcinoma (HCC) is the third highest cause of cancer death worldwide. In general, the disease is diagnosed at an advanced stage when potentially curative therapies are no longer feasible. For this reason, it is very important to develop new therapeutic approaches. Retinoic acid (RA) is a natural derivative of vitamin A that regulates important biological processes including cell proliferation and differentiation. In vitro studies have shown that RA is effective in inhibiting growth of HCC cells; however, responsiveness to treatment varies among different HCC cell lines. The objective of the present study was to determine if the combined use of RA (0.1 µM) and cAMP (1 mM), an important second messenger, improves the responsiveness of HCC cells to RA treatment. We evaluated the proliferative behavior of an HCC cell line (HTC) and the expression profile of genes related to cancer signaling pathway (ERK and GSK-3β) and liver differentiation [E-cadherin, connexin 26 (Cx26), and connexin 32 (Cx32)]. RA and cAMP were effective in inhibiting the proliferation of HTC cells independently of combined use. However, when a mixture of RA and cAMP was used, the signals concerning the degree of cell differentiation were increased. As demonstrated by Western blot, the treatment increased E-cadherin, Cx26, Cx32 and Ser9-GSK-3β (inactive form) expression while the expression of Cx43, Tyr216-GSK-3β (active form) and phosphorylated ERK decreased. Furthermore, telomerase activity was inhibited along treatment. Taken together, the results showed that the combined use of RA and cAMP is more effective in inducing differentiation of HTC cells.

  16. Effects of electron beam irradiation on inorganic exchanger AMP

    International Nuclear Information System (INIS)

    Rao, K.L.N.; Mathew, C.; Deshpande, R.S.; Jadhav, A.V.; Pande, B.M.; Shukla, J.P.

    1996-01-01

    The heteropolyacid salt inorganic exchanger ammonium molybdophosphate (AMP) was subjected to an electron dose upto 2 MGy to assess any possible radiation damage. The breakthrough and total exchange capacity of AMP for Cs + from simulated fission product solutions were determined for both control and irradiated samples. The scanning electron microscopy (SEM) and energy dispersive x-ray analysis (EDX) were deployed to examine any marked microscopic changes taking place in this exchanger. (author). 3 refs., 3 figs

  17. Effect of XingPiJieYu decoction on spatial learning and memory and cAMP-PKA-CREB-BDNF pathway in rat model of depression through chronic unpredictable stress.

    Science.gov (United States)

    Wang, Chunye; Guo, Jianyou; Guo, Rongjuan

    2017-01-24

    Depression is a mental disorder characterized by a pervasive low mood and loss of pleasure or interest in usual activities, and often results in cognitive dysfunction. The disturbance of cognitive processes associated with depression, especially the impairment of learning and memory, exacerbates illness and increases recurrence of depression. XingPiJieYu (XPJY) is one of the most widely clinical formulas of traditional Chinese medicine (TCM) and can improve the symptoms of depression, including learning and memory. However, its regulatory effects haven't been comprehensively studied so far. Recently, some animal tests have indicated that the cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA)-cAMP response element-binding protein (CREB)-brain derived neurotrophic factor (BDNF) signaling pathway in hippocampus is closely related to depression and the pathogenesis of cognitive function impairments. The present study was performed to investigate the effect and mechanism of XPJY on depression and learning and memory in animal model. The rat model of depression was established by chronic unpredictable stress (CUS) for 21 days. The rats were randomly divided into six groups: control group, CUS group, CUS + XPJY (1.4 g/kg, 0.7 g/kg and 0.35 g/kg) groups, and CUS + sertraline (10 mg/kg) group. The sucrose preference, open field exploration and Morris water maze (MWM) were tested. The expression of cAMP, CREB, PKA and BDNF protein in hippocampus was examined with Elisa and Western Blot. The mRNA level of CREB and BDNF in hippocampus was measured with PCR. The results demonstrated that rats subjected to CUS exhibited decreases in sucrose preference, total ambulation, percentage of central ambulation, rearing in the open field test and spatial performance in the MWM. CUS reduced the expression of cAMP, PKA, CREB and BDNF in hippocampus of model rats. These effects could be reversed by XPJY. The results indicated that XPJY can improve depression and

  18. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  19. Opposing effects of cAMP and T259 phosphorylation on plasma membrane diffusion of the water channel aquaporin-5 in Madin-Darby canine kidney cells

    DEFF Research Database (Denmark)

    Koffman, Jennifer Skaarup; Christensen, Eva Arnspang; Marlar, Saw

    2015-01-01

    Aquaporin-5 (AQP5) facilitates passive water transport in glandular epithelia in response to secretory stimuli via intracellular pathways involving calcium release, cAMP and protein kinase A (PKA). In epithelial plasma membranes, AQP5 may be acutely regulated to facilitate water transport...... in the plasma membrane diffusion coefficient of AQP5. We aimed to test the short-term regulatory effects of the above pathways, by measuring lateral diffusion of AQP5 and an AQP5 phospho-mutant, T259A, using k-space Image Correlation Spectroscopy of quantum dot- and EGFP-labeled AQP5. Elevated cAMP and PKA...... inhibition significantly decreased lateral diffusion of AQP5, whereas T259A mutation showed opposing effects; slowing diffusion without stimulation and increasing diffusion to basal levels after cAMP elevation. Thus, lateral diffusion of AQP5 is significantly regulated by cAMP, PKA, and T259 phosphorylation...

  20. CO2 capture. Two new structures in the 2-amino-2-methyl-1-propanol (AMP) – water – CO2 system

    DEFF Research Database (Denmark)

    Ståhl, Kenny; Neerup, Randi; Fosbøl, Philip Loldrup

    2016-01-01

    Energy production and transportation is responsible for more than 60 % of our CO2 emission. In particular coal-fired power plants are big contributors. However, these large scale facilities offer the possibility to effective CO2 capture through post-combustion processes. There are several options...... studied the 2-amino-2-methyl-1-propanol (AMP) and the AMP-water phase diagramand its ability for CO2 capture. The first crystal structure in the AMP – water system has been solved from powder diffraction data: AMP trihydrate (triclinic, P-1, a = 6.5897(3), b = 6.399 (2), c = 6.3399(2) Å and α = 92.40 (3...... for such CO2 capture. The problem is to make the absorption/desorption processes energetically and thereby economically viable. One process under investigation involves alkanoamines as absorbents in aqueous solutions. In these systems CO2 is captured either by carbonate and/orcarbamate formation. We have...

  1. Database for the ampC alleles in Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Nabil Karah

    Full Text Available Acinetobacter baumannii is a troublesome opportunistic pathogen with a high capacity for clonal dissemination. We announce the establishment of a database for the ampC locus in A. baumannii, in which novel ampC alleles are differentiated based on the occurrence of ≥ 1 nucleotide change, regardless of whether it is silent or missense. The database is openly accessible at the pubmlst platform for A. baumannii (http://pubmlst.org/abaumannii/. Forty-eight distinctive alleles of the ampC locus have so far been identified and deposited in the database. Isolates from clonal complex 1 (CC1, according to the Pasteur multilocus sequence typing scheme, had a variety of the ampC locus alleles, including alleles 1, 3, 4, 5, 6, 7, 8, 13, 14, 17, and 18. On the other hand, isolates from CC2 had the ampC alleles 2, 3, 19, 20, 21, 22, 23, 24, 26, 27, 28, and 46. Allele 3 was characteristic for sequence types ST3 or ST32. The ampC alleles 10, 16, and 25 were characteristic for CC10, ST16, and CC25, respectively. Our study points out that novel gene databases, in which alleles are numbered based on differences in their nucleotide identities, should replace traditional records that use amino acid substitutions to define new alleles.

  2. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  3. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  4. Hypoxia inhibits colonic ion transport via activation of AMP kinase.

    LENUS (Irish Health Repository)

    Collins, Danielle

    2012-02-01

    BACKGROUND AND AIMS: Mucosal hypoxia is a common endpoint for many pathological processes including ischemic colitis, colonic obstruction and anastomotic failure. Previous studies suggest that hypoxia modulates colonic mucosal function through inhibition of chloride secretion. However, the molecular mechanisms underlying this observation are poorly understood. AMP-activated protein kinase (AMPK) is a metabolic energy regulator found in a wide variety of cells and has been linked to cystic fibrosis transmembrane conductance regulator (CFTR) mediated chloride secretion in several different tissues. We hypothesized that AMPK mediates many of the acute effects of hypoxia on human and rat colonic electrolyte transport. METHODS: The fluorescent chloride indicator dye N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide was used to measure changes in intracellular chloride concentrations in isolated single rat colonic crypts. Ussing chamber experiments in human colonic mucosa were conducted to evaluate net epithelial ion transport. RESULTS: This study demonstrates that acute hypoxia inhibits electrogenic chloride secretion via AMPK mediated inhibition of CFTR. Pre-treatment of tissues with the AMPK inhibitor 6-[4-(2-piperidin-1-yl-ethoxy)-phenyl)]-3-pyridin-4-yl-pyyrazolo [1,5-a] pyrimidine (compound C) in part reversed the effects of acute hypoxia on chloride secretion. CONCLUSION: We therefore suggest that AMPK is a key component of the adaptive cellular response to mucosal hypoxia in the colon. Furthermore, AMPK may represent a potential therapeutic target in diseased states or in prevention of ischemic intestinal injury.

  5. 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine inhibit TNF-α and CXCL10 production from activated primary murine microglia via A2A receptors.

    Science.gov (United States)

    Newell, Elizabeth A; Exo, Jennifer L; Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Kochanek, Patrick M; Jackson, Edwin K

    2015-01-12

    Some cells, tissues and organs release 2',3'-cAMP (a positional isomer of 3',5'-cAMP) and convert extracellular 2',3'-cAMP to 2'-AMP plus 3'-AMP and convert these AMPs to adenosine (called the extracellular 2',3'-cAMP-adenosine pathway). Recent studies show that microglia have an extracellular 2',3'-cAMP-adenosine pathway. The goal of the present study was to investigate whether the extracellular 2',3'-cAMP-adenosine pathway could have functional consequences on the production of cytokines/chemokines by activated microglia. Experiments were conducted in cultures of primary murine microglia. In the first experiment, the effect of 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine on LPS-induced TNF-α and CXCL10 production was determined. In the next experiment, the first protocol was replicated but with the addition of 1,3-dipropyl-8-p-sulfophenylxanthine (DPSPX) (0.1 μM; antagonist of adenosine receptors). The last experiment compared the ability of 2-chloro-N(6)-cyclopentyladenosine (CCPA) (10 μM; selective A1 agonist), 5'-N-ethylcarboxamide adenosine (NECA) (10 μM; agonist for all adenosine receptor subtypes) and CGS21680 (10 μM; selective A2A agonist) to inhibit LPS-induced TNF-α and CXCL10 production. (1) 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine similarly inhibited LPS-induced TNF-α and CXCL10 production; (2) DPSPX nearly eliminated the inhibitory effects of 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine on LPS-induced TNF-α and CXCL10 production; (3) CCPA did not affect LPS-induced TNF-α and CXCL10; (4) NECA and CGS21680 similarly inhibited LPS-induced TNF-α and CXCL10 production. 2',3'-cAMP and its metabolites (3'-AMP, 2'-AMP and adenosine) inhibit LPS-induced TNF-α and CXCL10 production via A2A-receptor activation. Adenosine and its precursors, via A2A receptors, likely suppress TNF-α and CXCL10 production by activated microglia in brain diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. 2’,3’-cAMP, 3’-AMP, 2’-AMP and Adenosine Inhibit TNF-α and CXCL10 Production From Activated Primary Murine Microglia via A2A Receptors

    Science.gov (United States)

    Newell, Elizabeth A.; Exo, Jennifer L.; Verrier, Jonathan D.; Jackson, Travis C.; Gillespie, Delbert G.; Janesko-Feldman, Keri; Kochanek, Patrick M.

    2014-01-01

    Background Some cells, tissues and organs release 2’,3’-cAMP (a positional isomer of 3’,5’-cAMP) and convert extracellular 2’,3’-cAMP to 2’-AMP plus 3’-AMP and convert these AMPs to adenosine (called the extracellular 2’,3’-cAMP-adenosine pathway). Recent studies show that microglia have an extracellular 2’,3’-cAMP-adenosine pathway. The goal of the present study was to investigate whether the extracellular 2’,3’-cAMP-adenosine pathway could have functional consequences on the production of cytokines/chemokines by activated microglia. Methods Experiments were conducted in cultures of primary murine microglia. In the first experiment, the effect of 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine on LPS-induced TNF-α and CXCL10 production was determined. In the next experiment, the first protocol was replicated but with the addition of 1,3-dipropyl-8-p-sulfophenylxanthine (DPSPX) (0.1 µM; antagonist of adenosine receptors). The last experiment compared the ability of 2-chloro-N6-cyclopentyladenosine (CCPA) (10 µM; selective A1 agonist), 5’-N-ethylcarboxamide adenosine (NECA) (10 µM; agonist for all adenosine receptor subtypes) and CGS21680 (10 µM; selective A2A agonist) to inhibit LPS-induced TNF-α and CXCL10 production. Results 1) 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine similarly inhibited LPS-induced TNF-α and CXCL10 production; 2) DPSPX nearly eliminated the inhibitory effects of 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine on LPS-induced TNF-α and CXCL10 production; 3) CCPA did not affect LPS-induced TNF-α and CXCL10; 4) NECA and CGS21680 similarly inhibited LPS-induced TNF-α and CXCL10 production. Conclusions 2’,3’-cAMP and its metabolites (3’-AMP, 2’-AMP and adenosine) inhibit LPS-induced TNF-α and CXCL10 production via A2A-receptor activation. Adenosine and its precursors, via A2A receptors, likely suppress TNF-α and CXCL10 production by activated microglia in brain diseases. PMID:25451117

  7. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  8. Antimicrobial peptides in innate immune responses

    DEFF Research Database (Denmark)

    Sorensen, O.E.; Borregaard, N.; Cole, A.M.

    2008-01-01

    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de...... novo synthesis or by proteolytic cleavage from antimicrobially inactive proproteins. Studies of human diseases and animal studies have given important clues to the in vivo role of AMPs. It is now evident that dysregulation of the generation of AMPs in innate immune responses plays a role in certain...

  9. Dexamethasone-induced and estradiol-induced CREB activation and annexin 1 expression in CCRF-CEM lymphoblastic cells: evidence for the involvement of cAMP and p38 MAPK

    Directory of Open Access Journals (Sweden)

    M. Castro-caldas

    2003-01-01

    Full Text Available Aims: Annexin 1 (ANXA1, a member of the annexin family of calcium-binding and phospholipid-binding proteins, is a key mediator of the anti-inflammatory actions of steroid hormones. We have previously demonstrated that, in the human lymphoblastic CCRF-CEM cell line, both the synthetic glucocorticoid hormone, dexamethasone (Dex, and the estrogen hormone, 17β-estradiol (E2β, induce the synthesis of ANXA1, by a mechanism independent of the activation of their nuclear receptors. Recently, it was reported that the gene coding for ANXA1 contains a cAMP-responsive element (CRE. In this work, we investigated whether Dex and E2β were able to induce the activation of CRE binding proteins (CREB in the CCRF-CEM cells. Moreover, we studied the intracellular signalling pathways involved in CREB activation and ANXA1 synthesis in response to Dex and E2β; namely, the role of cAMP and the p38 mitogen-activated protein kinase (MAPK.

  10. cAMP-CRP acts as a key regulator for the viable but non-culturable state in Escherichia coli.

    Science.gov (United States)

    Nosho, Kazuki; Fukushima, Hiroko; Asai, Takehiro; Nishio, Masahiro; Takamaru, Reiko; Kobayashi-Kirschvink, Koseki Joseph; Ogawa, Tetsuhiro; Hidaka, Makoto; Masaki, Haruhiko

    2018-03-01

    A variety of bacteria, including Escherichia coli, are known to enter the viable but non-culturable (VBNC) state under various stress conditions. During this state, cells lose colony-forming activities on conventional agar plates while retaining signs of viability. Diverse environmental stresses including starvation induce the VBNC state. However, little is known about the genetic mechanism inducing this state. Here, we aimed to reveal the genetic determinants of the VBNC state of E. coli. We hypothesized that the VBNC state is a process wherein specific gene products important for colony formation are depleted during the extended period of stress conditions. If so, higher expression of these genes would maintain colony-forming activities, thereby restraining cells from entering the VBNC state. From an E. coli plasmid-encoded ORF library, we identified genes that were responsible for maintaining high colony-forming activities after exposure to starvation condition. Among these, cpdA encoding cAMP phosphodiesterase exhibited higher performance in the maintenance of colony-forming activities. As cpdA overexpression decreases intracellular cAMP, cAMP or its complex with cAMP-receptor protein (CRP) may negatively regulate colony-forming activities under stress conditions. We confirmed this using deletion mutants lacking adenylate cyclase or CRP. These mutants fully maintained colony-forming activities even after a long period of starvation, while wild-type cells lost most of this activity. Thus, we concluded that the lack of cAMP-CRP effectively retains high colony-forming activities, indicating that cAMP-CRP acts as a positive regulator necessary for the induction of the VBNC state in E. coli.

  11. Aging has the opposite effect on cAMP and cGMP circadian variations in rat Leydig cells.

    Science.gov (United States)

    Baburski, Aleksandar Z; Sokanovic, Srdjan J; Andric, Silvana A; Kostic, Tatjana S

    2017-05-01

    The Leydig cell physiology displays a circadian rhythm driven by a complex interaction of the reproductive axis hormones and circadian system. The final output of this regulatory process is circadian pattern of steroidogenic genes expression and testosterone production. Aging gradually decreases robustness of rhythmic testosterone secretion without change in pattern of LH secretion. Here, we analyzed effect of aging on circadian variation of cAMP and cGMP signaling in Leydig cells. Results showed opposite effect of aging on cAMP and cGMP daily variation. Reduced amplitude of cAMP circadian oscillation was probably associated with changed expression of genes involved in cAMP production (increased circadian pattern of Adcy7, Adcy9, Adcy10 and decreased Adcy3); cAMP degradation (increased Pde4a, decreased Pde8b, canceled rhythm of Pde4d, completely reversed circadian pattern of Pde7b and Pde8a); and circadian expression of protein kinase A subunits (Prkac/PRKAC and Prkar2a). Aging stimulates expression of genes responsible for cGMP production (Nos2, Gucy1a3 and Gucy1b3/GUCYB3) and degradation (Pde5a, Pde6a and Pde6h) but the overall net effect is elevation of cGMP circadian oscillations in Leydig cells. In addition, the expression of cGMP-dependent kinase, Prkg1/PRKG1 is up-regulated. It seems that aging potentiate cGMP- and reduce cAMP-signaling in Leydig cells. Since both signaling pathways affect testosterone production and clockwork in the cells, further insights into these signaling pathways will help to unravel disorders linked to the circadian timing system, aging and reproduction.

  12. Adrenal hormones and liver cAMP in exercising rats--different modes of anesthesia.

    Science.gov (United States)

    Winder, W W; Fuller, E O; Conlee, R K

    1983-11-01

    We have compared five different modes of anesthesia (iv and ip pentobarbital sodium, ether, CO2, and cervical dislocation) with respect to their effects on liver glycogen, liver adenosine 3',5'-cyclic monophosphate (cAMP), blood glucose and lactate, plasma corticosterone, norepinephrine, and epinephrine in resting rats and in rats run on a treadmill at 26 m/min for 30 min. Ether, CO2, and cervical dislocation were found to be unsuitable due to the marked elevation in plasma catecholamines seen in both resting and exercising rats. Injection of pentobarbital sodium ip required an average of 8 min before onset of surgical anesthesia as opposed to less than 5 s for iv pentobarbital. Exercising rats anesthetized with ip pentobarbital showed markedly lower plasma catecholamines compared with rats given iv pentobarbital. Hepatic cAMP increased in response to exercise in all groups except the ip pentobarbital group. This is most likely due to the long delay between the end of the exercise and freezing of the liver in the ip pentobarbital-anesthetized animals. We conclude that iv injection of pentobarbital is the most suitable method of anesthesia for obtaining accurate measurements of plasma stress hormones, substrates, and metabolites and of hepatic cAMP and glycogen in resting and exercising rats.

  13. Cyclic GMP-AMP Containing Mixed Phosphodiester Linkages Is An Endogenous High Affinity Ligand for STING

    Science.gov (United States)

    Zhang, Xu; Shi, Heping; Wu, Jiaxi; Zhang, Xuewu; Sun, Lijun; Chen, Chuo; Chen, Zhijian J.

    2013-01-01

    The presence of microbial or self DNA in the cytoplasm of mammalian cells is a danger signal detected by the DNA sensor cyclic-GMP-AMP (cGAMP) synthase (cGAS), which catalyzes the production of cGAMP that in turn serves as a second messenger to activate innate immune responses. Here we show that endogenous cGAMP in mammalian cells contains two distinct phosphodiester linkages, one between 2′-OH of GMP and 5′-phosphate of AMP, and the other between 3′-OH of AMP and 5′-phosphate of GMP. This molecule, termed 2′3′-cGAMP, is unique in that it binds to the adaptor protein STING with a much greater affinity than cGAMP molecules containing other combinations of phosphodiester linkages. The crystal structure of STING bound to 2′3′-cGAMP revealed the structural basis of this high-affinity binding and a ligand-induced conformational change in STING that may underlie its activation. PMID:23747010

  14. Cyclic AMP-specific phosphodiesterase-4 as a target for the development of antidepressant drugs.

    Science.gov (United States)

    Zhang, Han-Ting

    2009-01-01

    Phosphodiesterase-4 (PDE4), one of eleven PDE enzyme families, specifically catalyzes hydrolysis of cyclic AMP (cAMP); it has four subtypes (PDE4A-D) with at least 25 splice variants. PDE4 plays a critical role in the control of intracellular cAMP concentrations. PDE4 inhibitors produce antidepressant actions in both animals and humans via enhancement of cAMP signaling in the brain. However, their clinical utility has been hampered by side effects, in particular nausea and emesis. While there is still a long way to go before PDE4 inhibitors with high therapeutic indices are available for treatment of depressive disorders, important advances have been made in the development of PDE4 inhibitors as antidepressants. First, limited, but significant studies point to PDE4D as the major PDE4 subtype responsible for antidepressant-like effects of PDE4 inhibitors, although the role of PDE4A cannot be excluded. Second, PDE4D may contribute to emesis, the major side effect of PDE4 inhibitors. For this reason, identification of roles of PDE4D splice variants in mediating antidepressant activity is particularly important. Recent studies using small interfering RNAs (siRNAs) have demonstrated the feasibility to identify cellular functions of individual PDE4 variants. Third, mixed inhibitors of PDE4 and PDE7 or PDE4 and serotonin reuptake have been developed and may be potential antidepressants with minimized side effects. Finally, relatively selective inhibitors of one or two PDE4 subtypes have been synthesized using structure- and scaffold-based design. This review also discusses the relationship between PDE4 and antidepressant activity based on structures, brain distributions, and pharmacological properties of PDE4 and its isoforms.

  15. Control of βAR- and N-methyl-D-aspartate (NMDA Receptor-Dependent cAMP Dynamics in Hippocampal Neurons.

    Directory of Open Access Journals (Sweden)

    Andrew Chay

    2016-02-01

    Full Text Available Norepinephrine, a neuromodulator that activates β-adrenergic receptors (βARs, facilitates learning and memory as well as the induction of synaptic plasticity in the hippocampus. Several forms of long-term potentiation (LTP at the Schaffer collateral CA1 synapse require stimulation of both βARs and N-methyl-D-aspartate receptors (NMDARs. To understand the mechanisms mediating the interactions between βAR and NMDAR signaling pathways, we combined FRET imaging of cAMP in hippocampal neuron cultures with spatial mechanistic modeling of signaling pathways in the CA1 pyramidal neuron. Previous work implied that cAMP is synergistically produced in the presence of the βAR agonist isoproterenol and intracellular calcium. In contrast, we show that when application of isoproterenol precedes application of NMDA by several minutes, as is typical of βAR-facilitated LTP experiments, the average amplitude of the cAMP response to NMDA is attenuated compared with the response to NMDA alone. Models simulations suggest that, although the negative feedback loop formed by cAMP, cAMP-dependent protein kinase (PKA, and type 4 phosphodiesterase may be involved in attenuating the cAMP response to NMDA, it is insufficient to explain the range of experimental observations. Instead, attenuation of the cAMP response requires mechanisms upstream of adenylyl cyclase. Our model demonstrates that Gs-to-Gi switching due to PKA phosphorylation of βARs as well as Gi inhibition of type 1 adenylyl cyclase may underlie the experimental observations. This suggests that signaling by β-adrenergic receptors depends on temporal pattern of stimulation, and that switching may represent a novel mechanism for recruiting kinases involved in synaptic plasticity and memory.

  16. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  17. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  19. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  20. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  1. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  2. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  3. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  4. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  5. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.go